Title - ISOLATED POLYNUCLEOTIDE

AR111157B2Active Publication Date: 2026-08-26SYNGENTA CROP PROTECITON AG
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
ARP20180100482
Authority / Receiving Office
AR · AR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2008-07-14
Filing Date
2018-03-02
Publication Date
2026-08-26
Estimated Expiration
2029-07-13

AI Technical Summary

Technical Problem

Existing genetic modification techniques in plants result in the expression of proteins in reproductive tissues like pollen, affecting non-target insects and potentially causing harm, while also impacting the development of these structures.

Method used

A regulatory polynucleotide sequence that directs expression of a protein of interest in all plant tissues except reproductive structures, particularly pollen and spike tissues, using a chimeric polynucleotide construct with a transcription initiation function derived from actin depolymerizing factor 3 (ABP3) gene.

Benefits of technology

Ensures significant expression of proteins like insecticidal proteins in vegetative tissues without affecting pollen or spike tissues, minimizing harm to non-target insects and maintaining plant development.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This application relates to regulatory sequences. In particular, it relates to a regulatory nucleotide sequence, where at least part of this sequence has a transcription initiation function that directs the expression of a polynucleotide encoding a protein operatively associated with tissue other than, but not or substantially not pollen, pollen. It further relates to chimeric genes and expression cassettes comprising the regulatory sequence and to transgenic plants comprising the chimeric genes and expression cassettes.
Need to check novelty before this filing date? Find Prior Art

Description

PLANT REGULATORY SEQUENCE Field of Invention The present invention relates to the field of plant biotechnology and regulatory sequences. In particular, the invention relates to a regulatory polynucleotide sequence, where at least part of it has a transcription initiating function that directs the expression of an operatively associated protein-encoding polynucleotide of interest to basically all plant tissues. , but which essentially excludes expression in the tissues of reproductive structures of the plant, in particular in the pollen and / or spike tissues such that there is no significant expression product in the tissues. The invention further relates to chimeric genes and expression cassettes of plants comprising the regulatory sequence in association with a polynucleotide encoding the expressible protein of interest and with transgenic plants comprising the chimeric genes and expression cassettes, respectively, expressing the encoding polynucleotide of the protein of interest in essentially all plant tissues, but essentially exclude expression in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues in such a way that no expression product is present in tissues significantly. Background of the Invention In many agricultural crops, such as corn, devastating pests tend to feed on vegetative tissues, such as the leaf, stem, and root, and reproductive tissues, such as the ear. One technique used to protect plants against pests is the application of chemical compounds. An alternative technique 10 involves genetic recombination, where one or more genes are introduced into the plant to express protein products that are directly or indirectly involved in the control of pest organisms. The current protein products, produced by genetic recombination, are expressed constitutively, that is, in the entire plant at all times and in most tissues and organs. These protein products are also specifically expressed, either in response to particular stimuli or limited to specific cells or tissues. In contrast, the present invention includes expression of the protein or polynucleotide of interest in substantially all plant tissues, but essentially excludes expression in tissues of reproductive structures in the plant, particularly pollen and tissue tissues. / or the spike in such a way that no expression product is present in the tissues to a significant extent. Several insect control trait genes are targeted at the larval level of development. In some circumstances, these proteins also affect unintended insects that are not pests to corn but sometimes feed on corn pollen. Those insects can be affected by insectic proteins expressed in the pollen tissue. This has been a problem in early events of BT maize, which had high expression of the insecticidal protein in the pollen. This tissue was addressed in subsequent BT maize events through the development of alternative transgene expression systems. These more recent events were still effective against target pests and accumulated less insecticidal protein in pollen, but are still considered potentially dangerous to non-target pests because of the presence of insecticidal protein in pollen. In some cases, useful control trait genes may also affect the development of reproductive structures in the plant, such as the spike. Thus, it is desirable to provide plants, particularly maize plants, that exclude expression of the transgene in tissues of the reproductive structures of the plant, such as pollen and / or ear tissues. This could be achieved within the scope of the invention by providing a regulatory nucleotide sequence, where at least part of it has a transcription initiating function that directs the expression of an operatively associated protein encoding a polynucleotide of interest for essentially all tissues of the plant, but which essentially excludes expression in the tissues of reproductive structures of the plant, in particular in the pollen and / or spike tissues such that there is no significant expression product in the tissues. This nucleotide regulatory sequence can then be used to develop expression systems that allow effective accumulation of the polypeptide or protein of interest, such as an insecticidal protein, in tissues on which target pests normally feed, and to eliminate or reduce accumulation of the insecticidal protein in non-target tissues or organs and / or in tissues likely to be affected by the polypeptide or protein of interest. Summary of the Invention In one embodiment, the invention relates to a transgenic plant comprising, stably integrated into its genome, a construct, particularly a polynucleotide construct of interest, or a chimeric, chimeric polynucleotide, comprising a particular polynucleotide encoding a polypeptide or protein of interest, associated with and / or under the control of a regulatory nucleotide sequence, where at least part thereof has a transcription initiation function that directs expression of the protein-encoding polynucleotide of interest to essentially all plant tissues, particularly tissues on which insects typically feed, but essentially excluding pollen and / or spike tissues such that there is no significant expression product in the tissues. In one embodiment, the polynucleotide of interest, particularly a polynucleotide encoding a polypeptide or protein of interest, is not significantly transcribed in the tissues of plant reproductive structures, particularly in the pollen and / or spike tissue of the plant. transgenic plant according to the invention. Therefore, essentially no expression of the polynucleotide of interest, particularly a polynucleotide encoding a polypeptide or protein of interest, occurs in the tissues of the reproductive structures of the male plant, particularly in the pollen and / or spike tissues, and only trace amounts of the expression product, if any, can be detected in tissues, which is not sufficient for the expression product to fulfill its intended biological function in tissues, particularly on pollen and / or spike tissues, and therefore does not exhibit any toxic effects on insects that feed on those tissues or on plant reproductive structures. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein a chimeric polynucleotide construct, particularly a chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding . protein or polypeptide of interest, operatively associated with and / or under operative control of a regulatory nucleotide sequence, at least part of which has a transcription initiation function and can be derived from a gene encoding actin depolymerizing factor 3 ( ABP3), the polypeptide or protein being expressed in most plant tissues, but essentially excluding . pollen tissues such that no expression product is present in the tissues to a significant extent. In one embodiment, the actin depolymerizing factor 3 (ABP3) gene can be obtained from maize. In one embodiment of the invention, there is provided a transgenic plant as described herein, wherein a chimeric polynucleotide construct, in particular a chimeric DNA construct, comprises a polynucleotide of interest, in particular a polynucleotide encoding a polypeptide or protein of interest, operationally associated and / or under the operational control of a regulatory nucleotide sequence, which has at least partly a transcription initiating function and can be obtained from a gene represented by a DNA probe, particularly a DNA probe displaying a DNA sequence as described in SEQ ID NOs: 47 to 56, the DNA probe exhibiting a signal pattern in tissue samples indicating gene expression in all tissues and no or substantially no expression in pollen . In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein comprising a nucleotide regulatory sequence or polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence described in herein, wherein at least part thereof has a transcription initiation function and mediates the expression of a polynucleotide encoding an operatively associated protein of interest in most plant tissues, but essentially excluding pollen tissues from such that no expression product is present in the tissues in significant amounts, and the regulatory sequence can be obtained in a PCR reaction from a genomic Zea mays DNA template using i) a first primer having an identity of sequence of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1, particularly a first primer of SEQ ID NO: 1; or ii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly a second primer of SEQ ID NO: 2; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least the 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 1 and a second primer as a reverse primer having an identity of sequence of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2. In one embodiment, the invention relates to a transgenic plant as described herein, wherein the polynucleotide sequence providing the transcription initiation function has at least 80% to 85% sequence identity. with a nucleotide sequence represented in SEQ ID NO: 13, being also included in this all the integers included in this interval, particularly a sequence identity comprised at least between 85% and 90% with a nucleotide sequence that is represented in SEQ ID NO: 13, all integers included in this interval being also included in it, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95% , 96%, 97%, 9B% or the 99% with a nucleotide sequence as depicted in SEQ ID NO: 13, or a fragment thereof, and where the regulatory nucleotide sequence or fragment thereof mediates the transcription of an operably associated polynucleotide molecule, particularly of a polynucleotide encoding an operatively associated protein of interest such that the polynucleotide of interest is transcribed in most plant tissues, but essentially excluding pollen tissues such that no expression product is present in plant tissues meaningful way. In one embodiment, the invention relates to a transgenic plant as described herein, where the complementary strand of the polynucleotide sequence providing the transcription initiation function is capable of hybridizing to a nucleotide sequence depicted in SEQ ID NO: 13, particularly under mild hybridization conditions, more particularly under stringent hybridization conditions, and where the regulatory nucleotide sequence mediates transcription of an operatively associated polynucleotide molecule, particularly of an associated protein-encoding polynucleotide operatively of interest such that the polynucleotide of interest is transcribed in most plant tissues, but essentially excluding pollen tissues such that no expression product is present in the tissues to a significant extent. In one embodiment, the invention relates to a transgenic plant as described herein, where the polynucleotide sequence providing the transcription initiation function is the sequence depicted in SEQ ID N0-. 13 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprises a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a chimeric polynucleotide construct that comprises the regulatory sequence having at least partly a transcription termination function obtainable from a gene encoding actin depolymerizing factor 3 (ABP3), wherein the regulatory sequence mediates the transcription of an operably associated 5 polynucleotide molecule, particularly of a polynucleotide molecule encoding an operatively associated protein of interest such that the polynucleotide of interest is transcribed in most plant tissues except for pollen tissues10 but essentially including pollen tissues such that that there is no expression product present in l tissues significantly, particularly a maize actin depolymerizing factor 3 (ABP3) gene, where i) the nucleotide regulatory sequence comprises a transcription termination sequence having a sequence identity between at least 80% and 85%, also including all integers included in this interval, particularly an identity of sequence comprised at least between 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence less 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 14; or a fragment of it, which still exhibits the functionality of a completion sequence; or ii) the complementary strand of the regulatory nucleotide sequence hybridizes to a nucleotide sequence as depicted in SEQ ID NO: 14, particularly under mild hybridization conditions, more particularly under moderate-stringent hybridization conditions, particularly under mild hybridization conditions stringent, and mediates the termination of transcription of a polynucleotide encoding the operably associated protein of interest; or iii) the regulatory nucleotide sequence has the sequence depicted in SEQ ID NO: 14, including its complements. In one embodiment, the invention relates to a transgenic plant according to the invention as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising the nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising the regulatory sequence, where at least part thereof has a transcription initiation function and a transcription termination function, respectively, obtaining the regulatory nucleotide sequence of a gene encoding an actin depolymerization factor 3 (ABP3), which is expressed in most tissues of the plants but essentially excluding pollen tissues such that no expression product is present in the tissue to a significant extent, particularly of the maize actin depolymerizing factor 3 (ABP3) gene, and where the regulatory nucleotide sequence comprises a transcription initiation sequence and a transcription termination sequence, respectively, having a sequence identity between at least 80% and 85%, this also being included in this all integers included in this range, particularly a sequence identity comprised between at least 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94 %, 95%, 96%, 97%, 98%, or 99% with a nucleotide sequence as depicted in SEQ ID NO: 13 and SEQ ID NO: 14, respectively, or a fragment thereof that still exists. a exhibits full functionality as a transcription initiation or termination sequence, respectively. In one embodiment, the invention relates to a plant transgenic according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette that comprises the regulatory sequence of nucleotides or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising the regulatory sequence, where at least part of it has a transcription initiation function and a transcription termination function, respectively, obtaining the regulatory sequence 5 nucleotide length of a gene encoding actin depolymerization factor 3 (ABP3), which is expressed in most plant tissues but pollen tissues are essentially excluded such that no expression product is present in tissue significantly, particularly the maize actin depolymerizing factor 3 (ΆΒΡ3) gene, and where the nucleotide regulatory sequence comprises a transcription initiation sequence as depicted in SEQ ID NO: 13 and a transcription termination sequence 15 as depicted in SEQ ID NO:14. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising the nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising the regulatory sequence where at least part of it has a transcription initiation function and a transcription termination function, respectively, this regulatory nucleotide sequence being obtainable from a gene represented by a DNA probe, particularly a DNA probe that displays a DNA sequence as depicted in SEQ ID NOs: 47 to 56, the DNA probe showing a signal pattern in tissue samples that is indicative of gene expression in all tissues and without expression or no substantial expression in pollen. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein a chimeric polynucleotide construct, particularly the chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding a protein or polypeptide of interest. , operatively associated and / or under operative control of a 15 nucleotide regulatory sequence, where at least part of it has a transcription initiation function and can be obtained from plant genomic DNA, particularly maize genomic DNA, the polypeptide being expressed or protein in most tissues of the plant, but essentially excluding the ear tissues such that no expression product is present in the tissues to a significant extent. In one embodiment of the invention, a transgenic plant is provided as described herein, wherein the chimeric polynucleotide construct, particularly the chimeric DNA construct, comprises a polynucleotide of interest, particularly a polynucleotide encoding a polypeptide or protein of interest, operatively associated with and / or under the operative control of a regulatory nucleotide sequence, where at least part thereof has a transcription initiation function and is obtainable from a gene represented by a DNA probe, particularly a DNA probe. DNA displaying a DNA sequence as depicted in SEQ ID NOs: 57 to 79, with the DNA probe showing a signal pattern in tissue samples that is indicative of gene expression in all tissues and no or no expression substantial in the tissues of the spike. