CHIMERIC POLYPEPTIDE, VACCINES AGAINST CHAGAS DISEASE AND IMMUNIZATION METHODS
Patent Information
- Application Number
- ARP20150101738
- Authority / Receiving Office
- AR · AR
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2015-06-02
- Publication Date
- 2026-08-26
- Estimated Expiration
- 2035-06-02
Abstract
Description
Chimeric polypeptide, vaccines against Chagas disease and immunization methods. The present invention relates to a chimeric polypeptide, vaccines against Chagas disease, and immunization methods. More specifically, it relates to a chimeric polypeptide comprising the following linked components: a) a catalytic domain of cruzipain from T. cruzi; b) a linker; and c) a region of the Amastigote Surface Protein 2 (ASP2) antigen from T. cruzi. In a preferred embodiment, the catalytic domain may be the N-terminal region of cruzipain from T. cruzi; the linker may be an alpha helix of the transialidase protein from T. cruzi. Background Currently, the treatment of Chagas disease to control the T. cruzi parasite is not entirely successful. Various drugs are used, all of which have some toxicity. One of the problems is that the disease presents in different stages, requiring medications for both the acute and chronic phases. There are few vaccines to prevent infection with T. cruzi. In some cases, vaccines were developed by administering subunits of the parasite, for example, attempting to induce humoral and T-cell immune responses so that the individual's own body would reduce the amount of the parasite. In general, these vaccines did not prove effective in all three stages of infection. In many cases, the parasite was observed to induce an autoimmune response. Cruzipain protein, administered alone or with other products such as MALP-2, is known to induce an immune response against T. cruzi (Cazorla SI, et al., Vaccine 26: 1999-2009, 2008a; Cazorla SI, et al., The Journal of Infectious Diseases, 202:136-144, 2010; Araújo AF, BC de Alencar, et al., Infecí. Immun. 73: 6017-6025, 2005). The low efficacy of various formulations has been widely reported, namely: 1- Fralish, BH, Tarleton, RL, 2003. Genetic immunization with LYT1 or a pool of trans-sialidase genes protects mice from lethal Trypanosoma cruzi infection. Vaccine 21, 3070-3080, demonstrate the lack of protection from various antigens such as flagellar Ca2+ binding protein, FCaBP, and the Teεβ3 protein, both showing 0% survival at 75 days post-infection when formulated in conjunction with eukaryotic plasmids encoding cytokines such as IL-12 and GM-CSF as adjuvants. Furthermore, in 2- Frank, FM, Petray, PB, Cazorla, SI, Muñoz, MC, Corral, RS, Malchiodi, EL, 2003. Use of a purified Trypanosoma cruzi antigen and CpG oligodeoxynucleotides for immunoprotection against a lethal challenge with trypomastigotes. Vaccine 22, 77-86, demonstrates the importance of the adjuvant in the formulation since the use of cruzipain whole together with Aluminum as an adjuvant did not generate protection, with the survival level being 0% at 20 days post-infection. 3- The Tc24 protein, when administered via a eukaryotic plasmid encoding it and carried by an attenuated strain of Salmonella, was not shown to be effective in protecting against infection with the RA strain of T. cruzi. Cazorla SI, Matos MN, Cemy N, Ramírez C, Alberti AS, Bivona AE, Morales C, Guzmán CA, Malchiodi EL. Oral Multicomponent DNA Vaccine Delivered by Attenuated Salmonella Elicited Immunoprotection against American Trypanosomiasis. J Infecí Dis. 2014 Aug 25. pii: jiu480. Brief description of the invention A chimeric polypeptide is provided comprising the following linked together: a) a catalytic domain of cruzipain from T. cruzi, b) a linker, and c) a region of the Amastigote Surface Protein 2 (ASP2) antigen from T. cruzi. In a preferred embodiment, the catalytic domain may be the N-terminal region of cruzipain from T. cruzi; the linker may be an alpha helix of the transialidase protein from T. cruzi. A vaccine against Chagas disease is provided comprising a chimeric polypeptide comprising a catalytic domain of the cruzipain of T. cruzi, a linker, and a region of the Amastigote Surface Protein 2 (ASP2) antigen of T. cruzi; and adjuvants. In a preferred embodiment, the adjuvant may be c-di-AMP or CpG. In a preferred embodiment, the vaccine comprises a chimeric polypeptide having the sequence SEQ ID No. 16 or sequences having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID No. 16. A transformed microorganism is provided that expresses a chimeric polypeptide consisting of a catalytic domain of the cruzipain of T. cruzi, a linker, and a region of the Amastigote Surface Protein 2 (ASP2) antigen of T. cruzi. In a preferred embodiment, the microorganism is a strain of Salmonella that can express a chimeric protein comprising linked sequences SEQ ID No. 10, SEQ ID No. 4, and SEQ ID No. 15, or sequences having 90% identity. A vaccine against Chagas disease is provided comprising the chimeric polypeptide and / or the transformed microorganism and an adjuvant. In a preferred embodiment, the vaccine comprises a microorganism expressing a chimeric polypeptide having the sequence SEQ ID No. 16 or sequences having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID No. 16. In a preferred embodiment, the adjuvant may be c-di-AMP or CpG. Methods for immunizing a mammal against Chagas disease are provided. Description of the figures: Figure 1. Design of the chimeric protein, indicating the proteins and main epitopes included. Figure 2. Multivalent presentation of immunoprotective epitopes of the ASP2, Cz, and TSi proteins. For each Antigen-Presenting Cell that captures the developed molecule, an expanded activation of naïve T lymphocytes (TL) with TCRs capable of recognizing the epitopes strategically included in the chimeric molecule is generated. Figure 3. (A) ASP2 PCR using Pf-Splice leader and Pr-ASP2. Lane 1: Molecular Markers (MM in Kb). Lane 2: asp2 amplicon with mini exon. (B) Asp2 gene PCR using both specific primers, Pf-asp2 and Pr-asp2. Lane 1: MM (Kb). Lane 2: Final asp2 gene amplicon. (C) Cloned on pGEM-T easy. Lane 1: MM (Kb). Lane 2: Plasmid digestion and release of the 2Kb asp2 insert. (D) Cloned on pET23a. Lane 1: MM (Kb). 