VETERINARY COMPOSITION

Abstract

Claim 1: A composition or vaccine characterized in that it comprises a recombinant viral vector expressing a foot-and-mouth disease virus (FMDV) antigen. Claim 8: The composition or vaccine of any of claims 1 to 7, characterized in that the pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle is selected from the group consisting of polyacrylic acid, LF2 emulsion, LR6 emulsion, TS6 emulsion, LR4 emulsion, carbomer, aluminum hydroxide, aluminum phosphate, saponin, CpG, water-in-oil emulsion, oil-in-water emulsion, CARBIGEN™, and ENABL®.

Description

FMDV VACCINES VECTORIZED WITH ADENOVIRUS RECOMBINANTS AND THEIR USES This invention was made with government support. The government has certain rights to the invention. REFERENCE TO RELATED APPLICATIONS This application invokes the priority of U.S. provisional application 62 / 288.540 filed on January 29, 2016. FIELD OF INVENTION The present invention relates to compositions for combating old age fever virus (FMDV) infection in animals. This disclosure provides pharmaceutical compositions comprising an FMDV antigen, FMDV vaccination methods, and kits for use with such methods and compositions. BACKGROUND OF THE INVENTION Old age fever (AMF) is one of the most virulent and contagious diseases affecting farm animals. This disease is endemic in numerous countries worldwide, especially in Africa, Asia, and South America. Furthermore, outbreaks can occur periodically. The presence of this disease in a country can have severe economic consequences, resulting in lost productivity, weight loss, and reduced milk production in infected herds, as well as trade embargoes imposed on these countries. Measures taken against this disease include strict enforcement of restrictions, hygiene controls and quarantine, culling of infected animals, and disease prevention programs. vaccination using vaccines, either as a preventive measure at the national or regional level, or periodically when an epidemic outbreak occurs. Foot-and-mouth disease (FMD) is characterized by its short incubation period, highly contagious nature, the formation of ulcers in the mouth and on the feet, and sometimes the death of young animals. FMD affects numerous animal species, particularly cattle, pigs, sheep, and goats. The causative agent is an RNA virus belonging to the genus Aphthovirus of the family Picomaviridae (Cooper et al., Intervirology, 1978, 10, 165-180). Currently, at least seven types of foot-and-mouth disease virus (FMDV) are known: the European types (A, O, and C), the African types (SAT1, SAT2, and SAT3), and one Asian type (Asia 1). Numerous subtypes have also been identified (Kleid et al., Science (1981), 214, 1125-1129). FMDV is a naked icosahedral virus approximately 25 nm in diameter, containing a single-stranded, positive-sense RNA molecule of approximately 8500 nucleotides. This RNA molecule comprises a single open reading frame (ORF), which encodes a single polyprotein containing, among other components, the capsid precursor also known as the P1 or P88 protein. The P1 protein is myristylated at its amino terminus. During maturation, protease 3C cleaves the P1 protein into three proteins known as VPO, VP1, and VP3 (or 1AB, 1D, and 1C, respectively; Belsham GJ, Progress in Biophysics and Molecular Biology, 1993, 60, 241–261). In the virion, the VPO protein is further cleaved into two proteins, VP4 and VP2 (or 1A and 1B, respectively). The mechanism of conversion of VPO proteins into VP4 and VP2 is unknown, and of Formation of mature virions. The VP1, VP2, and VP3 proteins have a molecular weight of approximately 26,000 Da, while the VP4 protein is smaller, at approximately 8,000 Da. YO#' The simple combination of capsid proteins forms the promoter, or 5S molecule, which is the main constituent of the FMDV capsid. This promoter then complexes into a pentamer to form the 12S molecules. The virion results from the encapsulation of a genomic RNA molecule by the assembly of twelve 12S pentamers, thus constituting the 146S particles. The viral capsid can also form without an RNA molecule inside (hereafter referred to as the “empty capsid”). The empty capsid is also designated as the 70S particle. The formation of empty capsids can occur naturally during viral replication or can be artificially produced by chemical treatment. Some studies have been done on naturally occurring empty capsids. In particular, Rowlands et al. (Rowlands et al., J. Gen. Virol., 1975, 26, 227-238) showed that foot-and-mouth disease A10 virions comprise mainly the four proteins VP1, VP2, VP3, and VP4. In comparison, naturally occurring empty capsids (not obtained by recombination but purified from cultures of foot-and-mouth disease A10 virus) contain essentially the uncleaved VP0 protein; identical results with foot-and-mouth disease A-Pando virus are described by Rweyemamu (Rweyemamu et al., Archives of Virology, 1979, 59, 69-79). Artificially produced empty capsids are obtained after dialysis in the presence of Tris-EDTA and, after centrifugation, do not contain the VP4 protein. These artificial capsids are mildly immunogenic according to Rowlands et al., and natural empty capsids are only The capsids are immunogenic after treatment with formaldehyde to stabilize them, although the antibody response induced by the natural empty capsids in guinea pigs is not consistent, as the inventor indicates. Furthermore, Rowlands et al. and Rweyemamu et al. disagree on the necessity of stabilizing the natural empty capsids. According to Rweyemamu et al., the absence of formaldehyde treatment is not detrimental to the antigenicity of the natural empty capsids. Immunogenicity is demonstrated only by the induction of neutralizing antibodies in guinea pigs. Expression of the gene encoding the P1 precursor of capsid proteins by means of a recombinant baculovirus in insect cells V.· · ' compare with the expression of the gene encoding P1 associated with protease 3C in E. coli (Grubman et al., Vaccine, 1993, 11, 825-829; Lewis et al., J. Viro!, 1991, 65, 6572-6580). Co-expression of P1 and 3C in E. coli results in the assembly of empty 70S capsids. The expression product of these two constructs produces neutralizing antibodies in guinea pigs and pigs. Titers obtained with the P1 / baculovirus construct are low. These same expression products induce partial protection in pigs. However, some pigs protected against the disease are not protected against replication of the challenge virus. However, the expression system in E. coli does not myristylate the proteins, and protease 3C is toxic to this cell. Lewis et al.They conclude that the answers to fundamental questions related to virus conformation and capsid structure, necessary to achieve maximum protection in the animal, have not been found. Furthermore, Grubman et al. state that it might be necessary to stabilize empty capsids before formulating the vaccine; in this regard... They agree on the problems encountered with empty capsids obtained from viral culture extraction (see above). Fusion proteins containing part or all of the P1 protein have also been obtained using viral vectors, particularly a herpesvirus or a vaccinia virus. Specifically, CA-A-2,047,585 describes a bovine herpesvirus used to produce fusion proteins containing a peptide sequence from the vaccinia virus (amino acids 141 to 158 of P1 linked to amino acids 200 to 213 of P1) fused to the gplll glycoprotein of this bovine herpesvirus. Adenoviral vectors have been used to express the empty FMDV capsid (US 8,323,663). Viral vectors have also been used to express a stabilized empty FMDV capsid (US 7,531,182, USSN14 / 863,181). Recently, plant and insect cells have been investigated as a source for FMDV antigen production (US 2011 / 0236416, USSN14 / 863.181). It has been reported that maternally derived antibodies (MDA) can inhibit the response of steers (cattle less than 2 years old) to FMD vaccination (Graves, 1963, Journal of Immunology 91: 251-256; Brun et al., 1977, Developments in Biological Standardisation, 25:117-122). SUMMARY OF THE INVENTION Compositions or vaccines comprising recombinant viral vectors expressing FMDV polypeptides and fragments and variants thereof are provided. The FMDV antigens and fragments and variants thereof possess immunogenic and protective properties. The recombinant viral vectors may be adenoviral vectors expressing FMDV antigens. , ,ν . Recombinant viral vectors can be formulated into vaccines and / or pharmaceutical compositions. Such vaccines or compositions can be used to vaccinate an animal and to provide protection against homologous and heterologous FMDV strains. Vaccines or compositions formulated with pharmaceutically or veterinarily acceptable carriers, excipients, adjuvants, or vehicles offer improved thermostability and the ability to withstand temperature changes. Methods are provided for improving protection in conventional and maternally derived antibody-positive (MDA-positive) animals against FMDV infections. The component assemblies comprise at least one antigenic polypeptide, or a fragment or variant thereof, and instructions for use are also provided. BRIEF DESCRIPTION OF THE FIGURES The following detailed description, which is given by way of example, without intending to limit disclosure only to the specific embodiments described, can be better understood in conjunction with the accompanying figures, in which: Figure 1 shows a table summarizing the DNA and protein sequences. Figure 2 shows the FMDV strain A24 genes and the A24 (p1-2AB') genes used in the A24-A12 chimeric construct. Figure 3 shows the genes for FMDV strain A12 and the A12 (3B73C) genes that were used in the A24-A12 chimeric construct. Figure 4 shows the genetic structural identity assay of the recombinant adenovirus vectored FMDV vaccine using PCR. Figure 5 shows the Western blot of the recombinant adenovirus vectored FMDV A24-A12 vaccine. Figure 6 shows the genes for FMDV strain 01M that were used in the recombinant adenovirus vectored FMDV 01M vaccine. Figure 7 shows the genes for FMDV Irn strain used in the recombinant adenovirus vectored FMDV Irn vaccine. Figure 8 shows the genes for FMDV Asia strain used in the recombinant adenovirus vectored FMDV Asia vaccine. Figure 9 shows the percentage of protection of the FMDV serotype O vaccine at different doses. Figure 10 shows the serology of the FMDV serotype O vaccine at different doses. Figure 11 shows the virucidal activity of FMDV vectored with recombinant adenoviruses + adjuvants at 25°C. Figure 12 shows the virucidal activity of FMDV vectored with recombinant adenoviruses + adjuvants at 4°G. Figure 13 shows the geometric mean of the FMDV VN title. Figure 14 shows the geometric mean of the SAV title. Figure 15 shows the geometric mean of the FMDV VN title. DETAILED DESCRIPTION v Compositions or vaccines comprising recombinant viral vectors expressing FMDV antigens that produce an immune response in an animal are provided. The recombinant viral vectors may be adenoviral vectors expressing FMDV antigens. The recombinant viral vectors expressing the antigens may be formulated into vaccines or pharmaceutical compositions and may be used to produce or stimulate an immune response. a protective response in an animal. In one embodiment, the polypeptide antigen is an FMDV structural protein P1 (VP4-VP2-Vp3-VP1), a non-structural protein P2 (2A, 2B, and 2C) or a non-structural protein P3 (3A, 3B, 3C, and 3D) or an active fragment or variant thereof. It is recognized that the antigenic polypeptides disclosed herein may be full-length polypeptides or active fragments or variants thereof. “Active fragments” or “active variants” are intended to mean that the fragments or variants retain the antigenic nature of the polypeptide. Accordingly, this disclosure covers any FMDV polypeptide, antigen, epitope, or immunogen that elicits an immunogenic response in an animal. An FMDV polypeptide, antigen, epitope, or immunogen may be any FMDV polypeptide, antigen, epitope, or immunogen, such as, but not limited to, a protein, peptide, or a fragment or variant thereof, that generates, induces, or stimulates a response in an animal, such as a sheep, cattle, goat, or swine. The simple combination of capsid proteins forms the promoter or 5S molecule, which is the elementary constituent of the FMDV capsid. This promoter then complexes into a pentamer to form the 12S molecules. The virion results from the encapsulation of a genomic RNA molecule by the assembly of twelve 12S pentamers, thus constituting the 146S particles. The viral capsid can also form without the presence of an RNA molecule within it (hereafter referred to as the “empty capsid”). The empty capsid is also designated as the 70S particle. The formation of empty capsids can occur naturally during viral replication or It can be produced artificially by chemical treatment. This disclosure relates to vaccines or compositions for cattle, sheep, goats, or swine, which may comprise an amount T -Ah." effective of a recombinant FMDV antigen or a recombinant viral vector expressing the FMDV antigen, and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant or vehicle. In some embodiments, the vaccines also comprise adjuvants, such as the oil-in-water (O / W) emulsions described in U.S. Patent No. 7,371,395. In still other embodiments, the adjuvants include TS6, TS7, TS8 and TS9 emulsions, LR3, LR4 and LR6 emulsions, LF2 emulsion, CARBIGEN™ adjuvant, ENABL® adjuvant, polyacrylic acid, aluminum hydroxide or aluminum phosphate, saponin, CpG, water-in-oil emulsion, and oil-in-water emulsion, or combinations thereof. In some embodiments, the response in the animal is a protective immune response. The term “animal” refers to mammals, birds, and the like. The animal or host includes mammals and humans. The animal may be selected from the group consisting of equines (e.g., horses), canines (e.g., dogs, wolves, foxes, coyotes, jackals), felines (e.g., lions, tigers, domestic cats, wild cats, big cats, and other felines including cheetahs and lynxes), ovines (e.g., sheep), bovines (e.g., cattle, cows), porcines (e.g., pigs), caprines (e.g., goats), birds (e.g., chickens, ducks, swans, turkeys, quail, pheasants, parrots, finches, hawks, crows, ostriches, emus, and cassowaries), and primates. (for example, prosimians, tarsiers, monkeys, gibbons, apes) and fish. The term “animal” also includes an individual animal at all stages of its development, including the embryonic and fetal stages. Unless otherwise explained, all technical and scientific terms used have the same meaning commonly assigned to them by someone with ordinary experience in the technique to which this description pertains. The singular terms “a,” “one,” and “the” include plural references unless the context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The antigenic polypeptides disclosed may offer protection against FMDV. That is, they may stimulate an immune response in an animal. The term “antigen” or “immunogen” means a substance that induces a specific immune response in a host animal. The antigen may comprise a whole organism, dead, attenuated, or live; a subunit or portion of an organism; a recombinant vector containing an insert with immunogenic properties; a piece or fragment of DNA capable of inducing an immune response after presentation in a host animal; a polypeptide, an epitope, a hapten, or any combination thereof. Alternatively, the immunogen or antigen may comprise a toxin or an antitoxin. The term “immunogenic protein, polypeptide, or peptide” as used herein includes polypeptides that are immunologically active in the sense that, when administered to the host, they can evoke a humoral and / or cellular immune response directed against the protein. 11 In some embodiments, the protein fragment has substantially the same immunological activity as the full protein. Thus, a protein fragment, according to the disclosure, may comprise or consist essentially of, or consist of, at least one antigenic determinant or epitope. An “immunogenic” protein or polypeptide, as used herein, includes the full-length protein sequence, analogues thereof, or immunogenic fragments thereof. An “immunogenic fragment” means a fragment of a protein that includes one or more epitopes and thereby elicits the immune response described above. Such fragments can be identified using any number of epitope mapping techniques.For example, linear epitopes can be determined by simultaneously synthesizing large numbers of peptides on solid supports. These peptides correspond to portions of the protein molecule, and the peptides react with antibodies while still attached to the supports. Such techniques are known in the art and are described, for example, in U.S. Patent No. 4,708,871; Geysen et al., 1984, PNAS USA, 81(13); 3998400; Geysen et al., 1985, PNAS USA, 82(1): 178-82. Similarly, conformational epitopes are readily identified by determining the spatial conformation of amino acids, such as by X-ray crystallography and two-dimensional nuclear magnetic resonance. The methods especially applicable to T. parva proteins are described in PCT / US2004 / 022605. As discussed, disclosure encompasses active fragments and variants of the antigenic polypeptide. Thus, the term “protein, polypeptide, or The term “immunogenic peptide” also includes deletions, additions, and substitutions in the sequence, provided that the polypeptide functions to produce an immune response as defined herein. The term “conservative variation” denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue remains unchanged or is another biologically similar residue. In this respect, some substitutions will generally be conservative in nature; that is, substitutions that occur within a family of amino acids.For example, amino acids are generally divided into four families: (1) acidic: aspartate and glutamate; (2) basic: lysine, arginine, histidine; (3) nonpolar: alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) polar uncharged: glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. Examples of conservative variations include the substitution of a hydrophobic residue such as isoleucine, valine, leucine, or methionine with another hydrophobic residue, or the substitution of one polar residue with another polar residue, such as the substitution of arginine with lysine, glutamic acid with aspartic acid, or glutamine with asparagine, and so on. or a similar conservative replacement of an amino acid with a structurally related amino acid that will have no greater effect on biological activity.The proteins have substantially the same amino acid sequence as the reference molecule but possess minor amino acid substitutions that do not substantially affect the protein's immunogenicity, which therefore falls within the definition of the reference polypeptide. All of them. .. i V.