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, comprising a nucleotide regulatory sequence or an expression cassette comprising the nucleotide regulatory sequence or a polynucleotide construct, particularly a nucleotide construct. polynucleotide chimeric, comprising the regulatory sequence as described herein, this regulatory sequence being obtainable by PCR reaction of a genomic Zea mays DNA template using i) a first primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19, particularly the primer of SEQ ID NO: 19; OR ii) a second primer having at least 90% sequence identity, particularly at least the 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the reverse primer of SEQ ID NO: 20; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: .19 and a second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 20, particularly the forward primer of SEQ ID NO: 19 and the reverse primer of SEQ ID NO: 19. twenty. In one embodiment, the invention relates to a transgenic plant as described herein, wherein the nucleotide sequence providing the transcription initiation function has at least 80% to 85% sequence identity to a nucleotide sequence described in SEQ ID NO: 35, this also including all integers included in this range, particularly a sequence identity comprised at least between 85% and 90% with a nucleotide sequence that is represented in SEQ ID NO: 35, all integers included in this range being also included therein, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96 %, 97%, 98%, or 99% having a nucleotide sequence as depicted in SEQ ID NO: 35, or a fragment thereof, and where the polynucleotide regulatory sequence or fragment thereof mediates transcription of a aso polynucleotide molecule operably linked, particularly an operatively associated protein-encoding polynucleotide of interest such that the polynucleotide of interest is transcribed in most plant tissues, but essentially excluding ear tissues so that there is no product of expression present in the tissues significantly. In one embodiment, the invention relates to a transgenic plant as described herein, where the complementary strand of the polynucleotide sequence providing the transcription initiation function is capable of hybridizing to a nucleotide sequence depicted in SEQ ID NO: 35, particularly in mild hybridization conditions, more particularly stringent hybridization conditions and where the regulatory nucleotide sequence mediates transcription of an operably associated polynucleotide molecule, particularly an operably associated protein-encoding polynucleotide of interest such that the polynucleotide of interest is transcribe in most plant tissues, but essentially excluding spike tissues such that no expression product is present in the tissues to any significant extent. In one embodiment, the invention relates to a transgenic plant as described herein, where the nucleotide sequence providing the transcription initiation function is the sequence depicted in SEQ ID NO: 35 or a fragment of this one, which still exhibits full functionality as a transcription initiation sequence. In one embodiment, the invention relates to a plant transgenic according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette that comprises the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct comprising the regulatory sequence where at least part of it has a transcription termination function obtainable from plant genomic DNA, particularly genomic DNA and mediates the transcription of an operatively associated polynucleotide molecule, particularly a polynucleotide encoding an operatively associated protein of interest such that the polynucleotide of interest is transcribed in most plant tissues but essentially to the exclusion of spike tissues such that no expression product is present in the tissues to any significant extent,' where i) the nucleotide regulatory sequence comprises a transcription termination sequence having a sequence identity between at least 80% and 85%, also including all integers included in this range, particularly an identity of sequence comprised at least between 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or the 99% with a nucleotide sequence as represented in the SEQ ID NO: 36,- or a fragment thereof, which still exhibits full functionality as a transcription start sequence; or ii) the complementary strand of the regulatory nucleotide sequence hybridizes to produce a nucleotide sequence as depicted in SEQ ID NO: 36, particularly under mild hybridization conditions, more particularly under moderately stringent hybridization conditions, particularly under mild hybridization conditions. stringent hybridization, and mediates the termination of transcription of an operably associated protein-encoding polynucleotide of interest; or iii) the regulatory sequence has a sequence as depicted in SEQ ID NO: 36 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence, including its complements. In one embodiment, the invention relates to a transgenic plant according to the invention and as described herein comprising a nucleotide regulatory sequence or an expression cassette comprising the nucleotide regulatory sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, wherein at least part of this regulatory sequence has a transcription initiation function and a transcription termination function, respectively, the regulatory nucleotide sequence being obtained from a genomic plant DNA, particularly from a genomic maize DNA , and is expressed in most plant tissues but head tissues being essentially excluded such that there is no expression product significantly present in tissue, where the regulatory nucleotide sequence comprises a transcription initiation sequence and a transcription termination sequence, respectively, the sequences having a sequence identity between at least 80% and 100%. 85%, being also included in this all the integers included in this interval, particularly a sequence identity comprised at least between 85% and 90%, being also included in this all the integers included in this interval, particularly an identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence with a nucleotide sequence as represented in SEQ ID NO: 35 and SEQ ID NO: 36, respectively, or' a fragment thereof which still exhibits full functionality as a transcription initiation sequence and a transcription termination sequence, respectively. In one embodiment, the invention relates to a transgenic plant in accordance invention What regulatory with understands present sequence cassette expression understands regulatory sequence construct construct particularly the chimeric polynucleotide, which comprises a regulatory sequence, where at least part of it has a function beginning transcription, respectively, obtaining the regulatory nucleotide sequence of a genomic plant DNA, particularly a genomic maize DNA, and is expressed in most plant tissues but ear tissues being essentially excluded such that it does not expression product is present in the tissues to a significant extent, the regulatory nucleotide sequence comprising a transcription initiation sequence as depicted in SEQ ID NO: 35 and a transcription termination sequence as depicted in SEQ ID NO: 36 respectively, including a fragment thereof, which still exhibits full functionality as a transcription start sequence and a transcription stop sequence, respectively. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding the polypeptide or protein of interest encodes a polypeptide product exhibiting insecticidal activity, particularly a Bacillus thuringiensis endotoxin 20 . In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues, is such that no insecticidal activity can be detected in a standard insect feeding assay. In particular, the concentration of the expression product in the spike is less than a basal level not more than 10 ng / mg soluble protein, particularly not more than 5 ng / mg soluble protein, more particularly not more than 3 ng / mg soluble protein, but especially not more than 2 ng / mg soluble protein or less. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding the polypeptide or protein of interest encodes a Bacillus thuringiensis endotoxin having a sequence identity of at least 80% % and 85%, being also included in this all the integers included in this interval, particularly a sequence identity between at least 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to a nucleotide sequence as represented in SEQ ID NO:15. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding the polypeptide or protein of interest encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as depicted in SEQ ID NO: L5. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding the polypeptide or protein of interest encodes a polypeptide product that contributes to the amplification of enhanced drought tolerance. , particularly a deregulated form of an H*-pyrophosphatase, where the polypeptide or protein is under the control of a regulatory sequence according to the invention where at least part of it has a transcription initiation function mediating the expression of a polynucleotide encoding operatively associated protein of interest in most plant tissues but with essentially no expression in pollen tissues and / or spike tissues such that no expression product is present in the tissues to a significant extent. In one embodiment, the transgenic plant according to the invention and as described herein is a Zea mays plant. In one embodiment, the invention relates to a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or an i polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, at least part of which has a transcription initiation function mediating the expression of an operably associated protein encoding a polynucleotide of interest in most plant tissues, but essentially excluding expression in the tissues of male reproductive structures, particularly pollen and / or spike tissues such that no expression product is present in the tissues to any significant extent. In one embodiment of the invention, the regulatory nucleotide sequence can be obtained from a gene represented by a DNA probe, particularly a DNA probe displaying a DNA sequence as represented in SEQ ID NOs: 47 to 56, showing the DNA probe a signal pattern in tissue samples that is indicative of gene expression in all tissues and no or substantial expression in pollen. In one embodiment of the invention, the regulatory nucleotide sequence may be obtained from a gene encoding actin depolymerizing factor 3, which is expressed in most plant tissues but essentially excluding pollen tissues. that no expression product is present in the tissues to a significant extent, particularly a maize actin depolymerizing factor 3 gene. In one embodiment of the invention, the regulatory nucleotide sequence may be obtained from a gene represented by a DNA probe, particularly a DNA probe displaying a DNA sequence as represented in SEQ ID NOs: 57 to 79, showing the DNA probe a signal pattern in tissue samples that is indicative of expression of the gene in all tissues and no or no substantial expression in head tissues. In a . In another embodiment, the invention provides a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence as described herein, wherein obtain the sequence of a genomic Zea maya DNA template using i) a first primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1, particularly a first primer of SEQ ID NO: 1; or ii) a second primer having at least 90% sequence identity, particularly at least the 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 2, particularly a second primer of SEQ ID NO: 2; or iii) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97% , 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 1 and a second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 2, particularly the forward primer of SEQ ID NO: 1 and the reverse primer of SEQ ID NO: 2. In one embodiment, the regulatory nucleotide sequence according to the invention and as described herein is modified using one or more of 20 oligonucleotides selected from the group of oligonucleotides depicted in SEQ ID NO: 3, SEQ ID NO : 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8. In one embodiment, the invention relates to a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence as described in present, the regulatory nucleotide sequence providing a transcription initiation function, wherein the nucleotide sequence providing the function has at least 80% to 85% sequence identity, which also includes all the integers included in this interval, particularly a sequence identity between at least 85% and 90%, all the integers included in this interval being also included in this, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with a nucleotide sequence as represented by S EQ 15 ID NO: 13 and where the regulatory nucleotide sequence mediates transcription of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding pollen tissues such that there is no product of expression 20 present to a significant extent. In one embodiment, the invention relates to a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the sequence regulatory sequence as described herein, the regulatory nucleotide sequence providing a transcription initiation function, wherein the complementary strand of the nucleotide sequence providing the function anneals to provide a nucleotide sequence as depicted in SEQ ID NO: 13, particularly under mild hybridization conditions, more particularly under stringent hybridization conditions and where the regulatory nucleotide sequence mediates transcription of an operably associated protein-encoding polynucleotide of interest in most but excluding plant tissues. essentially pollen tissues such that no expression product is present to any significant extent. In particular, hybridization occurs under stringent hybridization conditions. In one embodiment of the invention, the polynucleotide sequence that provides the transcription initiation function is the sequence depicted in SEQ ID NO: 13 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence. transcription, including its supplements. In one embodiment, a nucleotide regulatory sequence or an expression cassette comprising the nucleotide regulatory sequence or a polynucleotide construct, particularly a nucleotide construct, is provided. polynucleotide chimeric, comprising the regulatory sequence according to the invention and as described herein, comprising approximately 1 kb of nucleotide sequence upstream from the ZmABP3 transcription start site of a ZmABP3 gene, particularly downstream up from the ZmABP3 transcription start site of the ZmABP3 gene as depicted in SEQ ID NO: 17. In one embodiment of the invention, the regulatory nucleotide sequence comprises in addition to the ZmABP3 5' untranslated sequence, the first ZmABP3 exon, the first ZmABP3 intron and a portion of the second ZmABP3 exon, particularly a portion of the second ZmABP3 exon ending in the translation start codon, particularly a portion of the second exon ZmABP3 between about 10 and 20 nucleotides, particularly between about 12 and 16 nucleotides, particularly about 14 nucleotides, from the second exon. In one embodiment, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part thereof has a function of transcription, being able sequence in a PCR reaction amplifying a gDNA template, particularly a gDNA template, using a forward primer (P3 (5'tatatagagctcgcatcatgatcatgcatcatggact-3') having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 9 and a primer reverse (P4 (51-atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-31) which has a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 10. In particular, the nucleotide regulatory sequence comprises a transcription terminator and a polyadenylation signal. a forward primer (P3 (5'-tatatagagctcgcatcatgatcatgcatcatggact-3')) having a nucleotide sequence as depicted in SEQ ID NO: 9 and a reverse primer (P4 (5'20 atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-3') having a nucleotide sequence as depicted in SEQ ID NO: 10. In one embodiment of the invention, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a chimeric polynucleotide construct, comprising the regulatory sequence of a polynucleotide construct, particularly a chimeric polynucleotide construct. polynucleotides, comprising a transcription termination sequence obtainable from a gene encoding actin depolymerizing factor 3 (ABP3), wherein the regulatory sequence mediates transcription of an operatively associated polynucleotide molecule, particularly of a polynucleotide molecule encoding an operably associated protein of interest such that the polynucleotide of interest is transcribed in most plant tissues but not, in whole or substantially, in pollen tissues such that it is not transcribed there is expression product present in the tissues to an extent 15 sig significant, particularly from a maize actin depolymerizing factor 3 (ABP3) gene, where i) the nucleotide regulatory sequence comprises a transcription termination sequence having a sequence identity between at least 80% and 85%, also including all integers included in this range, particularly at least between 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 14; or ii) the complementary strand of the regulatory nucleotide sequence hybridizes to produce a nucleotide sequence as depicted in SEQ ID NO: 14, particularly under mild hybridization conditions, more particularly under moderately stringent hybridization conditions, particularly under mild hybridization conditions. stringent hybridization, and mediates the termination of transcription of a polynucleotide encoding an operably associated protein of interest; or iii) the regulatory nucleotide sequence has a sequence as depicted in SEQ ID NO: 14 or a fragment thereof, which still exhibits full functionality as a termination sequence, including its complements. In one embodiment, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part thereof has a transcription initiation function and a transcription termination function, respectively, obtaining the nucleotide regulatory sequence of a gene encoding actin depolymerization factor 3 (ABP3), which is expressed in most tissues of the plants but not, so totally or substantially, in the pollen tissues such that no expression product is present in the tissues to a significant extent, particularly of a maize actin depolymerizing factor 3 (ABP3) gene and where the regulatory nucleotide sequence it comprises a transcription initiation sequence as represented in SEQ ID NO: 13 and a transcription termination sequence as represented in SEQ ID NO-.14. In one embodiment of the invention, the regulatory nucleotide sequence can be obtained from maize genomic DNA, particularly from a putative gene in the maize genome, which has high expression in most plant tissues but not, totally or substantially, in the tissues of the spike such that no expression product is present in the tissues to a significant extent. In one embodiment, a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, is provided. comprising the regulatory sequence according to the invention and as described herein, comprising approximately 2.6 kb of 5' sequence, including approximately 2 kb of 5' non-transcribed sequence, a 5' untranslated region and exon 1 and part of exon 2 and intron 1, in particular about 0.6 kb representing exon 1, intron 1 and about 16 bp of exon 2. In one embodiment, the invention provides a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part thereof has a transcription initiation function as described herein, the sequence of a genomic Zea mays DNA template being able to be obtained using i) a first primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 19, particularly the primer of SEQ ID NO: 19; or iii) a second primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the reverse primer of SEQ ID NO: 20; or iv) a first primer as a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least the 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 19 and one or second primer as a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 0.97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 20, particularly the forward primer of SEQ ID NO: 19 and the reverse primer of SEQ ID NO: twenty. In one embodiment, the regulatory nucleotide sequence according to the invention and-as described herein is modified using one or more of the oligonucleotides selected from the group of oligonucleotides represented in SEQ ID NO: 21, SEQ ID SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26. In one embodiment, the invention relates to a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence as described in present, the regulatory nucleotide sequence providing a -transcription initiation function, wherein the nucleotide sequence providing the function has at least 80% to 85% sequence identity, also being comprised herein all integers included in this interval, particularly a sequence identity between at least 85% and 90%, all integers included in this interval being also included in this, particularly a sequence identity of at least 90% , 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with a nucleotide sequence as represented by S EQ ID NO: 35 and where the 10 nucleotide regulatory sequence mediates transcription of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding spike tissues such that there is no product of expression present to a significant extent. In one embodiment, the invention relates to a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence as described in present, the regulatory nucleotide sequence providing a transcription initiation function, wherein the complementary strand of the nucleotide sequence providing the function anneals to provide a nucleotide sequence such as 25 is depicted in SEQ ID NO: 35, particularly under mild hybridization conditions, more particularly under moderately stringent hybridization conditions and where the regulatory nucleotide sequence mediates transcription of an operably associated protein-encoding polynucleotide of interest in most plant tissues but essentially excluding pollen tissues such that no expression product is present in the tissues to any significant extent. In particular, hybridization occurs under stringent hybridization conditions. In one embodiment of the invention, the polynucleotide sequence that provides the transcription initiation function is the sequence depicted in SEQ ID NO: 35 or a fragment thereof, which still exhibits full functionality as a transcription initiation sequence. transcription and its supplements. In one embodiment, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part thereof has a transcription termination function, this sequence being able to be obtained in a PCR reaction for the amplification of a gDNA pattern, particularly a maize gDNA pattern, using a forward primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93%, 94%, 95%, 96%, 97%, 98% or the 99% with a nucleotide sequence as depicted in SEQ ID NO: 29 and a reverse primer having a sequence identity of at least 90%, particularly at least 91%, particularly at least 92%, 93% , 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 30. In particular, the nucleotide regulatory sequence comprises a terminator. of transcription and a polyadenylation signal. In particular, a forward primer having a nucleotide sequence as represented in SEQ ID NO: 29 and a reverse primer having a nucleotide sequence as represented in SEQ ID NO: 30 are used. In one embodiment, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence where i) the regulatory nucleotide sequence comprises a transcription termination sequence having at least 80% sequence identity to 85%, being also included in this all the integers included