2: Product of the internal digestion of the pET-asp2 construct, releasing a 1066 bp fragment corresponding to the entire asp-2 gene. Figure 4. (A) Restriction of the N-terminal domain of Cruzipain. Lane 1: MM. Lane 2: Amplification of the N-terminal domain (catalytic). Lane 3: Empty. Lane 4: pET-rCz. Lane 5: Amplification of the catalytic prodomain of Cruzipain. (B) Restriction of the ASP2 domain (asp2 35kDa). Lane 1: MM. Lane 2: Empty. Lanes 3-4: pET-asp2 template. Lane 5: Asp2 amplification product 35kDa. (C) Construction of the helical alpha connector. Lanes 1-3: Nt-Cz and Lanes 4-6: Pro-Nt-Cz. Lane 7: DNA quantification marker (100-10 ng). (D) Domain fusion by SOE-PCR. 1: MM (Kb) 2: Effective fusion product 1.5Kb, between the Nt-cz-connector and Asp2 genes 35KDa. Figure 5. Immunochemical Identity Assay of the chimeric polypeptide. The nitrocellulose membrane was incubated with monospecific polyclonal serum (A) anti-N-terminal Cz and (B) anti-ASP2 35 KDa, revealed with a peroxidase-labeled mouse anti-gammaglobulin conjugate and allowed to develop color with H2O2 / 4-CI-Inafitol. Figure 6. IFA of BHK cells transfected with: (A and B) - pcDNA-chimera, (C) pcDNA-asp2 full length, (D) - pcDNA without insert. The transfected cells were incubated with specific sera directed against (A): aASP2, (B): N-terminal Cz, (C): ASP2. FITC-labeled mouse a-IgG was used as a secondary antibody. Figure 7. Mice were immunized with 3 doses of: Gl: PBS / c-di-AMP (naive mice), Gil: Chimera, GUI: Chimera c-di-AMP, GIV: Nt-Cz + ASP2 c-di-AMP, GIV: Nt-Cz c-di-AMP and GVI: ASP2 c-di-AMP. After two weeks from the last dose, the animals were sacrificed, and the Spot Forming Units of secreting splenocytes of (A): IFNy, (B): IL-17, (C): IL-2 and (D): IL-4 were analyzed. Figure 8. Mice immunized with Gl: PBS / c-di-AMP, Gil: Chimera c-di-AMP, GUI: Nt-Cz + ASP2 c-di-AMP, GIV: Nt-Cz c-di-AMP, and GV: ASP2 c-di-AMP were challenged with 1000 blood trypomastigotes of the RA strain of T. cruzi intraperitoneally. Parasitemia was analyzed by counting in a Neubauer chamber every two or three days. Figure 9. Mice immunized with GI: PBS / c-di-AMP, Gil: Chimera c-di-AMP, GUI: Nt-Cz + ASP2 c-di-AMP, GIV: Nt-Cz c-di-AMP and GV: ASP2 c-di-AMP, were challenged with 1000 blood trypomastigotes of the RA strain of T. cruzi intraperitoneally. (A) The weight of the mice was determined throughout the acute phase of the infection. (B) Survival. Figure 10. Cellular immune response pre- and post-infection. (A) DTH. Immunized mice were inoculated intradermally with 5 pg rChimera. Plantar thickness was measured before and 48 h after inoculation. (B) Antigen-specific proliferation assay at 96 days post-challenge of splenocytes from mice restimulated in vitro with an epimastigote lysate we call (F105). ***p<0.001, **p<0.01, *p<0.05. Figure 11. C3H mice previously immunized: Gl-SaroA + c-di-AMP, GIISquimera + CpG, GUI- Squimera + c-di-AMP, GIV- Scombination + c-di-AMP, GVSasp2 + c-di-AMP, were challenged with 1000 trypomastigotes of the RA strain. (A) Parasitemia, (B) Area under the parasitemia curve (AUC), and (C) Survival were subsequently determined. Figure 12. C3H mice previously immunized with the following strategies: GISaroA, Gil-Squimera, GUI-Scz, GIV-Sasp, GV-Squimera + CpG, and GVI-Chimera / CpG, were challenged with 1000 trypomastigotes of the RA strain. Parasitemia (A and B) and survival (C) were subsequently determined. In Figure B, a lower number of parasites in the blood is observed in the Squimera group compared to Scz and Sasp2. Figure 13. Muscle damage marker enzymes in previously immunized mice: GI-SaroA, Gil-Squimera, GUI-Scz, GIV-Sasp, GV-Squimera + CpG, and GVI-Chimera / CpG, challenged with trypomastigotes of the RA strain. Determinations were performed on serum samples taken at 96 dpi. Creatine Kinase: CK, (A). Cardiac isoform of Creatine Kinase: CK-MB, (B). Glutamate Oxalate Transaminase: GOT, (C), and Lactate Dehydrogenase: LDH (D). ***p<0.001 **p<0.01, *p<0.05. Figure 14. C3H mice previously immunized with the following strategies: GISaroA, Gil-Squimera, GUI-Scz, GIV-Sasp, GV-Squimera + CpG and GVI-Chimera / CpG, were challenged with blood trypomastigotes of the K98 strain. ***p<0.001 **p<0.01. Figure 15. Enzyme kinetics of the Creatine Kinase enzyme (A) and its cardiac isoform CK-MB (B). The determinations were performed on serum samples from mice taken on days 0, 35 and 70 post-infection in previously immunized mice: GI- SaroA, Gil- Squimera, GUI- Scz, GIV- Sasp, GV- Squimera + CpG and GVI- Chimera / CpG, and challenged with blood trypomastigotes of the K98 strain. Figure 16. Positive correlation between parasitemia and damage to cardiac muscle, during the acute phase of infection with trypomastigotes of the K98 strain in previously immunized mice: GI- SaroA (A) and Squimera (B). Detailed description and examples The inventive object comprises a chimeric polypeptide, said chimeric polypeptide comprising a catalytic domain of the main cysteine protease of T. cruzi, Cruzipain, and a region of the Amastigote Surface Protein 2 (ASP2) surface antigen linked by a connector that in one embodiment corresponds to an alpha helix of the parasitic protein Transialidase For the purposes of this application, “chimeric polypeptide” and “transpain” have the same meaning. Traspaina is a genetically engineered chimera containing the DNA encoding the catalytic domain of the main cysteine protease of T. cruzi, cruzipain, and a region of the Amastigote Surface Protein 2 (ASP2) antigen, linked by a strand corresponding to an alpha helix of the parasitic protein, transialidase. The construct resulted in a 1.5 kDa amplicon, which was digested and cloned into the prokaryotic expression vector pET23a and the eukaryotic expression plasmid pcDNA3.1. The recombinant protein was produced in E. coli, resulting in a 60 kDa molecule. Traspaina and its DNA were used in immunization protocols in mice, followed by challenge with Trypanosoma cruzi trypomastigotes, demonstrating a high degree of protection against infection. The main feature of the invention lies not only in the fusion of the proteins but primarily in the selection of regions of these proteins for the construction of the chimeric polypeptide, which allows for improved performance of the individual antigens, and the use of a connector with both structural and immunogenic functions (Figure 1). The ability to use the smallest portion of a molecule to confer immunoprotection is relevant in a vaccine against Chagas disease, for which an autoimmune origin has been reported that could be due to cross-reactive antigens. In one embodiment, the chimeric polypeptide comprises the N-terminal region of the main cysteine protease of T. cruzi, cruzipain (CzN-term), for which expression in prokaryotic cells is difficult and of low yield. Regarding the ASP2 protein, the chimeric polypeptide may comprise the central region, which includes residues 261-570 of the complete ASP2 sequence (ASP2Central). Two immunodominant epitopes with different restrictions on their ability to bind to MHC-I molecules were included to ensure universality in the formulation of a vaccine regardless of the recipient's genetic background. To fuse CzN-term with ASP2Central, a direct splice was not performed. Instead, a helical alpha connector of an inactive transialidase (TSi) from I. cruzi was added. This connector not only structurally separates the domains in space but also presents antigenic determinants that can be recognized by antibodies and CD4+ and CD8+ T cells, as predicted by bioinformatics. This effectively expands the repertoire of epitopes recognized by the immune system, not just for one protein, but for three. Each immune system cell that takes up the chimeric polypeptide will present an expanded repertoire of epitopes with immunoprotective capacity against three parasite antigens (Figure 2). In contrast, the probability of this occurring in a combined-dose protocol is very low. It is important to note that the expression of the complete ASP2 protein in prokaryotic cells is not easy. The protein was expressed in such low quantities that it could not be detected by SDS-PAGE. Conversely, the generation of the Traspain chimeric polypeptide was successfully achieved in bacteria with high yields, thus overcoming the low