· Polypeptides produced by these modifications are included herein. The term “conservative variation” also includes the use of a substituted amino acid in place of an original, unsubstituted amino acid, provided that the antibodies generated against the substituted polypeptide also react immunologically with the unsubstituted polypeptide. The term “epitope” refers to the site on an antigen or hapten to which specific B cells and / or T cells respond. The term is also used interchangeably with “antigenic determinant” or “antigenic determinant site.” Antibodies that recognize the same epitope can be identified in a single immunoassay that demonstrates an antibody’s ability to block another antibody from binding to a target antigen. An “immune response” to a composition or vaccine is the development in the host of a cellular and / or antibody-mediated immune response to a composition or vaccine of interest. Usually, but not exclusively, an “immune response” includes one or more of the following effects: the production of antibodies, B cells, helper T cells, and / or cytotoxic T cells, directed specifically against an antigen or antigens included in the composition or vaccine of interest. Preferably, the host will develop either a therapeutic or protective immune response such that resistance to reinfection is enhanced and / or the clinical severity of the disease is reduced. Such protection will be demonstrated by either a reduction or absence of symptoms normally exhibited by an infected host, a faster recovery time, and / or a decreased viral titer in the infected host. Synthetic antigens are also included within the definition, for example, polyepitopes, flanking epitopes, and other recombinantly or synthetically derived antigens. Immunogenic fragments, for disclosure purposes, will usually include at least approximately 3 amino acids, at least approximately 5 amino acids, at least approximately 10–15 amino acids, or approximately 15–25 amino acids or more amino acids from the molecule. There is no critical upper limit for fragment length, which could encompass almost the entire length of the protein sequence, or even a fusion protein comprising at least one epitope of the protein. Therefore, a minimal structure of a polynucleotide expressing an epitope is that it comprises or essentially consists of nucleotides encoding an epitope or antigenic determinant of an FMDV polypeptide. A polynucleotide encoding a fragment of an FMDV polypeptide may comprise or essentially consist of a minimum of 15 nucleotides, approximately 30 to 45 nucleotides, approximately 45 to 75 nucleotides, or at least 57, 87, or 150 consecutive or contiguous nucleotides of the sequence encoding the polypeptide. The terms “nucleic acid” and “polynucleotide” refer to RNA or DNA that is linear or branched, single-stranded or double-stranded, or a hybrid of the two. The term also encompasses RNA / DNA hybrids. The following are non-limiting examples of polynucleotides: a gene or gene fragment, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, and DNA isolated from any source. sequence, RNA isolated from any sequence, nucleic acid probes and primers. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and nucleotide analogues, uracil, other sugars and linker groups such as fluororibose and thiolate, and nucleotide branches. The nucleotide sequence may be further modified after polymerization, such as by conjugation with a labeling component. Other types of modifications included in this definition are caps. M*;. - > substitution of one or more of the natural nucleotides with an analogue, e ·.< Introduction of means to link the polynucleotide to proteins, metal ions, labeling components, other polynucleotides, or solid supports. Polynucleotides can be obtained by chemical synthesis or derived from a microorganism. The term “gene” is widely used to refer to a segment of polynucleotides associated with a biological function. Thus, genes include introns and exons, as in a genomic sequence, or only the coding sequences, as in cDNA, and / or the regulatory sequences required for their expression. For example, a gene can also refer to a fragment of nucleic acids that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences. The disclosure also includes a complementary polynucleotide chain encoding an FMDV antigen, epitope, or immunogen. The complementary chain may be polymeric and of any length and may contain deoxyribonucleotides, ribonucleotides, and analogues in any combination. The terms “protein”, “peptide”, “polypeptide” and “fragment of · The terms “polypeptides” are used interchangeably herein to refer to polymers of amino acid residues of any length. The polymer may be linear or branched, may comprise amino acids or modified amino acid analogues, and may be interrupted by chemical portions other than amino acids. The terms also encompass a polymer of amino acids that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling or bioactive component. An “isolated” biological component (such as a nucleic acid, protein, or organelle) refers to a component that has been separated or purified substantially from other biological components in the cell of the organism in which the component naturally originates, for example, other chromosomal and extrachromosomal DNA and RNA, proteins, and organelles. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. The term also encompasses nucleic acids and proteins prepared by recombinant technology as well as by chemical synthesis. The term “purified,” as used herein, does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified polypeptide preparation is one in which the polypeptide is more enriched than the polypeptide found in its natural environment. In some cases, the polypeptide is separated from cellular components. By “substantially purified,” it is intended that such a polypeptide represents at least 60% of various embodiments. At least 70%, at least 80%, at least 90%, at least 95%, or at least 98%, or more of the cellular components or materials have been removed. Similarly, the polypeptide may be partially purified. By “partially purified” it is meant that less than 60% of the cellular components or materials have been removed. The same applies to polynucleotides. The polypeptides described herein may be purified by any of the means known in the art. As previously noted, antigenic polypeptides, or fragments or variants thereof, are FMDV antigenic polypeptides produced by a live viral vector. The polynucleotide fragments and variants described, and the polypeptides encoded by them, are also included in this disclosure. "Fragment" is meant to be a portion of the polynucleotide or a portion of the antigenic amino acid sequence encoded by it. Polynucleotide fragments may encode protein fragments that retain the biological activity of the natural protein and, therefore, have immunogenic activity, as discussed elsewhere herein. Polypeptide sequence fragments retain the ability to induce a protective immune response in an animal. “Variant” is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a deletion and / or addition of one or more nucleotides at one or more sites within the natural polynucleotide and / or a substitution of one or more nucleotides at one or more sites in the natural polynucleotide. As used herein, a “natural” polynucleotide or polypeptide comprises a sequence of nucleotides or a sequence of naturally occurring amino acids, respectively. Variants of a particular polynucleotide in the disclosure (e.g., the reference polynucleotide) can also be assessed by comparing the percent sequence identity between the polypeptide encoded by a polynucleotide variant and the polypeptide encoded by the reference polynucleotide. The term “variant” is intended to mean a protein derived from the natural protein by the deletion or addition of one or more amino acids at one or more sites in the natural protein and / or the substitution of one or more amino acids at one or more sites in the natural protein. The protein variants included in this disclosure are biologically active, meaning they have the capacity to elicit an immune response. In one respect, this disclosure provides FMDV polypeptides from FMDV isolates from sheep, cattle, goats, or swine. In another respect, this disclosure provides a polypeptide having a sequence shown in SEQ ID Nos. 2, 4, 6, or 8 and a variant or fragment thereof. Furthermore, FMDV polypeptide homologs from sheep, cattle, goats, or swine are considered to be within the scope of this disclosure. As used herein, the term “homologs” includes orthologs, analogues, and paralogs. The term “analogues” refers to two polynucleotides or polypeptides that have the same or similar function but have evolved separately in unrelated organisms. The term “orthologs” refers to two polynucleotides or polypeptides from different species that have evolved from a common ancestral gene through speciation. Typically, orthologs encode polypeptides that have the The term “paralogs” refers to two polynucleotides or polypeptides that are related by duplication within a genome. Paralogs usually have different functions, but these functions may be related. Analogues, orthologs, and paralogs of a wild-type FMDV polypeptide may differ from the wild-type FMDV polypeptide by post-translational modifications, by differences in amino acid sequence, or by both. In particular, homologs of the disclosure will generally show at least 80–85%, 85–90%, 90–95%, or 95%, 96%, 97%, 98%, or 99% sequence identity with all or part of the wild-type FMDV polypeptide or polynucleotide sequences and will exhibit similar function. Variants include allelic variants.The term “allelic variant” refers to a polynucleotide or polypeptide containing polymorphisms that lead to changes in the amino acid sequences of a protein and that exists within a natural population (e.g., a species or strain of virus). Such natural allelic variations can typically result in 1–5% variance in a polynucleotide or polypeptide. Allelic variants can be identified by sequencing the nucleic acid sequence of interest in a number of different species, which can be easily accomplished by using hybridization probes to identify the same genetic site of the same gene in those species. Any and all nucleic acid variations and resulting polymorphisms or amino acid variations that are the result of a natural allelic variation and do not alter the functional activity of the gene of interest are within the scope of disclosure. As used in the present, the term “derivative” or “variant” is This refers to a polypeptide, or a nucleic acid encoding a polypeptide, that has one or more conservative amino acid variations or other minor modifications such that (1) the corresponding polypeptide has substantially equivalent function when compared to the wild-type polypeptide, or (2) an antibody generated against the polypeptide is immunoreactive with the wild-type polypeptide. These variants or derivatives include polypeptides that have minor modifications to the major amino acid sequences in the FMDV polypeptide, which can result in peptides that have substantially equivalent activity when compared to the unmodified polypeptide counterpart. Such modifications may be released, such as by site-directed mutagenesis, or they may occur spontaneously.The term “variant” also includes deletions, additions and substitutions in the sequence, as long as the polypeptide functions to produce an immune response as defined herein. The term “conservative variation” denotes the replacement of an amino acid residue by another biologically similar residue, or the replacement of a nucleotide in a nucleic acid sequence such that the encoded amino acid residue remains unchanged or is another biologically similar residue. In this respect, particularly preferred substitutions will generally be conservative in nature, as previously described. The polynucleotides described include sequences that degenerate as a result of the genetic code, for example, the host-optimized codon utility. As used herein, “optimized” refers to a polynucleotide that is genetically engineered to increase its expression in a given species. To provide optimized polynucleotide sequences encoding FMDV polypeptides, the FMDV protein gene DNA sequence can be modified to: 1) comprise codons preferred by genes highly expressed in a particular species; 2) comprise an A+T or G+C content in the nucleotide base composition that is substantially like that found in that species; 3) form a start sequence of that species; or 4) remove sequences that cause destabilization, inappropriate polyadenylation, degradation, and termination of RNA, or that form secondary structure hairpins or RNA splice sites. Increased expression of FMDV protein in the species can be achieved by utilizing the distribution frequency of a useful codon in eukaryotes and prokaryotes, or in a particular species.The term “frequency of a preferred useful codon” refers to the preference shown by a specific host cell for nucleotide codons useful for specifying a given amino acid. There are 20 naturally occurring amino acids, many of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the description as long as the amino acid sequence of the FMDV polypeptide encoded by the nucleotide sequence remains functionally unchanged. The sequence identity between two amino acid sequences can be established by paired blast and the NCBI (National Center for Biotechnology Information) blosum62 array, using predetermined parameters (see, for example, the BLAST or BLASTX algorithm available on the server of the “National Center for Biotechnology Information” (NCBI, Bethesda, Md„ USA). The “identity” of the sequences can refer to the number of positions with identical nucleotides or amino acids divided by the number of nucleotides or amino acids in the shorter of the two sequences, where the alignment of the two sequences can be determined according to the Wilbur and Lipman algorithm (1983, Proc. Nati. Acad. Sci. USA, vol. 80, pp. 726–730). The sequence identity or sequence similarity of two amino acid sequences, or the sequence identity between two nucleotide sequences, can be determined using the Vector NTI software package (Invitrogen, 1600 Faraday Ave., Carlsbad, CA). When RNA sequences are said to be similar, or to have a degree of sequence identity or homology with DNA sequences, thymidine (T) in the DNA sequence is considered equivalent to uracil (U) in the RNA sequence.Thus, RNA sequences are within the scope of disclosure and can be derived from DNA sequences, by the thymidine (T) in the DNA sequence being considered equal to uracil (U) in RNA sequences. Hybridization reactions can be performed under different “severity” conditions. See, for example, “Molecular Cloning: A Laboratory Manual”, fourth edition (Sambrook et al., 2014). The disclosure also covers FMDV polynucleotides contained in a vector molecule or expression vector and are operationally linked to a promoter element and optionally to a booster A “vector” refers to a recombinant DNA or RNA plasmid or virus comprising a heterologous polynucleotide that is released into a target cell, either in vitro or in vivo. The heterologous polynucleotide may comprise a sequence of interest for prevention or therapy purposes. 'I and optionally may be found in the form of an expression cassette. As used herein, it is not necessary that a vector be able to replicate in the final target cell or subject. The term includes cloning vectors and viral vectors. The term “recombinant” means a semi-synthetic or synthetically derived polynucleotide that is either not naturally occurring or is joined to another polynucleotide in an arrangement not found in nature. “Heterologous” means derived from an entity genetically distinct from the rest of the entity to which it is compared. For example, a polynucleotide can be inserted by genetic engineering techniques into a plasmid or vector derived from a different source, and it is a heterologous polynucleotide. A promoter removed from this natural coding sequence and operationally linked to a different coding sequence is a heterologous promoter. This disclosure relates to vaccines or pharmaceutical or immunological compositions for sheep, cattle, goats, and swine that may comprise an effective amount of a recombinant FMDV antigen and a pharmaceutically or veterinarily acceptable carrier, adjuvant, excipient, or vehicle. The subject matter described herein is directed in part to compositions and methods related to FMDV antigen prepared in a baculovirus / insect cell expression system that is highly immunogenic and protects animals against challenge with homologous and heterologous strains of FMDV. Compositions This disclosure relates to FMDV vaccines or compositions that may comprise an effective amount of a recombinant FMDV antigen and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle. In one embodiment, the FMDV vaccine or composition comprises a recombinant viral vector expressing FMDV antigens. One way to implement disclosure relates to a vaccine or composition comprising a viral vector expressing FMDV antigens. The FMDV antigens are obtained by expressing cDNA from the P1 (VP4-VP2-VP3-VP1), 2A / 2B / 3B', and 3C regions, or P1 (VP4-VP2-VP3-VP1), 2A / 2B / 2C, and 3A / 3B / 3C / 3D regions. The structural P1 region and the non-structural P2 or P3 regions may be derived from the same FMDV serotype or from different serotypes (chimeric antigens). This disclosure covers any FMDV polypeptide, antigen, epitope, or immunogen that elicits an immunogenic response in an animal, such as sheep, cattle, goats, or swine. An FMDV polypeptide, antigen, epitope, or immunogen may be any FMDV polypeptide, antigen, epitope, or immunogen, including, but not limited to, a protein, peptide, or fragment thereof, that elicits, induces, or stimulates a response in an animal, such as sheep, cattle, goats, or swine. In an embodiment where the FMDV immunological composition or vaccine is a recombinant immunological composition or vaccine, the composition or vaccine comprises a recombinant vector and a pharmaceutically or veterinarily acceptable excipient, carrier, adjuvant, or vehicle; the recombinant vector is a baculovirus expression vector that may comprise a polynucleotide encoding an FMDV polypeptide, antigen, epitope, or immunogen. The FMDV polypeptide, antigen, epitope, or immunogen may be VP1, VP2, VP3, VP4, 2A, 2B, 2C, 3A, 3B, 3C, or 3D, or any combination thereof. In one embodiment, the polypeptides P1(VP4-VP2-VP3-VP1)-2A / partial 2B / partial 3B and 3C can be expressed in a viral vector, and expression can be regulated by one or more promoter sequences. In another embodiment, the FMDV antigen can be a chimeric antigen comprising the P1(VP4-VP2-VP3-VP1)-2A-partial 2B antigen of FMDV serotype A24, the partial 3B antigen of FMDV serotype A12, and the 3C antigen of FMDV serotype A24. In yet another embodiment, the FMDV antigen can be P1(VP4-VP2-VP3-VP1)-2A-2B-partial 