in this interval, particularly a sequence identity comprised at least between 85% and 90%, being also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with a nucleotide sequence as represented in SEQ ID NO: -36 ; OR ii) the complementary strand of the regulatory nucleotide sequence hybridizes to produce a nucleotide sequence as depicted in SEQ ID NO: 36, particularly under mild hybridization conditions, more particularly under moderately stringent hybridization conditions, particularly under mild hybridization conditions stringent and mediates the completion of transcription of an operably associated protein-encoding polynucleotide of interest; or iii) the regulatory sequence has a sequence as depicted in SEQ ID NO: 36 or a fragment thereof, which still exhibits full functionality as a termination sequence, including its complements. In one embodiment of the invention, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part from this it has a transcription start function and a transcription termination function, respectively, obtaining the regulatory sequence of 5 nucleotides of a maize genomic DNA, which is expressed in most plant tissues but not totally or substantially, in the tissues of the spike such that no expression product is present in the tissues to a significant extent, and where the regulatory nucleotide sequence comprises a transcription initiation sequence and a < transcription termination sequence, respectively, having a sequence identity between at least 80% and 85%, also being also included in this all the integers included in this interval, particularly a sequence identity between at least 85% and 90%, also included in this all the integers included in this interval, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NO: 35 and SEQ ID NO:36, respectively. In one embodiment, there is provided a regulatory nucleotide sequence or an expression cassette comprising the regulatory nucleotide sequence or a polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence, where at least part thereof has a transcription initiation function and a transcription termination function, respectively, obtaining the 5-nucleotide regulatory sequence of a maize genomic DNA, which is expressed in most plant tissues but not fully or substantially , in the spike tissues such that no expression product is present in the tissues to any significant extent and where the 10 nucleotide regulatory sequence comprises a transcription initiation sequence as depicted in SEQ ID NO: 35 and a transcription termination sequence as depicted in SEQ ID NO: 36. It will be apparent to those skilled in the art that, based on the nucleotide sequences listed in SEQ ID NO: 13, SEQ ID NO 14, SEQ ID NO: 35 and SEQ ID NO: 36, fragments of various lengths can be obtained. of the sequences, for example to use any primer combination of interest to generate fragments that still exhibit the specific regulatory function in accordance with the invention that drives expression of an operatively associated polynucleotide of interest in most less plant tissues. in pollen and spike tissues, respectively. Thus, the invention includes fragments derived from a full-length transcriptional promoter and a full-length terminator of the invention and as described herein, respectively, which function in accordance with the invention, i.e., capable of of conferring expression and termination of an operably associated nucleotide sequence in most plant tissues but essentially excluding pollen tissues such that no expression product is present in the tissues to a significant extent and / or the spike. Once obtained, the function of the promoter and terminator fragments can be readily assayed by fusing them with a selectable or analyzable marker gene and testing the fusion constructs for promoter-specific activity. These assays are known to those skilled in the art. In one embodiment, the invention relates to nucleotide fragments, particularly nucleotide fragments obtainable from the regulatory sequences of an actin depolymerizing factor (ABP3) gene, the nucleotide fragments at least having at least a few bases, preferably between 400 bases to about 650 bases, more preferably between about 200 bases and about 400 bases and most preferably about 350 bases in length and still exhibit the specific regulatory function in accordance with the invention that is driving the expression of an operatively associated polynucleotide of interest in the most plant tissues but essentially excluding pollen and / or spike tissues so that no expression product is present in the tissues to any significant extent. In one embodiment, the invention relates to a nucleotide fragment comprising a nucleotide sequence comprising a consecutive length of at least 50 nt, particularly between approximately 400 nt and approximately 650 nt, particularly between approximately 200 nt and approximately 400 nt, particularly about 350 nt in length from the nucleotide sequence depicted in SEQ ID NO:13 and SEQ ID NO:35, respectively, where the nucleotide sequences still exhibit the regulatory function in accordance with the invention that is driving the expression of an operatively associated polypeptide of interest in most plant tissues but essentially excluding pollen and / or spike tissues such that no expression product is present in the tissues to a significant extent. It will also be clear to those skilled in the art that variant sequences can be obtained without affecting the specific properties of the regulatory sequences according to the invention by introducing mutations, that is to say insertions and / or deletions and / or substitutions of one or more nucleotides, in the DNA sequences of SEQ ID NO: 13, SEQ ID NO 14, SEQ ID NO: 35 and SEQ ID NO: 36, respectively , using methods known in the art. Likewise, variations can be introduced to a modified or unmodified nucleotide sequence, disordering the sequence of the invention. To assess a function of DNA sequence variants in accordance with the invention, the sequence of interest is operably linked to a selectable or analyzable labeled gene and expression of the marker gene is assessed in protoplast or whole plant tissue expression assays. or in stably transformed plants. One skilled in the art will know that DNA sequences capable of driving the expression of an operably associated nucleotide sequence are constructed in a modular fashion. Consequently, the expression levels of shorter DNA fragments may differ from the longer fragment and may differ from each other. For example, deletion of an upstream negative regulatory element will lead to increased expression levels of the associated nucleotide sequence whereas deletion of an upstream regulatory element will decrease expression levels of the associated nucleotide sequence. . In one embodiment, the invention relates to a cassette expression comprising a regulatory sequence or an expression cassette comprising the regulatory nucleotide sequence or polynucleotide construct, particularly a chimeric polynucleotide construct, comprising the regulatory sequence according to the invention and as described herein. In one embodiment, the expression cassette according to the invention comprises approximately 2.3 kb of ZmABP3 51 sequence consisting of approximately 1.1 kb of 5' non-transcribed sequence, approximately 0.25 kb of non-transcribed region translate of 51 and approximately 0.98 kb representing ZmABP3 intron 1, approximately 1.013 kb of 3' sequence beginning just after the ABP3 translation stop codon including approximately 0.3 kb of untranslated region of 31 and approximately 0.7 kb of non-transcribed sequence, with functions such as transcription terminator and polyadenylation signal. In one embodiment, an expression cassette according to the invention is provided wherein the natural translation initiation codon is silenced and translated into the second exon, in particular it is translated within 15 nucleotides of the 51 end and exon 2 of ZmABP3. . In one embodiment, an expression cassette according to the invention is provided where the start codon is preceded by the sequence Kozak 51-...CCACC...-3'. In one embodiment, the expression cassette according to the invention comprises a nucleotide regulatory sequence comprising approximately 2.6 kb of the nucleotide sequence. 5', consisting of approximately kb of non-kb region non-bp sequence representing exon 1, intron 1, and approximately 16 bp of exon 2; and approximately 1 kb of 3' sequence beginning just after the translation stop codon and includes approximately 0.6 kb of 31 untranslated region and approximately 0.4 kb of nontranscribed sequence, and functions such as that of transcription terminator and polyadenylation signal. In one embodiment, an expression cassette is provided in accordance with the invention where the natural translation start codon is silenced and translated into the second exon. In one embodiment, a nucleotide sequence encoding a polypeptide or protein encoding a Bacillus thuringiensis endotoxin is provided, having at least 80% sequence identity, particularly at least 85% sequence identity, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as represented in SEQ ID NOT :15. In one embodiment, a polypeptide or protein-encoding nucleotide is provided that encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence 5 as depicted in SEQ ID NO: 15. In one embodiment, the invention relates to a transgenic plant comprising an expression cassette in accordance with the invention and as described herein. In one embodiment, the invention provides a transgenic plant, particularly a transgenic maize plant, I comprising a regulatory sequence according to the invention and as described herein. In one embodiment, the invention provides a transgenic plant, in particular a transgenic maize plant comprising a regulatory sequence according to the invention and as described herein in association with a polynucleotide of interest, in particular a polynucleotide encoding a polypeptide or protein of interest. In one embodiment, the invention provides a transgenic plant, particularly a transgenic maize plant, comprising an expression cassette according to the invention and as described herein. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the nucleotide sequence encoding a polypeptide or protein encoding a Bacillus thuringiensis endotoxin, having a sequence identity of at least 80%, particularly a sequence identity of at least 85%, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO: 15 and is under the operational control of a plant-operable regulatory sequence. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polypeptide or protein-encoding polynucleotide sequence encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as depicted in Figure SEQ ID NO: 15 and is under the control of a regulatory sequence operable in the plant. The invention also provides methods for preparing expression cassettes comprising the regulatory sequence according to the invention comprising linking an expressible polynucleotide encoding a polypeptide or protein of interest with a regulatory sequence according to the invention and as described in the present to obtain an expression construct, wherein the polynucleotide of interest is linked or operatively associated with the regulatory sequence such that expression of the polypeptide or protein of interest is mediated by the regulatory sequence according to the invention and results in expression of the polypeptide or protein of interest in essentially all plant tissues, but essentially excludes expression in tissues of reproductive structures of plants, particularly in the pollen and / or ear tissues such that no expression product is present in the tissues to a significant extent. In one embodiment, the invention relates to a method of producing a transgenic plant that expresses a DNA sequence of interest in tissue other than pollen but not, substantially or completely, in pollen and / or spike tissues, which understands a. transforming an expression cassette according to the invention and as described herein into a plant cell comprising a nucleotide regulatory sequence, which at least in part has a transcription initiation function mediating the expression of a polynucleotide encoding an operatively associated protein of interest in most plant tissues but essentially excluding pollen and / or spike tissues such that no expression product is present in those tissues to a significant degree; Y b. regenerating the plant cell transformed in step a) into a plant. In one embodiment, the invention relates to a method of controlling target insect pests that feed on vegetative plant tissue such as the leaf, stem and root and / or reproductive tissues such as the ear, but which protects the pests non-targets that feed on pollen, which includes a. cultivating a plant in accordance with the invention and as described herein in an area infested by the target pest; b. expressing a polypeptide or protein that is capable of controlling the target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to a method of protecting reproductive tissues of a plant, particularly pollen and / or spike tissues, against damage caused by tissue expression of a polypeptide or protein of interest, comprising a. cultivating a plant in accordance with the invention and as described herein; b. express in the plant a polypeptide or protein of interest under the control of a regulatory sequence in accordance with the invention and as described in the Present. In one embodiment, the present invention relates to the use of a regulatory sequence in accordance with the present invention and as disclosed herein to protect the reproductive tissues of a plant, in particular the pollen and / or spike tissues against the damage caused by the expression in the tissues of a polypeptide or protein of interest that expresses in the plant the polypeptide or protein of interest under the control of a regulatory sequence according to the invention and as described herein. Brief Description of the Sequence Listing SEQ ID NO: 1 represents the nucleotide sequence of the forward primer Pl SEQ ID NO: 2 represents the nucleotide sequence of the reverse primer P2 SEQ ID NO: 3 represents the nucleotide sequence of the Patg oligonucleotide SEQ ID NO: 4 represents the sequence of nucleotides of the Pnco oligonucleotide SEQ ID NO: 5 represents the nucleotide sequence of the ADPc-1 oligonucleotide SEQ ID NO: 6 represents the nucleotide sequence of the ADPc-2 oligonucleotide SEQ ID NO: 7 represents the nucleotide sequence of the ADPc-4 oligonucleotide SEQ ID NO: 8 represents the nucleotide sequence of the oligonucleotide adp3-a SEQ ID NO: 9 represents the nucleotide sequence of the forward primer P3 SEQ ID NO: 10 represents the nucleotide sequence of the reverse primer P4 SEQ ID NO: 11 represents the nucleotide sequence of the Tnco forward primer SEQ ID NO: 12 represents the nucleotide sequence of the T2 forward primer SEQ ID NO: 13 represents the nucleotide sequence of the modified ZmABP3 regulatory sequence including the transcription initiation sequence SEQ ID NO: 14 represents the nucleotide sequence of ZmABP3 terminal sequence SEQ ID NO: 15 represents the nucleotide sequence of CrylAbG6 SEQ ID NO: 16 represents the nucleotide sequence of AtAVPlD encoded sequence optimized for maize SEQ ID NO: 17 represents the nucleotide sequence of the gene ! ZmABP3 SEQ ID NO: 18 represents the nucleotide sequence from plasmid pNOV1321 SEQ ID NO: 19 represents the nucleotide sequence of the forward primer ABT Pl forw SEQ ID NO: 20 nucleotides of primer represents reverse ABT E represents nucleotide sequence pABT >2 rev la mutl sequence SEQ ID NO: 21 nucleotides oligonuc 5 SEQ ID NO: 22 represents nucleotide sequence of pABT mut2 oligonucleotide SEQ ID NO: 23 represents the nucleotide sequence of the pABT mut3 oligonucleotide SEQ ID NO: 24 represents the 10 nucleotide sequence of the pABT mut4 oligonucleotide SEQ ID NO: 25 represents the nucleotide sequence of the pABT mut5 oligonucleotide SEQ ID NO: 26 represents the sequence of pABT mut6 oligonucleotide 15 SEQ ID NO: 27 represents the nucleotide sequence of the forward primer pABT ampl SEQ ID NO: 28 represents the nucleotide sequence of the reverse primer pABT amp2 SEQ ID NO: 29 represents the 20 nucleotide sequence of the forward primer ABT P4 SEQ ID NO: 30 represents the nucleotide sequence of the reverse primer ABT P5 SEQ ID NO: 31 represents the nucleotide sequence of the ABTt oligonucleotide ml 25 SEQ ID NO: 32 represents the sequence of oligonucleotide ABTt m2 nucleotides SEQ ID NO: 33 represents ZmABTl cDNA SEQ ID NO: ZmABT2 CADN 34 represents SEQ ID NO: 35 represents ZmABT promoter SEQ ID NO: 36 represents the terminal sequence of ZmABT of the of the of the of the nucleotide sequence of the nucleotide sequence of the nucleotide sequence the nucleotide sequence of SEQ ID NO: 37 represents the nucleotide sequence of the ZmABP3-CrylAbG6 pool construct SEQ ID NO: 38 represents the ZmABP3-CrylAbG6 binary construct sequence SEQ ID NO: 39 represents the ZmABP3-CrylAbG6 binary construct sequence SEQ ID NO: 40 represents the ZmABP3-AmCyan pool construct sequence SEQ ID NO: 41 represents the ZmABP3-AmCyan binary construct sequence SEQ ID NO: 42 represents the ZmABP3-AtAVPID set construct sequence of the ZmABP3-AtAVPID binary construct of of of of of of of nucleotides nucleotides nucleotides nucleotides nucleotides SEQ ID NO: 44 represents the nucleotide sequence of plasmid 15772 (ZmABT pool) SEQ ID NO; 43 represents the nucleotide sequence SEQ ID NO: 45 represents the nucleotide sequence of plasmid 15773 SEQ ID NO: 46 represents the nucleotide sequence of ZmABT gDNA SEQ ID NO: 47 represents the nucleotide sequence of Ctr1_ZMU4 5 8 5 5-3_at SEQ ID NO: 48 represents the nucleotide sequence of AF032370_at SEQ ID NO: 49 represents the nucleotide sequence of 10 Zm001747_s_at SEQ ID NO: 50 represents the nucleotide sequence of Zm005803_s_at SEQ ID NO: 51 represents the nucleotide sequence of 15 Zm007728_s_at SEQ ID NO: 52 represents the nucleotide sequence of Zm009722_s_at SEQ ID NO: 53 represents the nucleotide sequence of Zm021004 _s_at SEQ ID NO: 55 represents the nucleotide sequence of Zm058948. _s_at SEQ ID NO: 56 represents the nucleotide sequence of Zm061393_s_at SEQ ID NO: 57 represents the nucleotide sequence of Zm016864_s_at SEQ ID NO: 58 represents the nucleotide sequence of Zm018791_ at SEQ ID NO: 59 represents the nucleotide sequence of ZMMETALL_ X i at SEQ ID NO: 60 represents the nucleotide sequence of Zm000019 at SEQ ID Zm002987_at NO: 61 represents the nucleotide sequence of 10 SEQ ID NO: 62 represents the nucleotide sequence of Zm002990 s_¡ at SEQ ID NO: 63 represents the nucleotide sequence of Zm002990 xat SEQ ID NO: 64 represents the nucleotide sequence of Zm004433_ at SEQ ID NO: 65 represents the nucleotide sequence of Zm005761 at SEQ ID NO: 66 represents the nucleotide sequence of Zm006285at SEQ ID NO: 67 represents the nucleotide sequence of Zm006481_ _s_ at SEQ ID NO: 68 represents the nucleotide sequence of Zm010323_ _s_ at SEQ ID NO: 69 represents the nucleotide sequence of zm011554_at SEQ ID NO: 70 represents the nucleotide sequence of Zm011554 x_at SEQ ID NO: 71 represents the nucleotide sequence of Zm021403_at SEQ ID NO: 72 represents the nucleotide sequence of Zm028405_s_at SEQ ID NO: 73 represents the nucleotide sequence of Zm032921_s_at SEQ ID NO: 74 represents the nucleotide sequence of Zm033444_s_at SEQ ID NO: 75 represents the nucleotide sequence of ZmO 3508 2_s_at SEQ ID NO: 76 represents the nucleotide sequence of Zm040564_x_at SEQ ID NO: 77 represents the nucleotide sequence of Zm054116_s_at SEQ ID NO: 78 represents the nucleotide sequence of Zm066342_at SEQ ID NO: 79 represents the nucleotide sequence of Zm051284_at SEQ ID NO: 80 represents the nucleotide sequence of Vector 15289 SEQ ID NO: B1 represents the nucleotide sequence of ZmABP-948 -binary SEQ ID NO: 82 represents the nucleotide sequence of ZmABT-990-binary SEQ ID NO: 83 represents the nucleotide sequence of the 5' Bfrl primer SEQ ID NO: 84 represents the nucleotide sequence of the 3' Xbal primer SEQ ID NO: 85 represents the nucleotide sequence of the 5'Gfix primer SEQ ID NO: 86 represents the nucleotide sequence of the 3'Gfix primer SEQ ID NO: 87 represents the nucleotide sequence of the 5'!Ab5XbaI primer SEQ ID NO: 88 represents the nucleotide sequence of the 3'!Ab3d6 primer SEQ ID NO: 89 represents the sequence of nucleotides of cy2' SEQ ID NO: 90 represents the nucleotide sequence of cyl SEQ ID NO: 91 represents the nucleotide sequence of cy2 Detailed description of the invention Definitions Technical terms and expressions used in the scope of this application generally have the meaning that commonly corresponds to them in the relevant art of molecular biology unless otherwise indicated in the application. present below. As used in this and the appended claims, the singular forms a, an, and the and the include their plurals unless the context clearly indicates otherwise. Thus, for example, the reference to a plant includes one or more plants and the reference to a cell includes mixtures of cells, tissues, and the like. As used in the present and the appended claims, the plural form tissues, includes its form singular unless the context clearly indicates otherwise. Thus, for