expression of both proteins by expressing them independently. The chimeric polypeptide comprises the fusion of selected protein regions, which enhances vaccine performance. It includes a linker with both structural and immunogenic functions. The chimeric polypeptide offers various immunoprotective epitopes to immune system cells. This ensures that each immune cell that receives the product will possess an expanded repertoire of epitopes capable of providing immunoprotection against three parasite antigens. In contrast, the likelihood of this occurring in a combination-dose protocol is negligible. Cloning of the Amastigot Surface Protein 2 (ASP2) gene. To clone the ASP2 protein, which belongs to the Transialidase (TS) superfamily, total RNA was first isolated from T. cruzi amastigotes obtained in vitro from a Vero cell monolayer infected with the parasite. RT-PCR was performed using dT Oligos to reverse transcribe the mRNAs, followed by a first PCR from the cDNA, using a forward primer that pairs to the 5' end of mature T. cruzi mRNAs, Mini exon or Splice leader, and a specific reverse primer (Figure 3A). Pf Splice Leader: 5'- AACCGGATC CAACGC TATTATTGAT - 3' (SEQ ID N° 1) Pf Asp-2: 5'- GCGC GAATTC ATGCTCTCACGTGTTGCTG -3' (SEQ IN° 2) \--1 Clamp GC EcoRI Pr-Asp-2: 5'- GAGAGCGGCCGC TCAGTGATGGTGATGGTGATGGACCATTTTTAGTTCACCAAC -3' (SEQ ID NO: 3) ΐ —VClamp 5' Notl Stop His6x-Tag A second PCR was then performed amplifying the specific region (Figure 3B). The gene was cloned into the pGEM-Teasy vector and subsequently into the pET23a plasmid (Figure 3C and D), with positive clones being selected in E. coli DH5a cells. Specific primers were also designed to clone the ASP2 protein with certain modifications. Among them the entire gene and the central immunodominant region with greater immunoprotective capacity, immunoprotective domain (ASP2-35KDa: amino acids 261-570 (SEQ ID N° 4) of the Amastigot Surface Protein 2 (ASP2) containing the epitopes CD8+ TEWETGQI (SEQ ID N° 5) (320-327) for the H-2Kk haplotype and 2) VHHRFTIV (553-560) (SEQ ID N° 6) for H-2Kb in order to broaden the spectrum of protected individuals regardless of their genetic background. The aforementioned genes were cloned into the pGEM-Teasy vector, digested with restriction enzymes, and linked to the pET23a plasmid (Figures 3C and D). Positive clones in E. coli DH5a cells were selected for their ampicillin resistance, and the nucleotide sequences of the positive clones were analyzed, showing 92% identity with the previously reported sequence of the T. cruzi Y strain. ASP2-35KDa forward primer and restriction domain in the chimeric polypeptide of the invention: Pf Asp2-261 Protein Φ 5'- GCGC GAATTC ATGGATGTTGTGACTGCTGGTGGTT - 3' (SEQ ID NO: 7) EcoRI Pf-ASP2-261 Chimera 5'- GATGTTGTGACTGCTGGTGGTT- 3' (SEQ ID NO: 8) Reverse primer ASP2-35KDa: Pr-ASP2-571 His6x 5'GAGAGCGGCCGCTCAGTGATGGTGATGGTGATGCTTCGGAACCTGGTGGAT GGTCAC-3' (SEQ ID NO: 9) Amplification of the Cruzipain catalytic domain (CzN-term) and construction of the recombinant chimeric polypeptide. Briefly, the Cruzipain catalytic domain (CzN-term), whose amino acid sequence is shown in SEQ ID No. 10, was re-amplified from a previously obtained cloning vector (Figure 4A) (for reference, Cazorla SI, FM and collaborators, Vaccine 26: 1999-2009, 2008a), adding 30 nucleotides to the reverse primer corresponding to the first portion of the connector used for the construction of the chimeric polypeptide. Primer forward Nt-Cz: For pET23a 5- GCGCGAATTCATG GCGCCCGCGGCAGTGGATT -3 (SEQ ID N° 11) EcoRI Reverse primer Nt-Cz: 5- AGATTTGATGATACGCAGTTCACCAACCAG ACCGACCACCGCGGAGCT -3 (SEQ ID N° 12) nt Concetor The peptide was constructed containing the immunoprotective domain of ASP2-35KDa and the catalytic domain of the main cysteine protease of T. cruzi, Cruzipain (CzN-term). The sequence of nucleotides encoding the chimeric polypeptide (SEQ ID No. 13) was constructed using genetic engineering techniques. Starting from the catalytic domain of Cruzipain, an alpha helical connector was constructed by sequential PCR at the 3' end of the gene. A total of 75 nucleotides (SEQ ID No. 14) (25 amino acids) (SEQ ID No. 15) belonging to an alpha helix of another parasitic protein, Transialidase, were added to ensure efficient separation of the domains in space (Figure 4B and C). Finally, splicing by overlap extension PCR (SOE-PCR) was performed to obtain a fusion product with the ASP2-35 KDa domain by overlapping shared regions.It is worth noting that the connector was modified to optimize the expression in E. coli. The successful fusion resulted in a 1.5 kDa amplicon (Figure 4D) which was digested and cloned into the prokaryotic expression vector pET23a. The hybrid sequence was subsequently confirmed by sequencing, as shown below, wherein the chimeric polypeptide of the invention comprises SEQ ID No. 16 and is encoded by SEQ ID No. 13. Expression of recombinant proteins in E. coli. E. coli BL21 and Rossetta pLys expression strains were transformed with constructs expressing the ASP2-35kDa peptide (SEQ ID No. 4) and constructs expressing the chimeric peptide of the invention (SEQ ID No. 16) on the pET23a plasmid in both cases. Peptide expression was carried out using 0.5 mM IPTG at low temperatures (20 °C) overnight. The peptides were expressed as inclusion bodies for both ASP2-35kDa and the Traspaina chimeric peptide of the invention. For purification, cell lysis was performed, and the inclusion bodies were isolated. These were washed with Triton X100 and low concentrations of chaotropic agents, and the proteins were then solubilized with 8 M urea. Purification was carried out by affinity chromatography (IMAC). The in vitro refolding was then performed by dialysis using a refolding buffer (Tris 50 mM, EDTA 1 mM, Urea 2 M, Sucrose 5%, Glycerol 10%, DTT 0.5 mM pH 8).Purity was controlled by SDS-PAGE and bacterial endotoxin levels were determined using an LPS detection bioassay (HEK-Blue LPS detection Kit), confirming the absence of LPS above the detection limit (0.03 ng / ml) in the purified samples. To confirm the identity of the chimeric construct, a Western blot was performed with immune sera against Cz and ASP2. The recombinant peptide of the invention was recognized by both antisera (Figure 5 AB). Cloning and expression of full-length ASP2 and chimeric polypeptide of the invention in eukaryotic expression vectors. The purified pET23a-Chimera plasmids expressing the chimeric polypeptide and the pET23a-ASP2 plasmid expressing full-length ASP2 were used as templates for PCR amplification using a forward primer containing an EcoRI restriction site, the Kozak sequence, and a reverse primer with a Notl restriction site and the stop codon. Pr-ASP2-571 pcDNA Chimera 5'- GAGAGCGGCCGCTCACTTCGGAACCTGGTGGATGGTCAC - 3' (SEQ ID NO: 17) Notl -> ParapcDNA3.1 N-term Cz -3 +4Ala 5-TAGGATCCACCATGGCG ATGTCTGGCTGGGCGCGTGCGCTG -3 (SEQ ID NO: 18) BamHI RS Kozak The fragments were cloned into the pcDNA3.1 (+) vector and confirmed by sequencing. Subsequently, BHK cells were transfected in the presence of lipofectamine with each of the constructs and empty pcDNA as a control. Polypeptide expression was analyzed by indirect immunofluorescence using hyperimmune sera against ASP2 and Cz (Figure 6). Salmonella enterica