2C-partial 3A-3B-3C. In another embodiment, the FMDV antigen can be derived from FMDV 01 Manisa, 01 BFS or Campos, A24 Cruzeiro, A12, Asia 1 Shamir, A Iran'96, Asia / IRN / 05, A22 Iraq, SAT2 Saudi Arabia. This disclosure relates to an FMDV vaccine that may comprise an effective quantity of a recombinant FMDV antigen or a recombinant viral vector expressing an FMDV antigen, and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle. In another embodiment, the pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle may be a water-in-oil emulsion. The disclosure also covers FMDV polynucleotides contained in a vector molecule or expression vector and operationally linked to a promoter element and optionally to an enhancer. In one respect, the present disclosure provides FMDV polypeptides, particularly ovine, bovine, caprine or porcine polypeptides having a sequence shown in SEQ ID No.: 2, 4, 6 or 8, and variants or fragments thereof. In another respect, the present disclosure provides a polypeptide that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity with an antigenic polypeptide of the disclosure, particularly with polypeptides having a sequence as set forth in SEQ ID NO: 2, 4, 6, u8. In yet another aspect, the present disclosure provides fragments and variants of the previously identified FMDV polypeptides (SEQ ID No.: 2, 4, 6 or 8) which can be easily prepared by someone experienced in the technique using molecular biology techniques. The variants are homologous polypeptides that have an amino acid sequence of at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence as stated in SEQ ID No: 2, 4, 6, or 8. An immunogenic fragment of an FMDV polypeptide includes at least 8, 10, 15, or 20 consecutive amino acids, at least 21 amino acids, at least 23 aphthino acids, at least 25 amino acids, or at least 30 amino acids from an FMDV polypeptide having a sequence shown in SEQ ID No. 2, 4, 6, or 8, or variants thereof. In another embodiment, a fragment of an FMDV polypeptide includes a specific antigenic epitope found in a full-length FMDV polypeptide. In another aspect, this disclosure provides a polynucleotide encoding an FMDV polypeptide, such as a polynucleotide encoding a polypeptide having a sequence shown in SEQ ID No. 2, 4, 6, or 8. In yet another aspect, this disclosure provides a polynucleotide encoding a polypeptide that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% sequence identity with a polypeptide having a sequence shown in SEQ ID No. 2, 4, 6, or 8, or a conservative variant, allelic variant, homolog, or immunogenic fragment comprising at least eight or at least ten consecutive amino acids from one of these polypeptides, or a combination of these polypeptides. In another respect, this disclosure provides a polynucleotide having a nucleotide sequence as stated in SEQ ID No. 1, 3, 5, or 7, or a variant thereof. In yet another respect, this disclosure provides a polynucleotide having at least 70%, at least 75%, at least 80%, at least 85%, but at least 90%, at least 95%, at least 95%, 96%, 97%, 98%, or 99% sequence identity with one of a polynucleotide having a sequence shown in SEQ ID No.: 1, 3, 5 or 7, or a variant thereof. The polynucleotides of the disclosure may comprise additional sequences, such as additional sequences encoded within the same transcription unit, controlling elements such as promoters, ribosome binding sites, enhancers, 5'UTRs, 3'UTRs, transcription terminators, polyadenylation sites, additional transcription units under the control of the same promoter or different promoters, sequences enabling cloning, expression, homologous recombination, and transformation of a host cell, or any such constructs as may be desirable to provide the means of realizing this disclosure. The elements for the expression of an FMDV polypeptide, antigen, epitope, or immunogen are advantageously present in a release vector. At a minimum, this comprises essentially a start codon (ATG), a stop codon, and a promoter, and optionally also a polyadenylation sequence for certain vectors such as plasmids and certain viral vectors, for example, viral vectors other than smallpox viruses. When the polynucleotide encodes a polyprotein fragment, for example, an FMDV peptide, advantageously in the vector, an ATG is located at the 5' position of the reading frame and a stop codon is located at the 3' position. Other elements for controlling expression may be present, such as enhancer sequences, stabilizing sequences, such as intron sequences, and signal sequences that allow for protein secretion. ! This disclosure also relates to preparations comprising vectors, such as expression vectors, for example, therapeutic compositions. The preparations may comprise one or more vectors, for example, expression vectors, such as in vivo expression vectors, comprising and expressing one or more FMDV polypeptides, antigens, epitopes, or immunogens. In one embodiment, the vector contains and expresses a polynucleotide comprising, essentially consisting of, or consisting of a polynucleotide encoding (and advantageously expressing) an FMDV antigen, epitope, or immunogen, in a pharmaceutically or veterinarily acceptable carrier, excipient, or vehicle.Thus, according to one form of disclosure, the other vector or vectors in the preparation comprise, essentially consist of, or consist of a polynucleotide encoding, and under appropriate circumstances the vector expresses one or more different proteins from a polypeptide, antigen, epitope, or immunogen of FMDV, or a fragment thereof. According to another embodiment, the vector or vectors in the preparation comprise, or essentially consist of, a polynucleotide or polynucleotides encoding one or more proteins or fragments thereof of a polypeptide, antigen, epitope, or immunogen of FMDV, and the vector or vectors expressing the polynucleotide or polynucleotides. In another embodiment, the preparation comprises one, two, or more vectors comprising polynucleotides that advantageously encode and express in vivo a polypeptide, antigen, fusion protein, or epitope of FMDV. The disclosure also applies to mixtures of vectors comprising polynucleotides encoding and They express different FMDV polypeptides, antigens, epitopes, or immunogens, for example, an FMDV polypeptide, antigen, epitope, or immunogen from different animal species such as, but not limited to, sheep, cattle, goats, or pigs. According to yet another embodiment of the disclosure, the expression vector is a plasmid vector or a DNA plasmid vector, particularly an in vivo expression vector. In one specific, non-limiting example, the pVR1020 or 1012 plasmid (VICAL Inc.; Luke et al., 1997; Hartikka et al., 1996, Hum Gene Ther, 7(10): 1205-17; see, for example, U.S. Patent Nos. 5,846,946 and 6,451,769) can be used as a vector for the insertion of a polynucleotide sequence. The pVR1020 plasmid is derived from pVR1012 and contains the human tPA signal sequence. In one embodiment, the human tPA signal sequence comprises amino acid M(1) to amino acid S(23) in Genbank under accession number HUMTPA14.In another specific non-limiting example, the plasmid used as a vector for the insertion of a polynucleotide sequence may contain the equine IGF1 peptide sequence signal, from amino acid M(24) to amino acid A(48), in Genbank under accession number U28070. Additional information on DNA plasmids that may be consulted or used in practice can be found, for example, in U.S. Patent Nos. 6,852,705; 6,818,628; 6,586,412; 6,576,243; 6,558,674; 6,464,984; 6,451,770; 6,376,473 and 6,221,362. The term plasmid encompasses any DNA transcription unit comprising a polynucleotide according to the disclosure and the elements necessary for its in vivo expression in a cell or cells of the desired host or target; in this respect, it is noted that a superhelical or non-superhelical circular plasmid, as well as a linear form, is considered to be within the scope of disclosure.A plasmid may comprise, contain, or consist essentially of, in addition to the polynucleotide encoding an FMDV antigen, epitope, or immunogen, optionally fused to a peptide sequence, variant, analog, or heterologous fragment, operatively linked to, under the control of, or dependent on a promoter. In general, it is advantageous to employ a strong functional promoter in eukaryotic cells. The strong promoter may be, but is not limited to, the early cytomegalovirus intermediate (CMV-IE) promoter of human or murine origin, or optionally of another origin such as the rat or guinea pig super promoter (Ni, M. et al., Plant J. 7, 661-676, 1995*). The CMV-IE promoter may comprise the promoter portion itself, associated or not with the enhancer portion. Reference may be made to EP-A-260 148, EP-A-323 597, U.S. Patent Nos. 5,168,062, 5,385,839 and 4,968,615, as well as PCT Application No. W087 / 03905.In some embodiments, the CMV-IE promoter is a human CMV-IE (Boshart et al., 1985, Cali, 41(2): 521-30) or a murine CMV-IE. More generally, the promoter is of viral, plant, or cellular origin. A strong viral promoter other than CMV-IE that can be usefully employed in outreach is the early / late promoter of the SV40 virus or the LTR promoter of the Rous sarcoma virus. A strong cellular promoter that can be usefully employed in outreach is the promoter of a cytoskeleton gene, such as, for example, the Λ·· desmin promoter (Kwissa et al., 2000, Vaccine, 18(22): 2337-44), or actin promoter (Miyazaki et al., 1989, Gene, 79(2): 269-77). Plasmids may comprise other expression control elements. It is particularly advantageous to incorporate stabilizing sequence(s), for example, an intron sequence(s), such as the maize alcohol dehydrogenase intron (Callis et al., Genes & Dev. 1(10):1183-1200, Dec. 1987), the first intron of hCMV-IE (PCT Application No. WO1989 / 01036), or intron II of the rabbit β-globin gene (van Ooyen et al., 1979, Science, 206(4416): 337-44). In another embodiment, plasmids may comprise a 3' UTR. The 3' UTR may be, but not definitively, the 3' UTR of the Agrobacterium nopaline synthase (Nos) (Nopaline synthase: transcript mapping and DNA sequence. Depicker, A. et al. J. Mol. Appl. Genet., 1982; Bevart, NAR, 1984, 12(22): 8711-8721). As the polyadenylation (polyA) signal for plasmids and viral vectors other than smallpox viruses, one may use the poly(A) signal of the bovine growth hormone (bGH) gene (see U.S. 5,122,458), or the poly(A) signal of the rabbit β-globin gene, or the poly(A) signal of the SV40 virus. A “host cell” denotes a prokaryotic or eukaryotic cell that has been genetically altered, or that can be genetically altered by the administration of an exogenous polynucleotide, such as a plasmid or recombinant vector. When referring to genetically altered cells, the term encompasses both the originally altered cell and its progeny. In one embodiment, the recombinant FMDV antigen is expressed in insect cells. Methods of use In one embodiment, the subject matter disclosed herein relates to a method for vaccinating a sheep, bovine, caprine, or porcine animal comprising administering to the sheep, bovine, caprine, or porcine animal an effective quantity of a vaccine that may comprise a recombinant viral vector expressing an FMDV antigen, and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle. In one embodiment of the present disclosure, the method comprises single administration of a vaccine composition formulated with an emulsion according to the disclosure. For example, in one embodiment, the vaccine or immunocomposition comprises a recombinant viral vector expressing an FMDV antigen. In another embodiment of this disclosure, the method comprises single administration of two heterologous vaccine compositions. The heterologous vaccines or compositions may be different types of vaccines, such as FMDV VLP vaccines or FMDV viral vector vaccines. The heterologous vaccines may also be of the same vaccine type, expressing the capsid of different FMDV serotypes, such as strains A24, A12, O1 Manisa, Asia, or Iraq. In one embodiment, the subject matter disclosed herein relates to a method for vaccinating a sheep, cattle, goat, or pig comprising administering to the sheep, cattle, goat, or pig a vaccine comprising a recombinant viral vector expressing an FMDV antigen in vivo. In one embodiment, the subject matter disclosed herein relates to a method for producing an immune response comprising administering to sheep, cattle, goats, or swine a vaccine comprising a recombinant viral vector expressing an FMDV antigen in vivo. Both homologous and heterologous strains of FMDV are used to evaluate vaccine efficacy. Administration can be subcutaneous or intramuscular. Needle-free administration is also an option (e.g., Pigjet or Bioject). In one form of dissemination, a sensitization-booster regimen may be employed, comprising at least one primary administration and at least one booster administration using at least one common polypeptide, antigen, epitope, or immunogen. The immunological composition or vaccine used in the primary administration is of a different nature than that used as a booster. However, it is noted that the same composition may be used for both the primary and booster administrations. This administration protocol is called “sensitization-booster.” A sensitization-boost in accordance with this disclosure may include a recombinant viral vector used to express a sequence encoding FMDV or fragments thereof encoding an antigenic polypeptide or a fragment or variant thereof. Specifically, the viral vector may express an FMDV gene or a Γ fragment of it that encodes an antigenic polypeptide. The viral vector contemplated herein includes, but is not limited to, poxvirus [e.g., vaccinia virus or an attenuated vaccinia virus, fowlpox virus or attenuated fowlpox virus (e.g., canary pox, fowlpox, pigeonpox, squab pox, quailpox, ALVAC, TROVAC; see, e.g., U.S. Patents 5,505,941 and 5,494,807), raccoon pox virus, swinepox virus, etc.], adenovirus (e.g., human adenovirus, canine adenovirus), herpesvirus (e.g., canine herpesvirus, turkey herpesvirus, Marek's disease virus, infectious laryngotracheitis virus, feline herpesvirus, etc.) laryngotracheitis (ILTV), bovine herpesvirus, porcine herpesvirus), baculovirus, retrovirus, etc.In another embodiment, the fowlpox expression vector can be a canarypox vector, such as ALVAC. In yet another embodiment, the fowlpox expression vector can be a fowlpox vector, such as TROVAC. The disclosure FMDV antigen to be expressed is inserted under the control of a specific smallpox virus promoter, e.g., the 42K promoter of entomopox virus Amsacta moorei (Barcena, Lorenzo et al., 2000, J Gen Virol., 81(4): 1073-85), the 7.5 kDa vaccinia promoter (Cochran et al., 1985, J Virol, 54(1): 30-7), the I3L promoter of vaccinia (Riviere et al., 1992, J Virol, 66(6): 3424-34), the HA promoter of vaccinia (Shida, 1986, Virology, 150(2): 451-62), the ATI promoter of cowpox (Funahashi et al., 1988, J Gen Virol, 69(1): 35-47), the H6 promoter of vaccinia (Taylor et al., 1988, Vaccine, 6(6): 504-8; Guo et al., 1989, J Virol, 63(10): 4189-98; Perkus et al., 1989, J Virol, 63(9): 3829-36.), among others. In another embodiment, the fowlpox expression vector may be a canarypox vector, such as ALVAC. The FMDV antigen, epitope, or immunogen may be P1 of FMDV-3C. The FMDV viral vector may be a canarypox virus such as vCP2186, VCP2181, or VCP2176, or a fowlpox virus such as VFP2215 (see U.S. Patent 7,527,960). In yet another embodiment, the FMDV antigen, epitope, or immunogen may be produced in duckweed (U.S. Published Patent Application 2011 / 0236416). In another aspect of the disclosure sensitization and booster protocol, a composition comprising the disclosure FMDV antigen is administered followed by the administration of a vaccine or composition comprising a subunit vaccine comprising FMDV VLPs expressed by baculovirus in insect cells (see USSN14 / 863.181), or an inactivated viral vaccine or composition comprising the FMDV antigen; or a plasmid DNA vaccine or composition containing or expressing the FMDV antigen.Similarly, a sensitization and booster protocol may comprise the administration of a vaccine or composition comprising a subunit vaccine comprising FMDV VLPs expressed by baculovirus in insect cells, or an inactivated viral vaccine or composition comprising an FMDV antigen, or a plasmid DNA vaccine or composition containing or expressing an FMDV antigen, followed by the administration of a composition comprising the FMDV antigen as disclosed. It is also noteworthy that both primary and secondary administrations are included. may include the composition comprising the FMDV antigen of the ''«i .U'i. divulgation. A sensitization-booster protocol comprises at least one sensitization-booster and at least one booster administration using at least one polypeptide and / or common variants or fragments thereof. The vaccine used in the booster administration may be of a different nature than that used as a final booster vaccine. The booster administration may comprise one or more administrations. The dose volume of compositions for target species that are mammals, for example, the dose volume of compositions for sheep, cattle, goats, or swine, based on viral vectors, for example, compositions based on a viral vector of the smallpox virus, is generally between approximately 0.1 and approximately 5.0 ml, between approximately 0.1 and approximately 3.0 ml, and between approximately 0.5 ml and approximately 2.5 ml. The effectiveness of vaccines can be tested approximately 2 to 4 weeks after the last immunization by exposing animals, such as '.i. such as sheep, cattle, goats or pigs, with a virulent strain of FMDV, such as the Manisa 01, BFS 01 or Campos, A24 / Cruzeiro, Asia 1 / Shamir, A / Iran'96, A22 / Iraq, SAT2 / Saud / Arabia strains of FMDV. Other strains may also include strains A10-61, A5, A12, A24 / Cruzeiro, C3 / lndaial, 01, C1-Santa Pau, C1-C5, A22 / 550 / Azerbaijan / 65, SAT1-SAT3, A, A / TNC / 71 / 94, A / IND / 2 / 68, A / IND / 3 / 77, A / IND / 5 / 68, A / IND / 7 / 82, A / IND / 16 / 82, A / IND / 22 / 82, A / IND / 73 / 79, A / APS / 44 / 05, A / IND / 17 / 77, A / IND / 25 / 81, A / IND / 85 / 79, A / APS / 50 / 05, A / IND / 17 / 82, A / IND / 26 / 82, A / IND / 86 / 79, A / APS / 55 / 05, A / IND / 19 / 76, A / IND / 54 / 79, A / APA / 25 / 84, A / APS / 66 / 05, A / IND / 20 / 82, A / IND / 57 / 79, A / APN / 41 / 84, A / APS / 68 / 05, A / BIM / 46 / 95, A / GUM / 33 / 84, A / ORS / 66 / 84, A / ORS / 75 / 88, A / TNAn / 60 / 947 / Asia / 1, A / IRN / 05, Asia / IRN / 05, O / HK / 2001, O / UKG / 3952 / 2001, O / UKG / 4141 / 2001, Asia 1 / HNK / CHA / 05 (accession number of GenBank EF149010, incorporated in the present as a reference), Asia l / XJ (Li, ZhiYong y col. 0 / UKG / 4014 / 2001, O / UKG / 4998 / 2001, O / ÜKG / 9443 / 2001, 0 / UKG / 5470 / 2001, O / UKG / 5681 / 2001, O / ES / 2001, HKN / 2002, O5lndia, O / BKF / 2 / 92, K / 37 / 84 / A, KEN / 1 / 76 / A, GAM / 51 / 98 / A, A10 / Holahda, O / KEN / 1 / 91, O / IND49 / 97, O / IND65 / 98, O / IND64 / 98, O / IND48 / 98, O / IND47 / 98, O / IND82 / 97, O / IND81 / 99, O / IND81 / 98, O / IND79 / 97, O / IND78 / 97,: O / IND75 / 97, O / IND74 / 97, O / IND70 / 97, O / IND66 / 98, O / IND63 / 97, O / IND61 / 97, O / IND57 / 98, O / IND56 / 98, O / IND55 / 98, O / IND54 / 98, O / IND469 / 98, O / IND465 / 97, O / IND464 / 97, O / IND424 / 97, O / IND423 / 97, O / IND420 / 97, O / IND414 / 97, O / IND411 / 97, O / IND410 / 97, O / IND409 / 97, O / IND407 / 97, ​​O / IND399 / 97, O / IND39 / 97, O / IND391 / 97, O / IND38 / 97, O / IND384 / 97, O / IND380 / 97, O / IND37 / 97, ​​O / IND352 / 97, O / IND33 / 97, O / IND31 / 97, O / IND296 / 97, O / IND23 / 99, O / IND463 / 97, O / IND461 / 97, O / IND427 / 98, O / IND28 / 97, O / IND287 / 99, O / IND285 / 99, O / IND282 / 99, O / IND281 / 97, O / IND27 / 97, ​​O / IND278 / 97, O / IND256 / 99, O / IND249 / 99, O / IND210 / 99, O / IND208 / 99, O / IND207 / 99, O / IND205 / 99, O / IND185 / 99, O / IND175 / 99, O / IND170 / 97, • O / IND164 / 99, O / IND160 / 99, O / IND153 / 99, O / IND148 / 99, O / IND146 / 99' 0 / SKR / 2000, A22 / lndia / 17 / 77 del FMDV. Further details of these FMDV strains can be found on the European Bioinformatics Information (EMBL-EBI) website, and all associated nucleotide sequences are incorporated herein for reference. The inventors envisioned that all FMDV strains, both those listed herein and those yet to be identified, could be expressed according to the teachings of this description to produce, for example, effective vaccine compositions. Both homologous and heterologous strains are used in the challenge to test vaccine efficacy. Animals may be exposed via intradermal, subcutaneous, spray, intranasal, intraocular, intratracheal, and / or oral routes. The sensitization-booster administrations can be advantageously carried out 1 to 6 weeks apart, for example, approximately 3 weeks apart. Depending on one implementation, a semi-annual or annual booster is also available, which advantageously utilizes a viral vector-based vaccine. Animals are advantageously at least 6 to 8 weeks old, or approximately 6 months old, at the time of the first administration. The compositions comprising the recombinant antigenic polypeptides used in the sensitization-boost protocols are contained in a pharmaceutically or veterinarily acceptable vehicle, diluent, adjuvant, or excipient. The protocols protect animals against FMDV in sheep, cattle, goats or pigs and / or prevent the progression of the disease in an infected animal. Anyone experienced in the technique will understand that the description herein is provided as an example and this disclosure is not limited to it. Based on the description herein and their knowledge of the technique, a skilled technician can determine the number of administrations, the route of administration, and the dosages to be used for each injection protocol without excessive experimentation. This disclosure covers at least one administration to an animal of an effective quantity of the therapeutic composition as described herein. The animal may be male, female, pregnant female, or newborn. This administration may be by various routes, including, but not limited to, intramuscular (IM), intradermal (ID), or subcutaneous (SC) injection, or by nasal or oral administration. The therapeutic composition as described herein may also be administered by a needleless device (such as, for example, a Pigjet, Dermojet, Biojector, Avijet (Merial, GA, USA), a Vetjet, or a Vitajet (Bioject, Oregon, USA)). Other procedures for administering plasmid compositions include using electroporation (see, for example, Tollefsen et al., 2002; Tollefsen et al., 2003; Babiuk et al., 2002; PCT application No. WO99 / 01158).In another embodiment, the therapeutic composition is administered to the animal by gene gun or gold particle bombardment. In one form of embodiment, the disclosure provides for the administration of a therapeutically effective amount of a formulation for delivery and the expression of an FMDV antigen or epitope in a target cell. Determining the therapeutically effective amount is routine for someone with ordinary experience in the technique. In one embodiment, the formulation comprises an expression vector comprising a polynucleotide expressing an FMDV antigen or epitope and a pharmaceutically or veterinarily acceptable carrier, vehicle, or excipient. In another embodiment, the carrier, vehicle, or pharmaceutically or veterinarily acceptable excipient facilitates transfection or other means of transferring the polynucleotides to a host animal and / or improves the preservation of the vector or protein in a host. In one embodiment, the object described herein provides a detection method for differentiating between infected and vaccinated animals (DIVA). This disclosure describes how the use of the vaccine or composition herein enables the detection of FMDV infection in an animal. It also describes how the use of the vaccine or composition herein enables the detection of infection in animals by differentiating between infected and vaccinated animals (DIVA). Methods for diagnosing FMDV infection in an animal using a non-structural protein of FMDV (e.g., an FMDV 3ABC or 3D-specific ELISA) are described herein. Manufacturing Article In one embodiment, the object described herein is directed to a set of elements for executing a method for generating or inducing an immune response, which may comprise any of the FMDV recombinant immunological compositions or vaccines, FMDV immunological compositions or vaccines, FMDV recombinant viral compositions or vaccines, and instructions for performing the method. Another embodiment of the disclosure is a set of elements for carrying out a method to induce an immune or protective response against FMDV in an animal, comprising a composition or vaccine comprising an FMDV antigen of the disclosure and a recombinant FMDV viral immunological composition or vaccine, and instructions for carrying out the method of administration in an amount effective to generate an immune response in the animal. Another form of implementation of the disclosure is a set of elements for carrying out a method to induce an immune or protective response against FMDV in an animal comprising a composition or vaccine comprising an FMDV antigen of the disclosure and an inactivated FMDV immunocomposition or vaccine, and instructions for carrying out the method of administration in an amount effective to generate an immune response in the animal. Yet another aspect of this disclosure relates to a sensitization-booster vaccination kit as described herein. The kit may comprise at least two vials: a first vial containing a vaccine or composition for sensitization vaccination as described herein, and a second vial containing a vaccine or composition for booster vaccination as described herein. The kit may contain either a first or a second vial. additional for additional sensitization vaccinations or additional booster vaccinations. In one embodiment, a composition comprising an FMDV antigen, or a fragment or variant thereof, and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle is described. In another embodiment, a composition comprising a recombinant viral vector expressing FMDV antigens and a pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle is described. In another embodiment, the composition described above is described in which the FMDV antigen, or a fragment or variant thereof, comprises an immunogenic fragment comprising at least 15 amino acids from an ovine, bovine, caprine, or porcine FMDV antigen. In one embodiment, the above compositions are described in which the FMDV antigen, or a fragment or variant thereof, is partially purified.'In one embodiment, the above compositions are described in which the FMDV antigen or fragment or variant thereof is substantially purified. In one embodiment, the above compositions are disclosed, wherein the FMDV antigen or a fragment or variant thereof is an FMDV polypeptide from sheep, cattle, goats, or pigs. In one embodiment, the above compositions are disclosed wherein the FMDV polypeptide is polypeptide P1, polypeptide VPO, polypeptide VP1, polypeptide VP3, polypeptide VP2, polypeptide VP4, polypeptide 2A, polypeptide 2B, polypeptide 2C, polypeptide 3A, polypeptide 3B, polypeptide 3C, or polypeptide 3D. In one embodiment, the above compositions are disclosed in wherein the FMDV antigen or a fragment or variant thereof has at least 80% sequence identity with the sequence specified in SEQ ID No. 2, 4, 6, or 8. In one embodiment, the above compositions are disclosed wherein the FMDV antigen is encoded by a polynucleotide having at least 70% sequence identity with the sequence specified in SEQ ID No. 1, 3, 5, or 7. In another embodiment, the above compositions are disclosed wherein the pharmaceutically or veterinarily acceptable carrier, excipient, adjuvant, or vehicle is a water-in-oil emulsion or an oil-in-water emulsion. In another embodiment, a method for vaccinating an FMDV-susceptible ovine, bovine, caprine, or porcine animal is disclosed, comprising administering the above compositions to the animal.In one embodiment, a method for vaccinating an animal susceptible to FMDV (sheep, cattle, goats, or swine) is disclosed, comprising a sensitization and booster regimen. In one embodiment, a substantially purified antigenic polypeptide expressed in insect cells is disclosed, wherein the polypeptide comprises an amino acid sequence having at least 80% sequence identity with a polypeptide having the sequence specified in SEQ ID NO: 2, 4, 6, or 8. In any embodiment, the animal is preferably a sheep, cattle, swine, or goat. In one embodiment, a method for diagnosing FMDV infection in an animal is disclosed. In another embodiment, a sensitization and booster vaccination kit comprising at least two vials is disclosed, wherein a first vial contains the composition comprising an FMDV antigen. or fragment or variant thereof, and a second vial contains a recombinant viral vector that contains or expresses the FMDV antigen. Pharmaceutically or veterinarily acceptable carriers, vehicles, adjuvants, or excipients are well known to a person skilled in the art. For example, a pharmaceutically or veterinarily acceptable carrier, vehicle, or excipient may comprise a 0.9% NaCl solution (e.g., saline) or a phosphate buffer solution. Other pharmaceutically or veterinarily acceptable carriers, vehicles, or excipients that may be used for the methods of this disclosure include, but are not limited to, poly(L-glutamate) or polyvinylpyrrolidone. The carrier, vehicle, adjuvant, or excipient may be any compound or combination of compounds that facilitates the delivery of the vector (or protein expressed from a vector of the in vitro disclosure). Advantageously, the carrier, vehicle, or excipient may facilitate transfection and / or improve the preservation of the vector (or protein).Doses and dosage volumes are described in this document in the general description and can also be determined by the person skilled in the art from this description in relation to knowledge of the technique, without excessive experimentation. Cationic lipids containing a quaternary ammonium salt that are advantageously, but not exclusively, suitable for plasmids are advantageously those that have the following formula: CH3 I+ F^—o — ch2— ch-ch2— n— r2—X II OR! CH3• in which R1 is a saturated or unsaturated linear chain aliphatic radical having 12 to 18 carbon atoms, R2 is another aliphatic radical containing 2 or 3 carbon atoms, and X is an amine or hydroxyl group, for example, DMRIE. In another embodiment, the cationic lipid can be associated with a neutral lipid, for example, DOPE. Among these cationic lipids, preference is given to DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanamonium; WO96 / 34109), advantageously associated with a neutral unilipid, DOPE (dioleoylamine phosphatidylethanol; Behr, 1994), to form DMRIE-DOPE. Advantageously, the plasmid-adjuvant mixture is formed extemporaneously and contemporaneously with or shortly before administration of the preparation; for example, shortly before or prior to administration, the plasmid-adjuvant mixture is formed, advantageously to allow sufficient time before administration of the mixture to form a complex, for example, between approximately 10 and approximately 60 minutes before administration, such as approximately 30 minutes before administration. When DOPE is present, the DMRIE:DOPE molar ratio is between approximately 95:approximately 5, and approximately 5: approximately 95, more advantageously than approximately 1: approximately 1, for example, 1:1. The weight ratio of DMRIE or DMRIE-DOPE adjuvant to plasmid can be between approximately 50:approximately 1 and approximately 1 .approximately 10, such as between approximately 10:approximately 1 and approximately ^approximately 5, and between approximately 1 .approximately 1 and approximately 1 -.approximately 2, for example, 1:1 and 1: 2. In another embodiment, the carrier, excipient, adjuvant, or pharmaceutically or veterinarily acceptable vehicle may be a water-in-oil emulsion.Examples of suitable water-in-oil emulsions include water-in-oil vaccine emulsions that are stable and fluid at 4°C containing: between 6 and 50%v / v of an aqueous phase containing antigen, preferably between 12 and 25%v / v, and between 50 and 94%v / v of an oil phase containing in whole or in part; a non-metabolizable oil (e.g., mineral oil such as paraffin oil) and / or a metabolizable oil (e.g., vegetable oil, or fatty acid, polyol esters or alcohol), between 0.2 and 20% w / v of surfactants, preferably between 3 and 8% w / v, the latter being wholly or partly, or in a mixture, either of polyglycerol esters, such polyglycerol esters that are preferably polyglycerol (poly) ricinoleates, or polyoxyethylene castor oil or otherwise hydrogenated polyoxyethylene castor oils.Examples of surfactants that may be used in a water-in-oil emulsion include ethoxylated sorbitan esters (e.g., polyoxyethylene (20) sorbitan monooleate (TWEEN 80®), available from AppliChem, Inc., Geshire, CT) and sorbitan esters (e.g., sorbitan monooleate (SPAN 80®), available from Sigma Aldrich, St. Louis, MO). In addition, regarding a water-in-oil emulsion, see also U.S. Patent No. 6,919,084, e.g., Example 8 therein, which is incorporated herein by reference. In embodiments, the aqueous phase containing the antigen comprises a saline solution comprising one or more buffering agents. An example. A suitable buffer solution is phosphate-buffered saline. In one advantageous embodiment, the water-in-oil emulsion can be a triple water / oil / water (W / O / W) emulsion (U.S. Patent No. 6,358,500). Examples of other suitable emulsions are described in U.S. Patent No. 7,371,395. The immunological compositions and vaccines according to the disclosure may comprise or consist essentially of one or more adjuvants. Adjuvants suitable for use in the practice of this disclosure are (1) acrylic or methacrylic acid polymers, maleic anhydride, and alkenyl derivative polymers, (2) immunostimulatory sequences (ISS), such as oligodeoxyribonucleotide sequences having one or more unmethylated CpG units (Kliriman et al., 1996, PNAS USA, 93(7): 2879-83; WO98 / 16247), (3) an oil-in-water emulsion, such as the SPT emulsion described on page 147 of “Vaccine Design, The Subunit and Adjuvant Approach,” published by M.Powell, MbNewman, Plenum Press 1995, 6: 147, 183, and the MF59 emulsion described on page 183 of the same work, (4) cationic lipids containing a quaternary ammonium salt, for example, DDA, (5) cytokines, (6) aluminum hydroxide or aluminum phosphate, (7) saponin or (8) other adjuvants described in any document cited and incorporated by reference in this application, or (9) any combinations or mixtures thereof. The oil-in-water emulsion (3), which is especially suitable for viral vectors, can be based on: light liquid paraffin oil (type European Pharmacopoeia), isoprenoid oil such as squalane, squalene, oil resulting from the oligomerization of alkenes, for example isobutene or decene, esters of acids or alcohols having a linear chain alkyl group, such as vegetable oils^ ethyl oleate, propylene glycol, di(caprylate / caprate), triglycerol(caprylate / caprate) and propylene glycol dioleate, or of branched alcohols or fatty acids, especially esters of isostearic acid. The oil is used in combination with emulsifiers to form an emulsion. The emulsifiers can be non-ionic surfactants, such as: esters on one side sorbitan, mannidine (e.g., anhydromannitol oleate), glycerol, polyglycerol, or propylene glycol, and on the other side oleic, isostearic, ricinoleic, or hydroxystearic acids, the esters being optionally ethoxylated, or polyoxypropylene-polyoxyethylene copolymer blocks, such as Pluronic, e.g., L121. Among polymer adjuvants of type (1), preference is given to crosslinked acrylic or methacrylic acid polymers, especially those crosslinked with polyalkenyl ethers of sugars or polyalcohols. These compounds are known as carbomers (Pharmeuropa, vol. 8, no. 2, June 1996). A person skilled in the art may also refer to U.S. Patent No. 2,909,462, which provides such acrylic polymers crosslinked with a polyhydroxy compound having at least three hydroxyl groups, preferably no more than eight such groups, the hydrogen atoms of at least three hydroxyl groups being substituted by unsaturated aliphatic radicals having at least two carbon atoms. The preferred radicals are those containing from 2 to 4 atoms. of carbon, for example vinyls, allyls, and other ethogenically unsaturated groups. Unsaturated radicals may also contain other substituents, such as methyl. Products sold under the name CARBOPOL® (BF Goodrich, Ohio, USA) are especially suitable. They are crosslinked with allyl sucrose or allyl pentaerythritol. Among them, CARBOPOL® 1 974P, 934P, and 971P are referenced. Regarding maleic anhydride-alkenyl copolymers, preference is given to EMA® (Monsanto), which are linear-chain or crosslinked maleic anhydride-ethylene copolymers and are, for example, crosslinked by divinyl ether. With regard to structure, acrylic or methacrylic acid polymers and EMA® are preferably formed from basic units that have the following formula: 17 Ri R2 COOH COOH where: ' - R1 and R2, which can be the same or different, represent H or CH3 - X = 0 or 1, preferably x = 1 - Y = 1 or 2, with x + y = 2. ? For EMA®, x = 0 and y = 2 and for carbomers x = y = 1. These polymers are soluble in water or physiological saline solution (20 g / l of NaCl) and the pH can be adjusted from 7.3 to 7.4, for example, with sodium hydroxide. Sodium hydroxide (NaOH) is used to provide the adjuvant solution into which the expression vector(s) can be incorporated. The polymer concentration in