example, reference to tissues of the spike includes one or more tissues present in the spike. As used in this specification and the In the appended claims, the term "most plant tissues" or "essentially all plant tissues" is used interchangeably and refers to most tissues present in the plant with the exception of tissues of reproductive structures, particularly pollen tissues and spike. In particular, most tissues refer to those plant tissues that insects primarily feed on, with the exception of male reproductive structures, such as stem tissues, roots, leaves, ear, corn husk, silks and developing kernels. Herein it is understood that the term polynucleotide refers to the polymeric molecule of high molecular weight, which can be of one or two strands, composed of monomers (nucleotides) that contain a sugar, a phosphate and a base that can be purine. or pyrimidine. A polynucleotide fragment is a fraction of a given polynucleotide molecule. In higher plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) participates in the transfer of information included in DNA to proteins. A genome is the total body of genetic material included in each cell of an organism, including the genomes of mitochondria and plastids. Thus, the term "polynucleotide" refers to a DNA or RNA polymer that may be single or double stranded, optionally containing unnatural, or altered synthetic nucleotide bases capable of incorporation into DNA or RNA polymers. Unless otherwise indicated, a particular nucleic acid sequence of this invention also implicitly encompasses conservatively modified variants thereof (eg, degenerate codon substitutions) and complementary sequences as does the explicitly stated sequence. Specifically, codon substitutions degenerate can be achieved by generating sequences in which the third position of one or more (or all) of the selected codons is replaced with a mixed base residue and / or deoxynosine (Batzer, et al., Nucleic Acid Res. 19:5081 (1991 Ohtsuka, et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini, et al., Mol. Cell. Probes 8:91-98 (1994)). The term polynucleotide is used interchangeably with nucleic acid, nucleotide sequence, and can include genes, cDNA and mRNA encoded by a gene, etc. A nucleotide regulatory sequence where at least part thereof has a transcription initiation function is understood herein to refer to a nucleotide sequence that controls the expression of an operably associated coding sequence providing for RNA polymerase recognition and other factors necessary for proper transcription and is located upstream (5') of its coding sequence. The. Regulatory nucleotide sequences include 5' regulatory sequences located in the proximal and most distal elements upstream of the associated coding region, which influence RNA transcription, processing, or stability or translation of the associated coding sequence. The regulatory sequences of ) nucleotides may further include 3' sequences, including 3' non-translated and / or 3' non-transcribed sequences, located downstream of the associated coding region and may include a transcription termination site. Nucleotide regulatory sequences can include enhancers, promoters, untranslated leader sequences, introns, and polyadenylation signal sequences. They also include natural and synthetic sequences which may be a combination of natural synthetic sequences. An enhancer is a DNA sequence that can stimulate promoter activity and can be an innate element of the promoter or a heterologous element inserted to enhance the level of tissue specificity of a promoter. It is capable of operating in both orientations (normal or reverse) and capable of operating even when translated upstream or downstream of the promoter. The meaning of the term "regulatory nucleotide sequences" includes transcription initiation sequence or promoters and promoter regulatory sequences. These terms are used interchangeably herein. For the purposes of the invention, the definition of the term 3' non-transcribed sequence includes modifications of the nucleotide sequence of a 3' non-transcribed sequence derived from a target gene, the modified 3' non-transcribed sequence does not significantly reduce the activity of its regulatory sequence of 3' associated. The 3' untranscribed sequence extends approximately 0.5 to 1.5 kb downstream of the transcription termination site. It is understood that the polynucleotide of the invention is provided in isolated form. The term "isolated" means that the polynucleotide disclosed and claimed herein is not a polynucleotide that occurs as it occurs in its natural context, but in fact has a naturally occurring homologue. Accordingly, it is understood that the other compounds of the invention described in greater detail below are isolated. If claimed in the context of a plant genome, the polynucleotide of the invention is distinguished from naturally occurring homologs by, for example, modifications introduced to a naturally occurring homologous sequence and / or the insertion side in the genome and the flanking sequences on the insertion side. Operably associated and operably linked are used interchangeably and refer to the association of nucleic acid sequences in a single nucleic acid fragment such that the function of one affects that of the other. For example, a promoter is associated or operably linked with a coding sequence or functional RNA when it is capable of affecting the expression of that coding sequence or functional RNA (i.e., that the coding sequence or functional RNA is under transcriptional control of the promoter). Coding sequences in the sense or antisense orientation may be operatively unique to regulatory sequences. The term significantly present as used in the context of the present invention refers to the fact that only negligible expression occurs in pollen resulting from only minor amounts of expression product in pollen tissue, resulting in only minor amounts of expression product in pollen tissue at concentrations that can be detected by high resolution detection methods such as HPLC, ELISA and Western assays, insect feeding assays, enzyme activity assays, etc., but remain for below a certain threshold level that may be needed to effect the intended biological function of the expression product. For example, in the case of the Bacillus thuringiensis endotoxin CrylAbG6 the threshold level is in the range between ng / mg soluble protein and 60 ng / mg soluble protein, particularly in the range between 20 ng / mg protein soluble and ng / mg of soluble protein. The term chimeric gene'1 refers to any gene that contains 1) DNA sequences, including coding and regulatory sequences that do not occur together in the nature in that specific combination, or 2) sequences that encode parts of proteins that are not linked naturally, or 3) parts of promoters that are not linked naturally. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources or comprise regulatory sequences and coding sequences derived from the same source but are arranged differently from what occurs in nature. The terms heterologous DNA sequence, foreign DNA segment, or heterologous nucleic acid, as used herein, each refer to sequence that originates from a source foreign to the particular host cell or, if from the same source , is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but has been modified by, for example, the use of DNA shuffling or mutation. The terms also include non-naturally occurring multiple copies of a naturally occurring DNA sequence. Thus, the terms refer to a segment of DNA that is foreign or heterologous to the cell, or homologous to the cell but found in a position within the host cell genome in which the element is not ordinarily found. Foreign DNA segments are expressed to produce foreign polypeptides. A homologous DNA sequence is a DNA sequence naturally associated with a host cell into which it is introduced. A transgene refers to a gene that has been introduced into the genome by transformation and is stably maintained. Transgenes can include, for example, genes that are heterologous or homologous to the genes of a particular plant that it is desired to transform. Furthermore, transgenes can comprise native genes inserted into a non-native organism or chimeric genes. The term endogenous gene refers to a native gene in its natural location in the genome of an organism. A foreign gene refers to a gene that is not normally found in the host organism but is introduced by gene transfer. The term expression cassette, as used herein, means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the protein-encoding polynucleotide of interest that is operatively linked to a terminator. It also typically comprises the sequences necessary for the correct translation of the nucleotide sequence. The coding region usually encodes a protein of interest, but may also encode a functional RNA of interest, for example antisense RNA or an untranslated RNA, in the sense or antisense direction. The expression cassette comprising the protein-encoding polynucleotide of interest may be chimeric. Intron refers to an intervening section of DNA that occurs almost exclusively in a eukaryotic gene, but is not translated into amino acid sequences in the gene product. Introns are removed from premature mRNA through a process called splicing, which leaves the exons intact, to form an mRNA. For the purposes of the invention, the definition of the term "intron" includes modifications of the nucleotide sequence of an intron derived from a target gene, provided that the "modified" intron does not significantly reduce the activity of its associated 5' regulatory sequence. The term exon refers to the section of DNA that carries the coding sequence for a protein or part of it. The exons are separated by intervening non-coding sequences (introns). For the purposes of the invention, the definition of the term exon includes nucleotide sequence modifications of an exon derived from a target gene, provided that the modified exon does not significantly reduce the activity of its associated 5' regulatory sequence. The terms protein, peptide, and polypeptide are used interchangeably herein. Probe as used herein. refers to a defined nucleic acid (DNA or RNA) fragment of variable length that can be used to detect in a sample of DNA or RNA that contains sample nucleotide sequences that are complementary to the sequence represented by the test molecule. The probe molecules can be used in a biochip arrangement, where they are covalently linked to a chemical matrix on an inert surface, such as coated glass plates or silicon-based gene chips. Hybridization of probe molecules to a target nucleic acid usually occurs under highly stringent conditions. Generally, probe target hybridization is detected and quantitated by fluorescence-based detection of fluorophore-labeled targets to determine the relative transcriptional abundance of nucleic acid sequences in the target. DNA chips can be used in expression profiling experiments to quantify the abundance of transcript for a target molecule in pollen and / or spike tissue samples, calculated based on the strength of the signal detected in the respective samples. The term "hybridize" as used herein refers to standard hybridization conditions, preferably hybridization conditions in which uses a solution of 5xSSPE, 1% SDS, lxDenhardts as a solution and / or the annealing temperatures are between 35°C and 70°C, preferably 65°C. After hybridization, washing is preferably carried out first in 2xSSC, 1% SDS and then with 0.2xSSC at temperatures between 35°C and 75°C, particularly between 45°C and 65°C, but especially at 59°C (for the definition of SSPE, SSC and Denhardts solution, see Sambrook et al. loe. cit.). High stringency hybridization conditions, such as those described in Sambrook et al, supra, are particularly preferred. Particularly preferred stringent conditions are eg present at hybridization and washing occurs at 65°C as indicated above. Non-stringent hybridization conditions, eg with hybridization and wash performed at 45°C, are less preferred and 35°C are even less preferred. The terms sequence homology or sequence identity are used interchangeably herein. The terms identical or percent identity in the context of two or more nucleic acid or protein sequences refer to two or more sequences or subsequences that are the same or have an indicated percentage of amino acid residues or nucleotides that are the same, when used. compares and aligns for maximum correspondence, as measured using one of the following comparison algorithms or by visual inspection. If two sequences to be compared respectively differ in length, the sequence identity preferably refers to the percentage of nucleotide residues of shorter sequence that are identical with nucleotide residues of longer sequence. Sequence identity can be determined conventionally using computer programs such as the Bestfit program (Wisconsin Sequence 10 Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive Madison, WI 53711). Bestfit uses the local homology algorithm from Smith and Waterman, Advances in Applied Mathematics 2 (1981), 482-489, in order to determine the segment that has the highest sequence identity between two sequences. When using Bestfit or another sequence alignment program to determine if a particular sequence has, for example, 95% identity to a reference sequence of the present invention, the parameters are preferably adjusted so that the percentage identity is calculated for the full length of the reference sequence and that homology gaps of up to 5% of the total number of nucleotides in the reference sequence are allowed. When using Bestfit, the so-called optional parameters 25 are preferably left at their default values. The Deviations that appear in the comparison between a given sequence and the sequences described above can be caused, for example, by addition, deletion, insertion or recombination. This reference comparison can preferably be carried out with the fasta20u66 program (version 2.0u66, September 1998 by William R. Pearson and the University of Virginia; see also W.R. Pearson (1990), Methods in Enzymology 183, 63-98, attached examples and http: / / workbench.sdsc.edu / ). For this purpose, the default parameter settings can be used. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions. The term "hybridize specifically with" refers to the binding, duplication, or hybridization of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (eg, total cellular) DNA or RNA. Substantially binds refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and encompasses minor mismatches that can be accommodated. by reducing the stringency of the hybridization medium to achieve the desired detection of the target nucleic acid sequence. Stringent hybridization conditions and stringent hybridization wash conditions in the context of nucleic acid hybridization experiments, such as Southern and Northern hybridizations are sequence dependent and are different under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. An extensive guide to nucleic acid hybridization is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probea Part I, Chapter 2 Overview of principles of hybridization and the strategy of nucleic acid probe assays, Elsevier, NY. In general, highly stringent hybridization and washing conditions are selected to be about 5°C lower than the thermal melting point (Tm) for the specific sequence at a defined pH and ionic strength. Typically, under stringent conditions a probe will hybridize to its target subsequence, but not to other sequences. The Tm is the temperature (lower pH and ionic strength defined) in which 50% of the target sequence hybridizes to obtain a perfectly matched probe. Very stringent conditions are selected to be equal to the Tm for a particular probe. An example of stringent hybridization conditions for nucleic acid hybridization complementary that have more than 100 complementary residues on a filter on a Southern or Northern blot is 50% formamide with 1 mg heparin at 42°C, hybridization being performed overnight. An example of very stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent wash conditions is a 0.2x SSC wash at 65°C for 15 minutes (see, Sambrook, infra, for a description of the SSC buffer). Often, a high stringency wash is preceded by a low stringency wash to remove the background probe signal. An example of a medium stringency wash for a duplex of, for example, more than 100 nucleotides, is 0.1x SSC at 45°C for 15 minutes. An example of a low stringency wash for a duplex of, for example, more than 100 nucleotides, is 4-6x SSC at 40°C for 15 minutes. For short probes (eg, about 10 to 50 nucleotides), stringent conditions typically include salt concentrations less than about 1.0 M Na* ion, typically about 0.01 M Na* ion concentration. to 1.0 M (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C. Harsh conditions can also be achieved with the addition of destabilizing agents, such as formamide. In general, a signal-to-noise ratio of 2x (or greater) than that observed for an unrelated probe in the particular hybridization assay indicates detection of specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions remain substantially identical if the proteins they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy allowed by the genetic code. A plant is any plant at any stage of development, in particular a seed plant. A plant cell is a structural and physiological unit of a plant, comprising a protoplast and a cell wall. The plant cell may be in the form of a single isolated cell or a cell culture, or as a part of a more organized unit such as plant tissue, a plant organ, or a whole plant. Plant cell culture means the cultures of plant units such as protoplasts, cell culture cells, cells in plant tissues, pollen, pollen tubes, ovules, embryo sacs, zygotes and embryos at different stages of development. Plant material means leaves, stems, roots, flowers or parts of flowers, fruits, pollen, egg cells, zygotes, seeds, cuttings, tissue or cell cultures, or any other part or product of a plant. A plant organ is a visibly differentiated and structured part of a plant such as a root, stem, leaf, flower bud, or embryo. "Plant tissue" as used herein means a group of plant cells organized into a functional structural unit. Any tissue from a plant in planta or in culture is included. This term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue culture, and any group of plant cells organized into structural and / or functional units. Plant tissue includes undifferentiated differentiated plant tissue including, but not limited to, roots, stems. buds, leaves, pollen. seeds, tumor tissue and various forms of cultured cells such as single cells, protoplasts, callus tissue embryos. The plant tissue may be in plant organs, tissues or cell cultures. The use of this term in conjunction with, or in the absence of, any specific type of plant tissue as noted above or otherwise included by this definition is not intended to be exclusive of any other type of plant tissue. The terms "corn mays" are used interchangeably herein and refer to plants belonging to the genus Zea, for example, different strains, races or varieties, commercial or not, of other species of Zea maye. The present invention relates to a transgenic plant comprising, stably integrated into its genome, a chimeric polynucleotide construct, particularly a chimeric DNA construct, comprising polynucleotide encoding the protein of interest, particularly a polypeptide. encoding the polypeptide or protein of interest, under the control of a regulatory nucleotide sequence, where at least part thereof has a transcription initiation function that directs expression of the polynucleotide encoding the protein of interest in essentially all tissues of the plant, except for the tissues of the male reproductive structures, in particular the pollen and / or ear tissues such that no expression product is present in the tissues to any significant extent. A regulatory nucleotide sequence according to the present invention, where at least part thereof has a transcription initiation function that mediates the expression of an operatively associated protein-encoding polynucleotide of interest in most plant tissues but not in structures male reproductive tissues, particularly pollen and / or spike tissues, can be obtained in an expression profiling experiment to test for probes that give strong signals in all samples, but only one signal or no signal in the pollen sample and / or spike, which is indicative of expression of respective polynucleotides represented by the probes in the majority of plant tissues or no or substantial expression in pollen and / or spike tissues. In particular. Plant tissues and tissues of maize reproductive structures, particularly pollen and / or ear tissues, can be analyzed to identify and obtain a regulatory sequence in accordance with the present invention. In particular, samples of all plant tissues, particularly samples of green tissues and the root of the maize plant, can be directly compared to obtain samples of the male reproductive structures, particularly samples of the pollen and / or ear. Probes representing polynucleotides that do not meet the target expression profile are removed. Only the probes with the strongest signal