serovar Typhimurium aro A 7207 (S) were subsequently transformed with the plasmids to be used as a carrier and adjuvant in DNA vaccination protocols. Immunization with the chimeric nolipeptide Traspain and bis-(3',5')-cyclic dimeric adenosine monophosphate (c-di-AMP) as an adjuvant. To analyze the capacity of the chimeric polypeptide in stimulating an immune response, 6-8 week old female C3H / HeN mice were immunized (intranasally) with 3 doses of protein along with adjuvant: G1: PBS / c-di-AMP, G1: Chimera-c-di-AMP, G1: Nt-Cz + ASP2 c-di-AMP, G2: Nt-Cz c-di-AMP and G3: ASP2 c-di-AMP. Each dose received 10 pg of total recombinant protein (except for GIV, which received 1.9 pg Nt-Cz and 3.8 pg ASP2, molar equivalents to 10 pg of the chimeric polypeptide) along with 10 pg of adjuvant. Two weeks after the last dose, the animals were sacrificed, the spleen was aseptically removed, and the cellular and mucosal immune responses were analyzed. Immunization with Traspain and c-di-AMP was shown to stimulate the secretion of cytokines from the THI / THI 7 profile. The frequency of IFN-γ, IL-2, IL-4, and IL-17 producing cells was analyzed in splenocytes from immunized animals, restimulated in vitro with the three recombinant proteins: the chimeric polypeptide, ASP2, and CzN-term, using ELISpot kits (BD Pharmingen, USA). The immunized mice developed an immune response associated with a Thl / Thl7 profile, with a low frequency of IL-4 producing cells (Figure 7). A significant finding was the presence of IL-2 producing cells, a cytokine essential for the differentiation and survival of CD8+ lymphocytes. It can be observed that the chimeric polypeptide efficiently primes specific cells against Cz and ASP2, with no immunodominance towards any of the molecule's regions. Only the levels of IL-2 in the chimeric polypeptide + c-di-AMP group and IL-17 in the CzN-term + ASP2 group showed statistically significant differences in their contribution to the overall response, with the frequency of cells producing specific cytokines for each domain being similar (Figure 7). The immune response developed was characterized in more detail, finding that immunization with the chimeric polypeptide traspain, aided by c-di-AMP, is able to activate CD8+ T cells, which would act as key cells in the elimination of host cells infected by the parasite. To determine in vivo whether different vaccination strategies were capable of generating an immunoprotective response against challenge with T. cruzi, mice immunized as described above were challenged with a lethal dose of 1000 blood trypomastigotes of the RA strain of T. cruzi via intraperitoneal injection, fifteen days after the last immunization. As shown in Figure 8, the application of the chimera of the invention + c-di-AMP as an adjuvant significantly reduced the level of parasitemia compared to control mice. Furthermore, animals immunized with the chimera polypeptide + c-di-AMP showed less weight loss (Figure 9A) and 40% greater survival compared to the combination of each polypeptide in its same molar ratio (Figure 9B). Comparison of the pre- and post-infection cellular profile. The cellular immune response (prior to infection) was evaluated using a delayed-type hypersensitivity (DTH) assay, which verified efficient priming of specific cells against T cell epitopes present in the chimeric polypeptide in all groups. The response of almost half in the ASP2 and CzN-term groups could be explained solely by the recognition of the homologous immunogen's epitopes (Figure 10A). At 96 days post-infection (dpi), when the animals were in the chronic phase, they were sacrificed, the spleen was removed, and the cellular immune response was evaluated using a proliferation assay with epimastigote lysate, F105, as a stimulus. Maintenance of the memory immune response was observed in the immunized groups compared to the control (Figure 10B).This finding in the chronic phase of the infection would be important as it would allow for better control of the parasite in the event of reactivation or re-infection. Vaccination strategy based on a Prime-Boost regimen. In the search for different vaccination protocols, and due to the excellent response obtained using c-di-AMP intranasally, a priming protocol was analyzed using Salmonella enterica serovar Typhimurium aroA 7207 as the delivery system. This protocol consisted of pcDNA encoding the vaccine genes administered orally, and two protein boosts administered intranasally using c-di-AMP or CpG as adjuvants. C3H / HeN mice were immunized on days 0, 10, 20, and 30 according to the following regimens: I: Salmonella aro A (SaroA) + PBS / c-di-AMP, henceforth we will call this group SaroA + c-di-AMP II: Salmonella transformed with the pcDNA-Chimera plasmid (Schimera) + chimera polypeptide / CpG. (Schimera + CpG) III: Schimera + chimera / c-di-AMP polypeptide. (&7w / wera + c-di-AMP) IV: Salmonella transformed with the pcDNA-ASP2 plasmid (Sasp2) together with Salmonella transformed with the pcDNACz plasmid (SCz), referred to as Scombination, followed by 2 doses (of the ASP2-35KDa + Nt-Cz / c-di-AMP proteins. (Scombination + c-di-AMP) V: Sasp2 + ASP2c-di-AMP. (Sasp2 + c-di-AMP) Mice immunized with the strategies described above were challenged with 1000 trypomastigotes of a high virulence (HR) strain via intraperitoneal route 15 days after the last dose. As shown in Figure 11A, parasitemia levels were significantly lower in the GUI (Schimera + chimera / c-di-AMP) group compared to the control group and were similar for both adjuvants used. Additionally, GIV receiving the combination of both antigens showed higher parasitemia (AUC = 160) compared to the group immunized with chimera GUI (AUC 49.8) (Figure 11B). The prime-boost strategy combining Traspaína coding DNA and c-di-AMP-adjuvanted recombinant protein (GUI) generates protection against a lethal challenge of T. cruzi trypomastigotes (Fig 11 C). In parallel, the immunoprotective capacity of the chimeric polypeptide was validated, independent of the c-di-AMP adjuvant, which had shown excellent results when administered intranasally with the polypeptide. To this end, 2-month-old C3H mice were immunized orally with 4 doses (at 10-day intervals) of 10⁹ CFU of: Gl: SaroA, Gil: Squimera, GUI: Scz, and GIV: Sasp2. The GV regimen was also incorporated: two doses of Squimera orally, followed by two doses of the chimeric polypeptide adjuvanted with CpG intramuscularly (Squimera + CpG), and GVI immunized with 4 doses of the chimeric / CpG polypeptide (Chimera / CpG) intramuscularly, both regimens with a 10-day interval between doses. Fifteen days after the last immunization, mice were challenged intraperitoneally with 1000 trypomastigotes of the RA strain. Parasitemia levels, weight, and survival were assessed every two days using Neubauer chamber counting (Figure 12 AC). A significant decrease in parasitemia was observed in all mice immunized with the chimeric polypeptide, along with increased survival. Notably, the group immunized with Squimera showed a 17-fold decrease in the area under the parasitemia curve (AUC) compared to the control group. In contrast, mice immunized with SCz and Sasp2 individually showed AUC reductions of 4.5 and 8.5 times, respectively, compared to the