the final immunological or vaccine composition can vary between approximately 0.01 and approximately 1.5% w / v, between approximately 0.05 and approximately 1% w / v, and between approximately 0.1 and approximately 0.4% w / v. The cytokine or cytokines (5) may be in the form of proteins in the immunological or vaccine composition, or they may be co-expressed in the host with the immunogen or immunogens or their epitope(s). Co-expression of the cytokine or cytokines is preferred, either by the same vector that expresses the immunogen or immunogens or their epitope(s), or by a separate vector. The disclosure includes the preparation of such combined compositions; for example, by mixing the active components advantageously with each other and with an adjuvant, carrier, cytokines, and / or diluent. Cytokines that may be used in the present disclosure include, but are not limited to, granulocyte colony-stimulating factor (G-CSF), granulocyte / macrophage colony-stimulating factor (GM-CSF), interferon a (IFN a), interferon β (ΙΡΝβ), interferon γ, (IFN γ), interleukin-1a (IL-1a), interleukin-1 β (IL-Ιβ), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8:(IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-11 (IL-11), Interleukin-12 (IL-12), tumor necrosis factor alpha (TNFα), tumor necrosis factor β (TNF), polyinosinic and polycytidylic acid, cytidine-phosphate-guanosine oligodeoxynucleotides (CpG ODN), and transforming growth factor β (TGFβ). It is understood that the cytokines may be co-administered and / or administered sequentially with the immunological composition or vaccine described in this disclosure.Thus, for example, the vaccine in this disclosure may also contain an exogenous nucleic acid molecule that expresses in vivo a suitable cytokine, for example, a cytokine adapted to the host to be vaccinated or in which an immune response can be provoked (for example, a bovine cytokine for preparations to be administered to cattle). In one particular embodiment, the adjuvant may include emulsions TS6, TS7, TS8, and TS9 (U.S. Patent No. 7,371,395); LR3 and LR4 (US7,691,368); TSAP (U.S. Published Patent Application 20110129494); TRIGEN™ (Newport Labs); synthetic RNAdh (e.g., polyIC, poly-ICLC [HILTONOL®]); CARBIGEN™ adjuvant (MVP Laboratories, Inc.); ENABL® adjuvant (VaxLiant); and MONTANIDE™ adjuvants (W / O, W / O / W, O / W, IMS, and Gel) (SEPPIC). The concentration of adjuvant in the final composition of the immunological vaccine may be in the range between 5% and 80% v / v. In the case of an immunological composition and / or vaccine based on polypeptides expressed in baculovirus / insect cells, a dose may include between approximately 1 pg and approximately 2000 pg, between approximately 50 pg and approximately 1000 pg, and between approximately 100 pg and approximately 500 pg of FMDV antigen, epitope, or immunogen. The dose may include between approximately 10² and approximately 10²⁰, between approximately 10³ and approximately 10¹⁸, between approximately 10⁴ and approximately 10¹⁶, between approximately 10⁵ and approximately 10¹² VLPs (viral-like particles). In the case of an immunological composition and / or vaccine based on a viral vector expressing FMDV antigens, a dose may include between approximately 10³ viral particles and approximately 10¹⁵ viral particles, between approximately 10³ viral particles and approximately 10¹⁴ viral particles, between approximately 10³ viral particles and approximately 10¹³ viral particles, and between approximately 10³ viral particles and approximately 10¹² viral particles. Viral particles can be calculated based on any virus titration method including, but not limited to, FFA (Focus Formation Assay) or FFU (Focus Formation Unit), TCID50 (50% Infective Cell Culture Dose), PFU (Plaque Forming Units), and FAID50 (50% Infective Fluorescent Antibody Dose).The dose volumes can be between approximately 0.1 and approximately 10 ml, or between approximately 0.2 and approximately 5 ml. The disclosure will now be described in more detail through the following non-limiting examples. EXAMPLES The construction of recombinant DNA inserts, plasmids, and viral vectors was carried out using standard molecular biology techniques described in J; Sambrook et al. (Molecular Cloning: A Laboratory Manual, 4th edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 2014). Example 1 Construction of FMDV antigens vectored by recombinant human adenovirus 5 Example 1.2 Construction of a chimeric FMDV A24-A12 antigen vectored by recombinant human adenovirus 5 The Human Adenovirus C, serotype 5 (Ad5) vector (adenoviral vector) with deletions in the E1, E3, and E4 regions of the genome (GV11 skeletal, see U.S. Patent 8,323,663) was used to construct the recombinant FMDV vaccine expressing the chimeric FMDV protein. The chimeric FMDV protein contains the capsid structural gene of FMDV serotype A24 (A24 Pl) and the non-structural genes A24 (2A-partial 2B), partial non-structural gene 3B, and protease gene of FMDV serotype A12 (partial 3B-C3) (SEQ ID NO:2). The chimeric polynucleotide encoding FMDV A24 (P1-2A-partial 2B)-A12 (partial 3B-3C) was introduced into the shuttle plasmid (see Figures 2 and 3). After cotransformation of the linearized backbone of the GV11 plasmid (carrying a kanamycin resistance gene) and the linearized shuttle plasmid containing the FMDV chimeric polynucleotide in E. coli BJDE3 cells, kanamycin-resistant E. coli clones were selected. Clones were confirmed with recombinant plasmids by RFLP. An individual clone was selected, the plasmid was lineatized, and it was transfected into M2A cells. The lysate from the M2A cell transfection was serially diluted to produce a high-titer stock solution of recombinant adenovirus-vectored chimeric FMDV vaccine. The donor gene insertion site is between the CMV promoter and the SV40 PolyA of an Ad5 E1 expression cassette, and the expression cassette is inserted into the BBA site of the El region. The A24-A12 expression cassette, located at the deletion junction of the E1 region, produces the right-to-left readout. Left with respect to the transcription of the viral genome's RNA. There are no regulatory signals in the nucleotide sequence flanking the insertion cassette. The CMV enhancer / promoter controls the initiation of transcription. Within this sequence are the viral CAAT box enhancer, the TATA box, the transcription start site, and the 5'-side sequences of the splice site. The CMV sequences are followed by an artificial untranslated region (UTR) containing a splice donor sequence. The open reading frame of the gene to be expressed is located after the 3' side sequences of the splice site, and the early polyadenylation signal from Simian Virus 40 (SV40) is positioned on the 3' side of the open reading frame to terminate transcription. Primer pairs were designed for the RBA Genetic Structural Identity (GSI) assay. The GSI assay uses PCR to identify the biological agent backbone and expression cassette. GSI transfer (see Figure 4) showed the correct backbone and expression cassette of FMDV A24-A12. Sequence analysis of the A24-A12 expression cassette also confirmed nucleotide sequence identity between the shuttle plasmid and the DNA extracted from the recombinant adenovirus-vectored chimeric FMDV A24-A12 vaccine. The recombinant adenovirus-vectored chimeric FMDV A24-A12 vaccine was confirmed to express the A24 protein in vitro in 293 cells by a Western blot assay, showing a reactive protein that migrated to the approximate 28 kDa position (see Figure 5). The antibody used for detection in the Western blot assay was a monoclonal antibody. The molecular weight of the A24 protein expressed from the recombinant adenovirus-vectored chimeric FMDV A24-A12 vaccine was indistinguishable from that observed after transfection of the positive control shuttle plasmid into 293 cells (see Figure 5). Example 1.2 Construction of an FMDV O1M antigen vectored with recombinant human adenovirus 5 The Human Adenovirus C, serotype 5 (Ad5) vector (adenoviral vector) with deletions in the El, E3, and E4 regions of the genome (GV11 skeletal, see U.S. Patent 8,323,663) was used to construct the recombinant FMDV vaccine expressing the FMDV protein. The FMDV protein contains the structural capsid Pl (VP4-VP2-VP3-VP1) and the non-structural proteins 2ABC and 3ABC, including the full-length protease 3C (SEQ ID NO: 4) from FMDV strain O1 / Man / 87. The synthetic polynucleotide (SEQ ID NO: 3) encoding FMDV 01M Pl (VP4-VP2-VP3-VP1-2ABC'3A'BC) was introduced into the shuttle plasmid (see Figure 6). The recombinant adenoviral vectored 01M FMDV vaccine was constructed following <el procedimiento como se describe en el Ejemplo 1.2. The O1M87 FMDV^ expression cassette, located at the E1 region's delete junction, produces a right-to-left reading with respect to the transcription of the viral genome's RNA. There are no known regulatory signals in the nucleotide sequence flanking the insertion cassette. The CMV enhancer / promoter controls the initiation of transcription. Within this sequence are the CAAT viral box enhancer and the box TATA, the transcription start site, and the 5' side sequences of the cut and splice site. The CMV sequences are followed by an artificial untranslated region (UTR) containing a splice donor sequence. The open reading frame of the gene to be expressed is located after the 3'-side sequences of the splice site, and the early polyadenylation signal from Simian Virus 40 (SV40) is positioned on the 3' side of the open reading frame to terminate transcription. GSI transfer showed the correct backbone and expression cassette of FMDV O1M87. Sequence analysis of the FMDV O1M87 expression cassette also confirmed the nucleotide sequence identity between the shuttle plasmid and the DNA extracted from the recombinant adenoviral vectored FMDV O1M87 vaccine. The recombinant adenoviral vectored FMDV O1M87 vaccine was confirmed to express the O1M87 protein in vitro in 293 cells by Western blot assay. Example 1.3 Construction of an FMDV IFN antigen vectored with recombinant human adenovirus 54 The Human Adenovirus C, serotype 5 (Ad5) vector (adenoviral vector) with deletions in the E1, E3, and E4 regions of the genome (GV11 skeletal, see U.S. Patent 8,323,663) was used to construct the recombinant FMDV vaccine expressing the FMDV protein. The sequence encoding P1 from the synthetic FMDV capsid and the nonstructural genes 2A, 2B, partial 2C (2C'), partial 3A (3A'), 3B, and the sequence encoding protease 3C from FMDV serotype A / lrn / 05 were introduced into a shuttle plasmid (see Figure 7). The FMDV Irm vaccine vectored with recombinant vector1 following the procedure as described in Example 1.2. The FMDV Irn expression cassette, located at the E1 region's deletion junction, produces a left-to-right reading of the viral genome's RNA transcription. There are no known regulatory signals in the nucleotide sequence flanking the insertion cassette. The CMV enhancer / promoter controls transcription initiation. Within this sequence are the CAAT box viral enhancer, the TATA box, the transcription start site, and the 5'-side sequences of the splice site. The CMV sequences are followed by an artificial untranslated region (UTR) containing a splicing donor sequence. The open reading frame of the gene to be expressed is located after the 3'-side sequences of the splicing site, and the early polyadenylation signal from Simian Virus 40 (SV40) is positioned on the 3' side of the open reading frame to terminate transcription. The recombinant vectored FMDV Irm vaccine was identified using a PCR-based Genetic Structural Identity (GSI) assay and confirmed by protein expression using the Western blot technique. Example 1.4 Construction of an Asia antigen from FMDV vectored with recombinant human adenovirus 5 The Human Adenovirus C, serotype 5 (Ad5) vector (adenoviral vector) was used with deletions in the El, E3, and E4 regions of the genome (GV11 skeletal, see U.S. Patent 8,323,663) to construct the recombinant FMDV vaccine expressing the FMDV protein. The P1 coding sequence of the synthetic FMDV capsid and the nonstructural genes 2A, 2B, partial 2C (2C'), partial 3A (3A), 3B, and the 3C protease coding sequence of the FMDV Asia / Leb / 89 strain were introduced into a shuttle plasmid (see Figure 8). The recombinant adenoviral vectored Asia FMDV vaccine was constructed following the procedure described in Example 1.2. The FMDV Asia expression cassette, located at the E1 region's deletion junction, produces a left-to-right reading of the viral genome's RNA transcription. There are no known regulatory signals in the nucleotide sequence flanking the insertion cassette. The CMV enhancer / promoter controls transcription initiation. Within this sequence are the CAAT box viral enhancer, the TATA box, the transcription start site, and the 5'-side sequences of the splice site. The CMV sequences are followed by an artificial untranslated region (UTR) containing a splice donor sequence. The open reading frame of the gene to be expressed is located after the 3'-side sequences of the splice site, and the early polyadenylation signal from Simian Virus 40 (SV40) is positioned on the 3' side of the open reading frame to terminate transcription. The recombinant adenoviral vectored FMDV Asia vaccine was confirmed to express the Asia protein in vitro in 293 cells by a Western blot assay, showing a reactive protein of .60 which migrated to the approximate 38 kDa position. The antibody used for detection in the Western blot assay is the FMD anti-VP2 polyclonal antibody. The molecular weight of the expressed AsiaSS.2B protein was indistinguishable from that observed after transfection of the positive control plasmid into 293 cells. Example 2 Challenge study in cattle and pigs Cattle and pigs were vaccinated with FMDV A24-A12 vaccine or FMDV O1M87 vaccine once on Day 0 via IM and challenged on Day 14 with many FMDV serotypes, such as strains A24, A12, O1, Asia, Irn, and Iraq. Figure 9 shows the protection provided by the FMDV 01 vaccine in animals against FMDV challenge at three different doses and as a control. In this dose-titration study, the recombinant adenoviral vectored FMDV 01M vaccine was evaluated to verify its ability to confer protection against generalized FMD disease (leg lesions) following direct IDL homologous challenge 14 days post-vaccination (dpv). Healthy, 6-month-old female Holstein cattle were randomized to one of four treatment groups. Treatment-naïve control cattle (T01; n=4) were immunized intramuscularly with a single 2 mL dose of final formulation buffer (FFB).Cattle between T02 and T04 (n=7 / group) were vaccinated with decreasing doses [focus-forming units with anti-adenovirus hexon (FFU) or focus-forming assay (FFA); logw] of active ingredient prepared from mother passage 2 (MSV+2) viral inoculum formulated in ENABL™ C1 adjuvant. T02-T04 received 2.38x105; 5.94x104FFU or 1.49 x104FFU of dose. total, respectively. At 2 weeks post-vaccination (challenge day), 100% of vaccinated T02 and T03 cattle had serum virus neutralizing (SVN) titers against FMDV of Manisa, versus 43% in the group treated with the lower vaccine dose (T04). Following intradermal lingual challenge with 1 x 10⁴ infectious dose units in cattle at 50% (BID50) of FMDV 01 Manisa, 100% of the untreated T01 control cattle showed generalized disease (leg lesions). In contrast, the level of protection against generalized disease in the vaccinated groups ranged from 86% (T04) to 100% (T02 and T03). The four control cattle (T01) were positive for FMDV in plasma collected between 1 and 3 days after challenge (dpc), while none of the twenty-one vaccinated cattle had detectable plasma viremia between 1 and 5 dpc.In the T01 group, 88% of nasal samples collected between 2 and 5 days post-vaccine (dpc) were positive for the virus, compared to 25% (T03), 27% (T02), and 36% (T04) for samples tested between 2 and 5 dpc. Figure 10 shows the serology of the three-dose FMDV vaccine and the control group. These results demonstrate that the active ingredient of the 01M FMDV vaccine in recombinant adenovector formulated in ENABL C1 adjuvant is highly immunogenic and effective against IDL, by homologous challenge with FMDV in cattle, and provides data on the estimated minimum protective dose. Both the A24-A12 and O1M87 vaccines were shown to be safe in calves and mice. Example 3 Serological immunogenicity study of the adjuvant and corresponding virucidal activity / stability The use of adjuvants in a vaccine can lower the minimum protective dose (MPD) and result in a more effective vaccine. The lower MPD may be offset by the cost of the adjuvant and may provide added safety. However, some adjuvants can reduce vaccine efficacy. The adjuvant may induce an unwanted immune response, or it may be detrimental to the vaccine agent (for example, due to instability). The objective of the study was to evaluate the serological efficacy of the adjuvant. A serological efficacy study was conducted in cattle, and in parallel, a virucidal activity-stability study was performed to determine if any of the five adjuvants had detrimental effects on FMDV vaccines with adenovirus. Each dose consisted of 200 µL of Al (Active Ingredient) per dose at a dose of 2 µL with each of the adjuvants. The adjuvants were polyacrylic acid, LF2 emulsion, LR6 emulsion, CARBIGEN™ M, and ENABL® C1 (see Table 1.1 below). Table 1.1 FMDV vaccine preparation with adenovirus Group G1 Adjuvant Without Adjuvant Vaccine Formulation FMDV Vaccine (1057 per ml) + FFB (final formulation buffer solution) (50% v / v) G2 Acid FMDV Vaccine (105.7 per ml) + polyacrylic acid polymer (4mg / 2ml dose) G3 LF2 Emulsion FMDV Vaccine (105.7 per ml) + TS6* at 20% v / v final serial dilution G4 LR6 Emulsion FMDV Vaccine (105.7 per ml) + LR4** at 25% final serial dilution v / v G5 CARBIGEN™ FMDV Vaccine (105.7 per ml) + CARBIGEN™ MM at 10% v / v final serial dilution G6 ENABL® C1 FMDV Vaccine (105.7 per ml) + ENABL® C1 (20% in final serial dilution! TS6*: TS6 Adjuvant / emulsion as described in US 7,608,279 and US 7,371,395 LR4**: LR4 Adjuvant / emulsion as described in US 7,691,368 CARBIGEN™: Carbomer-based adjuvant suspension (Carbopol 934P), product of MVP Laboratories, Inc. ENABL® C1: adjuvant product for cattle acquired commercially from VaxLiant Table 1.2 TS6 emulsion (pre-emulsion described in US 7,608,279 and US 7,371,395) Oil phase (120ml) Sorbitan monooleate (SPAN 80®) Sorbitan trioleate (20 OE) (TWEEN 85®) Paraffin oil (MARCOL 82®) Aqueous phase (120ml) 1.8% w / v 10.2% w / v 88% v / v 20% (w / v) sorbitan monooleate solution (20 11.25% w / v OE) (TWEEN 80®) Disodium and monopotassium phosphate, 85.75% v / v isotonic buffer solution 0.02M (pH7.8) Sodium mercurothiolate (Thionersal®) 1% in 1.5% v / v water Table 1.3 LR4 emulsion (pre-muization described in US7,691,368) Oil phase (72ml) Oleth-2 (BRIJ® 92) Oleth-5 (VOLPO® N5) Paraffin oil (MARCOL 82®) 1.8% w / v 8.2% w / v 87.5% v / v Preservative 2.5% v / v Aqueous phase (108ml) Poloxamer407 (LUTROL® F127) 0.58%w / v Isotonic buffer solution that QS up to 100.0% v / v contains disodium and monopotassium phosphate 0.02M{pH7.8L The vaccines were stored at 4°C and 25°C and tested over time. The viruses in each vaccine were titrated according to the standard spot titration assay, which measures the amount of virus detected by specific anti-adenovirus antibodies on the cell monolayer. The respective titers were compared. Data for the first 3 months are presented later in Table 2 and Figures 11 (25°C) and 12 (4°C). At 4°C, most of the antigens or viruses present in the formulated vaccines were stable for up to 3 months. At 25°C, the antigens or viruses formulated with polyacrylic acid, LF2, and Carbigen M adjuvants were relatively stable for up to 7 weeks. The stability of these three formulations showed a slight decrease at 25°C at the 3-month point. However, this drop is less when the recombinant virus is combined with the adjuvant, confirming the protective effect of the adjuvant.The antigens or viruses formulated with LR6 adjuvant experienced some interference in the assay from the adjuvant, as evidenced by the lower detection level at both 4°C and 25°C. However, the formulation with adjuvant... LR6 generated a specific virus titer at 3 months and is stable at 25°C. Table 2 Virucidal activity and stability study of the five adjuvants up to 3 months Adjuvant T= T=24hr T=1 T=2 T=4 T=7 T=3 e 0 week weeks weeks months G1 - 4°C 6.9 4 6.61 6.88 6.90 6.89 6.80 7.21 G1 - 25°C 7.1 0 6.70 6.76 6.34 - 5.59 4.24 Below detection level G2 - 4°C 6.9 7 6.51 7.04 6.96 6.97 6.90 7.07 G2 - 25°C 6.9 1 6.40 6.94 6.93 6.69 6.56 5.85 G3 - 4°C 6.6 8 6.25 6.74 6.80 6.74 6.93 6.92 G3 - 25 °C 6.4 2 6.40 6.71 6.69 6.67 6.63 5.85 G4 - 4°C 6.5 By 6.69 5.36 By By 6.78 1 below below below the detection level of ... 