in all tissues that are neither pollen nor spike have no signal or have a weak signal in pollen and / or spike are selected for further analysis, i.e. probes that represent polynucleotides that have high expression in all tissue samples, but show substantially no expression in pollen and / or spike. The probes can be aligned with cDNA pool data sets to detect bona fide plant genes, particularly maize genes or putative maize genes. The DNA sequence representing probes in the corn chip that were determined to represent genes that had high expression in all tissue samples but were essentially unexpressed in pollen, particularly the probes represented by the DNA sequence representing are presented in SEQ ID NOs: 47 to 56 and those representing genes that had high expression in all tissue samples and have essentially no or substantial expression in spike samples, particularly probes represented by the DNA sequence. which is presented in SEQ ID NOs: 57 to 79, can be easily extended to the expression cassettes designed following the steps established in the Examples. Candidate probe sequences from expression profiling analysis for each expression category can be selected and grown to a finished binary vector with the designed expression cassette bound to a gene of interest such as a reported gene, ie say the GUS reporter gene. In a first step, each expression cassette is flanked with one or more suitable restriction sites such as SanDi / RsrII sites and cloned into the vector molecule. Typically, the regulatory region that includes the transcription start function resides in a fragment approximately 1000-1500 bp upstream of the transcription start site and extends to the second exon or natural translation start codon. when it is not in the first exon. It typically ends with the corn optimized 1gtaaaccatgg1 Kozak sequence. The generated translation start codon is then incorporated into a suitable restriction site such as the Ncol 'ccatgg' restriction endonuclease site. All translation start codons in the theoretical transcript that are upstream of the generated restriction site were removed. Ά1 minus one stop codon should be present in each reading frame upstream of the generated restriction site. The regulatory region that includes the transcription initiation function is designed to be flanked by suitable restriction sites such as Xhol / SanDI sites at the 5' end and an Ncol site at the 3' end. The gene of interest (GOI) as the GUS reporter gene is provided as a suitable restriction fragment in the example provided herein as a fragment Ncol / Sacl. The terminus extends from just after the translation stop codon for about kb downstream. The terminus is designed to be flanked by suitable restriction sites such as SacI at the 5' end and RsrII / Xmal at the 3' end. The complete expression cassette is designed to be mobilized as a suitable restriction fragment, such as a SanDi / RsrII fragment, which can be ligated to the corresponding site located on the Agrobacterium 10 binary vector such as the vector presented in SEQ ID NO: 80. All internal restriction sites used in the cloning steps identified above are mutated by single base substitutions to silence them. Through the application of these basic steps a plant expression cassette can be designed that corresponds to the respective probe molecules, particularly probe molecules in the maize chip that were identified as having high expression in all tissue samples but essentially was not expressed in pollen, particularly probes that are represented by the DNA sequence presented in SEQ ID NOs: 47 to 56 and those that represented genes that were highly expressed in all tissue samples and essentially non-expressed. no or reduced expression in spike samples, particularly probes represented by the DNA sequence which is presented in SEQ ID NOs: 57-79. The latter is an expression cassette that should be transcribed in all maize tissues but not in pollen. The latter is an expression cassette that should be transcribed in all maize tissues but not transcribed, or moderately transcribed, in ears. This design strategy can be applied to all probes identified in an expression profiling experiment. In a specific embodiment of the invention, applying the above criteria results in the identification of genes that exhibit the desired expression profile. In particular, a gene encoding an actin-binding protein 3 (ABP3) is identified, particularly a maize actin-binding protein 3 (ZmABP3), which is a member of a small gene family that had been characterized. previously (López et al., 1996). The gene product has also been called actin depolymerizing factor 3. Through southern analysis it was found that there are two ABP3 genes in the maize genome (López et al., 1996), designated herein as ZmABP3-A and ZmABP3-B, respectively. The ZmABP3-A and ZmABP3-B cDNAs encode a protein of 139 amino acids that are identical to all but one residue. Expression profiling data indicate that ZmABP3-B is highly expressed in most plant tissues, but essentially excluding . the tissues of the pollen such that no expression product is present in all tissues to a significant extent, while ZmABP3-A does not have high expression. A structural analysis of the ZmABP3-B gene reveals that the coding region of the ZmABP3-B protein is encoded in 3 exons, which are interrupted by two intervening sequences (introns) flanked by the expected b and GT...AG border nucleotides. The regulatory sequence is located in the 5' region of the ABP3 gene immediately upstream of the coding sequence. The size of the regulatory region is in the range from about 2 kb to about 3 kb, particularly between about 2.3 kb and about 2.5 kb, and comprises a 5' non-transcribed sequence, in particular a 5' non-transcribed sequence. ' between approximately 0.9 kb and 1.3 kb, but especially approximately 1.1 kb, and a 5' untranslated region, particularly between approximately 0.1 kb and 0.3 kb, but especially 0 .25 kb of the 5' untranslated region and representing all or part of the ZmABP3-intron 1 nucleotide sequence, particularly a nucleotide sequence between about 0.7 kb and 1.2 kb, but especially 0.98 kb approximately. The regulatory sequence according to the invention further comprises part of the 3' sequence starting just after the ABP3 translation stop codon including transcribed but non-translated sequence (untranslated region) and non-transcribed sequence that functions as a terminator transcription and polyadenylation signal. In particular, the 3' sequence is in the range of about 0.8 kb to about 1.2 kb, particularly about 0.9 kb to about 1.1 kb, but especially about 1.013 kb. The size of the 3' untranslated region is in the range of about 0.2 kb to about 0.4 kb, but especially about 0.3 kb, and that of the untranscribed sequence is in the range of 0.5 kb and about 0.8 kb, but specifically about 0.7 kb. In a specific embodiment of the invention, the regulatory sequence is modified such that the natural translation initiation codon is silenced in order to translate it into the second exon. In another embodiment of the invention, candidate probes can be identified in a DNA chip or gene array, particularly a maize DNA chip or gene array such as the Affymetrix™ Maize Chip by applying the above criteria, which may used to identify genes or putative genes in the maize genome that exhibit the desired expression profile. Two candidate probes were identified that show virtually no signal in the spike but have high signal in other tissues. This indicates that the gene expressed in the candidate probes is not expressed in the spike, but is highly expressed in the rest of the plant. The largest expression differential, 60-fold higher in tissue other than the spike, was observed in a candidate probe of ZmO33444_S_AT. The other candidate probe (Zm040564_X_AT) showed signal variation as a function of the state of development of the probe plant material, i.e. a low signal in young spike that gradually increases to a high or higher signal as the probe grows. plant ages. The signal strength between spike samples and non-spike tissue samples differed by less than 10-fold, but the signal strength in the non-spike tissue samples was approximately 10-fold higher compared to the other candidate probe. The sequence data indicates that none of the probes correspond to a characterized gene. Both pathways identify good candidate genes for developing promoters that have high expression in non-spike tissue and have no or substantial expression in spikes. Given the high signal differential between the spike and non-spike tissue samples, an expression cassette based on the ZmO33444_S_AT probe was developed. Public and private databases 25 can be searched for the word BLASTN with the sequence Candidate probe ZmO33444_S_AT to obtain DNA sequence evidence for both transcripts and gDNA corresponding to ZmO33444_S_AT. The cDNA results with a precise match to the search sequence had two similar contigs. ZmABTl corresponds to Corn,1482.c47 and Corn.1908.c31, and ZmABT2 corresponds to Corn.1482.c32, Corn.1482.c28, Corn.1482.c53, Corn.1908.cl7, Corn.1908.c20, Corn.1908.c37 and AI947567. the sequences ZmO33444_S_AT, ZmABTl and ZmABT2 can then be used to search maize genomic DNA sequence databases to identify regulatory sequences that have high expression in non-head tissue and little or no expression in heads. These searches identified three entries, AZM4_12, ZmGSStucll-12-04.4740.1, and MAGI_88845, which meet in one with you. The ZmABT gDNA sequence is depicted in SEQ ID NO: 46. It encodes the ZmABT1 and ZmABT2 transcript, suggesting that they are alternatively spliced ​​variants of the same transcript. ZmABT1 is encoded in 5 exons and ZmABT2 is encoded in 6 exons. The extra exon is between exon 2 and exon of ZmABTl. The largest open reading frame in ZmABT1 and ZmABT2 can be used to define their translation start and stop codons and further to define the location of each translation start and stop codon. By this analysis both cDNAs use the same translation start and stop codon. In an important aspect of the present invention the regulatory sequence according to the invention can be used in the development of robust expression cassettes that express recombinant genes in most plant tissues but are not fully or substantially expressed in the tissues of the male reproductive structures, particularly the pollen and / or spike tissues so that no expression product is present in the tissues to a significant extent. In a specific embodiment of the invention, a regulatory sequence obtainable from an ABP3 gene, more particularly regulatory sequence obtainable from a Zea mays ABP3 gene, can be used in the development of robust expression cassettes that express recombinant genes in most plant tissues but essentially excluding pollen tissues so that no expression product is significantly present in the tissues. The transcription initiation region of the regulatory sequence according to the invention, particularly of the regulatory sequence obtainable from an ABP3 gene, more particularly of the regulatory sequence obtainable from a Zea mays ABP3 in a PCR reaction containing a pair of primers including a first primer Pl (5'~ atatatgcatgcggcgcgccgaaagtagcaaacaacaggttcatgtgcac-3') as depicted in SEQ ID NO: 1 and a reverse primer P2 (51tatataccatggtgggtttgcctgcgaccacaagttca-3') as depicted in SEQ ID NO: 2 through amplification of a gDNA template, particularly a maize gDNA template. In a specific embodiment of the invention, a thermocycling program is applied that includes amplification to approximately 95’C for about 15 minutes, followed by about 45 cycles 94°C for about 1 minute, about 64°C for about a minute 72°C for about 5 minutes. The final extension step is carried out at approximately 72°C for about 15 minutes. The reaction product, in particular about 2.3 kb of reaction product, is purified and the DNA is extracted using a DNA extraction method known in the art. The DNA is precipitated, recovered and finally cloned' into a suitable vector. The transcription initiation region according to the invention, in particular a transcription initiation region obtainable from an ABP3 gene, more particularly obtainable from a ZmABP3, can be modified in a series of reactions using at least one of the oligonucleotides selected from the group of oligonucleotides represented in . -SEQ ID NO: 3 (Patg (5'cagctcgcccgagttggtaaggccccct-3') ), -SEQ ID NO: 4 ... (Pnco (5 ' -acagattagtccatcgcccacggt-3 1)) , -SEQ ID NO: 5...(ADPc-1(5'-agccctgtccatgacggcccaagcaac3')), -SEQ ID NO: 6... (ADPc-2 (51-agtagcaattcggtaggcacaggcac3')), -SEQ ID NO: 7... (ADPc-4 (5'-tctatggtctgcgaggtgcggtggc3’)), and -SEQ ID NO: Θ... (adp3-a (5' -gtccccttcttcgccgcgccagctcgc3')) . The terminus of the regulatory sequence according to the invention, in particular a terminus sequence obtainable from an ABP3 gene, more particularly a terminus sequence obtainable from a ZmABP3, can be amplified from a gDNA template, particularly a template of maize gDNA, in a DNA polymerase reaction using a forward primer (P3 (5'tatatagagctcgcatcatgatcatgcatcatggact-31)) as depicted in SEQ ID NO: 9 and a reverse primer (P4 (5'atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-31)). having a nucleotide sequence as depicted in SEQ ID NO: 10. A thermocycling program may be applied comprising a first cycle of about 95°C for about 5 minutes followed by about 45 cycles of about 94'C for about 30 seconds, about 50°C for about 1 minute, and about 72°C for about 4 minutes. The final extension step can be carried out at approximately 72°C for about 15 minutes. Approximately 1 kb of reaction product is purified and DNA extracted using standard extraction methods. The DNA is precipitated, recovered, and cloned into a suitable vector. The terminus of a regulatory sequence according to the invention, in particular a terminus sequence obtainable from an ABP3 gene, more particularly a terminus sequence obtainable from a ZmABP3, can be modified to eliminate an internal restriction site, particularly an internal Ncol restriction site using a suitable primer pair, in particular the Tnco (51-Pgtaaaaaaaggtcccttggctcccagaaga-3') / T2 (51-Pcaatgtgttagactgacgtg-3') primer pair as depicted in SEQ ID NO: 11 and SEQ ID NO: 12, respectively, in DNA polymerase reaction. The thermocycling program employed may comprise a first cycle at approximately 95°C for approximately 5 minutes followed by approximately 30 cycles at approximately 95°C for approximately 1 minute, approximately 50°C for approximately 1 minute, and approximately 65°C for approximately 25 minutes. 15 minutes. The product can then be processed and sequenced. The present invention also relates to expression cassettes that incorporate the regulatory mechanisms of a target gene of interest that shows the desired expression profile, ie high expression in most plant tissues but no expression in the pollen tissue, particularly an ABP target gene, more particularly a ZmABP3 target gene, to control in plants the expression of products of nucleic acid molecules of interest in a manner that mimics the expression profile of the original target gene. The present invention further includes expression cassettes incorporating regulatory sequences obtainable from the 5' region of the target gene, in particular an ABP target gene, more particularly a ZmABP3 target gene, for expressing the products of acid molecules. nucleic of interest in plant tissues but no or substantial expression in pollen tissue. The present invention also relates to expression cassettes incorporating the regulatory sequences obtainable from the 5' region and the 3' region of the target gene, particularly an ABP3 target gene, more particularly a ZmABP3 target gene. In another specific embodiment of the invention, an obtainable maize genomic DNA sequence can be used for the development of robust expression cassettes that transcribe polynucleotides in most plant tissues but essentially excluding ear tissues. such that no expression product is present in the tissues to a significant extent. An inclusive gene structure-based design can be used to construct this expression cassette. In order to incorporate the alternative method of splicing the identified putative maize gene into a method as described above in the expression cassette, the design strategy can be based on the structure of the ZmABTl transcript as depicted in SEQ ID NO. :33. The transcription initiation region of the regulatory sequence according to the invention, in particular of the ZmABT promoter region, can be amplified from a maize gDNA standard in a DNA polymerase reaction containing gDNA in a primer pair containing includes the forward primer ABT Pl forw (5'-CGACCAGCGCGACATGCATGGCA-3') as depicted in SEQ ID NO: 19 and ABT P2 rev (5'ACCCAGGGCGTACGACAAGGCC-31) as depicted in SEQ ID 20 NO: 20. In In a specific embodiment of the invention, a thermocycling program is applied that includes amplification at approximately 95°C for approximately 5 minutes, followed by approximately 40 cycles at approximately 94°C for approximately 30 seconds, at approximately 67°C for 30 seconds. about and about 72°C for about 2.5 minutes. The final extension step was carried out at approximately 72°C for about 10 minutes. This amplification reaction leads to an approximately 2.6 kb amplification product, which can be purified and DNA extracted using standard DNA extraction methods. The DNA can then be cloned into a suitable vector such as the pCR-BluntlI -TOPO vector. The ZmABT promoter can be modified in a series of mutagenesis reactions to silence the endogenous translation start codon, silence a SanDI restriction site, and correct point mutations created during amplification. This can be achieved by a series of reactions using at least one of the oligonucleotides 15 selected from the group that -SEQ ID NO: 21 pABT mutl -SEQ ID NO: 22 pABT mut2 -SEQ ID NO: 23 pABT mut3 -SEQ ID NO: 24 pABT mut4 20 -SEQ ID NO: 25 pABT mut5 -SEQ ID NO: 26 pABT mut6 is represented in (51 -GATCGCO3GAIT3GGCTCCaX3GGTGGAG-3') (5' -CT3GGAGGQ3OSCAAGGGCX2)GITOCTOG-3 ') (5' -O3JACCG(XX3GñG^^ ') (5' -GrCACCOGGGAGCACITCCOGGOGCOG-3') (5 ' -CAITGGGCCX3AGCAO9GCr-TCr3 ' ) (5'-GGGGI7M3GGTXnTCITGAGrOGrGAAGOGAC-3') The modified ZmABT promoter can be amplified in another PCR reaction using the primers pABT ampl (5'GCGTCTAGAGGGACCCCGACCAGCGCGACATGCATGGCA-3') as depicted in SEQ ID NO: 27 and pABT amp2 (5'-ACCCCAGGG- CGTACGACAAGGCCCCACCATGGGCGC-3') as depicted in SEQ ID NO: 28. The PCR product can then be purified and DNA extracted using a standard DNA extraction method. The DNA can then be cloned into a suitable vector such as the pCR-BluntlI -TOPO vector, transformed and sequenced. The ZmABT promoter can then be excised, particularly as an Xbal / Ncol fragment, and ligated into a suitable expression vector such as pNOV6901. In one embodiment of the invention, an expression cassette is provided comprising a termination sequence obtainable from the ZmABT gene identified and described hereinabove. The ZmABT-terminus can be amplified from a maize gDNA template by a DNA polymerase reaction containing gDNA and a primer pair including the forward primer ΆΒΤ P4 (51TATATAGAGCTCGAATCGAAGAAGCCACACTGTAAATCTGCCGGG-3') as depicted in SEQ ID NO: 29 and a reverse primer ΑΒΤ P5 (5'-AGCAAGGCATATGCAGCAGCTGCTGGTCGGACCGGGCCCTATATA-3') as depicted in SEQ ID NO: 30 resulting in an approximately 1 kb amplification product. This reaction product can then be purified and DNA extracted using a standard DNA extraction method. The DNA can then be cloned into a suitable vector such as the pCR4-TOPO-Blunt vector. In one embodiment of the invention the ZmABP3 terminus is modified to remove the internal Ncol and Xhol restriction sites. This can be achieved by a series of reactions using at least one of the oligonucleotides selected from the group represented in -SEQ ID NO: 31 ABTt mi (5'-GTCATCCATGGGCAICTGAAGGAGGAGCC-31) -SEQ ID NO: 32 ABTt m2 (5'The amplification product can then be processed and be sequenced to result in a terminator sequence as depicted in SEQ ID NO: 36. In one embodiment of the invention, a expression cassette that expresses recombinant genes in most plant tissues but essentially excludes ear tissues such that no expression product is significantly present in the tissues, comprising a regulatory sequence where at least part of this it has a transcription initiation function and a regulatory sequence where at least part of it has a termination function, these regulatory sequences being able to be obtained from the ZmABT gene identified and described herein above. In one embodiment of the invention, this expression cassette can be obtained by cutting the ZmABT-terminus and ligating it to a suitable vector that already comprises a regulatory sequence where at least a couple of these have a transcription initiation function, particularly the sequence of the ZmABT promoter such as the pNOV6901-prABT vector described above. In one embodiment, the expression cassette according to the invention comprises a nucleotide regulatory sequence comprising approximately 2.6 kb of 5' sequence, consisting of approximately 2 kb of 5' nontranscribed sequence, and approximately 12 5' untranslated region bp, approximately 0.6 kb representing exon 1, intron 1 and approximately 16 bp of exon 2; and approximately 1 kb of 3' sequence beginning just after the translation