control. Importantly, the prime-boost protocol combining the coding DNA and the chimeric polypeptide adjuvanted with CpG via intramuscular injection did not improve the protective response conferred by Squimera. The group immunized with 4 doses of chimeric DNA coding enzymes carried by Salmonella (Schimera) showed the best protection against infection by the parasite, both in the acute and advanced stages of T. cruzi infection (Fig. 13). In the chronic phase of the infection, we observed a significant decrease in the activity of enzymes that mark cardiac damage: CK, CK-Mb, LDH and GOT levels were lower in the Squimera group compared to the control group. These results suggest that immunization protected against the tissue damage characteristic of the chronic phase of Chagas disease. Given the wide genetic diversity of Trypanosoma cruzi, the immunoprotection results were validated using six Discrete Typing Units (DTUs): Tcl to TcVI, by challenging vaccinated animals with a heterologous strain of the parasite. While the RA strain, belonging to DTU VI, is highly virulent, K98 (DTU I) is a low-virulence, non-lethal strain. Male C3H mice were vaccinated in a manner analogous to that previously described. Fifteen days after the last dose, the animals were challenged intraperitoneally with 250,000 parasites of the K98 strain. When parasitemia was analyzed during the acute phase of infection with the K98 strain of T. cruzi, a significant decrease in circulating parasite levels was observed in the immunized mice compared to the control group (Figure 14A). This decrease was even greater in the Gil group (AUC: 57 vs control AUC: 1400) (Figure 14 B). Cardiac damage was also assessed at different time points post-infection by measuring the release of muscle enzymes (total CK) and its cardiac isoform (CK-MB) into the bloodstream (Figure 15 A and B). We observed a significant decrease in both enzymes in the group immunized with Squimera, both at the end of the acute phase (35 dpi) and in the chronic stage of I. cruzi infection (70 dpi), compared to the control group, and even compared to mice immunized with the other vaccination strategies. When analyzing the results as a whole, a positive correlation was observed between parasitemia levels and muscle damage (Figure 16). The significant decrease in parasitemia observed in the group immunized with Squimera (10 to 30-fold reduction in the area under the parasitemia curve compared to the control) translated into a significant decrease in tissue damage, reflected in the reduction of CK and CK-MB enzymes at the end of the acute phase of the parasitic infection. In the early chronic phase at 70 days post-infection (dpi), less injury was observed in the groups immunized with Squimera and in the group that received the recombinant protein adjuvanted with CpG intramuscularly (Chimera / CpG) compared to the controls and other groups immunized with either Sasp2 or Scz. These results demonstrate the effectiveness of Salmonella carrying the DNA encoding the chimeric polypeptide in protecting against infection with T.cruzi of different UDTs, as well as its better performance with respect to individual antigens. The stimulation of a specific effector and memory cellular and humoral immune response against proteins (Cz, Asp2, and TSi) allows animals infected with T. cruzi to control parasite replication and prevent the establishment of a productive infection. This phenomenon is reflected in a decrease in parasitemia during the acute phase of infection and less damage to tissues where T. cruzi exhibits greater tropism (skeletal and cardiac muscle). The rational design used in constructing the chimeric protein, employing portions of three T. cruzi antigens, allowed for its production in bacteria at high levels, thus overcoming the low expression of the proteins individually. This represents a significant advantage of the chimera over the individual molecules. Through various immunization protocols based on the administration of the chimera, its efficiency in generating a protective immune response against T. cruzi infection has been demonstrated, resulting in a decrease in parasitemia during the acute phase, as well as less cardiac damage during the chronic phase of the infection. The chimera proved superior to the individual molecules in the protection it conferred. It should be noted that there is a dose bias when comparing the groups that received the individual antigens with the group receiving the invention presented here, since, in molar ratio, the latter receive a greater number of molecules from each domain compared to the groups receiving the invention or the combination separately. In other words, the invention reported here allows for a reduction in the dose of each immunogenic polypeptide, enhancing its individual protective capacity. Furthermore, the greatest protection was obtained using different adjuvants (for example, but not limited to, CpG or c-di-AMP adjuvants) and routes of administration (oral, intranasal, and intramuscular), demonstrating that the chimera is superior to its components under different administration conditions. Furthermore, the use of a plasmid expressed in eukaryotic cells and its transport by an attenuated strain of Salmonella conferred greater protection than the component molecules, highlighting the enormous capacity of the chimeric molecule to generate a protective response. The protective superiority of the vaccine of the invention compared to individual antigens lies in the fact that the immunoprotection of the chimera is effective against challenges with strains of Trypanosoma cruzi belonging to different lineages, which would broaden its use as a vaccine in different geographical regions. The chimeric polypeptide of the invention comprises the catalytic domain of the main cysteine protease of T. cruzi, Cruzipain, for example, as shown in SEQ ID No. 10, and a region of the Amastigote Surface Protein 2 (ASP2) antigen, for example, as shown in SEQ ID No. 4; joined by a linker corresponding to an alpha helix of the parasitic protein Transialidase, for example, the sequence shown in SEQ ID No. 15. It is known by those skilled in the art that the amino acid sequence in a chimeric polypeptide can be varied, and all such variations fall within the scope of the present invention, provided that the chimeric polypeptide fulfills the same functions as the chimeric polypeptide shown. In particular, and as shown in Figure 1, the chimeric polypeptide should, at least in a preferred embodiment, comprise the following motifs or epitopes: SEQ ID No. 5 and 6 of ASP-2 of T. cruzi.cruzi, the SEQ ID No. 19 of the connector sequence and the SEQ ID No. 20 and 21 sequences of the T. cruzi cysteine protease, Cruzipain. In light of the aspects disclosed herein, it is obvious and evident that a chimeric polypeptide comprising at least the following motifs is within the scope of the present invention: SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 19, SEQ ID No. 20 and SEQ ID No. 21. This invention is best illustrated by the following examples, which should not be interpreted as imposing a limitation on its scope. On the contrary, it should be clearly understood that other embodiments, modifications, and equivalents of the invention may