7.11 7.16 4 G6 - 25 6.8 6.84 6.81 6.72 Per Per Per °C 4 below below below the detection level of ... Below the detection level*: interference in assay by adjuvant The corresponding serological study was carried out in cattle. Each group contained 10 animals per experimental group (5 in the control) and they were administered a 2 ml dose on day zero, followed by a booster on day 21. Blood samples were collected at various time points throughout the study, and serum samples were analyzed. Virus Neutralizing Titer serology was performed. Initial data indicated serological responses by day 14 after the first vaccination in several groups. Taken together, the data suggest that adenovirus-vectored FMD vaccines formulated with certain adjuvants may offer opportunities for improvements in thermostability and the ability to withstand temperature changes. When combined with these initial data, the immune response is maintained or potentially enhanced. Example 4 Serological immunogenicity of vaccination with two doses with FMDV O1M antigen vectored with multiple recombinant human adenoviral vectors, in cattle The objective of the study is to evaluate the serological antibody response in cattle after administration of FMDV OIManisa vectored with adenovirus formulated with and without different adjuvants. Fifty-five conventionally reared calves (approximately months old) were randomized to one of six treatment groups as shown in Table 4 below. Table 4 Group Vaccine Adjuvant Route of Administration Frequency of Administration No. of 0 e Animal Administration nns 1 Adt.O1 / Manis ENABL® IM Twice 10 a C1 with a 21-day separation 2 Adt. O1 / Manís LF IM Twice 10 a with a 21-day separation 3 Adt.O1 / Manís Acid IM Twice 10 a polyacrylic 0 with a 21-day separation 4 Adt.O1 / Manís Carbigen IM Twice 10 a MJ with a 21-day separation 5 Adt. O1 / Manís Ninguno IM Twice 10 a with a 21-day separation 6 FFB Placebo None IM Twice 5 with separation of days All calves, except those in Group 6 (controls), were vaccinated with an adenovirus-vectored O1 / Manisa construct with (Groups IA) or without adjuvant (Group 5), twice at a 21-day interval, using 2 ml of the test vaccine. All injections were administered intramuscularly (IM) alternately over the right and left shoulder. Table 4 above contains a summary of the treatment for each group. Calves were intermittently observed for at least 1 hour after each vaccination for clinical signs of acute systemic adverse events. Blood samples were collected from all cattle on Days -1 (before vaccination), 7, 15, 21 (before vaccination), 28, and 35. Blood samples from all cattle were tested for anti-FMDV antibodies by Serum Virus Neutralization (SVN). In addition, Adenovirus (SAV) antibody responses were determined in all animals from all Groups using samples collected on Day -1 and 35. SVN and SAV results were reported on a Log™ basis, with a value <0.6 Log™ considered negative for serum antibody. Post-vaccination safety assessments included rectal temperature, visual inspection, and palpation at injection sites for at least 3 days after each vaccination. Cows with local adverse events at the injection site were observed intermittently until the abnormality resolved. The study was terminated on day 35 after the final blood collection. The results of the serological response to FMDV using anti-FMDV antibodies by Serum Virus Neutralization (SVN) based on Logw are described below. All calves in all groups tested negative for anti-FMDV antibodies before the start of the study. All controls were negative for anti-FMDV antibodies throughout the study. Seroconversion after vaccination was defined as a titer increase based on Logio > 0.9. On Day 14 (2 weeks after the first vaccination), 5 / 10 calves (50%) in the ENABL® C1 group (Group 1) seroconverted. Those in the remaining vaccinated groups (2-5) had between 20 and 40% seroconverted calves. Furthermore, the mean antibody titer per group was slightly higher in Group 1 (ENABL® C1), followed by Groups 2 (LF) and 3 (Polyacrylic Acid) (Figure 13). On Day 35 (2 weeks after the second vaccination), all vaccinated animals (Groups 1 [ENABL®], Group 2 [LF] and Group 5 [No Adjuvant]) seroconverted, followed by ninety and eighty percent of the animals in Groups <8 (Polyacrylic Acid) and 4 (Carbigen M) respectively. Animals vaccinated with the LF adjuvant, followed by those vaccinated without adjuvant (Group 5) and by those vaccinated with the ENABL® C1 adjuvant (Group 1), had a superior antibody response after the two-dose vaccination regimen (see Figure 13). Ί\ The results of the serological response to FMDV using anti-Adenovirus antibodies by Serum Virus Neutralization (SVN) based on Logio are described below. All controls and vaccinated calves were negative for Adenovirus based on SN antibody titers on Day -1 (< 0.6 Log™). By Day 35, all but one vaccinated calf (ID: 134; Group 5) had seroconverted, with a higher overall geometric mean titer per group in those animals vaccinated with an adjuvant-containing vaccine (Groups 1-4) (see Figure 14). The results indicated serotoxic responses on day 14 after the first vaccination in several groups. Two weeks after the second vaccination, the highest antibody response was seen in calves vaccinated with the LF adjuvant, followed by those vaccinated without adjuvant and with the Enable C1 adjuvant. The results suggest that the antibody response after a single vaccination, regardless of the presence or absence of an adjuvant, is small. However, using a two-dose regimen (sensitization and booster), the antibody response is generally higher. No systemic adverse events were observed when the vaccine construct was administered twice (3 weeks apart) intramuscularly. Example 5 Serological evaluation of FMDV vaccines after vaccination in pigs The objective of the study is to evaluate the antibody response in piglets after administration of vaccine formulations monovalents containing FMDV 01 Manisa vectored with Adeno 5 and / or recombinant virus-like particles (VLPs) with FMDV 01 Manisa expressed in baculovirus. Twenty conventionally reared piglets (approximately 5 weeks old) were randomly assigned to two treatment groups, each containing 10 piglets. The composition of the groups is presented in Table 5 below. Table 5 Group Vaccines doses per Frequency No. of piglets; Animals constructs of adenovirus (FAID50 / 2mí .. (togio) 1 Adenovirus 01M 108 Adenovirus X+5 10 Without Adjuvant / 01M (Day 0) and Bac Bac 01M 01M+Adjuvant Adjuvant TS6 TS6 (Day 21) 2 Control (N / A) N / AN / A 10 The piglets in Group 1 were vaccinated with 2 ml of the vaccine. All injections were given intramuscularly (IM) alternately over the right and left shoulder. The piglets were observed before each vaccination to assess their overall condition. Health. Blood samples were collected from all piglets on days 0 (before vaccination), 7, 14, 21 (before vaccination), 28, and 35. Serum samples from Day 35 of all piglets were tested for anti-FMDV antibodies by Serum Virus Neutralization (SVN). Samples from those piglets in Group 1 were tested by SVN for all collection days because they had a higher overall antibody response after Day 35. Results were reported on a Log10 basis, and a value <0.75 Log10 was considered negative for serum antibody. Post-vaccination safety assessments included rectal temperature, visual inspection, and palpation at injection sites for 3 days after each vaccination. The results of the serological response to FMDV using anti-FMDV antibodies by Serum Virus Neutralization (SVN) based on Log10 are described below. All controls were negative for anti-FMDV antibodies before and at the end of the study. By Day 28 (1 week after the second vaccination), all piglets in Group 1 had seroconverted (titers ≤ 1.20 logw) (see Figure 15). No local and / or systemic adverse events attributable to vaccination were observed. The results clearly showed that although the vaccinated group had a small antibody response after the first vaccination, the antibody response after the second vaccination (sensitization and booster) was high by the end of the study. Example 6 Administration Route The objective of this study is to evaluate the serological response to two-dose vaccination in cattle or swine when using two recombinant adenovirus-vectored FMDV vaccines, one recombinant adenovirus-vectored FMDV vaccine and one FMDV virus-like particle (VLP) vaccine expressed in baculovirus, or two FMDV VLP vaccines, and when using different routes of administration (transdermal, subcutaneous, or intradermal). The study is also designed to address the issue of interference when administering multiple vaccines. The adjuvants are polyacrylic acid, LF2 emulsion, LR6 emulsion, CARBIGEN™ M, and ENABL® C1. The treatment groups are represented in Table 6 below. Table 6 Vaccine Group Route of administration Frequency of administration 1 Adeno FMDV IM or IM / TD or IM / SQ Twice, 21 days apart 2 Adeno FMDV TD or TD / IM or TD / SQ Twice, 21 days apart 3 Adeno FMDV SQ or SQ / TD or SQ / IM Twice, 21 days apart 4 Baculo FMDV VLP IM or IM / TD or IM / SQ Twice, with 21-day separation 5 Baculum FMDV VLP TD or TD / IM or TD / SQ Twice, with a 21-day separation 6 Baculum FMDV VLP SQ or SQ / TD or SQ / IM Twice, with a 21-day separation 7 Adeno IM or IM / TD or IM / SQ Twice, with FMDV / Baculum separation of 21 FMDV VLP days 8 Adeno TD or TD / IM OR TD / SQ Twice, with FMDV / Baculum separation of 21 FMDV VLP days 9 Adeno SQ or SQ / TD or SQ / IM Twice, with FMDV / Baculum separation of 21 FMDV VLP days Calves are intermittently observed for at least 1 hour after each vaccination for clinical signs of acute systemic adverse events. Blood samples are collected from all cattle on Days -1 (before vaccination), 7, 15, 21 (before vaccination), 28, and 35. Blood samples from all cattle are tested for anti-FMDV antibodies by Serum Virus Neutralization (SVN). In addition, Antibody responses to Adenovirus (SAV) are determined in all animals from all Groups in samples collected on Day -1 and 35. Post-vaccination safety assessments include rectal temperature, visual inspection, and palpation of injection sites for at least 3 days after each vaccination. Cows with local adverse events at the injection site are monitored intermittently until the abnormality resolves. The results show an effect of the sensitization and booster regimen for all groups, but the effect of the sensitization and booster regimen is greater in animals that received sensitization with the adenovirus vaccine followed by a booster with the FMD baculovirus construct. Furthermore, the route of administration has an impact on the serological response and protection, as well as on the duration of immunity. Specific routes of administration and / or the specific combination of TD, IM, and SQ routes of administration appear to exacerbate the immune response, in addition to amplifying protection, overcoming interference, and protecting animals positive for maternally derived antibodies (MDA positive). Example 7 Efficacy in swine Pigs are vaccinated against FMDV (against several serotypes) twice with a separation of 21 days in a sensitization and booster regimen with a heterologous sensitization and booster protocol (sensitization with adeno followed by booster with baculo) as well as a homologous sensitization and booster protocol (adeno-adeno; baculo-baculo), and They challenge 14 dpv with many FMDV serotypes, such as strains A24, A12, O1, Asia, Irn, and Iraq. In the dose titration study, the recombinant adenoviral vectored FMDV vaccine is evaluated to study its ability to confer protection against generalized FMD disease (leg lesions) after homologous and heterologous challenges 14 days post-vaccination (dpv). This study uses the procedure described in Example 2 to determine the minimum protective dose in the sensitization-booster administration regimen. The results demonstrate that the recombinant adenovector FMDV vaccine used in the sensitization and booster protocol is highly immunogenic and effective against homologous and heterologous FMDV challenges in pigs, overcomes interference, and protects animals positive for maternally derived antibodies (MDA positive). Example 8 Efficacy in cattle Cattle are first vaccinated with a recombinant adenovirus vectored FMDV vaccine and boosted with a conventional killed FMD vaccine or a baculovirus-expressed FMDV VLP vaccine at a 21-day interval, and challenged on day 14 after the second vaccination with various FMDV serotypes, such as strains A24, A12, O1, Asia, Irn, and Iraq. In the dose titration study, the recombinant adenoviral vectored FMDV vaccine is evaluated to study its ability to confer protection against generalized FMD disease (leg lesions) after homologous and heterologous direct challenges at 14 days after vaccination (dpv). In this study, the procedure described in Example 2 is used to determine the minimum protective dose in the sensitization and booster administration regimen. The results demonstrate that the sensitization and booster administration regimen is highly immunogenic and effective against homologous and heterologous FMDV challenges in cattle, and that it provides protection in animals against FMDV infection, overcomes interference, and protects animals positive for maternally derived antibodies (MDA positive). Having described in detail the ways of carrying out this disclosure, it must be understood that the disclosure defined by the previous examples is not limited by the particular details established in the previous description, since many obvious variations of them are possible without departing from the spirit or scope of this disclosure. All documents cited or referenced herein (“documents cited herein”), and all documents cited or referenced in the documents cited herein, together with all manufacturer's instructions, descriptions, product specifications, and product data sheets for any product mentioned herein or in any document incorporated by reference herein, are incorporated herein by reference and may be used in the practice of the invention. LIST OF SEQUENCES, <110> Merial, Inc. Genvec Inc. The United States Government, represented by the Secretary of Homeland Security Widener, Justin Woodyward, Leszlie Siger, Leonardo Brough, Douglas Ettyreddy, Damodar Gall, Jason McVey, Duncan Burrage, Tom <120 > FMDV VACCINES VECTORIZED WITH RECOMBINANT ADENOVIRUS AND THEIR USES <130> MER 15-277.PCT <150> 62 / 288,540 <151> 2016-01-29 <160> 8 <170> Patentln version 3.5 <210> 1 <211> 3381 <212> DNA <213> artificial sequence <220> <223> polynucleotide encoding FMDV antigen A24-A12 <400> 1 atgaacacaa ctgactgttt tatcgctttg gtgcacgcaa tcagagagat cagagcactt 60 ttcctaccac gaaccacagg aaagatggaa ctcacqctgt acaacggcga gaaaaagact 120 ttctactcca gacctaacaa ccacgacaac tgttggttga acactgtcct tcagttgttc 180 aggtatgtcg atgagccctt cttcgactgg gtctacaact cacctgagaa cctcacgctc 240 gaagccatcg agcaattgga ggaactcaca ggacttgagc tgcacgaagg tgggccgccc 300 gccctcgtga tctggaacat caaacacttg ctccacaccg gcatcggcac agcctcacga 360 cccagtgagg tgtgcatggt ggacggtacg gacatgtgtc ttgccgactt ccacgcaggc 420 attttcctga agggacagga acacgcagtc tttgcatgtg tcacctccaa cgggtggtac 480 gcgattgatg atgaggaatt ttacccctgg acgcctgacc cgtcagacgt cctggtgttt 540 gtcccatacg accaagagcc actcaacggg gactggaaag cgatggtcca gaggaagctt 600 aagggcgccg ggcaatccag cccggcgacc ggctctcaga accagtctgg caacactggc 660 agcataatca ataactacta catgcagcag taccagaact ccatggacac gcagcttggt 720 gacaatgcca tcagtggagg ctccaacgaa ggctccacgg acacaacgtc aacacacaca 780 accaacaccc aaaacaacga ctggttttcg aaacttgcca gctcagcctt taccggtctg 840 ttcggcgcct tgcttgccga caagaagacg gaagagacta cgcttctgga ggaccgcatt 900 ctcaccaccc gcaacgggca caccatctcg accacccagt cgagtgtggg agtcacctac 960 gggtactcca ctggagaaga ccacgttgct gggcccaaca catcgggcct ggagacgcgg 1020 gtggtgcagg ctgagagatt ttacaaaaag tttttgtfctg attggacaac ggataagcct 1080 tttggacatt tggaaaagtt ggaacttccc accgaccacc acggtgtttt cgggcacttg 1140 gtggaatcgt atgcctacat gagaaacggt tgggaegttg aggtgtctgc tgttggcaac 1200 cagttcaacg gcgggtgtct cctggtggct atggtaccgg agtggaagga gtttgaacaa 1260 cgtgagaagt accagctcac cctctttccc caccagttca ttagccccag aacaaacatg 1320 actgcccaca ttactgtccc ataccttgga gtgaacaggt acgaccagta caagaaacac 1380 aaaccttgga ccctggttgt tatggtagtg tcgcccctta cagttagcag cactgccgcg 1440 gcacagatta aggtctacgc caacattgct ccaacctacg ttcacgtggc cggggaacta 1500 ccctcgaagg aggggatttt cccggttgca tgttcggacg gttacggagg actggtgaca 1560 acagacccga aaacagctga ccctgcctac ggcaaggtgt acaacccgcc caggaataac 1620 taccccgggc ggttcaccaa cttgttggac gtggctgaag cgtgtcccac tttcctctgt 1680ttcgacgacg ggaaaccgta cgtcgttacg cggacagatg acacacgact cttagccaag 1740 ttcgacgttt cccttgccgc aaaacacatg tccaaeacgt acctgtcagg gatagcacag 1800 tactatacac agtactctgg taccatcaac ttgcacttca tgtttacagg ttcaacagat 1860 tcaaaggccc gttacatggt ggcctacatc ccgcccgggg tggaagtgcc accggacaca 1920 cctgaaaggg ctgcccactg tatccacgct gaatgggaca caggactgaa ctccaaattc 1980 actttttcaa tcccgtacgt gtccgccgca gattacgcgt acaccgcgtc tgacacggca 2040 gaaacaacca acgtacaggg ctgggtctgc atttaccaga