stop codon and includes approximately 0.6 kb of 3' untranslated region and approximately 0.4 kb of nontranscribed sequence, and features such as transcription terminator and polyadenylation signal. In one embodiment, an expression cassette is provided in accordance with the invention where the natural translation start codon is silenced and translated into the second exon. The complete expression cassette can be mobilized in a vector suitable for plant transformation and expression such as, for example, an Agrobacterium binary vector, particularly the Agrobacterium 15289 binary vector. The nucleic acid segment of interest can, for example, encode ribosomal RNA, antisense RNA, or any other type of RNA that is not translated into protein. In In another preferred embodiment of the invention, the nucleic acid segment of interest is translated into a protein product. The transcription directing nucleotide sequence and / or nucleic acid segment may be of homologous or heterologous origin with respect to the plant being will transform. A useful recombinant DNA molecule for introduction into plant cells includes one derived or isolated from any source that can be subsequently characterized with respect to size and / or function of structure, chemically altered, and then introduced into plants. Thus a useful nucleotide sequence, segment or fragment of interest includes fully synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, etc. Generally, the introduced DNA is not an original resident of the receiving plant genotype, but it is within the scope of the invention to isolate a gene from a given plant genotype and subsequently introduce multiple copies of the gene into the same genotype, for example to increase the production of a given gene product such as a storage protein or a protein involved in carbohydrate metabolism or any other gene of interest as represented in SEQ ID NO of the sequence listing. The introduced recombinant DNA molecule includes, but is not limited to, DNA from plant genes and from genes from non-plant tissues such as bacteria, yeast, animals or viruses. The introduced DNA may include modified genes, portions of genes, or chimeric genes, including genes of the same or another genotype. The term chimeric gene or chimeric DNA is defined as a gene or DNA sequence or segment that comprises at least two DNA sequences or fragments from species that do not combine DNA under natural conditions, or where the DNA sequences or segments are located or are linked in a way that does not occur naturally in the native genome or the untransformed plant. The introduced recombinant DNA molecule used for transformation herein can be circular or linear, double-stranded or single-stranded. Generally, the DNA is in the form of chimeric DNA, such as plasmid DNA. In one embodiment the regulatory sequences may be operatively associated with an expressible polynucleotide of interest. The expressible polynucleotide can encode a polypeptide or protein of interest. This polypeptide or protein of interest can be such that it exhibits a certain biological activity such as, for example, an insecticidal, herbicidal or fungicidal activity or can contribute to a better yield of a crop of agricultural interest in the form of yield, quality, turnover, resistance to biotic and abiotic stress) control of flowering, etc. 100 In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the tissues of the reproductive structures of the plant, particularly in the pollen and / or spike tissues, is such that no insecticidal activity can be detected in an assay. of standard insect feeding. In particular, the concentration of the expression product in tissues of the male reproductive structures, particularly in the pollen and / or spike tissues, is less than the baseline level of about 10 ng / mg of soluble protein, particularly 5 ng / mg. about soluble protein, more particularly about 3 ng / mg soluble protein, but especially about 2 ng / mg soluble protein or less. In a specific embodiment of the invention, the polypeptide or protein of interest is an insecticidally active protein or polypeptide, particularly an insecticidally active protein or polypeptide obtainable from Bacillus thuringiensis, more particularly a Bacillus thuringiensis endotoxin, such as crylA endotoxin. (b). Other endotoxins known to occur in Bacillus thuringiensis can also be used in association with the regulatory sequence according to the invention to obtain toxin expression in most plant tissues except pollen and / or spike in a manner 101 that there is no expression product present in the tissues to a significant extent. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding a polypeptide or protein of interest encodes a Bacillus thuringiensis endotoxin, having a sequence identity of at least 80%, particularly a sequence identity of at least 85%, particularly a sequence identity of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% with a nucleotide sequence as depicted in SEQ ID NO:15. In one embodiment, a transgenic plant is provided in accordance with the invention and as described herein, wherein the polynucleotide encoding the polypeptide or protein of interest encodes a Bacillus thuringiensis endotoxin having the nucleotide sequence as- depicted in SEQ ID NO: 15. Upon completion, the expression cassette can be transferred into a vector suitable for plant transformation, such as a binary vector, which can be mobilized into maize via Agrobacterium-mediated transformation. Transgenic plants (or plant cells or plant explants or plant tissues) incorporating the 102 polynucleotides of the invention and / or express a polypeptide of interest, such as a B. thuringiensis toxin protein, can be produced in a variety of well-established techniques. After constructing an expression cassette and a vector incorporating the polynucleotide sequence in accordance with the invention and as described herein, standard techniques can be used to introduce the polynucleotide into a plant, plant cell, plant explant, or plant tissue of interest. Optionally, the plant cell, explant or tissue can be regenerated to produce a transgenic plant. The plant may be a higher plant, gymnosperm, monocot and including dicot plants. There are suitable protocols available for Leguminosae (alfalfa, Umbelliferae (carrot, celery, turnip), Cruciferae (cabbage, radish, rapeseed, broccoli, Curcurbitaceae (melon and cucumber), Gramineae (wheat, corn, rice, barley, millet, etc.), Solanaceae (potato, tomato, tobacco. pepper, etc.), and various other crops. See some described protocols Ammirato et al. , eds. , (1984) Handbook of Plant Cell Culture--Crop Species, Macmillan Publ. Co., New York, N.Y. ; Shimamoto et al. (1989) Nature 338: 274 276; Fromm et al. (1990) Bio / Technol. 8:833 839; and Vasil et al. (1990) Bio / Technol. 8: 429 434. Currently, the transformation and regeneration of monocot cells 103 and dicots is a routine procedure and the connoisseur will select the most suitable transformation technique will be determined. The choice of method will vary depending on the type of plant to be transformed; those skilled in the art will recognize the suitability of particular methods for particular types of plants. Suitable methods include, without limitation: electroporation of plant protoplasts; liposome-mediated transformation; polyethylene glycol (PEG)-mediated transformation; transformation using viruses; plant cell microinjection; bombardment of plant cells with microprojectiles; vacuum infiltration; and Agrobacterium tumefaciens-mediated transformation. Transformations can be performed with a single DNA species or with multiple DNA molecules (ie, co-transformation) and both of these techniques are suitable for use with the expression cassettes of the present invention. There are numerous transformation vectors available for the transformation of plants and the expression cassettes of this invention can be used in conjunction with any of those vectors. Selection of the vector will depend on the preferred transformation technique and the target species for transformation. There are a variety of techniques available to those skilled in the art and for introducing constructs into a 104 PLANT CELL RECEIVER. Generally, such techniques include transformation with DNA using A. tumefaciens or A. rhizogenes as the transforming agent, liposomes, PEG precipitation, electroporation, DNA injection, direct DNA uptake, microprojectile bombardment, particle acceleration, and the like (see eg EP 295959 and EP 138341) (see below). However, cells other than plants can also be transformed using the expression cassettes of the invention. General descriptions of plant expression vectors and reporter genes and of Agrobacterium and Agrobacterium-mediated gene transfer can be found in Gruber et al. (1993). Expression vectors containing the regulatory polynucleotide sequence according to the invention can be introduced into protoplasts or into intact tissue or isolated cells. Preferably, expression vectors are introduced into intact tissue. General methods for culturing plant tissues are presented, for example, in Maki 20 et al., (1993); and by Phillips et al. (1988). Preferably, expression vectors are introduced into maize and other plant tissue using a direct gene transfer method such as microprojectile delivery, DNA injection, electroporation, and the like. More preferably, vectors of 105 expression in plant tissues using microprojectile medium delivery with the biolistic device. See, for example, Tomes et al. (nineteen ninety five). The vectors of the invention may not be used exclusively for the expression of structural genes, but also in exon cloning or promoter procedures to detect differential expression of genes in a variety of tissues (Lindsey et al., 1993; Auch & Reth et al.). Particularly preferred is the use of the binary vectors of Agrobacterium spp. Ti and Ri plasmid vectors. Ti-derived vectors transform a wide variety of higher plants, including monocots and dicots, such as soybean, cotton, rapeseed, tobacco, and rice (Pacciotti et al., 1985; Byrne et al., 1987; Sukhapinda et al., 1987; Lorz et al., 1985; Potrykus, 1985; Park et al., 1985: Hiei et al., 1994). The use of T-DNA to transform plant cells has been the subject of extensive studies and is described in detail (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An et al., 1985). For introduction into plants, the chimeric genes of the invention can be inserted into binary vectors as described in the examples. One skilled in the art will appreciate that the selection of the method should depend on the type of plant, ie monocot or dicot, which it is desired to transform. 106 Suitable methods for transforming plant cells include, but are not limited to, microinjection (Crossway et al., 1986), electroporation (Riggs et al., 1986), Agrobacterium-mediated transformation (Hinchee et al., 1988), direct gene transfer (Paszkowski 1984) and ballistic particle acceleration using devices available from Agracetus, Inc., Madison, Wis. and BioRad, Hercules, Calif. (See, for example, Sanford et al., US Patent No. 4,945,050; and McCabe et al., 1988). See also Weissinger et al., 1988; Sanford et al., 1987' (onion); Christou et al., 1988 (soybean); McCabe et al., 1988 (soybean); Datta et al., 1990 (rice); Klein et al., 1988 (corn); Klein et al., 1988 (corn); Klein et al., 1988 (corn); Froram et al., 1990 (corn); and Gordon-Kamm et al., 1990 (corn); Svab et al., 1990 (tobacco chloroplast); Koziel et al., 1993 (corn); Shimamoto et al., 1989 (rice); Christou et al., 1991 (rice); European patent application EP 0 332 581 (dactylis and other Pooideae); Vasil et al., 1993 (wheat); Weeks et al., 1993 (wheat). In another embodiment, the protoplast transformation method for maize is employed (European patent application EP 0 292 435, US patent No. 5,350,689). In another embodiment, a nucleotide sequence of the present invention is directly transformed into the plastid genome. The plastid transformation technology 107 is extensively described in US Pat. 5,451,513, 5,545,817 and 5,545,818, in PCT application no. WO 95 / 16783 and in McBride et al., 1994. After transformation, plants are preferably selected using a dominant selectable marker incorporated into the transformation sector. Typically such a marker will confer antibiotic or herbicide resistance to transformed plants and selection of transformants can be achieved by exposing plants to suitable concentrations of antibiotic or herbicide. After the transformed plants or cells are selected and grown to maturity, plants displaying the trait of interest are identified. The trait can be any of the traits described above. Additionally, to confirm that the trait of interest is due to expression of the introduced polynucleotide of interest under the control of the regulatory nucleotide in accordance with the invention, expression levels or activity of the polypeptide or polynucleotide of interest can be determined. 20 analyzing mRNA expression using Northern blot, RTPCR or microassays, or protein expression using immunoblotting or Western blot or enzyme activity assays. Thus, the invention relates to plant cells and tissues, to plants derived from these cells and 108 tissues, respectively, with plant material, with the progeny and seeds derived from those plants, and with agricultural products, including processed plant products with better properties obtainable by, for example, any of the transformation methods described below . Once an expression cassette according to the present invention and as described herein comprising a regulatory sequence according to the invention in association with a polynucleotide of interest has been transformed in a particular plant species, it can be propagated. in that species or migrate to other varieties of the same species, particularly among them commercial varieties, using traditional breeding methods. Preferred plants of the invention include gymnosperms, monocots and dicots, especially agriculturally important crops such as rice, wheat, barley, rye, rapeseed, maize, potato, carrot, sweet potato, sugar beet, bean, pea, chicory , lettuce, cabbage, cauliflower, broccoli, turnip, radish, spinach, asparagus, onion, garlic, eggplant, pepper, celery, carrot, zucchini, pumpkin, zucchini, cucumber, apple, pear, quince, melon, plum, cherry, peach , nectarine, apricot, strawberry, grape, raspberry, blackberry, pineapple, avocado, papaya, mango, banana, soybean, tobacco, tomato, 109 sorghum and sugar cane. The genetic properties engineered in the described transgenic plants are transmitted by sexual reproduction or vegetative growth and can thus be maintained and propagated in progeny plants. Generally, maintenance and propagation make use of methods known in agriculture developed to suit specific purposes such as tilling, planting or harvesting. Specialized processes 10 such as hydroponics or greenhouse techniques can also be applied. The use of the advantageous genetic properties of the transgenic plants according to the invention can also be applied in the genetic improvement of plants aimed at the development of plants with better properties such as tolerance to pests, herbicides or stress, better nutritional value, higher performance or better structure causing less losses due to overturning or breaking. The different stages of genetic improvement are characterized by a well-defined intervention by the human being in the selection of the lines to be crossed, the direction of pollination of the parental lines or the selection of suitable progeny plants. Depending on the desired properties, different genetic improvement measures are taken. Relevant techniques are well known in the art and include, but are not limited to, hybridization, 110 inbreeding, crossbreeding, multiline breeding, varietal mixing, interspecific hybridization, aneuploid techniques, etc. Hybridization techniques also include sterilization of plants to produce sterile male or female plants by mechanical, chemical, or biochemical means. Cross-pollination of a male-sterile plant with pollen from a different line ensures that the genome of the male-sterile plant and the female-fertile plant uniformly obtain the properties of both parental lines. In this way, the transgenic plants according to the invention can be used for the genetic improvement of improved plant lines, which for example increase the efficiency of methods Conventional methods such as herbicide or pesticide treatment or allow these methods to be ruled out thanks to their improved genetic properties. Alternatively, new crops with improved stress tolerance can be bred which, thanks to their improved genetic characteristics, produce a higher yield than plants that could not tolerate comparable adverse growing conditions. In one embodiment of the invention, the plant expresses and has been transformed with a nucleotide sequence encoding a polypeptide or protein a polypeptide product that encodes a polypeptide product that exhibits insecticidal activity, particularly a Bacillus endotoxin. 111 thuringiensis in most plant tissues but essentially excluding pollen and / or spike tissues such that no expression product is present in tissues to a significant extent, where the nucleotide sequence is not transcribed to any significant extent. Thus, essentially no expression occurs in the pollen and / or spike tissue and only trace amounts, if any, can be detected in the tissues, which is not sufficient for the expression product to fulfill its intended biological function in the tissues. tissues or exhibit any toxic effect against insects that feed on those tissues or against the plant itself. In one embodiment, the concentration of the expressed polypeptide product of the protein-encoding polynucleotide of interest in the pollen and / or spike tissues is such that no insecticidal activity can be detected in a standard insect feeding assay. In one embodiment of the invention, the concentration of expression product in pollen is less than the baseline level of about 10 ng / mg soluble protein, particularly about 5 ng / mg soluble protein, more particularly 3 ng / mg protein. about soluble, but especially 2 ng / mg soluble protein or less. The invention also provides methods for preparing expression cassettes comprising the regulatory sequence 112 according to the invention comprising joining an expressible polynucleotide encoding a polypeptide or protein of interest with the regulatory sequence according to the invention and as described herein to obtain an expression construct, wherein the polynucleotide of interest is operably linked or associated with the regulatory sequence such that expression of the polypeptide or protein of interest is mediated by the regulatory sequence in accordance with the invention and results in expression of the polypeptide or protein of interest in essentially all. plant tissues, but essentially excludes expression in the tissues of plant reproductive structures, particularly in the pollen and / or spike tissues such that no expression product is significantly present in the tissues. In one embodiment, the invention relates to a method of producing a transgenic plant that expresses a DNA sequence of interest in tissue other than pollen but not, substantially or entirely, in pollen and / or spike tissues, which comprises a) transforming an expression cassette according to the invention and as described herein into a plant cell comprising a 25 nucleotide regulatory sequence, which at least in part has a function of 113 transcription initiation mediating expression of a polynucleotide encoding an operably associated protein of interest in most plant tissues but essentially excluding pollen and / or spike tissues such that no expression product is present in those tissues significantly; Y b) regenerating the plant cell transformed in step a) into a plant. In one embodiment, the invention relates to a method of controlling target insect pests that feed on vegetative plant tissue such as the leaf, stem and root and / or reproductive tissues such as the ear, but which protects the pests non-targets that feed on pollen, which includes a) cultivating a plant in accordance with the invention and as described herein in an area infested by the target pest; b) expressing a polypeptide or protein that is capable of controlling the target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to a method to protect the reproductive tissues of a plant, particularly the pollen and / or tassel tissues, from damage caused by expression in the tissues of a 114 polypeptide or protein of interest, comprising a) cultivating a plant in accordance with the invention and as described herein; b) expressing a polypeptide or protein of interest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the invention relates to the use of a regulatory sequence in accordance with the present invention and as disclosed herein to control target insect pests that feed on vegetative plant tissue such as leaf, stem, and root. and / or reproductive tissues such as the ear, but that protects non-target pests that feed on pollen, which includes a) cultivating a plant in accordance with the invention and as described herein in an area infested by the target pest; b) expressing a polypeptide or protein that is capable of controlling the target pest