be suggested to those skilled in the art after reading this description, without departing from the spirit of the present invention and / or the scope of the appended claims. Examples: Total RNA extraction from amastigotes Amastigotes were obtained by infecting Vero cells in a monolayer with blood trypomastigotes of the RA strain of Trypanosoma cruzi. Extracellular amastigotes were centrifuged and washed with sterile PBS. Total RNA was then extracted using Trizol (TRIZOL® Reagent, Life Technologies). One pg of RNA from the extraction was treated with DNase I (Sigma) to remove parasitic and contaminating host cell DNA. mRNAs were obtained using oligo dT in RT-PCR with the MMLV enzyme according to the manufacturer's instructions (Invitrogen). Finally, the remaining RNA was removed from the cDNA by treatment with 2 U of RNase H (Invitrogen). Cloning of the Amastigot Surface Protein 2 (ASP2) gene from the RA strain and of the ASP2 35KDa protein. c-DNA obtained from cultured amastigotes was used as a template. To ensure amplification of the mature transcript, a first PCR reaction was performed using the Pf splice leader 5'-AACCGGATC CAACGC TATTATTGAT-3' (SEQ ID N° 1) that spliced into the 5' miniexon region of Trypanosoma cruzi and a reverse primer Pr-Asp-2: 5'-GAGAGCGGCCGC TCAGTGATGGTGATGGTGATGGACCATTTTTAGTTCACCAAC -3' (SEQ ID No. 2) including the restriction site for Notl. The product was purified and re-amplified using specific primers Pr-Asp-2 and Pf Asp-2: 5'- GCGC GAATTC ATGCTCTCACGTGTTGCTG -3' (SEQ ID No. 3), the latter including the restriction site for EcoRI. The final 2Kb amplicon was purified from the agarose gel using a QiaGen Purification Kit, digested, and incorporated into a pET23a prokaryotic expression vector. E. coli DH5alpha cloning strains were transformed, followed by BL21 expression strains. For cloning the central immunodominant region with greater immunoprotective capacity (ASP235KDa: amino acids 261-570 (SEQ ID N° 4) containing the epitopes CD8+ TEWETGQI (320-327) (SEQ ID N° 5) for the H-2Kk haplotype and 2) VNHRFTLV (553-560) (SEQ ID N° 6) for H20 The following primers were used in 2Kb: Pf Asp2-261 Protein: GCGCGAATTC ATGGATGTTGTGACTGCTGGTGGTT (SEQ ID No. 7) which incorporates the restriction site for EcoRI and Pr-ASP2-571 Hisóx: GAGAGCGGCCGCCTCAGTGATGGTGATGGTGATG CTTCGGAACCTGGTGGATGGTCAC (SEQ ID N° 9) which incorporates the site for cleavage with Notl. Construction of the Chimeric Antigen, Traspain. The N-terminal domain of cruzipain was re-amplified from a previously obtained pcDNApreproCz vector [Cazorla 2010]. A Pf vector mapping to the catalytic domain (5' region of the enzyme) was used. Pf Nt-Cz 5'-GCGC C GAATTC ATG GCG CCC GCG GCA GTG GAT T -3' (SEQ ID No. 11), incorporating the restriction site for EcoRI. As a reverse primer, a degenerate primer was used containing 18 nt of the n-terminal region of Cz and 30 nt of the alpha helical linker sequence of a TSi. Pr linker 1 AGA TTT GAT GAT ACG CAG TTC ACC AAC CAG ACC GAC CAC CGC GGA GCT (SEQ ID No. 12). The linker was completed by sequential PCRs using the following primers: Pr Linker 2 AGA GTC CCA GTT TTT CCA AGA CTG CAG AAC AGA TTT GAT GAT ACG (SEQ ID No. 22) Pr Linker 3 AGC AGT CAC AAC ATC GAT AGA AGA CAG GTG AGA GTC CCA GTT TTT (SEQ ID No. 23). Then, two more reactions were performed to extend the overlap range to 90 nt between the genes to be fused: GTC ATT CTG CAT CAC AAT GCC TGA ACC ACC AGC AGT CAC AAC ATC (SEQ ID No. 24).For fusion, Slicing by overlap extension PCR (SOE-PCR) was performed using the 2 fragments and the primers Pf Nt-Cz and Pr Pr-ASP2-571 Hisóx (for incorporation into pET23a) and Pr-ASP2-571 Chimera pcDNA: GAGAGCGGCCGCTCACTTCGGAACCTGGTGGATGGTCAC (SEQ ID N° 9) (incorporates Notl restriction site for pcDNA3.1) that map to the ends of the constructed gene. Cloning of the Chimeric Antigen, Traspain. The Traspaina chimera amplicon and the pET23a expression vector were purified from the agarose gel and then digested with the restriction enzymes EcoRI and Notl (Fermentas). The cleaved product was purified and ligated using the T4 ligase enzyme (Promega) according to the manufacturer's instructions. The ligation product was used to transform the cloning strain of E. coli DH5α. After the construct was confirmed by sequencing, the pET-Chimera plasmid was purified and used to transform expression strains of E. coli BL21. Expression and purification of recombinant proteins in E. coli E. coli BL21 and Rosetta pLys expression strains were transformed with the various constructs obtained, and protein expression was induced with 0.5 mM IPTG at low temperatures (20°C ON). After induction, the cells were sonicated in 2.5% Triton X-100 PBS at a ratio of 5 mL of buffer per gram of cell pellet. The recombinant proteins rASP235 kDa and rChimera were expressed as inclusion bodies (IBs). These were washed twice with 1% Triton X-100 and twice with detergent-free PBS, centrifuged for 30 min at 20,000 x g and 4°C, and the IBs were resuspended using homogenizers and sonication. For purification, cell lysis and isolation of ICs were carried out, washed with Triton-X100 and low concentrations of chaotropic agents, and then the proteins were solubilized with 8 M urea. They were centrifuged at 20.000 xg for 30 min at room temperature, and the supernatants were separated for subsequent purification of the recombinant proteins. The proteins were purified by affinity chromatography (IMAC), eluting them with 8 M urea buffer, 100 mM NaE^PCM, 10 mM TrisHCl, pH 4.5. In-vitro refolding was then performed by dialysis using a refolding buffer (50 mM Tris, 1 mM EDTA, 2 M Urea, 5% Sucrose, 10% Glycerol, 0.5 mM DTT pH 8). The purity of the proteins in the different fractions eluted by 12.5% SDSPAGE was controlled in the presence of a reducing agent (DTT, dithiothreitol), and subsequent staining with Coomassie Blue. Bacterial endotoxin levels were then determined using an LPS detection bioassay (HEK-Blue LPS detection kit). Immunoblotting To confirm the identity of the chimeric construct, a Western blot was performed using immune sera against Cz and ASP2 previously obtained in the laboratory. Ten pg of the recombinant chimera were plated onto a 12.5% acrylamide-bisacrylamide gel. The proteins were transferred to a PVDF (polyvinylidene fluoride) membrane, which was then blocked with 3% milk PBS and incubated with the corresponding antibodies [Towbin 1979]. After washing the membrane with PBS, it was incubated with a specific anti-mouse IgG antibody conjugated to horseradish peroxidase (HRP). After PBS washes, the membranes were visualized with 4-chloro-1-naphthol (0.86 mg / ml) and 0.003% H₂O₂ in 28% methanol in PBS. Study of the triggered humoral immune response Determination of specific antibody titers Specific IgG antibody titers were determined by ELISA [Voller 1988]. For this purpose, 96-well polyvinyl chloride plates (Nunc - Thermo Scientific) were sensitized with 0.2 pg of the recombinant proteins. Blocking was then performed with 3% BSA in PBS for 2 h at 37 °C. Three washes were performed with 0.05% PBS Tween-20, serial dilutions of the samples were added, and the plates were incubated for 18 h at 4 °C. Subsequently, three washes were performed with 0.05% PBS Tween-20. The corresponding antibody, anti-IgG-HRP (Sigma