ttacacacgg gaaggccgag 2100 aacgacacac tagtcgtgtc ggccagcgcc ggcaaggact ttgagttgcg cctcccgatt 2160 gacccgcgac ggcaaaccac cgctgttggg gagtccgcag accctgtcac caccaccgtg 2220 gagaactacg gcggtgagac acagacccag aggcgacatc atacagatgt cagtttcatc 2280 atggacagat ttgtgaaaat aaacagcttg agtcccacac atgtcattga cctcatgcag 2340 acccaccaac acgggctggt gggcgcgctg ctgcgtgcag ccacgtacta cttctccgac 2400 ttggagattg ttgtgcggca tgacggtaat ttgacttggg tgcccaacgg tgcgcctgaa 2460 gcagctttgt caaacaccag caaccccact gcctacaaca aggcaccgtt cacgaggctc 2520gctctccctt acactgcgcc acaccgggcg tgtaatgacg tgaactccga gcctgcccgg 2580 cccgctgaag agcaaccaca agctgaagga ccctataccg ggccactcga gcgtcagaga 2640 cctctgaaag tgagagctaa gctcccacag caggaaggac cttacgctgg cccgttggag 2700 agacagaaac cgctgaaagt gaaagcaaaa gccccggtcg tcaaggaagg accttacgag 2760 ggaccggtga agaagcctgt cgctttgaaa gtgaaagcta agaacttgat agtcactgag 2820 agtggtgccc caccgaccga cttgcaaaag atggtcatgg gcaacacaaa gcctgttgag 2880 ctcatccttg acgggaagac agtagccatc tgttgtgcta ctggagtgtt tggcactgct 2940 tacctcgtgc ctcgtcatct tttcgcagag aagtatgaca agatcatgct ggatggcaga 3000 gccatgacag acagtgacta cagagtgttt gagtttgaga ttaaagtaaa aggacaggac 3060 atgctctcag acgctcgct catggtgctc caccgtggga accgcgtgag agatatcacg 3120 aaacactttc gtgatacagc aagaatgaag aaaggcaccc ccgtcgtgg tgtggtcaac 3180 aacgccgacg ttgggagact gattttctct ggtgaggccc tcacctacaa ggatattgta 3240 gtgtgcatgg acggagacac catgcctggc ctctttgcct acaaagccgc caccaaggca 3300 ggctactgtg gaggagccgt tctcgccaag gacggggccg acactttcat cgtcggcact 3360 cactccgcag gaggcaatgg a 3381 <210> 2 <211> 1127 <212> PRT <213> artificial sequence <220> <223> antigeno de FMDV A24-A12 A24 P1-2A2B / A12 3B3C <400> 2 Met Asn Thr Thr Asp Cys Phe lie Ala Leu Val His Ala lie Arg Glu 1 5 10 15 lie Arg Ala Leu Phe Leu Pro Arg Thr Thr Gly Lys Met Glu Leu Thr 20 25 30 Leu Tyr Asn Gly Glu Lys Lys Thr Phe Tyr Ser Arg Pro Asn Asn His 35 40 ;45 Asp Asn Cys Trp Leu Asn Thr Val Leu Gln Leu Phe Arg Tyr Val Asp 50 55 60 Glu Pro Phe Phe Asp Trp Val Tyr Asn Ser Pro Glu Asn Leu Thr Leu 65 70 75 80 Glu Ala lie Glu Gln Leu Glu Glu Leu Thr Gly Leu Glu Leu His Glu 85 90 95 Gly Gly Pro Pro Ala Leu Val lie Trp Asn lie Lys His Leu Leu His 100 105 110 Thr Gly lie 115 Gly Thr Ala Ser Arg Pro Ser 120 Glu Val Cys 125 Met Val Asp Gly Thr Asp Met Cys Leu Ala Asp Phe His Ala Gly lie Phe Leu Lys 130 135 140 Gly Gln Glu His Ala Val Phe Ala Cys Val Thr Ser Asn Gly Trp Tyr 145 150 155 160 Ala lie Asp Asp Glu Glu Phe Tyr Pro Trp Thr Pro Asp Pro Ser Asp 165 170 175 Val Leu Val Phe Val Pro Tyr Asp Gln Glu Pro Leu Asn Gly Asp Trp 180 185 190 Lys Ala Met Val Gln Arg Lys Leu Lys Gly Ala Gly Gln Ser Ser Pro 195 200 205 Ala Thr Gly Ser Gln Asn Gln Ser Gly Asn Thr Gly Ser lie lie Asn 210 215 220 Asn Tyr Tyr Met Gln Gln Tyr Gln Asn Ser Met Asp Thr Gln Leu Gly 225 230 23 5 240 Asp Asn Ala lie Ser Gly Gly Ser Asn Glu Gly Ser Thr Asp Thr Thr 245 250 255 Ser Thr His Thr Thr Asn Thr Gln Asn Asn Asp Trp Phe Ser Lys Leu 260 265 270 Ala Ser Ser Ala Phe Thr Gly Leu Phe Gly Ala Leu Leu Ala Asp Lys 275 280 285 Lys Thr Glu Glu Thr Thr Leu Leu Glu Asp Arg lie Leu Thr Thr Arg 290 295 300 Asn Gly His Thr lie Ser Thr Thr Gln Ser Ser Val Gly Val Thr Tyr 305 310 315 320Gly Tyr Ser Thr Gly Glu Asp His Val Ala Gly Pro Asn Thr Ser Gly 325 330 335 Leu Glu Thr Arg Val Val Gln Ala Glu Arg Phe Tyr Lys Lys Phe Leu 340 345 350 Phe Asp Trp Thr Thr Asp Lys Pro Phe Gly His Leu Glu Lys Leu Glu 355 360 365 Leu Pro Thr Asp His His Gly Val 375 Phe Gly His Leu Val Glu 380 Ser Tyr 370 Ala Tyr Met Arg Asn Gly Trp Asp Val Glu Val Ser Ala Val Gly Asn 385 390 395 400 Gln Phe Asn Gly Gly Cys Leu Leu Val Ala Met Val Pro Glu Trp Lys 405 410 415 Glu Phe Glu Gln Arg Glu 420 Lys Tyr Gln 425 Leu Thr Leu Phe Pro His 430 Gln Phe lie Ser Pro Arg Thr Asn Met Thr Ala His lie Thr Val Pro Tyr 435 440 445 Leu Gly Val Asn Arg Tyr Asp Gln Tyr Lys Lys His Lys Pro Trp Thr 450 455 460 Leu Val Val Met Val Val Ser Pro Leu Thr Val Ser Ser Thr Ala Ala 465 470 475 480 Ala Gln lie Lys Val Tyr Ala Asn lie Alá Pro Thr Tyr Val His Val 485 490 495 Ala Gly Glu Leu Pro Ser Lys Glu Gly lie Phe Pro Val Ala Cys Ser 500 505 510 Asp Gly Tyr Gly Gly Leu Val Thr Thr Asp Pro Lys Thr Ala Asp Pro 515 520 525 Ala Tyr Gly Lys Val Tyr Asn Pro Pro Arg Asn Asn Tyr Pro Gly Arg 530 535 540 Phe Thr Asn Leu Leu Asp Val Ala Glu Ala Cys Pro Thr Phe Leu Cys 545 550 555 560 Phe Asp Asp Gly Lys Pro Tyr Val Val Thr Arg Thr Asp Asp Thr Arg 565 570 575 Leu Leu Ala Lys Phe Asp Val Ser Leu Ala Ala Lys His Met Ser Asn 580 585 590 Thr Tyr Leu Ser Gly lie Ala Gln Tyr Tyr Thr Gln Tyr Ser Gly Thr 595 600 605 lie Asn Leu His Phe Met Phe Thr Gly Ser Thr Asp Ser Lys Ala Arg 610 615 620 Tyr Met Val Ala Tyr 625 He 630 Pro Pro Gly Val Glu Val 635 Pro Pro Asp Thr 640 Pro Glu Arg Ala Ala His Cys He His Ala Glu Trp Asp Thr Gly Leu 645 650 655 Asn Ser Lys Phe Thr Phe Ser He Pro Tyr Val Ser Ala Ala Asp Tyr 660 665 670 Ala Tyr Thr Ala Ser Asp Thr Ala Glu Thr Thr Asn Val Gln Gly Trp 675 680 685 Val Cys lie Tyr Gln He Thr His Gly Lys Ala Glu Asn Asp Thr Leu 690 695 700 Val Val Ser Ala Ser Ala Gly Lys Asp Phe Glu Leu Arg Leu Pro He 705 710 715 720 Asp Pro Arg Arg Gln Thr Thr Ala Val Gly Glu Ser Ala Asp Pro Val 725 730 735 Thr Thr Thr Val Glu Asn Tyr Gly Gly Glu Thr Gln Thr Gln Arg Arg 740 745 750 His His Thr Asp Val Ser Phe He Met Asp Arg Phe Val Lys He Asn 755 760 765 Ser Leu Ser Pro Thr His Val He Asp Leu Met Gln Thr His Gln His 770 775 780 Gly Leu Val Gly Ala Leu Leu Arg Ala Ala Thr Tyr Tyr Phe Ser Asp 785 790 795 800 Leu Glu lie Val Val Arg His Asp Gly Asn Leu Thr Trp Val Pro Asn 805 810 815 Gly Ala Pro Glu Ala Ala Leu Ser Asn Thr Ser Asn Pro Thr Ala Tyr 820 825 830 Asn LysAla Pro Phe Thr Arg Leu Ala Leu Pro Tyr Thr Ala Pro His 835 840 845 Arg Ala Cys Asn Asp Val Asn Ser Glu Pro Ala Arg Pro Ala Glu Glu 850 855 860 Gln Pro Gln Ala Glu Gly Pro Tyr Thr Gly Pro Leu Glu Arg Gln Arg 880 865 870 875 Pro Leu Lys Val Arg Ala 885 Lys Leu Pro Gln Gln Glu Gly Pro Tyr Ala 890 895 Gly Pro Leu Glu Arg Gln Lys Pro Leu Lys Val Lys Ala Lys Ala Pro 900 905 910 Val Val Lys Glu Gly Pro Tyr Glu Gly Pro Val Lys Lys Pro Val Ala 915 920 925 Leu Lys Val Lys Ala Lys Asn Leu lie Val Thr Glu Ser Gly Ala Pro 930 935 940 Pro Thr Asp Leu Gln Lys Met Val Met Gly Asn Thr Lys Pro Val Glu 945 950 955 960 Leu lie Leu Asp Gly Lys Thr Val Ala lie Cys Cys Ala Thr Gly Val 965 970 975 Phe Gly Thr Ala Tyr Leu Val Pro Arg His Leu Phe Ala Glu Lys Tyr 980 985 990 Asp Lys lie Met Leu Asp Gly Arg Ala Met Thr Asp. Ser Asp Tyr Arg 995 1000 1005 Val Phe Glu Phe Glu lie Lys 1015 Val Lys Gly Gln Asp 1020 Met Leu Ser 1010 Asp Ala 1025 Ala Leu Met Val Leu 1030 His Arg Gly Asn Arg 1035 Val Arg Asp lie Thr 1040 Lys His Phe Arg Asp 1045 Thr Ala Arg Met Lys 1050 Lys Gly Thr Pro Val 1055 Val Gly Val Val Asn 1060 Asn Ala Asp Val Gly 1065 Arg Leu lie Phe Ser 1070 Gly Glu Ala Leu Thr 1075 Tyr Lys Asp lie Val 1080 Val Cys Met Asp Gly 1085 Asp Thr Met Pro Gly 1090 Leu Phe Ala Tyr Lys 1095 Ala Ala Thr Lys Ala 1100 Gly Tyr Cys Gly Gly 1105 Ala Val Leu Ala Lys 1110 Asp Gly Ala Asp Thr 1115 Phe lie Val Gly Thr His Ser Ala Gly Gly Asn Gly 1120 1125 <210> 3 <211> 3585 <212 > ADN <213> secuencia artificial <220> <223> synthetic polinucleótido que codifica Antígeno de FMDV O1M87 <400> 3 atgggagccg ggcaatccag cccggcaacc gggtcacaga accaatcagg caacactggg 60 agcatcatca acaattacta catgcagcag taccaaaact ccatggacac acaacttggt 120 gacaacgcta caagcggagg ctcaaacgag gggtccacct caggcac 180 acacacaca accaacactc agaacaacga ctggttctcg aagctggcca gttccgcttt cagcggtctt 240 ttcggcgctc ttctcgccga caagaaaacc gaggagacca ctcttctcga ggaccgcatc 300 ctcactactc gtaacggaca caccacccgcgcgcgcgcgcggcgg 360 gggtatgcaa cagctgagga ttcgtgagc gggccaaaca cctctggtct cgagaccagg 420 gttgcccagg cagagcggtt cttaaaacc cacctgttcg actgggtcac cagtgacccg 480 ttcggacggt gccaccttgct cggcagcctg 540 accgactcgt atgcttatat gaggaacggc tgggatgttg aagtcactgc agtgggaaac 600 cagttcaatg gaggatgcct gttggtggcc atggtgccag aactttgctc catacagaag 660 agggagctgt accagctct gccagccct gccagctt tcaaccctcg gacgaacatg 720 acagcacaca tcactgtgcc ctttgttggc gtcaaccgtt atgaccagta caaggtacac 780 aaaccttgga ccctcgtggt tatggttgta gccccctga ccgtcaacag tgaaggtgcc 840 cccacaca aggtatccaacatcgca cctaccaacg tacacgtcgc gggtgagttc 900 ccttccaaag aggggatctt ccctgtggct tgcagcgatg gttatggcgg tctggtgacc 960 actgacccga aaacggctga ccccgcttac gggaaagtgt ttaacccccc ccgcaacatg ttgccggggc ggttcaccaa ttttcttgac gtggctgagg cgtgccccac gtttctccac 1080 ttcgaggggtg acgtgccata cgtgaccacg aagacggatt cagacagggt gctcgctcag 1140 ttcgacttgt ctttggcagc aaagcacatg tcgaacacct tccttgcagg tctcgcccag 1200 tactacacac agtacagcgg caccatcaac ctgcacttca tgttcacagg gcctactgac 1260 gcgaaggcgc gttacatgat tgcgtatgct cctcctggca tggaaccacc taaaacgcca 1320 gaggcggctg cccactgcat tcatgctgaa tgggacacag ggttgaactc aaaattcaca 1380 ttttcaatcc cttacctttc ggcggctgat tacgcttaca cagcgtctga cactgctgag 1440 accacaaatg tacagggatg ggtttgcctg tttcaata cacacggga agctgacggc gacgcactgg tcgttttggc tagcgccgga aaggactttg agctgcgcct gccggtggat 1560 gctcgcacac agactacctc cgcgggcgag tcagctgacc ccgtgaccgc caccgttgag 1620 aattacggtg gcgagacaca ggtccagagg cgccaacaca cggacgtctc atttatatta 1680 gacagatttg tgaaagtgac accaaaagac caaattaatg tattggacct gatgcaaacc 1740 cctgctcaca ctttggtggg agcactcctt cgtactgcca cttactattt cgctgactta 1800 gaggtggcag tgaagcacga gggaaacctc acctgggtcc cgaacggggc gcctgaagcg 1860 gcgttggaca acaccaccaa cccaacagct taccacaagg caccactcac ccgacttgca 1920 ctgccttaca cggcgccaca ccgcgtgttg gctactgttt acaacgggaa cagcaagtat 1980 ggtgacggca cggtggccaa tgtgagaggt gacctgcaag tgttggccca gaaggcggcg 2040 agagcgctgc ctacctcctt caactacggt gccattaaag ctactcgggt gactgaactg 2100 ctttaccgca tgaagagggc tgagacatac tgtccccggc ctcttttggc cattcacccg 2160 gaccaggcta gacacaagca gaagattgtg gcaccggtga aacagcttct aaattttgac 2220 ctgctcaaat tggcgggaga tgtggagtcc aaccctgggc ccttcttctt ctccgacgtc 2280 aggtcaaatt tctcaaaact ggtagaaacc atcaatcaga tgcaggagga catgtcaaca 2340aaacacgggc ctgactttaa ccggttgtg tccgcattg aggaattggc cactggagtg 2400 aaggctca gggccggtct cgacgaggcc aaaccctgt aaaactcat cagcactcctg 2460 agccgctgca cgcagcaggtgc ccttgtggcc 2520 atcatgctgg ctgacaccgg tctgagatt ctggacagca ccttgtcgt gaagagatc 2580 tccgactcgc tctcagtct cttcacgtg ccggcccccg 2cttcagtt cggagtt4gggccccg caaagtcgcc tcgagtttct tccggtccac acccgagagac 2700 cttgagagag cagaaaaca gctcaagca cgtgacatta acgacatact tgagcgtcag 2760 aaacctga gagtgagat ac caagttgcca caacaggagg t28gacccacc aaccgttgaa agtgagagca agagccccgg tcgtgaagga gggaccctac 2880 gagggaccgg tgaagaagcc tgtcgcttg aaagtgaaag ccagaactt gattgtcact 2940 gagagtggtg ccccaccgac cgactcattccag tgg0 aagatgg gagctcatcc tcgacgggaa gacggtagcc atctgctgtg ctaccggagt gtttggcact 3060 gcctacctcg tacctcgtca cctctcgcg gagaagtacg acagataat gttggacggt 3120 agagccattgatg ctagacagagtg aaaaagggg 3180gacatgctct cagacgctgc actcatggtg cttcaccgtg ggaaccgcgt gagagacatc 3240 acgaaacatt ttcgtgacac agcaagaatg aagaaaggca cccccgttgt cggtgtgatc 3300 aacaacgccg acgttgggag actgattttc 3360 gtagtgtgca tggatggaga caccatgccg ggcctgtttg cctacagagc cgccaccaag 3420 gctggttact gcgggggagc actcactccg caggtggtaa ctgaaaatga aggcacacat cgttctcgcc aaggacggag cggagttgga tactgctcgt tgaccctgaa ccacaccácg ccgacacatt catcgttggc gcgtgtccag gtcatgctc agtagcatc 3480 3540 3585 <210> 4 <211> 1194 <212 > PRT <213> artificial sequence <220> <223> FMDV antigen O1M87 <400> 4 Met 1 Gly Ala Gly Gln 5 Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln Ser 10 15 Gly Asn Thr Gly Ser lie lie Asn Asn Tyr Tyr Met Gln Gln Tyr Gln 20 25 30 Asn Ser Met Asp Thr Gln Leu Gly Asp Asn Ala Thr Ser Gly Gly Ser 35 40 45 Asn Glu Gly Ser Thr Asp Thr Thr Ser Thr' His Thr Thr Asn Thr Gln 50 55 60 Asn Asn Asp Trp Phe Ser Lys Leu Ala Ser Ser Ala Phe Ser Gly Leu 65 70 75 80 Phe Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu 85 90 95 Glu Asp Arg lie Leu Thr Thr Arg Asn Gly His Thr Thr Ser Thr Thr 100 105 110 Gln Ser Ser Val Gly Val Thr Tyr Gly Tyr Ala Thr Ala Glu Asp Phe 115 120 125 Val Ser Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Ala Gln Ala 130 135 140 Glu Arg Phe Phe Lys Thr His Leu Phe Asp Trp Val Thr Ser Asp Pro 145 150 155 160 Phe Gly Arg Cys His Leu Leu Glu Leu Pro Thr Asp His Lys Gly Val 165 170 175 Tyr Gly Ser Leu Thr Asp Ser Tyr Ala Tyr Met Arg Asn Gly Trp Asp 180 185 190 Val Glu Val Thr Ala Val Gly Asn Gln Phe Asn Gly Gly Cys Leu Leu 195 200 205 Val Ala Met Val Pro Glu Leu Cys Ser lie Gln Lys Arg Glu Leu Tyr 210 215 220 Gln Leu Thr Leu Phe Pro His Gln Phe lie Asn Pro Arg Thr Asn Met 225 230 235 240 Thr Ala His lie Thr Val Pro Phe Val Gly Val Asn Arg Tyr Asp Gln 245 250 Γ 255 Tyr Lys Val His Lys Pro Trp Thr Leu Val Val Met Val Val Ala Pro 260 265 270 Leu Thr Val Asn Ser Glu Gly Ala Pro Gln lie Lys Val Tyr Ala Asn 275 280 285 lie Ala Pro Thr Asn Val His Val Ala Gly Glu Phe Pro Ser Lys Glu 290 295 300 Gly lie Phe Pro Val Ala Cys Ser Asp Gly Tyr Gly Gly Leu Val Thr 305 310 315 320 Thr Asp Pro Lys Thr Ala Asp Pro Ala Tyr Gly Lys Val Phe Asn Pro 325 330 • 335 Pro Arg Asn Met Leu Pro Gly Arg Phe Thr Asn Phe Leu Asp Val Ala 340 345 350 Glu Ala Cys Pro Thr Phe Leu His Phe Glu Gly Asp Val Pro Tyr Val 355 360 365 Thr Thr Lys Thr Asp Ser Asp Arg Val Leu Ala Gln Phe Asp Leu Ser 370 375 380 Leu Ala Ala Lys His Met Ser Asn Thr Phe Leu Ala Gly Leu Ala Gln385 390 395 400 Tyr Tyr Thr Gln Tyr Ser Gly Thr lie Asn Leu His Phe Met Phe Thr 405 410 415 Gly Pro Thr Asp Ala Lys Ala Arg Tyr Met lie Ala Tyr Ala Pro Pro 420 425 430 Gly Met Glu Pro 435 Pro Lys Thr Pro 440 Glu Ala Ala Ala His 445 Cys lie His Ala Glu Trp Asp Thr Gly Leu Asn Ser Lys Phe Thr Phe Ser lie Pro 450 455 460 Tyr Leu Ser Ala Ala Asp Tyr Ala Tyr Thr Ala Ser Asp Thr Ala Glu 465 470 475 480 Thr Thr Asn Val Gln Gly Trp Val Cys Leu Phe Gln lie Thr His Gly 485 490 495 Lys Ala Asp Gly Asp Ala Leu Val Val Leu Ala Ser Ala Gly Lys Asp 500 505 510 Phe Glu Leu Arg Leu Pro Val Asp Ala Arg Thr Gln Thr Thr Ser Ala 515 520 525 Gly Glu Ser Ala Asp Pro Val Thr Ala Thr Val Glu Asn Tyr Gly Gly 530 535 540 Glu Thr Gln Val Gln Arg Arg Gln His Thr Asp Val Ser Phe lie Leu 545 550 555 560 Asp Arg Phe Val Lys Val Thr Pro Lys Asp Gln lie Asn Val Leu Asp 565 570 575 Leu Met Gln Thr Pro Ala His Thr Leu Val Gly Ala Leu Leu Arg Thr 580 585 590 Ala Thr Tyr Tyr Phe Ala Asp Leu Glu Val Ala Val Lys His Glu Gly 595 600 605 Asn Leu Thr Trp Val Pro Asn Gly Ala Pro Glu Ala Ala Leu Asp Asn 610 615 620 Thr Thr Asn Pro Thr Ala Tyr His Lys Ala Pro Leu Thr Arg Leu Ala 625 630 635 640Leu Pro Tyr Thr Ala Pro His Arg Val Leu Ala Thr Val Tyr Asn Gly 645 650 655 Asn Ser Lys Tyr Gly Asp Gly Thr Val Ala Asn Val Arg Gly Asp Leu 660 665 670 Gln Val Leu Ala Gln Lys Ala Ala Arg Ala Leu Pro Thr Ser Phe Asn 675 680 685 Tyr Gly 690 Ala lie Lys Ala Thr 695 Arg Val Thr Glu Leu 700 Leu Tyr Arg Met Lys 705 Arg Ala Glu Thr Tyr 710 Cys Pro Arg Pro Leu 715 Leu Ala lie His Pro 720 Asp Gln Ala Arg His 725 Lys Gln Lys lie Val 730 Ala Pro Val Lys Gln 735 Leu Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser 750 Asn Pro 740 745 Gly Pro Phe Phe Phe Ser Asp Val Arg Ser Asn Phe Ser Lys Leu Val 755 760 765 Glu Thr lie Asn Gln Met Gln Glu Asp Met Ser Thr Lys His Gly Pro 770 775 780 Asp Phe Asn Arg Leu Val Ser Ala Phe Glu Glu Leu Ala Thr Gly Val 785 790 795 800 Lys Ala lie Arg Ala Gly Leu Asp Glu Ala Lys Pro Trp Tyr Lys Leu 805 810 815 lie Lys Leu Leu Ser Arg Leu Ser Cys Met Ala Ala Val Ala Ala Arg 820 825 830 Ser Lys Asp Pro Val Leu Val Ala lie Met Leu Ala Asp Thr Gly Leu 835 840 845 Glu lie Leu Asp Ser Thr Phe Val Val Lys Lys lie Ser Asp Ser Leu 850 855 860 Ser Ser Leu Phe His Val Pro Ala Pro Val Phe Ser Phe Gly Ala Pro 865 870 875 880 lie Leu Leu Ala Gly Leu Val Lys Val ' . . :Λ Ala Ser Ser ✓ Phe Phe Arg Ser 885 890 895 Thr Pro Glu Asp Leu Glu Arg Ala Glu Lys Gln Leu Lys Ala Arg Asp 900 905 910 binds Asn Asp binds Leu Glu Arg Gln Lys Pro Leu Arg Val Lys Thr Lys 915 920 925 Leu Pro Gln Gln Glu Gly Pro Tyr Ala Gly Pro Met Asp Arg Gln Lys 930 935 940 Pro 945 Leu Lys Val Arg Ala Arg Ala Pro Val Val Lys Glu Gly Pro Tyr 960 950 955 Glu Gly Pro Val Lys Lys Pro Val Ala Leu Lys Val Lys Ala Lys Asn 965 970 975 Leu He Val Thr Glu Ser Gly Ala Pro Pro Thr Asp Leu Gln Lys Met 980 985 990 Val Met Gly Asn Thr Lys 995 Pro Val Glu Leu lie Leu Asp Gly Lys Thr 1000 1005 Val Ala 1010 lie Cys Cys Ala Thr 1015 Gly Val Phe Gly Thr 1020 Ala Tyr Leu Val Pro 1025 Arg His Leu Phe Ala 1030 Glu Lys Tyr Asp Lys 1035 lie Met Leu Asp Gly 1040 Arg Ala Met Thr Asp 1045 Ser Asp Tyr Arg Val 1050 Phe Glu Phe Glu He 1055 Lys Val Lys Gly Gln 1060 Asp Met Leu Ser Asp 1065 Ala Ala Leu Met Val 1070 Leu His Arg Gly Asn 1075 Arg Val Arg Asp He 1080 Thr Lys His Phe Arg 1085 Asp Thr Ala Arg Met 1090 Lys Lys Gly Thr Pro 1095 Val Val Gly Val He 1100 Asn Asn Ala Asp Val 1105 Gly Arg Leu He Phe 1110 Ser Gly Glu Ala Leu 1115 Thr Tyr Lys Asp lie 1120 Val Val Cys Met Asp 1125 Gly Asp Thr Met Pro 1130 Gly Leu Phe Ala Tyr 1135 Arg Ala Ala Thr Lys 1140 Ala Gly Tyr Cys Gly 1145 Gly Ala Val Leu Ala 1150 Lys Asp Gly Ala Asp 1155 Thr Phe He Val Gly 1160 Thr His Ser Ala Gly 1165 Gly Asn Gly Val Giy 1170 Tyr Cys Ser Cys Val Ser Arg Ser Met Leu Leu Lys Met Lys Ala His He Asp 1175 1180 1185 Pro Glu Pro His His Glu 1190 <210> 5 <211> 3579 <212> DNA <213> artificial sequence <220> <223> Polynucleotide Encoding FMDV Antigen Irn <400> 5 atgggagccg ggcaatccag tccggcaacc gggtcacaaa accaatcagg taacactggt 60 agtatcatca acaactacta catgcagcag taccagaact ccatggacac acaacttggc 120 gacaacgcca ttagcggtgg ttccaacgag ggctccactg acacacaca 180 accaacacac agaacaatga ttggttttca aaattggcca gttctgcctt cagcggtctc 240 ttcggcgctc ttctcgctga caaaaagaca gaggagacta ccctcctgga agaccgcatc 300 ctcaccaccc gcaacggaca caccacctcg acagcaccgt agt36gtcgtc gggtactcca ctggggaaga ccacgtctct ggacctaaca catctggcct ggagacgcga 420 gtggtacagg cagagagatt cttcaagaaa cacttgtttg attggacaac cgataaagct 480 tttggacacc tggaaaaact ggaactcccc actgacacc aggcagtagc gtggactctt tcgcatacat gagaaatggc tgggacgtgg aggtgaccgc cgtggcaac 600 cagttcaacg gtgggtgtct cctggtggcc atggtacctg agtggaaaga gtttaccctt 660 cgtgagaaat accagctcac cctttcca caccaattta tcaccacattag 720 acagcccaca tcacggtccc gtaccttggt gtcaataggt atgaccagta caaacagcac 780 aaaccctgga cactggtcgtgatggtggtt tcgccactga ccaccagcag cattggagct 840 tcacagatca aggtctacgc caacattgcc ccaaccttcg ttcacgtggc cggcgagctc 900 ccatcgaagg aagggatcgt gccggttgct tgttcagacg ggtacggtgg cctggtgaca 960 acagacccga aaacagctga ccctgtttat ggtatggtct acaacccgcc cagaaccaac 1020 taccctgggc gctttacaaa cttgttggac gtggccgagg cttgcccgac cttcctctgt 1080 tttgacgacg ggaaaccgta cgttgtgaca aggacggacg accaacgtct cctggccaag 1140 tttgacgttt ctcttgctgc aaagcacatg tcaaacacct acctctcagg gatagcacag 1200 tactacacac agtactctgg cactatcaat ctgcacttca tgttcactgg ctctactgaa 1260 tcaaaggccc ggtacatggt ggcgtacatt ccacctggca tggacacgcc accggacaca 1320 cctgagaagg ctgcacattg catccacgcc gagtgggaca ccgggctgaa ctccaaattt 1380 actttttcta tcccgtacgt gtctgctgca gactacgcat acactgcgtc tgacgtggca 1440 gaaacaacaa acgtacaggg gtgggtctgc atataccaaa tcacccacgg gaaggctgag 1500 caggacactc tggtcgtgtc ggtcagcgcc ggcaaggact ttgaactgcg cctcccaatt 1560 gacccccgca cgcaaaccac cactgccggg gagtcagcag accctgtcac caccaccgtt 1620 gagaactacg gtggtgagac acaggctcag