under the control of a regulatory sequence in accordance with the invention and as described herein. In one embodiment, the present invention relates to the use of a regulatory sequence in accordance with the present invention and as disclosed herein to protect the reproductive tissues of a plant, in particular the pollen and / or spike tissues against the damage 115 caused by the expression in the tissues of a polypeptide or protein of interest that expresses the polypeptide or protein of interest under the control of a regulatory sequence in accordance with the invention and as described herein. EXAMPLES The following Examples present illustrative embodiments. In light of the present description and the general level of skill in the art, those skilled in the art can appreciate that the following Examples are presented by way of example only and that numerous changes, modifications, and alterations may be made without departing from the scope of the content contained therein. is claimed in this document. All manipulations and techniques necessary to construct and propagate the strains described in the invention are known to those skilled in the art. Technical details are described, for example, in Ausubel et al 1995; Sambrook, J, 2001 and Miller, J.H. 1992 and in the relevant publications cited in the invention. Example 1: Expression in tissues other than pollen Example 1.1 Identification of ZmñBP3 In a maize expression profiling experiment, ✓ performed a corn growth array search on a Zea mays Affymetrix chip (Zm80K) for probes that had 25 strong signals in all samples, but none or 116 substantially none in the pollen sample. All green and root tissue samples were directly compared to pollen and probes representing polynucleotides that did not meet the target expression profile were removed. The analysis produced two sets of results. The first set contains 36 probes representing polynucleotides that had high expression in tissue samples, but very low expression in pollen. The second set contains 10 probes representing polynucleotides that had high expression in the tissue samples, but none in the pollen. Alignment of the probe sequence with the maize cDNA pool data sets indicated that all 46 represented bona fide maize genes. The top 10 probes are those that have the strongest signal in all tissues other than pollen and have no signal at all in pollen (see Table A). Application of additional criteria including determination of cDNA and genomic DNA (gDNA) sequence availability for each lane yielded Zm07728_s_at as the top candidate meeting all promoter development requirements. Analysis of the literature revealed that this probe represents the gene encoding actin-binding protein 3 (ZmABP3), which is a member of a small gene family that had been previously characterized (López et al., 1996). The product 117 gene has also been called actin depolymerization factor 3. López et al (1996) confirm in Figure 3 that ZmABP3 has high expression in most plant tissues examined, except in pollen samples. López et al (1996) also demonstrated by southern analysis that there are two ABP3 genes in the maize genome. The reported ZmABP3 cDNA is GenBank accession X97726 and corresponds to TIGR accession TC248585. This gene was designated ZmABP3-A. Both ZmABP3 genes are represented on the maize Affymetrix chip (Zm80K): ZmABP3-A corresponds to the Zm007595_at probe and ZmABP3-B corresponds to Zm07728_s_at. The sequence ,ZmO7728_s_at' was used to identify TC248588 in the TIGR database, and MAIZE.974.CB1 in a maize cDNA pool database. He also identified the gDNA sequences MAGI_93606, MAGI_93607, AZM4_39177, ZmGSStucll-12-04.2725.1, ZmGSStucll-12-04.2725.2 and CC463190. The ZmABP3-A and ZmABP3-B cDNAs encode proteins that are identical at all but one residue. The expression profiling data indicates that ZmABP3-B is highly expressed in most plant tissues, but essentially excluding pollen tissues such that no expression product is present in all tissues to a significant degree. ZmABP3-A does not have a high expression. SEQ ID NO: 16 shows that the ZmABP3-B mRNA is encoded in 3 exons. The two intervening sequences (introns) are between the expected OT...AG boundary nucleotides. 11Θ More specifically, SEQ ID NO: 16 presents the design of the ZmABP3 expression cassette. The ZmABP3 regulatory components to be included in the construct are 2.3 kb of 5'-sequence (prZmABP3-01) containing 1.1 kb of 5'- nontranscribed sequence, 0.25 kb of nontranslated sequence of 5'- and 0.98 kb representing the ZmABP3-B-intron 1; and 1.013 kb of 3' sequence (tZmZBP3~01) beginning just after the ABP3-B translation stop codon. This includes about 0.3 kb of 3' untranslated region and 0.7 kb of non-transcribed sequence. Table A shows a summary of the 10 candidate probes that represent polynucleotides with a high level of expression in all maize tissues but no expression signal in pollen. Mean expression Ncanbre do Expression gene description (all Zea mays probe reference pollen tissues) Coinc. TIGR AF032370_at Profilina Zea mays, (PRO4) mRNA, cds. comp. absent 4208 TC269677 Ctrl_ZnU45855- 3_at From 808 to 1307 glyceraldehyde-3-phosphate dehydrogenase GAPC2 (gpc2), mRNA, cds. comp. absent 4275 TC269361 Similar to CAA63903,l Pennisetum glaucum; heat shock protein 17.9; P,glaucum ñRNm for protein Zm001747_s_at of heat shock, HSP 17.9 absent 4945 TC268849 119 Similar to AAB99745.1 Triticum aestivum; HSP70; Triticum aestivum 70 kDa heat shock protein (TaHSP70d) mRNA, cds. comp.; 70 kDa shock protein Zm005803_s_at caloric, molecular escort absent 4091 TC247918 Similar to SW:ADF3_MAIZE Q41764 zea mays (maize), actin depolymerizing factor 3 (adf3) (zmabp3) absent Zm00772B_s_at (zmadf3), Similar to BAC2,Ory4za4 sativa (japonica cultivar group); ; Oryza sativa (japonica cultivar group) genomic DNA, chromosome 7, PAC clone:P0453E03; contiene ESTS C96778(C10671),022278 (C10671) proteína ausente 4805 TC248583 Zm009722_s_at desconocida Similar a SW:RS5A_ARATH Q9zut9 arabidcpsis thaliana (Arabidopsis thaliana), 4Os ausente 3306 TC248975 ZmO1533S_S_at proteína s5-l, 2 / 2003 Similar a AAD39835,1 Arabidcpsis thaliana ; Ran-binding protein siRanBP; Arabidopsis thaliana Ran-binding protein (siRanBP) mRNA, cds. absent 3598 TC269022 Zm021004_s_at comp.; atranbpla homolog 3092 TC269986 Zm058948_s_at No description No description =absent absent sucrose synthase 4337 TC270333 Zm061393_s_a 6509 TC258905 120 Example 1.2 CrylAbG6 Construction CrylAbG6 (2814 bp) is a modified version of the full-length CrylAb (pNOV1321-, 3546bp) gene. The Geiser sequence (81 bp from 4398-4478 in pN0V1321) and the 3' terminus (651bp from 4908-5558 in pNOV1321) were removed. The CrylAbG6 sequence was constructed from pNOV1321 (source vector for the full length CrylAb gene) as follows: Plasmid DNA from pNOV1321 was cut with BamHI / SacI. The full length CrylAb gene (3546bp, named Michigan) was gel purified and ligated into expression vector pTrcHisB (In vitrogen life technologies, Cat# V36020), which was cut with BamHI / SacI. This construct was named Michigan-pTrcHisB. The Geiser sequence (81bp) was removed from Michigan-pTrcHisB by overlapping PCR with the following primers: 5' Bfrl (5'-cctggtggagtgcttaagcgacgagttctgcctgg-3'), (SEQ ID NO: 83) 3' Xbal (5'-gggcttctcctccaggaactctagattgcccaggcg-3'), (SEQ ID NO: 84) 5'Gfix (5'-catcggcaagtgccaccacagccaccacttcagcctg-3') (SEQ ID NO: 85) and 3'Gfix (5'-gctgtggtggcacttgccgatggggctggg-3') (SEQ ID NO: 86). PCR product A was prepared using high fidelity PCR with Michigan-pTrcHisB as template and the 5' Bfrl and 3' Gfix primers. PCR product B was prepared using 121 High fidelity PCR with Michigan-pTrcHisB as template and primers 5' Bfrl and 3'Xbal. The final PCR used the products A and B as standards and the primers 5'Bfrl and 3'Xbal. The final band from the PCR was digested with AflII / Xbal and gel-purified. This fragment was ligated with MichiganpTrcHisB which had also been digested with Xbal / AflII. The correct recombinant DNA product was identified by an AflII / Xbal digest assay. This construct was named CrylAb-G. A second PCR construct was prepared by high fidelity PCR using pNOV1321 as template, primer 5'lAbSXbal (51-gcccgcctgggcaatctagagttcctggagggag-31) depicted in SEQ ID NO: 87 and reverse primer 3'lAb3d6 (51 -gcgagctcctagatgcggccctcgagttcctcgaaga-31) which is depicted in SEQ ID NO: 88. The PCR product was digested with Xbal / SacI and ligated to CrylAb-G which was also digested with Xbal / SacI. The correct recombinant DNA product was identified by BamHI / SacI restriction analysis. This construct was called CrylAbG6. The CrylAbG6 sequence was subjected to QuikChange mutagenesis to remove an internal Ncol site. The 25 pL reaction contained pL of CrylAbG6 standard, 2.5 pL QuikChange 10X buffer, pL dNTP QuikChange mix, 122 pL of cy2' (51-Pccctgtacggcacgatgggcaacgctgca-31; SEQ ID NO: 89) 20 μΜ, 0.75 μΐι Quik Solution and pL QuikChange DNA Polymerase. The thermocycling program was 95°C for 5 minutes followed by 30 cycles of 95°C for 1 minute, 55°C for 1 minute, and 65°C for 20 minutes. The product was processed as described by the manufacturer (Stratagene) and fully sequenced. The CrylAbG6 coding sequence was amplified from a mutagenized plasmid stock, above, in 50 pL of a Pfu turbo DNA polymerase reaction (Stratagene) containing pL of stock, pL of 10X Pfu buffer, pL of 10 mM dNTP mix, pL of cyl(51-atatatccaccatggacaacaaccccaaca-3'; SEQ ID NO: 90) 20 pM, pL of cy2(51-tatatagagctcctagatgcggccctcgagt-31; SEQ ID NO: 91) 20 pM and pL Pfu turbo DNA polymerase. The thermocycling program was 95°C for 2 minutes followed by 40 cycles of 95°C for 1 minute, 50°C for 1 minute, and 72°C for 7 minutes. The final extension step was 72°C for 15 minutes. The product 2.8 kb reaction 123 was gel purified on 1% agarose TAE and DNA was extracted using the extraction method of Qiaprep DNA. The recovered DNA was digested with Ncol / SacI and ligated with pNOV6901 vector which was also digested with Ncol / SacI. The operation replaced the GUS coding sequence in pNOV6901 with CrylAbG6. The CrylAbG6 sequence is presented in SEQ ID NO: 15. Example 1.3 Construction of the ZmABP3 Expression Cassette An inclusive design strategy was used to develop the ZmABP3 expression cassette. The cassette contains 2.3 kb of 5' sequence consisting of 1.1 kb of 5' nontranscribed sequence, 0.25 kb of 5' untranslated region and 0.98 kb representing the ZmABP3-intron 1 The natural translation start codon was silenced to move it to the second exon. The expression cassette also contains 1013 kb of 3' sequence beginning just after the ABP3 translation stop codon. This includes approximately 0.3 of the 3' untranslated region and 0.7 kb non-transcribed sequence, and functions as the transcription terminator and polyadenylation signal. Terminal ZmABP3 was amplified from maize cDNA template in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing pg gDNA, 124 pL of Proofstart 10X buffer, 1.5 pL of 10 mM dNTP mix, 2.5 pL of P3 (51-tatatagagctcgcatcatgatcatgcatcatggact- 3'; SEQ ID NO: 9) 20 pM, 2.5 µL of P4 (5 atatatactagtggcgcgccacactttctgtcgcatgtgatttgca-31; SEQ ID NO: 10) 20 pM, pL Quik Solution and pL Proofstart DNA Polymerase. The thermocycling program was 95°C for 5 minutes followed by 45 cycles of 94°C for 30 seconds, 50°C for 1 minute and 72°C for 4 minutes. The final extension stage was 72°C for 15 minutes. The 1 kb reaction product was gel-purified on 1% agarose ΤΆΕ and DNA was extracted using the extraction method of Qiaprep DNA. The DNA was ethanol precipitated, recovered in 4 pL of ddH2O, and cloned into the pCR4-TOPO-Blunt vector. The ZmABP3 terminus was modified to remove the internal Ncol restriction site using the Stratagene QuikChange Multi-site mutagenesis package. The pL reaction contained pL of pCR4-TOPO-ZmABP3-terminal, 2.5 pL QuikChange 10X buffer, pL dNTP QuikChange mix, pL Tnco(51-Pgtaaaaaaaggtcccttggctcccagaaga-31; SEQ 125 ID NO: 11) 20 μΜ, pL of T2 (5'-Pcaatgtgttagactgacgtg-3'; SEQ ID NO: 12) μΜ, 0.75 pL Quik solution and 1 pL QuikChange DNA polymerase, The thermocycling program was 95°C for 5 minutes followed by 30 cycles of 95°C for 1 minute, 50°C for 1 minute, and 65°C for 15 minutes. The product was processed as described by the manufacturer (Stratagene) and fully sequenced. The ZmABP3-terminal sequence is depicted in SEQ ID NO: 14. The ZmABP3 promoter was amplified from the maize cDNA template in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing 10 pg gDNA, pL of 2X Hotstart Master Mix, 1.25 pL of 20 pM P1 (51 atatatgcatgcggcgcgccgaaagtagcaaacaacaggttcatgtgcac-31; SEQ ID NO: 1), 1.25 µL of P2 . (5'tatataccatggtgggtttgcctgcgaccacaagttca-31; SEQ ID NO: 2) 20 P.M, 10.5 pL of Quik Solution and pL of 25 mM MgCl2. The thermocycling program was 95 °C for 15 126 minutes followed by 45 cycles of 94°C for 1 minute, 64°C for 1 minute, and 72°C for 5 minutes. The final extension step was 72°C for 15 minutes. The 2.3 kb reaction product was gel purified on 1% TAE agarose and DNA extracted using the Qiaprep DNA extraction method. The DNA was ethanol precipitated, recovered in 4 pL of ddH2O, and cloned into the pCR4-TOPO vector. The ZmABP3 promoter was modified in a series of QuikChange reactions as detailed above using the following oligonucleotides: Patg (5'-cagctcgcccgagttggtaaggccccct-3'; SEQ ID NO: 3), Pnco (51-acagattagtccatcgcccacggt-3'; SEQ ID NO: 4), ADPc-1 (5'-agccctgtccatgacggcccaagcaac-31 1 ; SEQ ID NO: 5 ), ADPc-2 (51-agtagcaattcggtaggcacaggcac-3'; SEQ ID NO: 6), ADPc-4 (5 1 -tctatggtctgcgaggtgcggtggc-31 ; SEQ ID NO: 7), and adp3-a (5'-gtccccttcttcgccgcgccagctcgc-3 1 ; SEQ ID NO: 8). The ZmABP3-terminal sequence is depicted in SEQ ID NO: 13. The ZmABP3 Be terminus was ligated with the vector pNOV6901CrylAbG6 (from Example 2) as a Sacl / Spel fragment. Subsequently, the ZmABP3 promoter was ligated into the vector as a Sphl / Ncol fragment. This produced the set ZmABP3 127 CrylAbG6, which is depicted in SEQ ID NO: 37. This full length ZmABP3-CrylAbG6 expression cassette was transferred into a binary vector, pNOV6900, as an Ascl fragment. These constructs, ZmABP3-CrylAbG6-6900 and ZmABP3-CrylAbG6-enhanced binary, are depicted in SEQ ID NOS: 38 and 39, respectively. The only difference between these vectors is the presence of the CaMV-FMV dual enhancer in the enhanced ZmABP3CrylAbG6-binary. Both were transferred to maize by Agrobacterium-mediated transformation. Example 1.4 Construction of ZmABP3-AmCyan The CrylAbGu coding sequence was excised from the ZmABP3-CrylAbG6 pool as a fragment replaced with the Ncol / SacI coding sequence. I know the reporter gene AmCyan that was excised from plasmid 13718 as a fragment of NcoI / SacI. This produced the set ZmABP3-AmCyan, which is depicted in SEQ ID NO: 40. The expression cassette of ZmABP3-AmCyan was transferred into a binary vector, pNOV6900, as an Ascl fragment. This construct, ZmABP3-AmCyan-binary, is depicted in SEQ ID NO: 41. It was transferred to maize by Agrobacterium-mediated transformation. Example 1.5 Expression of ZmABP3-AmCyan in Transgenic Maize Several transgenic maize events containing the ZmABP3-AmCyan expression cassette were produced. Those containing a single copy of the transgene and 128 no unforeseen vector sequence. All transgenic events accumulated AmCyan transcript in leaf tissue (data not shown). Several tissues from a representative event were examined for accumulation of AmCyan transcript. Total RNA was prepared using the Plant RNAeasy total RNA isolation system (Qiagen). Total pollen RNA was prepared using the method described by Shirzadegan et al (1991). The quality of the preparation was assessed by UV spectrometry, 10 pg total RNA per sample was resolved on 1% formaldehyde gel and transferred to Nytran SuPerCharge membrane following the recommended protocol (Schleicher & Schuell). The blot was hybridized to a randomly primed 32 P-labeled AmCyan DNA probe using stringent conditions. The results clearly indicate that ZmABP3 promotes transcription in ear, leaf, silk, ear and root tissue, but does not promote transcription in pollen. Example 1.6 Expression of ZmABP3-CrylAbG6 in Transgenic Maize Several transgenic maize events containing the ZmABP3-CrylAbG6 expression cassette were produced. Those containing a single copy of the transgene and no unforeseen vector sequences were analysed. TO events were evaluated for insecticidal activity against the ear caterpillar twice in the course of development. 129 The first samples were taken in V2-V4 and the second were taken in V7-V9. Leaf discs were cut from the tips of the lower leaves and placed on water-moistened Whatman paper in 47 X 10 mm petri dishes. 22 larvae of the L1 earworm or European corn borer were added to each disk and incubated for 48 hours at 28°C. Leaf discs were analyzed for damage done by insects. Samples showing no significant leaf damage and absolute mortality were scored positively and those with visible damage negatively. The data obtained indicate that several transgenic events with activity against both insects were identified. CrylAbG6 protein accumulation in TO plants was also measured using enzyme-linked immunosorbent assay (ELISA) with a fully truncated CrylAb standard. The first test was carried out on seedling tissue, taking samples between 1 and 2 weeks after transfer to the soil. The second test was carried out on leaf tissue of maturing plants and samples were taken just before X the transition to reproductive development. The data in Table B show the change of CrylAbG6 protein accumulated in the plants with insecticidal activity. The data indicates that plants require nearly 50 ng (or more) of CrylAbG6 protein / mg extractable protein to have insecticidal activity. 130 Table B shows the insect control characteristics of greenhouse-grown plants. Activity cassette description CrylAbGS from corn cob caterpillar ECB activity Event Number (ng / mg extractable protein) 1 Adult Seedling 79 V2-V4 + V7-V9 + V7-V9 + ABP3-CrylAbg6 63 10 2 ABP3-CrylAbg6 54 56 + + + 3 ABP3-CrylAbg6 85 108 + + + 4 ABP3-CrylAbg6 67 94 + + + 5 ABP3 -CrylAbg6 45 83 + + / - + / - 6 ABP3-CrylAbg6 68 120 + + + 7 ABP3-CrylAbg6 133 159 + + + 8 ABP3-CrylAbg6 96 . 46 + + + 15 9 ABP3-CrylAbg6 138 101 + + + 10 ABP3-CrylAbg6 131 ' 100 + + + 11 ABP3-CrylAbg6 94 65 + + + 12 ABP3-CrylAbg6 111 59 + + + 13 ABP3-Cryl39 1 + + + 14 ABP3-CrylAbg6 121 81 20 15 ABP3-CrylAbg6 66 55 + + + 16 ABP3-CrylAbg6 130 95 + + + 131 Leaf tissue of TO plants was assayed for CrylAbG6 protein by ELISA using truncated CrylAb protein as standard, earworm activity and European corn borer activity. At the top of each column is the stage of development of the plant when the samples were taken. Samples were taken from the oldest (lowest) leaf. For the insect tests (+) indicates that there is no visible leaf damage and the complete and absolute mortality of the insects. (-) represents visible leaf damage. Example 1.7 Efficacy of ZmABP3-CrylAbGó Events Against European Corn Borer in the Field 15 Efficacy Studies Against Corn Borer European were conducted in Stanton, MN (SMN) and Bloomington, IL (BIL) during the 2006 growing season. Near-isogenic hybrids comprising the ABP3-CrylAbG6 events listed in Table C, Btll, and a non-transgenic control hybrid. The experimental design was randomized block with three replicates at each location. One plot consisted of a 5.31 m long row containing 25 plants, with a 0.76 m spacing between rows. Table C shows the yield of ZmABP3- maize 132 CrylAbG6 in field studies. Test Place K3371 BIL ECB «3331 Sme BCB 5 Test type BCEUl fiCSXN KBSN ECBUl ECSKN BCSSf Sheet CE8SN Maz. Stem Sheet CSBSN Mu. Stem Event AllSBntacián Ped. Alia. Allm. Allm. grid. Allm. Allm. Descr. cassette Number Rating {cml <cxu>(in) Rating (om> (cm) (om) 1 ABP3-CrylAbg6 1.0 0.00 1.42 0.00 1.1 0.00 0.00 0.30 2 ABP3-CrylAbg6 l.o 0.00 1.42 0.08 1.0 0, 00 0.15 0.10 10 3 ABP3-CrylAbg6 l.o 0.00 1.25 0.08 l.o 0.00 0.00 0.80 4 ABP3-Crylflbg6 1.0 0.00 1.57 0.00 1.0 0.10 0, 51 1.10 5 ABP3-CTylAbg6 1.0 0.00 1.25 0.04 l.o 0.00 0.07 0.20 β ABP3-CrylAbg6 l.o 0.00 1.08 0.00 7 ABP3-CrylAbg6 l.o 0.00 1.31 0.oo 1.1 0.10 0.45 0.80 .8 ABP3-CrylAbg6 1.0 0.04 2.00 0.08 1.1 0.00 0.00 0.30 9 ABP3-CrylAbg6 l.o 0.00 0.92 0, 00 1.3 0.00 0.00 0.10 10 ABP3-CrylftbgC 1.0 0.00 1.42 0.04 1.2 0.00 0.00 0.40 15 11 ADP3-CrylAbg6 l.o 0.13 1, 17 0.00 1.0 0.00 0.00 0.10 12 ABP3-CrylAbg6 1.0 0.00 1.62 0.08 1.1 0.00 0.17 0.30 13 ABP3-CrylAbg6 l.o 0.00 1.29 0 .00 1.2 0.00 0.00 0.20 14 ABP3-CrylAbg€ 1.0 0.00 1.10 0.13 1.0 0.00 0.07 0.10 15 ABP3-CrylAbg6 1-¾ 0.08 1.33 0.04 1 .1 0.00 0.24 0.20 16 ABe3-cryiAbg6 1.0 0.00 1.33 0.21 1.0 0.00 0.00 0.10 Btll 1.0 0.00 2.75 0.00 1.3 0 .00 0.00 0.00 Vi*, negative 7.0 0.21 3.00 4.67 4.3 0.40 5.80 13.50 20 1 Rep coi data 3 3 3 3 3 3 3 3 Loe ccn data 1 1 1 1 1 1 1 1 DÍBeño ut. RCB RCB RCB RCB RCB RCB RCB • RCB LSD (5%) SE genarak 0.149 0.923 0.257 0.399 0.200 1.988 0.650 LSD (5%) Excl, Negative 0.158 0.936 0.255 0.397 0.181 0.391 1.5 | 242.21 38.47 72.14 20.10 292.75 138.76 120.87 t probability 0.90 0.09 0.00 0.00 4.10 0.00 0.00 133 Two studies were conducted in Bloomington, IL (BIL) and Stanton, MN (SMN) in 2006. Various ZmABP3-CrylAG6 events were compared with positive and negative controls represented by and Btll and Negative Check, respectively. Newly hatched European corn borer larvae were produced in a laboratory colony in accordance with the principles established in