B6398), was added, and the mixture was incubated for 1 h at 37 °C. The reaction was developed by adding OPD (o-phenyldiamine dihydrochloride, ICN Biomedicals Inc.) 1 mg / ml and 0.045% H₂O₂ in citrate buffer (0.1 M citric acid, 0.1 M Na₂HPO₄, pH 5.0). The reaction was stopped with 4 N HCl, and the absorbance was determined at 492 nm using an ELISA reader (Labsystems Multiscan EX). Study of the cellular immune response. Delayed cellular hypersensitivity test (DTH). Fifteen days after the last immunization, a delayed-type hypersensitivity (DTH) reaction was performed. Five percent of the recombinant proteins were inoculated intradermally into the footpad of the mice. Footpad thickness was determined before and 48 hours after antigen inoculation. Results are expressed as the difference in thickness, in millimeters. Splenocyte culture. To evaluate the cellular immune response developed in vitro, mice were sacrificed 15 days after the last immunization or alternatively 100 days post-infection, and their spleens were aseptically removed. Cell suspensions were prepared from the spleens in RPMI medium. Red blood cells were centrifuged and lysed with lysis buffer (NH4Cl 141 mM, Tris base 17 mM, pH 7.65) for 5 min in an ice bath, when appropriate. They were centrifuged at 500 x g, 4 °C, 7 min and then resuspended in RPMI-SFB 5%. Splenocyte proliferation. 2 x 10⁵ splenocytes were cultured in the presence of different concentrations of recombinant proteins in RPMI supplemented with 5% FBS in 96-well U-bottom culture plates. Three days later, the cells were pulsed with 3H-thymidine (5 pCi / well), and 18 h later, they were harvested and the incorporated radioactive material was quantified using a liquid scintillation counter. The results were expressed as a proliferation index: cpm (counts per minute) of cells in the presence of the antigen / cpm of cells in the absence of the antigen. Determination of cytokine-producing cells ELISPOT. To determine the number of cells producing IFN-γ, IL-4, IL-2, and IL-17 in response to antigenic stimulation, ELISPOT assays were performed. 96-well ELISPOT plates were sensitized with the corresponding capture antibodies for 16 h at 4 °C and blocked with RPMI supplemented with 10% FBS. Subsequently, 2 x 10⁵ and 4 x 10⁵ splenocytes were added in the presence or absence of the recombinant proteins or specific peptides, and the plates were incubated at 37 °C, 5% CO₂ for 24 h for IFN-γ, and 48 h for IL-4, IL-2, and IL-17. After washing, the plates were incubated for 2 h at room temperature with the biotin-conjugated detection antibody, streptavidin-HRP was added, and the plates were visualized with AEC (3-amino-9-ethylcarbazole). The plates were scanned and the spots were quantified using an ImmunoSpot CTL analyzer. The results are expressed as the number of spots per 10⁶ cells. Study of protection against infection Acute phase. To study protection during the acute phase of infection, immunized mice were infected 15 days after their last immunization with a lethal dose of highly virulent RA strain blood trypomastigotes. Alternatively, when indicated, mice were infected intraperitoneally with 250,000 K98 strain parasites. Determination of parasitemias. The number of circulating parasites in the blood after infection was determined every 2 days. Five microliters of blood were taken from the tails of mice, using heparin as an anticoagulant, and diluted 1 / 5 in lysis buffer (141 mM NH4Cl, 17 mM Tris base, pH 7.65). Parasite counts were performed using a Neubauer chamber. Determination of weight loss and mortality. Immunized and infected mice were monitored by determining their weight every 2 days and assessing survival daily. Weight loss was calculated for each mouse individually and expressed as a percentage of initial (pre-infection) weight. Chronic phase. To study protection during the chronic phase of infection, immunized mice were infected 15 days after the last immunization with 100 blood trypomastigotes of the RA strain. One hundred days after infection, the mice were sacrificed and serum was taken for the determination of muscle enzymes. Determination of serum muscle enzyme activity As markers of tissue injury in the chronic phase, serum muscle enzyme activity was determined. Specifically, the activity of lactate dehydrogenase (LDH), aspartate transaminase (AST), creatine kinase (CK), and its cardiac isoform CK-MB was measured. This was done using a spectrophotometric assay following the manufacturer's specifications (Wiener Lab). LIST OF SEQUENCES <110> CONICET <120> chimperic polypeptide <130> CONICET <160> 24 <i70>Patentln versión 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <22 0> <223> Pf Splice Leader <400> 1 aaccggatcc aacgctatta ttgat <210> 2 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Pf Asp-2 <400> 2 gcgcgaattc atgctctcac gtgttgctg <210> 3 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> Pr-Asp-2 <400> 3 gagagcggcc gctcagtgat ggtgatggtg atggaccatt tttagttcac caac <210> 4 <211> 310 <212> PRT <213> Trypanosoma cruzi <400> 4 Asp Val Val Thr Ala Gly Gly Ser Gly lie Val Met Gln Asn Asp Thr 10 15 Leu Val Phe Pro Leu Met Val Asn Gly Gln Asn Tyr Pro Phe Ser Ser 20 25 30 lie Thr Tyr Ser Thr Asp Lys Gly Asn Asn Trp Val Phe Pro Glu Gly 35 40 45 lie Ser Pro Val Gly Cys Leu Asp Pro Arg lie Thr Glu Trp Glu Thr 50 55 60 Gly Gln lie Leu Met lie Val Gln Cys Lys Asp Asp Gln Ser Val Phe 65 70 75 80 Glu Ser Arg Asp Met Gly Lys Thr Trp Thr Glu Ala lie Gly Thr Leu 85 90 95 Ser Gly Val Trp Val Met Ser Gln Pro Gly Val Arg Leu Tyr Lys lie 100 105 110 Phe Arg Val Gly Ala Leu Val Thr Ala Thr lie Glu Gly Arg Lys Val 115 120 125 Met Leu Tyr Thr Gln Arg Gly Tyr Thr Ser Gly Glu Lys Glu Ala Asn 130 135 140 Ala Leu Tyr Leu Trp Val Thr Asp Asn Asn Arg Thr Phe His Val Gly 145 150 155 160 Pro Leu Phe Leu Glu Asp Asn Val Asn Glu Thr Leu Ala Asn Ala Leu 165 170 175 Leu Tyr Ser Asp Gly Ala Leu His Leu Leu Lys Glu Arg Ala Asn Glu 180 185 190 Lys Asp Glu Ala lie Ser Leu Ala Arg Leu Thr Glu Glu Leu Asn Thr 195 200 205 lie Lys Ser Val Leu Ser Thr Trp Ala Lys Leu Asp Ala Ser Phe Ser 210 215 220 Glu Ser Ser Thr Pro Thr Ala Gly Leu Val Gly Phe Leu Ser Asn Thr 225 230 235 240 Ser Ser Gly Gly Asp Thr Trp lie Asp Asp Tyr Arg Cys Val His Ala 245 250 255 Ser Val Thr Lys Ala Ser Lys Val Lys Asn Gly Phe Lys Phe Met Gly 260 265 270 Pro Gly Ser Met Ala Thr Trp Leu Val Asn Ser Arg Glu Asp Asn Arg 275 280 285 Gln Tyr Ser Phe Val His His Arg Phe Thr lie Val Ala Thr Val Thr 290 295 300 lie His Gln Val Pro Lys 305 310 <210> 5 <211> 8 <212> PRT <213> Trypanosoma cruzi <400> 5 Thr Glu . Trp Glu Thr Gly Gln 1 5 <210> 6 <211> 8 <212> PRT <213> Trypanosoma cruzi <400> 6 Val His His Arg Phe Thr lie 1 5 <210> 7 <211> 35 <212> DNA <213> Artificial Sequence <220> lie Val <223> Pf Asp2-261 Proteina <400> 7 gcgcgaattc atggatgttg tgactgctgg tggtt 35 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PÍ-ASP2-261 Quimera <400> 8 gatgttgtga ctgctggtgg tt 22 <210> 9 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> Pr-ASP2-571 His6x <400> 9 gagagcggcc gctcagtgat ggtgatggtg atgcttcgga acctggtgga tggtcac 57 <210> 10 <211> 216 <212> PRT <213> Trypanosoma cruzi <400> 10 Met Ala Pro Ala Ala Val Asp Trp Arg Ala Arg Gly Ala Val Thr Ala 15 10 15 Val Lys Asp Gln Gly Gln Cys Gly Ser Cys Trp