cgacagcgcc acactgacgt cggcttcatc 1680 atggacaggt ttgtgaaaat cagccccgtg agccccacgc acgtcattga cctcatgcaa 1740 acacaccaac acgcgttggt gggtgccctt ttgcgtgcag ccacgtacta cttctccgat 1800 ctggagatcg tggtgcgtca tgatggtaac ttgacgtggg tgcccaatgg agcacctgta 1860 gaagccttgg ccaacacaag caaccccacc gcctaccaca agcagccatt tacgagactt 1920 gcgctccctt acaccgcgcc gcaccgagtg ttggcaacag tgtataacgg agtaagcaag 1980 tactctcaa ctggtaatgg tagaaggggt gacctggggc ctcttgcgg gcgggtcgcc 2040 gcacagctcc ccagctcttt caactttggt gcaattcggg ccacgaccat ccacgagctt 2100 ctcgtgcgca tgaaacgtgc cgagctctac tgtcccaggc ctctgctggc agtggaagtg 2160 ttgtcgcagg acagacacaa gcaaaagatc attgcaccta caaagcaact ggcccttct cctgaacttc 2220 gacctgctca agttggcggg agacgtcgag tccaaccctg cttctctgac 2280gtcaggacga acttttctaa gctggttgac accatcaacc agatgcagga ggacatgtca 2340 acaaaacacg ggcccgactt taaccggttg gtgtctgcgt ttgaggaatt ggccgctgga 2400 gtgaaagcta tcaggaccgg tctcgacgag gccaagccct ggtacaagct cattaagctc 2460 ctgagccgcc tgtcatgcat ggccgctgta gcagcacggt caaaggaccc agtccttgtg 2520 gccatcatgc tagctgacac cggtctcgag attctggaca gcacctttgt cgtgaagaag 2580 atctccgact cgctctccag tctctttcac gtgccggccc ccgtcttcag cttcggagcc 2640 ccgattctgc tggccgggtt ggtcaaagtc gcctcgagtt tcttccggtc cacacccgaa 2700 gaccttgaga gagcagagaa acagctcaaa gcacgtgaca tcatcgagcg tcagaaacct 2760 ctgaaagtga gagccaagct cccacagcag gaggggccct acgctggtcc gatggagaga 2820 caaaagcccc tgaaagtgaa agcaaaagcc ccggtcgtaa aggaaggacc ttacgagggg 2880 cttgtgaaga aacctgtcgc tttgaaagtg aaagccaaaa atttgattgt cactgagagt 2940 ggtgcccccc cgaccgactt gcaaaagatg gtcatgggca acaccaagcc tgttgagctc 3000 atcctcgacg ggaagacggt agccatctgt tgcgctaccg gagtgtttgg cactgcttac 3060 cttgtaccac gtcatctttt cgcggagaag tatgacaaga tcatgctgga cggcagagcc 3120atgacagaca gtgactacag agtgtttgag tttgagatta aagtaaaagg acaggacatg 3180 ctttcagatg ccgcgctcat ggtgctccac cgtgggaatc gcgtgagaga tatcacgaaa 3240 cactttcgtg acacagcaag aatgaagaag ggcacccccg ttgtcggtgt tatcaacaac 3300 gccgatgtcg ggagactgat tttctctggt gaggccctta cctácaagga cattgtagtg 3360 tgtatggatg gagacaccat gcctggcctc tttgcctaca gagccgccac caaggctggc 3420 tattgtggag gagctgttct tgcaaaggac ggagccgaga ctttcatcgt cggcactcac 3480 tccgcaggcg gtaatggagt tggatactgt tcatgcgttt ccaggtccat gctgctaaaag 3540 atgaaggcac acattgaccc tgagccacac cacgagtaa 3579 <210> 6 <211> 1192 ' <212> PRT <213> artificial secuencia <220> <223> Antígeno de FMDV Irn <400> 6 · <·' · : ¿ Met Gly Ala Gly Gln Ser Ser Pro Ala.Thr Gly Ser Gln Asn Gln Ser 1 5 10 15 Gly Asn Thr Gly Ser lie lie Asn Asn Tyr Tyr Met Gln Gln Tyr Gln 20 25 30 Asn Ser Met Asp Thr Gln Leu Gly Asp Asn Ala lie Ser Gly Gly Ser 35 40 45 Asn Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Thr Asn Thr Gln 50 55 60 Asn 65 Asn Asp Trp Phe Ser Lys 70 Leu Ala Ser Ser Ala Phe Ser 75 Gly Leu 80 Phe Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu 85 90 95 Glu Asp Arg lie Leu Thr Thr Arg Asn Gly His Thr Thr Ser Thr Thr 100 105 110 Gln Ser Ser Val Gly Val Thr Tyr Gly Tyr Ser Thr Gly Glu Asp His 115 120 125 Val Ser Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Val Gln Ala 130 135 140 Glu Arg Phe Phe Lys Lys His Leu Phe Asp Trp Thr Thr Asp Lys Ala 145 150 155 160 Phe Gly His Leu Glu Lys Leu Glu Leu Pro Thr Glu His Lys Gly Val 165 170 175 Tyr Gly His Leu 180 Val Asp Ser Phe Ala Tyr Met Arg Asn Gly Trp Asp 185 190 Val Glu Val Thr Ala Val Gly Asn Gln Phe Asn Gly Gly Cys Leu Leu 195 200 205 Val Ala Met Val Pro Glu Trp Lys Glu Phe Thr Leu Arg Glu Lys Tyr 210 215 220 Gln 225 Leu Thr Leu Phe Pro His Gln Phe lie Asn Pro Arg Thr Asn Met 230 235 240 Thr Ala His He Thr Val Pro Tyr Leu Gly Val Asn Arg Tyr Asp Gln 245 250 255 Tyr Lys Gln His Lys Pro Trp Thr Leu Val Val Met Val Val Ser Pro 260 265 270 Leu Thr Thr Ser Ser He Gly Ala Ser Gln lie Lys Val Tyr Ala Asn 275 280 285 lie Ala Pro Thr Phe Val His Val Ala Gly Glu Leu Pro Ser Lys Glu 290 295 300 Gly He Val Pro Val Ala Cys Ser Asp Gly Tyr Gly Gly Leu Val Thr 305 310 315 320 Thr Asp Pro Lys Thr Ala Asp Pro Val Tyr Gly Met Val Tyr Asn Pro 325 330 335 Pro Arg Thr Asn Tyr Pro Gly Arg Phe Thr Asn Leu Leu Asp Val Ala 340 345 350 Glu Ala Cys Pro Thr Phe Leu Cys Phe Asp Asp Gly Lys Pro Tyr Val 355 360 365 Val Thr 370 Arg Thr Asp Asp Gln 375 Arg Leu Leu Ala Lys 380 Phe Asp Val Ser Leu Ala Ala Lys His Met Ser Asn Thr Tyr Leu Ser Gly He Ala Gln 385 390 395 400 Tyr Tyr Thr Gln Tyr Ser Gly Thr He Asn Leu His Phe Met Phe Thr 405 410 415 Gly Ser Thr Glu Ser Lys Ala Arg Tyr Met Val Ala Tyr lie Pro Pro 420 425 430 Gly Met Asp 435 Thr Pro Pro Asp Thr Pro Glu Lys Ala Ala His Cys lie 440 445 His Ala Glu Trp Asp Thr Gly Leu Asn Ser Lys Phe Thr Phe Ser lie 450 455 460 Pro Tyr Val Ser Ala Ala Asp Tyr Ala Tyr Thr Ala Ser Asp Val Ala 465 470 475 480 Glu Thr Thr Asn Val Gln Gly Trp Val 485 Cys 490 lie Tyr Gln lie Thr His 495 Gly Lys Ala Glu Gln Asp Thr Leu Val Val Ser Val 500 505 Ser Ala Gly Lys 510 Asp Phe Glu Leu Arg Leu 515 Ala Gly Glu Ser Ala Asp 530 Pro lie Asp Pro Arg 520 Pro Val Thr Thr Thr 535 Gly Glu Thr Gln Ala Gln Arg Arg Gln His 545 550 Thr Gln Thr Thr Thr 525 Val Glu Asn Tyr Gly 540 Thr Asp Val Gly Phe 555 lie 560 Met Asp Arg Phe Val Lys 565 lie Ser Pro Val 570 Ser Pro Thr His Val 575 lie Asp Leu Met Gln Thr His Gln His Ala Leu Val Gly Ala Leu Leu Arg 580 585 590 Ala Ala Thr Tyr Tyr Phe Ser Asp Leu Glu lie Val Val Arg His Asp 595 600 605 Gly Asn Leu Thr Trp Val 610 Pro Asn Gly Ala Pro Val Glu Ala Leu Ala 615 620 Asn Thr Ser Asn Pro Thr Ala Tyr His Lys Gln Pro Phe Thr Arg Leu 625 630 635 640 Ala Leu Pro Tyr Thr Ala Pro His Arg Val Leu Ala Thr Val Tyr Asn 645 650 655 Gly Val Ser Lys Tyr Ser Thr Thr Gly Asn Gly Arg Arg Gly Asp Leu 660 665 670 Gly Pro Leu 675 Ala Ala Arg Val Ala Ala Gln Leu Pro Ser Ser Phe Asn 680 685 Phe Gly Ala lie Arg Ala Thr Thr lie His Glu Leu Leu Val Arg Met 690 695 700 Lys Arg Ala Glu Leu Tyr Cys Pro Arg Pro Leu Leu Ala Val Glu Val 705 710 715 720 Leu Ser Gln Asp Arg His Lys Gln Lys lie lie Ala Pro Thr Lys Gln 725 730 735 Leu Leu Asn Phe Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser Asn 740 745 750 Pro Gly Pro Phe Phe Ser Asp Val Arg Thr Asn Phe Ser Lys Leu 755 760 765 Val Asp Thr lie Asn Gln Met Gln Glu Asp Met Ser Thr Lys His Gly 770 775 780 Pro Asp Phe Asn Arg Leu Val Ser Ala Phe Glu Glu Leu Ala Ala Gly 785 790 795 800 Val Lys Ala lie Arg Thr Gly Leu Asp Glu Ala Lys Pro Trp Tyr Lys 805 810 815 Leu lie Lys Leu Leu Ser Arg Leu Ser Cys Met Ala Ala Val Ala Ala 820 825 830 Arg Ser Lys Asp Pro Val Leu Val Ala lie Met Leu Ala Asp Thr Gly 835 840 845 Leu Glu lie Leu Asp Ser Thr Phe Val Val Lys Lys lie Ser Asp Ser 850 855 860 Leu Ser Ser Leu Phe His Val Pro Ala Pro Val Phe Ser Phe Gly Ala 865 870 875 880Pro lie Leu Leu Ala Gly Leu Val Lys Val Ala Ser Ser Phe Phe Arg 885 890 895 Ser Thr Pro Glu Asp Leu Glu Arg Ala Glu Lys Gln Leu Lys Ala Arg 900 905 910 Asp lie lie Glu Arg Gln Lys Pro Leu Lys Val Arg Ala Lys Leu Pro 915 920 925 Gln Gln 930 Glu Gly Pro Tyr Ala Gly Pro Met Glu Arg Gln Lys Pro Leu 935 940 Lys Val Lys Ala Lys Ala Pro Val Val Lys Glu Gly Pro Tyr Glu Gly 945 950 955 960 Leu Val Lys Lys Pro Val Ala Leu Lys Val Lys Ala Lys Asn Leu He 965 970 975 Val Thr Glu Ser Gly Ala Pro Pro Thr Asp Leu Gln Lys Met Val Met 980 985 990 Gly Asn Thr Lys 995 Pro Val Glu Leu 1000 lie Leu Asp Gly Lys Thr Val Ala 1005 lie Cys Cys Ala Thr Gly Val 1015 Phe Gly Thr Ala Tyr 1020 Leu Val Pro 1010 Arg His 1025 Leu Phe Ala Glu Lys 1030 Tyr Asp Lys He Met 1035 Leu Asp Gly Arg Ala 1040 Met Thr Asp Ser Asp 1045 Tyr Arg Val Phe Glu 1050 Phe Glu He Lys Val 1055 Lys Gly Gln Asp Met 1060 Leu Ser Asp Ala Ala 1065 Leu Met Val Leu His 1070 Arg Gly Asn Arg Val 1075 Arg Asp He Thr Lys 1080 His Phe Arg Asp Thr 1085 Ala Arg Met Lys Lys 1090 Gly Thr Pro Val Val 1095 Gly Val lie Asn Asn 1100 Ala Asp Val Gly Arg 1105 Leu He Phe Ser Gly 1110 Glu Ala Leu Thr Tyr 1115 Lys Asp He Val Val 1120 Cys Met Asp Gly ' 'i ΰ Asp 1125 Thr Met Pro Gly Leu 1130 Phe Ala Tyr Arg Ala 1135 Ala Thr Lys Ala Gly 1140 Tyr Cys Gly Gly Ala 1145 Val Leu Ala Lys Asp 1150 Gly Ala Glu Thr Phe 1155 He Val Gly Thr His 1160 Ser Ala Gly Gly Asn 1165 Gly Val Gly Tyr Cys 1170 Ser Cys Val 100 Ser Arg Ser Met Leu Leu Lys Met Lys Ala His lie Asp Pro Glu 1175 1180 1185 Pro His His Glu 1190 <210> 7 <211> 3576 <212> DNA <213> artificial sequence <220> <223> Polynucleotide Encoding Antigen of FMVD Asia <400> 7 atgggagccg gtcaatccag tccggcaacc gggtcacaga accaatctgg caacactgga 60 agcatcatta acaáctacta catgcaacag taccagaatt ccatggacac acagcttggt 120 gacaacgcta ttagcggagg ttccaacgaa ggttccacgg attack18 accac aaaacaacga ctggttctcg cgcctggcta gctctgcatt cagtggtctc 240 tttggtgcac ttttggctga caagaagaca gaagagacaa ctctgcttga agaccgcatt 300 ctcaccacca ggaacggcca cacaacatcg acgacagt cgagcttc ggttacgctg tggccgagga cgcggtgtct ggacccaata cctcgggtct agagactcgt 420 gttcaacagg cagaacggtt tttcaagaaa cacctgtttg actggacacc gaacttggca 480 tttggacact gttactacct ggaacttccc actgaacactc atgggctcgt acgcctacat gagaaatgga tgggacatag aggtgactgc tgttggaaac 600 caattcaacg gtggttgtct ccttgtcgcg ctcgtgccag agctgaagga actcgacacg 660 cgacagaagt accagctgac cctctttcc cacacag caccag caccag720 acggcccaca tcaacgtgcc gtacgtgggt atcaacaggt acgaccagta cgccctccac 780 aagccgtgga cgcttgttgtgatggtggta gccccactca ccgtcaaaac tggtggttct 840 gaacagatca aggtttacat gaatgcagcg ccaacctacg tgcatgtggc gggagagctg 900 ccctcgaaag agggaatagt tcccgtcgcg tgtgcggacg gttacggcaa catggtgacc 960 acggacccga agacggccga tccagtttac gggaaagtgt tcaaccccccc caggacaaac 1020 ctccctgggc gcttcacgaa cttccttgat gttgcggagg catgtccaac tttcctccgc 1080 tttggagaag taccatttgt gaagacggtg aactctggtg accgcttgct ggccaagttc 1140 gacgtgtccc tcgctgcagg gcacatgtcc aacacctact tggctggcct ggcgcagtac 1200 tacacacagt acagcggcac catgaacgtc cacttcatgt tcaccgggcc cacggatgct 1260 aaagcccgat acatggtggc ttatgtcccc cctggcatga caccgcccac ggaccctgag 1320 101 cacgccgcac actgcattca ctctgagtgg gatactggtc ttaacttaa gtttaccttt 1380 tccatacctt acctctctgc tgctgactat gcctacactg cttctgacgt ggcggagacc 1440 acgagtgtgc agggatgggt gtgtatctat cagatcaccc acggcaaggc tgagggagac 1500 gcactggtcg tttctgtcag cgccggcaaa gactttgagt ttcgcttgcc tgttgacgca 1560 cgccagcaaa ccaccaccac tggcgaatca gcagatccag tcacaaccac ggttgagaac 1620 tatggagag agactcagac agccagacgg cttcacactg acgtcgcctt cattcttgac 1680 aggtttgtga aactcactgc tcccaagaac atccaaaccc tcgatctcat gcagatcccc 1740 tcacacacgc tggttggagc actacttcgt tctgcgacgt actapttctc agacctggag 1800 gtcgcgcttg tccacacagg cccggtcacc tgggtgccca acggggcgcc caaggatgct 1860 ctaaacaacc agaccaaccc aactgcctat cagaagcaac ccatcacccg cctggcactc 1920 ccctacaccg ccccccatcg tgtgctggca acagtgtaca acgggaagac ggcgtacggg 1980 gaaacgacct caaggcgcgg cgacatggcg gccctcgcac aaaggttgag cgctcggctg 2040 cccacctcct tcaactacgg cgccgtgaag gccgacacca tcactgagct tttgatccgc 2100 atgaagcgcg cggagacata ttgccctagg cccttactag cccttgacac cactcaggac 2160cgccgcaaac stirring tgcacctgag ; ΐ aagcaggttt tgaactttga cctactcaag 2220 ttggcaggag acgttgagtc caaccctggg cccttcttct tctccgacgt taggtcgac 2280 ttctccaaac tggtcgagac catcaaccag atgcaggagg acatgtcaac aaagcacgga 2340 cccgacttca accggttggt ttccgcgttt gaggaattgg ccacaggagt aaaggccatc 2400 aggaacggtc tcgatgaggc caagccctgg tacaagctca tcaaactcct aagccgcctg 2460 tcgtgcatgg ccgctgtagc agcacggtcc aaggacccag tccttgtggc catcatgctg 2520 gctgacaccg gtcttgagat tctggacagc acgttcgtcg tgaagagat ctccgactcg 2580 ctctccagtc tctttcacgt gccggcccc gtcttcagtt tcggagctcc gattctgttg 2640 gctgggttgg tcaaagtcgc ctcgagttc ttccggtcca cacccgaaga ccttgagaga 2700 gcagagaaac agctcaaagc acgtgacatc aacgacatac tcgagcgtca gaaacccctg 2760 aaagtgagag ctaagctgcc acaacatgag ggaccttacg ctggcccgat ggagagacag 2820 aaaccactga aaagtgaaagc aaaagccccg gtcgttaagg aaggacctta cgagggaccg 2880 gtgaagaagc ctgtcgcttt gaaagtgaaa gctaagaact tgattgtcac tgagagtggt 2940 gccccaccga ccgacttgca aaagatggtc atgagcaaca ctaagcctgt tgagctcatc 3000cttgacggta agacggtggc catctgctgc gccaccggag tgtttggtac tgcctacctc 3060 gtgcctcgtc accttttcg agaaaagtac gacaggatca tgttggacgg cagggccatg 3120 agacagagtg actacagagt gtttgagttt gagattaag taaaaggaca ggacatgctc 3180 tcagacgctg cgctcatggt gctccaccgt ggcaaccgtg tgagagacat cacaaacac 3240 102 tttcgtgata cagcaagaat gaagaaaggt accccccgttg tcggcgtgat caacaacgcc 3300 gacgttggga gactgatttt ctccggtgag gccctcacct acaaggacat tgtagtgtgc 3360 atggatggag acaccatgcc gggcctattt gcctacagag ccgctaccaa ggctggctac 3420 tgtggaggag ccgttcttgc caaggacgga gctgacacat ttatcgtcgg cactcactcc 3480 gcaggaggca atggagtcgg gtactgctca tgggtatcta ggtccatgct cttgaagatg 3540 aaggcacaca ttgaccccga accacaccac gagtag 3576 <210> 8 <211> 1191 <212> PRT <213> artificial sequence <220> <223> FMVD Asia antigen <400> 8 Met Gly 1 Ala Gly Gln Ser Ser Pro Ala Thr Gly Ser Gln Asn Gln 15 Ser 5 10 Gly Asn Thr Gly Ser lie lie Asn Asn Tyr Tyr Met. Gln Gln Tyr Gln 20 25 30 Asn Ser Met Asp Thr Gln Leu Gly Asp Asn Ala He Ser Gly Gly Ser 35 40 45 Asn Glu Gly Ser Thr Asp Thr Thr Ser Thr His Thr Asn Asn Thr Gln 50 55 60 Asn Asn Asp Trp Phe Ser Arg Leu Ala Ser Ser Ala Phe Ser Gly Leu 65 70 75 80 Phe Gly Ala Leu Leu Ala Asp Lys Lys Thr Glu Glu Thr Thr Leu Leu 85 90 'V. - 95 Glu Asp Arg lie Leu Thr Thr Arg Asn Gly His Thr Thr Ser Thr Thr 100 105 110 Gln Ser Ser Val Gly Val Thr Tyr Gly Tyr Ala Val Ala Glu Asp Ala 115 120 125 Val Ser Gly Pro Asn Thr Ser Gly Leu Glu Thr Arg Val Gln Gln Ala 130 135 140 Glu Arg Phe Phe Lys Lys His Leu Phe Asp Trp Thr Pro Asn Leu Ala 145 150 155 160 103 Phe Gly His Cys Tyr Tyr Leu Glu Leu Pró Thr Glu His Lys Gly Val 165 170 175 Tyr Gly Ser Leu Met Gly Ser Tyr Ala Tyr Met Arg Asn Gly Trp Asp 180 185 190 lie Glu Val Thr Ala Val Gly Asn Gln Phe Asn Gly Gly Cys Leu Leu 195 200 205 Val Ala Leu Val Pro Glu Leu Lys Glu Leu Asp Thr Arg Gln Lys Tyr 210 215 220 Gln Leu Thr Leu Phe Pro His Gln Phe lie Asn Pro Arg Thr Asn Met 225 230 235 240 Thr Ala His lie Asn Val Pro Tyr Val Gly lie Asn Arg Tyr Asp Gln 245 250 255 Tyr Ala Leu His Lys Pro Trp Thr Leu Val Val Met Val Val Ala Pro 260 265 270 Leu Thr Val Lys Thr Gly Gly Ser Glu Gln lie Lys Val Tyr Met Asn 275 280 285 Ala Ala Pro Thr Tyr Val His Val Ala Gly Glu Leu Pro Ser Lys Glu 290 295 300 Gly lie Val Pro Val Ala Cys Ala Asp Gly Tyr Gly Asn Met Val Thr 305 310 315 320 Thr Asp Pro Lys Thr Ala Asp Pro Val Tyr Gly Lys Val Phe Asn Pro 325 330 335 Pro Arg Thr Asn Leu Pro Gly Arg Phe Thr Asn Phe Leu Asp Val Ala 340 345 350 Glu Ala Cys Pro Thr Phe Leu Arg 360 Phe Gly Glu Val Pro Phe Val 365 Lys 355 Thr Val Asn Ser Gly Asp Arg Leu Leu Ala Lys Phe Asp Val Ser Leu 370 375 380 Ala Ala Gly His Met Ser Asn Thr Tyr Leu Ala Gly Leu Ala Gln Tyr 385 390 395 400 Tyr Thr Gln Tyr Ser Gly Thr Met Asn Val His Phe Met Phe Thr Gly 405 410 415 104 Pro Thr Asp Ala Lys Ala Arg Tyr Met Val Ala Tyr Val Pro 430 Pro Gly 420 425 Met Thr Pro Pro Thr Asp Pro Glu His Ala Ala His Cys lie His Ser 435 440 445 Glu Trp Asp Thr Gly Leu Asn Ser Lys Phe Thr Phe Ser lie Pro Tyr 450 455 460 Leu Ser Ala Ala Asp Tyr Ala Tyr Thr Ala Ser Asp Val Ala Glu Thr 465 470 475 480 Thr Ser Val Gln Gly Trp Val Cys lie Tyr Gln lie Thr His Gly Lys 485 490 495 Ala Glu Gly Asp Ala Leu Val Val Ser Val Ser Ala Gly Lys Asp Phe 500 505 510 Glu Phe Arg Leu Pro Val Asp Ala Arg Gln Gln Thr Thr Thr Thr Gly 515 520525 Glu Ser Ala Asp Pro Val Thr Thr Thr Val Glu Asn Tyr Gly Gly Glu 530 535540 ' Thr Gln Thr Ala Arg Arg Leu His Thr Asp Val Ala Phe lie Leu Asp 545 550 555560 Arg Phe Val Lys Leu Thr Ala Pro Lys Asn lie Gln Thr Leu Asp Leu 565 570575 Met Gln lie Pro Ser His Thr Leu Val Gly Ala Leu Leu Arg Ser Ala 580 585590 Thr Tyr Tyr Phe Ser Asp Leu Glu Val Ala Leu 600 Val His Thr 605 Gly Pro 595 Val Thr Trp Val Pro Asn Gly Ala Pro Lys Asp Ala Leu Asn Asn Gln 610 615 620 Thr Asn Pro Thr Ala Tyr Gln Lys Gln Pro lie Thr Arg Leu Ala Leu 625 630 635 640 Pro Tyr Thr Ala Pro His Arg Val Leu Ala Thr Val Tyr Asn Gly Lys 645 650 655 Thr Ala Tyr Gly Glu Thr Thr Ser Arg Arg Gly Asp Met Ala Ala Leu 105 660 665 670 Ala Gln Arg Leu Ser Ala Arg Leu Pro Thr 680 Ser Phe Asn 685 Tyr Gly Ala 675 Val Lys Ala Asp Thr lie Thr Glu Leu Leu lie Arg Met Lys Arg Ala 690 695 700 Glu Thr Tyr Cys Pro Arg Pro Leu Leu Ala Leu Asp Thr Thr Gln Asp 705 710 715 720 Arg Arg Lys Gln Glu lie lie Ala Pro Glu Lys Gln Val Leu Asn Phe 725 730 735 Asp Leu Leu Lys Leu Ala Gly Asp Val Glu Ser Asn Pro Gly Pro Phe 740 745 750 Phe Phe Ser Asp Val Arg Ser Asn Phe Ser Lys Leu Val Glu Thr lie 755 760 765 Asn Gln Met Gln Glu Asp Met Ser Thr Lys His Gly Pro Asp Phe Asn 770 775 780 Arg Leu Val Ser Ala Phe Glu Glu Leu Ala Thr Gly Val Lys Ala lie 785 790 795 800 Arg Asn Gly Leu Asp Glu Ala Lys Pro Trp Tyr Lys Leu lie Lys Leu 805 810 815 Leu Ser Arg Leu Ser Cys Met Ala Ala Val Ala Ala Arg Ser Lys Asp 820 825 830 Pro Val Leu Val Ala lie Met Leu Ala Asp Thr Gly Leu Glu lie Leu 835 840 845 Asp Ser Thr Phe Val Val Lys Lys lie Ser Asp Ser Leu Ser Ser Leu 850 855 860 Phe His Val Pro Ala Pro Val Phe Ser Phe Gly Ala Pro lie Leu Leu 865 870 875 880Ala Gly Leu Val Lys Val Ala Ser Ser Phe Phe Arg Ser Thr Pro Glu 885 890 895 Asp Leu Glu Arg Ala Glu Lys Gln Leu Lys Ala Arg Asp lie Asn Asp 900 905 910 106 He Leu Glu Arg 915 Gln Lys Pro Leu 920 Lys Val Arg Ala Lys 925 Leu Pro Gln His Glu Gly Pro Tyr Ala Gly Pro Met Glu Arg Gln Lys Pro Leu Lys 930 935 940 Val Lys Ala Lys Ala Pro Val Val Lys Glu Gly Pro Tyr Glu Gly Pro 945 950 955 960 Val Lys Lys Pro Val Ala Leu Lys Val Lys Ala Lys Asn Leu He Val 965 970 975 Thr Glu Ser Gly Ala Pro Pro Thr Asp Leu Gln Lys Met Val Met Ser 980 985 990 Asn Thr Light 995 Pro Val Glu Leu lie 1000 Leu Asp Gly Lys Thr Val Ala lie 1005 Cys Cys 1010 Ala Thr Gly Val Phe 1015 Gly Thr Ala Tyr Leu 1020 Val Pro Arg His Leu 1025 Phe Ala Glu Lys Tyr 1030 Asp Arg He Met Leu 1035 Asp Gly Arg Ala Met 1040 Thr Asp Ser Asp Tyr 1045 Arg Val Phe Glu Phe 1050 Glu He Lys Val Lys 1055 Gly Gln Asp Met Leu 1060 Ser Asp Ala Ala Leu 1065 Met Val Leu His Arg 1070 Gly Asn Arg Val Arg 1075 Asp He Thr Lys His 1080 Phe Arg Asp Thr Ala 1085 Arg Met Lys Lys Gly 1090 Thr Pro Val Val Gly 1095 Val He Asn Asn Ala 1100 Asp Val Gly Arg Leu 1105 He Phe Ser Gly Glu 1110 Ala Leu Thr Tyr Lys 1115 Asp lie Val Val Cys 1120 Met Asp Gly Asp Thr 1125 Met Pro Gly Leu Phe 1130 Ala Tyr Arg Ala Ala 1135 Thr Lys Ala Gly Tyr 1140 Cys Gly Gly Ala Val 1145 Leu Ala Lys Asp Gly 1150 Ala Asp Thr Phe He 1155 Val Gly Thr 107 His Ser Ala Gly Gly Asn Gly Val Gly Tyr Cys 1160 1165 Ser Cys Val Ser 1170 Arg Ser Met Leu Leu Lys Met Lys Ala His lie Asp Pro Glu Pro 1175 1180 1185 His His Glu 1190 108

Claims

1. A veterinary composition, excluding its use in humans, characterized in that it comprises a recombinant viral vector expressing a foot-and-mouth disease virus (FMDV) antigen, wherein the FMDV antigen comprises a polypeptide having the sequence specified in SEQ ID NO: 4, 6, or 8; wherein the viral vector is an adenovirus; wherein the composition further comprises a veterinarily acceptable carrier, excipient, adjuvant, or vehicle; and wherein the veterinarily acceptable carrier, excipient, adjuvant, or vehicle is selected from the group consisting of polyacrylic acid, LF2 emulsion, LR6 emulsion, TS6 emulsion, LR4 emulsion, carbomer, aluminum hydroxide, aluminum phosphate, saponin, CpG, water-in-oil emulsion, oil-in-water emulsion, and carbomer-based adjuvant. Two claims follow.