Guthrie (1989) at an entomological laboratory located in Slater, IA. Eggs were incubated at approximately 28°C and approximately 80% relative humidity and hatchlings were collected from incubation vessels approximately 6 hours after each hatch. The larvae were healthy and vigorous when placed on the plants, as evidenced by their movement. Two types of European corn borer (ECB) application were carried out: ECB1 was applied at approximately the V6-V8 leaf stage and ECB2, applied in pollen spray. Applications are made with the BioServe Davis Inoculator using 1 mL of corn cob grits per application. For ECB1 (first generation ECB infestation) a total of approximately 150 larvae were placed on the central stem of each plant, in corn cob clumps. Two to four applications were made, with one to six days between applications. The first plant in the groove 134 were not treated and up to 10 consecutive plants were infested. For ECB2 (ECB second generation infestation) a total of approximately 200 larvae per plant were applied, which were placed at the junction of the ear petiole and the junctions of the petiole directly above or below the ear, in clumps of corn cob. . Four applications were made, with one to six days between applications. Up to 10 consecutive plants were infested at the opposite end of the ECB1-treated row. The last plant in the row was left untreated. The following observations were recorded. For ECB1, up to six consecutive infested plants in the row were evaluated for ECB leaf damage (ECBLR in Table C) at least 14 days after the first infestation. The Guthrie scale of 1-9 was used (Guthrie et al. (1960) and a rating, the average of the evaluated plants, was recorded in each plot. For ECB2, about 45 days after plant infestation up to 8 consecutive plants Infested at the opposite end of the row to the ECB1 assessments were dissected to assess ear stalk, ear pip, and stalk feeding, measuring feeding tunnel lengths (cm). ECB2 data were subjected to analysis of variance suitable for a randomized complete block design. The replicates were considered random while another 25 effects were considered fixed. The middle separation was prepared 135 using the least significant difference (LSD) procedure, but only if the F test for inputs was significant at the usual 5% level of significance. As there was no inter-event variability in the ECB1 data, an analysis of variance 5 was not performed for this trait. The data and analysis are summarized in Table D. Overall, the data indicate that ZmABP3-CrylABG6 offers protection against ECB similar to that observed in the Btll material. Table D shows the amount of CrylAbG6 protein in transgenic maize tissue. The youngest developing leaf was evaluated to determine CrylAbG6 by ELISA in 5 stages of development (V5-V6, V8, VIO, Rl, R3-R4) for each plant. CrylAbG6 was also measured in pollen. Events 5, 12, 15 and 16 express the ABP3-CrylAbG6 construct and events A-D express the enhanced ABP3-CrylAb construct. Data shown are mean ± SD (n=8-10). development stage V5-V6 V8 VIO Rl R3-R4 Pollen Event 5 39 (3.8) 38 (2.7) 61 (8.2) 75(5.3) 60 (3.5) 1.5(0.14) EventO12 61(5.2) 32(1.9) 50(6.1) 44(5.1) 49 (4.4) 1.4(0.39) Event 15 45(4.5) 45(4 .8) 46(4.8) 38(7.4) 55(5.4) 1.0(0.14) Eventie 58(5.4) 30(2.9) 47 (5.3) 53( 7.2) 44(4.6) 1.2(0.17) Event A 260(24) 190 (22) 250(18) 200(21) 150(14) 1.3(0.19) Event B 260 (22) 227 (29) 240(30) 200(23) 150(76) 1.6(0.30) Event C 310(31) 210(26) 270(26) 150(15) 160(16) 1.9(0.31) Event D 310 (30) 180 (23) 240(15) 170(26) 150(18) 1.4(0.19) 136 Example 1.8 Use of the ZmABP3 Expression Cassette to Improve Drought Tolerance in Maize A deregulated form of an Arabidopsis H+-pyrophosphatase (AtAVPID) has been shown to enhance drought tolerance when overexpressed in various plants {Gaxiola et al., 2001; Park et al., 2005). The improved yield is made possible by high expression in the plant. To demonstrate the utility of AtAVPID in improving drought tolerance in maize, an optimized coding sequence for maize was synthesized. The sequence of the synthetic AtAVPID gene is shown in SEQ ID NO: 16. It was ligated to the ZmABP3 expression cassette as a Ncol / SacI fragment. The vector map shown in SEQ ID: 42 illustrates the ZmABP3-AtAVPID expression cassette. The complete ZmABP3-AVP1D expression cassette was excised from the pool vector as a SanDi / RsrII fragment and ligated to the RsrII site of the Agrobacterium binary vector, 152 89. A map of the construct is depicted in SEQ ID NO: 43. Example 1.9 Measurement of CrylAbG6 in maize tissue Hybrid IT seeds were produced (in the antecedent ID5829 / AX5707) for various ZmABP3-CrylABG6 events in a Syngenta field located in Bloomington, IL. Several seeds were germinated in 5 cm pots. Seedlings were evaluated for the transgenic heterozygote and only 25 hemizygotes were retained. A minimum of 8 were transplanted 137 plants per event in 11-liter pots and were grown in a greenhouse at a controlled temperature. Leaf tissue samples were taken from each plant and assayed for CrylAbG6 protein at 5 developmental stages V5-V6, V8, VIO, R1 and R3-R4 (Ritchie et al., 1997). Pollen was also collected and assayed for the CrylAbG6 protein. At each stage, samples of leaf tissue (minus the neck, stem, and sheath) were taken from the youngest expanding leaf. Duplicate samples were sprayed in 96-well blocks. The powder was suspended in 500 pL-1 mL of extraction buffer (0.1 M sodium borate, 0.5% Tween 20, 0.2% polyvinylpyrrolidone, 0.05% sodium azide, and cocktail tablets protease inhibitor IX (Roche)). The mixture was clarified by centrifugation and soluble protein was quantified using the BCA assay. Fresh pollen was collected in 1.5 mL Eppendorf tubes. 3 mm glass beads were added to each tube and samples were frozen at -80°C. Samples were sprayed on a horizontal oscillator at 600rpm. The protein was extracted by adding 500 pL-1 mL of extraction buffer and incubating at 4°C for 30 minutes. The samples were clarified by centrifugation at 4°C and the soluble protein in each sample was quantified by BCA assay. The samples were normalized for the content of 138 protein and CrylAbG6 was quantified by ELISA using CrylAb fully truncated as standard. Each data point is the average of duplicate measurements, taken at a different dilution of total protein. Data for each event is reported as mean + SD for all relatives. The results in Table D show that the ZmABP3CrylAbG6 cassette produces stable CrylAbG6 protein in leaf tissue throughout development. Some reduction in CryAbGS protein is evident as the vegetative tissue begins to age (R3-R4). Also evident is the 3-5 fold increase in CrylAbGfi accumulation in events that also have the CaMV-FMV dual-enhancer complex. Finally, the data shows that there is virtually no detectable CrylAbG6 protein in pollen. In all events CryAbG6, on average, accumulates no less than 1.5 ng / mg of total soluble protein. Furthermore, the dual-enhancer complex does not influence the accumulation of CrylAbGS in pollen; is identical between all events. This is consistent with our data indicating that ZmABP3 is not transcribed in pollen (Example 5). We concluded that pollen-detectable CrylAbG6 was possibly produced in microspore mother cells or their progenitors and delivered to the pollen through cell division. EXAMPLE 2: Expression not present in spike Example 2.1 Identification of ZmABT 2.1.1 Expression profiling experiment: Probes were searched for in a series of on-chip experimental maize 139 Zm80K Affymetrix, which had strong signal in all samples and had low or no signal in spike samples. Twenty-three probes representing polynucleotides meeting the expression criteria were identified. To fully represent the differential expression signal between spike samples and other tissue samples, the mean signal ratio for the other samples and spike was calculated for each test. This indicates the differential expression between the spike and other samples. Any signal below 50 is within experimental noise, which means that the gene may not be transcribed or transcribed at a very low level. To understand the expression level of each gene represented by candidate probes, a second expression profiling study was performed. In this experiment, tissues from two maize genotypes were hybridized on the Affymetrix Zm80K chip. In general, signals greater than 1,000 indicate high expression and signals greater than 10,000 indicate very high expression. 2.1.2 Identification of candidate probes: The two main candidate probes were identified. The ZmO33444_S_AT probe demonstrates virtually no signal on the spike and elevated signal on other 140 tissues. This indicates that the gene represented by ZmO33444_S_AT is not expressed in the spike, but has a high expression in the rest of the plant. It also shows the highest expression differential, 60 highest in tissue other than spike. the probe Zm040564_X_AT has a very low signal in young spikes, gradually increasing to a strong or very strong signal. The signal intensity between the spike and non-spike tissue samples differs by less than 10-fold. However, the signal intensity in samples other than spike is almost 10 times higher than ZmO33444_S_AT. The sequence data indicates that none of the probes correspond to a characterized gene. Both pathways identify good candidate genes for developing promoters that have high expression in non-spike tissue and no or substantial expression in spikes. Given the high signal differential between spike and non-spike tissue samples, a probe-based expression cassette was developed. ZmO33444SAT. Table E shows a summary of the main candidate probes that represent polynucleotides with a high level of expression in all tissues of maize 25 but have no expression signal in the ear. 141 P value Q value Induction V9 V12 V15 Mean BH in spike spike spike samples other than spike Zm033444_s_at 0.00 0.00 60 16.2 10.2 132 Zm002990_S_at 0.00 0.00 45 32.8 68.7 47.8 Zm006285_at 0, 00 0, 00 20 37.9 44.1 35.8 Zm000019_at 0.00 0.00 16 117 200 242 ZmO 0648l_s_at 0.00 0.00 14 26.9 32.1 31.5 Zm002987_at 0.00 0.00 14 83.7 80.8 119 Zm004433_at 0.00 0.00 12 53.8 35.3 127 Zm010323_s_at 0.00 0.00 11 45.4 63 71.5 Zm016864_s_at 0.01 0.01 11 89.5 55.6 1280 Zm018791_at 0.01 0.01 11 41.4 34 .7 252 Zm028405_s_at 0.00 0.00 10 69 65.1 89 Zm021403_at 0.00 0.00 10 42.2 41.4 71 Zm054116_s_at 0.00 0.00 10 93.3 62.4 2190_x0029 90.090 0.00 10 13.6 29.5 29.2 Zm005761_at 0.00 0.00 9.6 33.2 40 46.7 Zm035082_S_at 0.00 0.00 8.5 83 84 143 Zm066342_at 0.00 0.00 8.2 52.9 59.2 199 Zm032921_s_at 0.00 0.00 8.1 57.5 29.8 90.5 Zm040564_x_at 0.01 0.01 7.5 277 143 3710 Zm051284_at 0.01 0.01 6 0.01 0.01 5.3 325 199 2330 Zm011554_x_at 0.04 0.04 4.9 63, 5 62.6 664 Example 2.2 Development of an expression cassette DNA evidence was collected to identify cDNAs 142 corresponding to Zm033444_S_AT. Public and private databases were searched by BLASTN with ZmO33444_S_AT sequence. The cDNA results in precise sequence matching to similar contiguous sequences. ZmABTl corresponds to Corn.1482.c47 and Corn.1908.c31, and ZmABT2 corresponds to Corn.1482.c32, Corn.1482.c28, Corn.1482.c53, Corn.1908.c17, Corn.1908.c20, Corn.1908.c37 and AI947567. the sequences Zm033444 SAT, ZmABT1 and ZmABT2 were used to search maize genomic DNA sequence databases to identify regulatory sequences that have high expression in non-head tissue and little or no expression in heads. These searches identified three entries, AZM4_12, ZmGSStucll12-04.474 0.1, and MAGI_88845, which assemble into a single contiguous sequence. The ZmABT gDNA sequence is depicted in SEQ ID NO: 46. It encodes ZmABT1 and ZmABT2 (SEQ ID NO: 33 and 34, respectively). They are alternatively spliced ​​variants of the same transcript. ZmABT1 is encoded in 5 exons and ZmABT2 is encoded in 6 exons. The extra exon is between exon 2 and exon of ZmABTl. The largest reading frame in ZmABT1 and ZmABT2 was used to define their translation start and stop codons. Both cDNAs used the same translation start and stop codon. Is 143 information made possible the design of an expression cassette based on ZmABT. Example 3: Construction of a ZmABT-GUS expression cassette An inclusive gene structure-based design strategy was used to construct the ZmABT expression cassette. To incorporate the known alternative of splicing this gene into the expression cassette, the design strategy was based on the structure of ZmABT1. The cassette contains 2.615 10 kb of 5' sequence consisting of 2.02 0 kb of 5' nontranscribed sequence, 12 kp of 5' untranslated region, and 0.58 kb representing exon 1, intron 1 and 16 bp of exon 2. The natural translation start codon was silenced to move it to the second exon. The expression cassette also contains 1039 kb of 3' sequence beginning just after the translation stop codon. This includes approximately 0.603 of 31 untranslated region and 0.436 kb of non-transcribed sequence and functions as the transcription terminator and polyadenylation signal. The ZmABT promoter was amplified from the maize gDNA standard in 50 pL of a Proofstart DNA polymerase reaction (Qiagen) containing 10 pg gDNA, 5 pL of 10X Proofstart buffer, 1.0 pL of 10 mM dNTP mix, 1.0 pL of ABT 25 P1 forw (5·- CGACCAGCGCGACATGCATGGCA-3 ' ; SEQ ID NO: 19) 20 144 μΜ, 1.0 pL of ABT P2 rev (5'-ACCCCAGGGCGTACGACAAGGCC-31; SEQ ID NO: 20) 20 μΜ, and 10.0 pL of 5X Q solution. The thermocycling program was 95'C for 5 minutes followed by 40 cycles of 94°C for 30 seconds, 67°C for 30 seconds, and 72°C for 2.5 minutes. The final extension stage was 72'C for 10 minutes. The 2.6 kb reaction product was gel purified on 1% TAE agarose and DNA' extracted using the Qiaprep DNA extraction method. The DNA was cloned into the vector pCR-BluntlI-TOPO. The ZmABT promoter was modified in a series of mutagenesis reactions to silence the endogenous translation start codon, silence a SanDI restriction site, and correct point mutations created during amplification. This was achieved using the Stratagene QuikChange Multi-site mutagenesis package. The 25 pL reaction contained 1 pL pCR4-TOPO-ZmABT-promoter, 2.5 pL QuikChange 10X buffer, 1 pL QuikChange dNTP mix, 0.75 pL Quik Solution, 1 pL QuikChange DNA polymerase, and 1 pL of 20 pM of at least one of the following oligonucleotides: pABT mutl (5'-GATGGCCGGATTGGGCTCCCGGGGTGGAG-31) (SEQ ID NO: 21) pABT mut2 (5'-CTGGGAGGCGCGCAAGGGGCAGTTCCTCG-3') (SEQ ID NO: 22) pABT mut3 (51-CCCACCGCCGGAGCACCGAAAGGCCCCGCG-3') (SEQ ID 145 NO: 23) (5'-GTCACCCGGGAGCACTTCCCGGCGCCG-3') (SEQ ID pABT mut4 NO: 24) pABT mut5 (5' -CATTGGGCCGAGCACGGCTTCTTCCGC-31) (SEQ ID NO: 25) pABT mut6 (5- -GGGGTACGGTGTTCTTGAGTCGTGAAGCGAC-3') (SEQ ID NO: 26) The thermocycling program was 95°C for 1 minute followed by 35 cycles of 95"C for one minute, 50°C for 1 minute and 65°C for 12 minutes. The product was processed as described by the manufacturer (Stratagene) and fully sequenced. The ZmABT promoter sequence is depicted in SEQ ID NO: The corrected promoter ZmABT was PCR amplified from the vector TOPO in 50 pL polymerase reaction Proofstart DNA (Qiagen) as above using primers pABT ampl (5* depicted in SEQ ID NO: 27 and pABT amp2 (5'-ACCCCAGGGCGTACGACAAGGCCCCACCATGGGCGC-3'), depicted in SEQ ID NO: 28 The PCR product was gel-purified on 1% TAE agarose and DNA extracted using the Qiaprep DNA extraction method.DNA was cloned into the pCRBluntII-ΤΟΡΟ vector, transformed and sequenced.The ZmABT promoter was excised as a Xbal / Ncol fragment and ligated into pNOV6901. 146 The ZmABT-terminus was amplified from the maize gDNA standard in 50 pL of Extender DNA Polymerase (ABgene) reaction containing 10 pg gDNA, 5 pL of buffer. 10X Extender #1, 2.0 pL of 10 mM dNTP mix, 2.0 pL of ABT P4 (5'-TATATAGAGCTCGAATCGAAGAAGCCACACTGTAAATCTGCCGGG-3'; SEQ ID NO: 29) 10 mM, 2.0 pL of ABT P5 (51AGCAAGGCATATGCAGCAGCTGCTGGTCGGACCGGGCCCTATATA-3'; SEQ ID NO: 30) 20 mM, 10 pL of 5X 0 Q solution, 5X .5 pL polymerase Extender DNA and 0.5 pL of Amplitaq DNA polymerase. The reactions were covered with mineral oil and the thermocycling program was 95°C for 2 minutes followed by 40 cycles of 98°C for 2 seconds, 63°C for 1 minute, and 68°C for 4 minutes. The final extension step was 68°C for 7 minutes. The 1 kb reaction product was gel purified on 1% TAE agarose and DNA extracted using the Qiaprep DNA extraction method. The DNA was ethanol precipitated, recovered in 4 pL of ddH2O, and cloned into the pCR4-TOPO-Blunt vector. The ZmABT-terminus was modified to remove the internal Ncol and Xhol restriction sites using the Stratagene QuikChange Multi-site mutagenesis kit, as indicated above. The 25 pL reaction contained 1 pL pCR4-TOPO-ZmABT-promoter, 2.5 pL QuikChange 10X buffer, 1 pL dNTP QuikChange mix, 0.75 pL solution Quik, 1 pL of QuikChange DNA polymerase, and 1 pL of 20 pM of 147 at least one of the following oligonucleotides: ABTt ml (5>-GTCATGCATGGGCATGTGAAGGAGGAGCC-3') (SEQ ID NO: 31) ABTt m2 (5'-GTTGCATGCATGCTGCATGGCGTCGAGAT-3') (SEQ ID NOT: 32) The thermocycling program was 95°C for 1 minute followed by 35 cycles of 95°C for 1 minute, 50°C for 1 minute, and 65°C for 13 minutes. The product was processed as described by the manufacturer (Stratagene) and completely sequenced. The ZmABT terminator sequence is depicted in SEQ ID NO: 36. The ZmABT-terminus was excised as a Sacl / Apal fragment and ligated into vector pNOV6901-prABT (above). This produced plasmid 15772 (ZmABT Pool) and a plasmid map is shown in SEQ ID NO: 44. The entire ZmABT expression cassette was translated as a SanDi / RsrII fragment into the RsrII site of the Agrobacterium 15289 binary vector. Plasmid map of this construct, 15773, is shown in SEQ ID NO: 45. Example 4: Extension of DNA probe sequences to designed expression cassettes The DNA sequence representing probes on the corn chip can be easily extended to expression cassettes designed according to the steps set forth above. The DNA sequence for probes to be 14Θ identified that they represent genes that have high expression in all tissue samples and are not expressed in pollen (Table A) and those that have high expression in all tissue samples and have reduced expression in pollen samples. spike (Table E) is reported as SEQ ID NOs: 47-79. An additional probe candidate was selected from the expression profiling analysis for each expression category to demonstrate progress from that αDNA sequence to a finished binary vector where the designed expression cassette is linked to the GUS reporter gene. The method used is identical to that used for ZmABP3 and ZmABT. In summary, the stages of the process that are applied are the following: 1. Flank each expression cassette with sites SanDI / RsrII and report as cloned into the RsrII site of 15289 (SEQ ID NO: 80). 2. The promoter consists of 1000-1500 bp of sequence upstream of the transcription start site and extends 10 bases into the second exon or the natural translation start codon if not the first exon. It ends with the Maize optimized Kozak 'gtaaaccatgg' sequence. The generated translation start codon is now incorporated into the 'ccatgg' restriction endonuclease Ncol site. All translation start codons in the theoretical transcript that are upstream of the Ncol site are mutated. 149 It is ensured that at least one stop codon is in each reading frame upstream of the generated Ncol site. The promoter is designed to be flanked by Xhol / SanDI at the 5' end and by Ncol at the 3' end. 3. The gene of interest is represented by the GUS reporter gene as a Ncol / Sacl fragment. 4. The terminus extends from just after the translation stop codon for 1 kb downstream. The terminus is designed to be flanked by SacI at the 5' end and by RsrII / Xmal at the 3' end. 5. The complete expression cassette is designed for transfer as a SanDI / RsrII fragment, which can be ligated to an RsrII site located on an Agrobacterium binary vector such as 15289 (SEQ ID NO: 80). 6. All internal SanDI, RsrII, Ncol, SacI, Xhol and Xmal sites are mutated by a single base substitution to silence them. Through the application of these basic steps, it is possible to design a plant expression cassette (SEQ ID NO: 81) that corresponds to probe1 Zm058 94 8_s_at (SEQ ID NO: 55) and a plant expression cassette (SEQ ID NO: 82) that corresponds to the probe Zm002990_s_at (SEQ ID NO: 62). The latter is an expression cassette that should be transcribed in all maize tissues but not in pollen. The latter is a speech cassette that should be transcribed in all 150 maize tissues and have a reduced transcription in the ears. This design strategy is applied to all probes identified in Tables A and E. Further details on how to prepare these expression cassettes are described in US2005235311, which is incorporated herein by reference in its entirety. References Ammirato et al., eds., (1984) Handbook of Plant Cell Culture--Crop Species, Macmillan Publ. Co., New York, N.Y. An et al., (1985) EMBO J. 4, 277 287 Auch & Reth et al. Batzer, et al., Nucleic Acid Res. 19:5081 (1991) Byrne, M. C., McDonnell, R. E.z Wright, M. S. and Carnes, M.G., 1987. Strain and Cultivar Specificity in the Agrobacterium-soybean Interaction. Plant Cell Tissue and Organ Culture 8:3-15

Claims

1. An isolated polynucleotide characterized in that it comprises SEQ ID NO: 35 operatively linked to a heterologous nucleotide sequence of interest in maize, wherein the heterologous nucleotide sequence is transcribed in maize leaf tissue and not in the ear. Sole Claim