Ala Phe Ser Ala lie 20 25 30 Gly Asn Val Glu Cys Gln Trp Phe Leu Ala Gly His Pro Leu Thr Asn 35 40 45 Leu Ser Glu Gln Met Leu Val Ser Cys Asp Lys Thr Asp Ser Gly Cys 50 55 60 Gly Gly Gly Leu Met Asn Asn Ala Phe Glu Trp lie Val Gln Glu Asn 65 70 75 Asn Gly Ala Val Tyr Thr Glu Gly Ser Tyr Pro Tyr Ala Ser Gly Glu 90 95 Gly lie Ser Pro Pro Cys Thr Thr Ser Gly His Thr Val Gly Ala Thr 100 105 110 lie Thr Gly His Val Glu Leu Pro Gln Asp Glu Ala Gln lie Ala Ala 115 120 125 Trp Leu Ala Val Asn Gly Pro Val Ala Val Ala Val Asp Ala Ser Ser 130 135 140 Trp Met Thr Tyr Thr Gly Gly Val Met Thr Ser Cys Val Ser Glu Gln 145 150 155 160 Leu Asp His Gly Val Leu Leu Val Gly Tyr Asn Asp Ser Ala Ala Val 165 170 175 Pro Tyr Trp Val lie Lys Asn Ser Trp Ala Thr Gln Trp Gly Glu Asp 180 185 190 Gly Tyr lie Arg lie Ala Lys Gly Ser Asn Gln Cys Leu Val Lys Glu 195 2ΩΩ Glu Ala Ser Ser Ala Val Val Gly 210 215 <210> 11 <211> 32 <212> DNA <213> <220> Artificial Sequence <223> Cebador hacia adelante Nt <4 00> 11 gcgcgaattc atggcgcccg cggcagtgga <210> 12 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> Cebador reverso Nt-Cz <400> 12 agatttgatg atacgcagtt caccaaccag accgaccacc gcggagct <210> 13 <211> 1674 <212> DNA <213> Trypanosoma cruzi <400> 13 atggcgcccg cggcagtgga ttggcgtgcg agaggcgccg tgacagccgt caaggaccag 60 ggccaatgcg gttcgtgctg ggccttctcc gccattggca acgttgagtg ccagtggttt 120 ctcgccggcc acccgctgac gaacctgtcg gagcagatgc tcgtgtcgtg cgataagacg 180 gactctggct gcggtggtgg cctgatgaac aacgcctttg agtggattgt gcaggagaat 240 aacggcgccg tgtacacgga gggcagctac ccttatgcgt cgggcgaggg gatatcgccg 300 ccgtgcacga cgtcaggcca cacggtgggt gccacgatta ccggtcacgt tgaattaccg 360 caggacgagg cccaaatagc cgcatggctt gcagtcaatg gcccggttgc cgttgccgtc 420 gacgccagca gctggatgac ctacacgggc ggcgttatga cgagctgcgt ctccgagcag 480 ctggatcacg gcgttcttct cgtcggctac aatgacagcg ccgcagtgcc gtactgggtc 540 atcaagaact cgtgggccac gcagtggggt gaggatggct acatccgcat tgcaaagggc 600 tcgaaccagt gccttgtgaa ggaggaggcg agctccgcgg tggtcggtct ggttggtgaa 660 ctgcgtatca tcaaatctgt tctgcagtct tggaaaaact gggactctca cctgtcttct 720 accgatgttg tgactgctgg tggttcaggc attgtgatgc agaatgacac gcctgtgttt 780 cctctgatgg tgaatgggga aaattaccct ttttcctcga tcacttactc gacggacaaa 840 ggcaataatt gggtgttccc agagggcatt tctcctgtag gatgccttga tccccgcatc 900 accgaatggg agacgggaca aattctcatg atcgttcagt gtaaagatga ccagagtgtg ttcgagtcgc gtgacatggg gaaaacgtgg acggaggcta tcgggacact ctcaggcgtg tgggtcatgt cacaaccagg agttcgtcta tacaaaattt ttcgtgtggg ggccctcgtc accgccacca ttgagggaag gaaggtcatg ctgtacaccc agagagggta cacctcgggg gagaaagagg ccaatgcgct ctacctttgg gtcacggaca acaaccgcac gtttcatgtt ggaccgcttt ttttggagga taatgtgaat gagacgcttg ccaacgccct gctgtactcg gatggtgcgt tgcacctctt aaaggagagg gccaatgaaa aagacgaggc catttcactt gcccgcctga cggaggagct gaatacaatc aagtccgtcc tcagtacttg ggcaaagctt gacgcctcct tttccgagtc atccacaccc acggctggtc tggttggatt cctgtccaat acgtcgtccg gtggcgacac gtggatcgac gattaccgct gcgtgcatgc atccgtgacg aaagcatcga aggtcaaaaa tgggttcaag ttcatggggc ctgggtccat ggcaacatgg ctcgtgaaca gccgggagga taacagacag tacagctttg tgcaccacag attcactatt gtggcgacgg tgaccatcca ccaggttccg aagcatcacc atcaccatca ctga 960 1020 1080 1140 1200 1260 1320 1380 1440 1500 1560 1620 1674 <210> 14 <211> 75 <212> DNA <213> Trypanosoma cruzi <400> 14 ctggttggcg agctacggat cattaaatca gtgctgcagt cctggaagaa ttgggacagc cacctgtcca gcatt <210> 15 <211> 25 <212> PRT <213> Trypanosoma cruzi <400> 15 Leu Val Gly Glu Leu Arg lie lie Lys Ser Val Leu Gln Ser Trp Lys 10 15 Asn Trp Asp Ser His Leu Ser Ser lie 20 25 <210> 16 <211> 557 <212> PRT <213> Trypanosoma cruzi <400> 16 Met Ala Pro Ala Ala Val Asp Trp Arg Ala Arg Gly Ala Val Thr Ala 15 10 15 Val Lys Asp Gln Gly Gln Cys Gly Ser Cys Trp Ala Phe Ser Ala lie 20 25 30 Gly Asn Val Glu Cys Gln Trp Phe Leu Ala Gly His Pro Leu Thr Asn 35 40 45 Leu Ser Glu Gln Met Leu Val Ser Cys Asp Lys Thr Asp Ser Gly Cys 50 55 60 Gly Gly Gly Leu Met Asn Asn Ala Phe Glu Trp lie Val Gln Glu Asn 70 75 80 Asn Gly Ala Val Tyr Thr Glu Gly Ser Tyr Pro Tyr Ala Ser Gly Glu 90 95 Gly lie Ser Pro Pro Cys Thr Thr Ser Gly His Thr Val Gly Ala Thr 100 105 110 lie Thr Gly His Val Glu Leu Pro Gln Asp Glu Ala Gln lie Ala Ala 115 120 125 Trp Leu Ala Val Asn Gly Pro Val Ala Val Ala Val Asp Ala Ser Ser 130 135 140 Trp Met Thr Tyr Thr Gly Gly Val Met Thr Ser Cys Val Ser Glu Gln 145 150 155 160 Leu Asp His Gly Val Leu Leu Val Gly Tyr Asn Asp Ser Ala Ala Val 165 170 175 Pro Tyr Trp Val lie Lys Asn Ser Trp Ala Thr Gln Trp Gly Glu Asp 180 185 190 Gly Tyr lie Arg lie Ala Lys Gly Ser Asn Gln Cys Leu Val Lys Glu 195 200 205 Glu Ala Ser Ser Ala Val Val Gly Leu Val Gly Glu Leu Arg lie lie 210 215 220 Lys Ser Val Leu Gln Ser Trp Lys Asn Trp Asp Ser His Leu Ser Ser 225 230 235 240 Thr Asp Val Val Thr Ala Gly Gly Ser Gly lie Val Met Gln Asn Asp 245 250 255 Thr Pro Val Phe Pro Leu Met Val Asn Gly Glu Asn Tyr Pro Phe Ser 260 265 270 Ser lie Thr Tyr Ser Thr Asp Lys Gly Asn Asn Trp Val Phe Pro Glu 275 280 285 Gly lie Ser Pro Val Gly Cys Leu Asp Pro Arg lie Thr Glu Trp Glu 290 295 300 Thr Gly Gln lie Leu Met lie Val Gln Cys Lys Asp Asp Gln Ser Val 305 310 315 320 Phe Glu Ser Arg Asp Met Gly Lys Thr Trp Thr Glu Ala lie Gly Thr 325 330 335 Leu Ser Gly Val Trp Val Met Ser Gln Pro Gly Val Arg Leu Tyr Lys 340 345 350 lie Phe Arg Val Gly Ala Leu Val Thr Ala Thr lie Glu Gly Arg Lys 355 360 365 Val Met Leu Tyr Thr Gln Arg Gly Tyr Thr Ser Gly Glu Lys Glu Ala 370 375 380 ϊ Asn Ala Leu Tyr Leu Trp Val Thr Asp Asn Asn Arg Thr Phe His Val 385 390 395 400 Gly Pro Leu Phe Leu Glu Asp Asn Val Asn Glu Thr Leu Ala Asn Ala 405 410 415 Leu Leu Tyr Ser Asp Gly Ala Leu His Leu Leu Lys Glu Arg Ala Asn 420 425 430 Glu Lys Asp Glu Ala lie Ser Leu Ala Arg Leu Thr Glu Glu Leu Asn 435 440 445 Thr lie Lys Ser Val Leu Ser Thr Trp Ala Lys Leu Asp Ala Ser Phe 450 455 460 Ser Glu Ser Ser Thr Pro Thr Ala Gly Leu Val Gly Phe Leu Ser Asn 465 470 475 480 Thr Ser Ser Gly Gly Asp Thr Trp lie Asp Asp Tyr Arg Cys Val His 485 490 495 Ala Ser Val Thr Lys Ala Ser Lys Val Lys Asn Gly Phe Lys Phe Met 500 505 510 Gly Pro Gly Ser Met Ala Thr Trp Leu Val Asn Ser Arg Glu Asp Asn 515 520 525 Arg Gln Tyr Ser Phe Val His His Arg Phe Thr lie Val Ala Thr Val 530 535 540 Thr lie His Gln Val Pro Lys His His His His His His 545 550 555 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Pr-ASP2-571 Quimera pcDNA <400> 17 gagagcggcc gctcacttcg gaacctggtg gatggtcac <210> 18 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Para pcDNA3.1 N-term Cz <400> 18 taggatccac catggcgatg tctggctggg cgcgtgcgct g 41 <210> 19 <211> 9 <212> PRT <213> Trypanosoma cruzi <400> 19 Gly Glu Leu Arg lie lie Lys Ser Val 1 5 <210> 20 <211> 10 <212> PRT <213> Trypanosoma cruzi <400> 20 Thr Ser Gly His Thr Val Gly Ala Thr lie 1 5 10 <210> 21 <211> 8 <212> PRT <213> Trypanosoma cruzi <400> 21 Lys Glu Glu Ala Ser Ser Ala Val 1 5 <210> 22 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Pr Linker 2 <400> 22
Claims
1. An isolated chimeric polypeptide, characterized in that it comprises, linked together, the catalytic domain of cruzipain from T. cruzi of sequence SEQ ID No. 10, a linker shown in sequence SEQ ID No. 15, and a region of the Amastigote Surface Protein 2 (ASP2) antigen from T. cruzi of sequence SEQ ID No. 4; wherein said chimeric polypeptide comprises the sequence shown in SEQ ID No.
16. Eight claims follow.