TRANSGENIC SOYBEAN EVENT IND-ØØ41Ø-5

Abstract

This application relates to plant production, plant breeding, and agriculture. More specifically, it relates to the transgenic soybean event IND-ØØ41Ø-5, which expresses the HaHB4 gene that confers drought tolerance without affecting other agricultural properties. The application also describes related nucleotide sequences, plants, plant parts, seeds, cells, agricultural products, and methods for detecting and producing the event.

Description

TRANSGENIC SOYBEAN EVENT IND-00410-5 FIELD OF INVENTION The invention relates to the fields of plant production, plant breeding, and agriculture. More specifically, it relates to the transgenic soybean event IND-00410-5, nucleotide sequences, plants, plant parts, seeds, cells, agricultural products, and methods of detection and production related to the transgenic soybean event IND-00410-5. BACKGROUND OF THE INVENTION Improving crop yields and characteristics has become essential to meeting food demand. Thanks to advances in biotechnology and its integration with agriculture, crops have been developed with the ability to adapt to diverse environmental and / or ecological conditions. During cultivation, plants are exposed to a variety of abiotic stresses: drought, salinity and low temperatures, high temperatures, excessive radiation, low nutrient availability, soil compaction that impedes root growth, etc. (Duque et al., 2013; Sayed, 2003). All of these can affect plant growth and development, as well as productivity, at some point. It is reasonable to assume that some of these environmental factors may appear during a crop's life cycle in the field. In such cases, complex response mechanisms are triggered, which will be reflected in the measurements taken, as these are the result of an integration of the effects of these stresses. One of the techniques commonly used to mitigate the damage caused by 234123 IF-2019-1026218 85 -APN-ANP#INPI Page 1 of 67. The impact that the environment can have on the crop is based on transgenic events, that is, the insertion of genes of interest into the genome of the target crop. However, the production and selection of a commercially suitable transgenic event requires extensive research, analysis, and characterization of a large number of individual transformation events. In this way, an event can be selected that has the desired trait and therefore develops the phenotypic and agricultural characteristics necessary to be suitable for commercial purposes, without negatively affecting the other characteristics of the crop. This process requires the generation of transgenic events that will be characterized molecularly and phenotypically to identify and select the event that expresses the heterologous gene of interest according to obtaining the desired phenotype. The selection of the event involves both laboratory development stages and field and / or greenhouse trials, where conditions are controlled. It is necessary to analyze the response of the events over the years, in multiple locations, and under a variety of environmental conditions to select the event that best suits the required phenotypic, genetic, and commercial characteristics. The present invention presents that type of commercially suitable event that gives rise to new advantageous traits in soybeans. There is a wide variety of genes that can be used in the development of commercially valuable traits. Among them, there are soybean plants on the market that express herbicide tolerance genes or genes that encode insecticidal proteins, etc. A gene whose expression in plants results from IF-2019-1026218 85 -APN-ANP#INPI Page 2 of 67 of interest is the one that codes for the transcription factor HAHB4. HAHB4 (Helianthus annuus homeobox-4) is a sunflower transcription factor belonging to the HD-Zip family. The expression of the HaH84 gene is regulated at the transcriptional level by external environmental factors such as water availability and soil salinity, as well as by related phytohormones, abscisic acid and ethylene. Patent AR81216B2 discloses the HaHB4 gene, inducible by water and abscisic acid deficiency, which encodes a sunflower HD-Zip transcription factor. This patent discloses the isolation and characterization of the gene and its introduction into the model plant Arabidopsis thaüana. However, it does not disclose commercially viable transgenic plants carrying the event of the present invention or their advantageous properties in relation to abiotic stresses that occur together under agricultural conditions. Nor does patent AR81216B2 mention the particular selection of an event that expresses the HaHB4 gene in such a way as to preserve the main trait of interest, drought tolerance, without affecting other agricultural aptitudes. Furthermore, application AR090110A1 discloses the modified HaHB4 gene, specifically i-i01-184.2, inducible by water and abscisic acid deficiency, which encodes a modified HD-Zip-type sunflower transcription factor, specifically mod1HaHB4. This publication discloses the generation and characterization of modified HaHB4 expression constructs and their introduction into the model plant Arabidopsis thaüana. Additionally, this publication provides a general overview of the generation and selection of transgenic soybean, wheat, and maize events containing the HaHB4.2 gene. IF-2019-1026218 85 -APN-ANP#INPI Page 3 of 67 DETAILED DESCRIPTION OF THE INVENTION The present invention provides soybean plants resistant to abiotic stresses that contain the IND-00410-5 event. These plants exhibit cultivation advantages under unfavorable environmental conditions, allowing for higher yields. More specifically, the present invention relates to the soybean event designated as IND-00410-5, which has a representative seed registered with the American Type Culture Collection (ATCC) under accession number PTA125535 and the offspring derived therefrom. The present invention also includes soybean plants comprising the IND-00410-5 event represented by SEQ ID NO: 1. The transgenic insert present in the invention and in the registered seed comprises the following genes: a single copy of the bar selection marker gene and a single copy of the HaHB4 gene, which confers tolerance to abiotic stresses. The bar gene, derived from Streptomyces hygmscopicus, encodes the PAT protein (Phosphinothrilcin Acetyl Transferase). The HaHB4 gene is derived from the sunflower plant, Helianthus annuus, and encodes an HD-Zip I type protein that possesses a chemodomain-associated leucine closure domain, which confers tolerance to abiotic stresses, primarily drought. The regulation of the genes of interest can be directed by various promoter sequences that have different levels of expression, sensitivity, and tissue specificity.Those skilled in the art know that any nucleic acid promoter or terminator that directs or regulates the expression of the gene of interest can be used without altering the essence of the invention. In particular, the event developed in the present invention contains a partial duplication of the promoter of the cauliflower mosaic virus (CaMV) 35S, version 2x35SCaMV, and the vsp terminator for the gene that confers resistance to the herbicide glufosinate ammonium. On the other hand, the event comprises the variant. IF-2019-1026218 85 -APN-ANP#INPI Page 4 of 67 of longer length of the HaHB4 gene promoter (FPL) and the nos terminator to regulate the expression of the HaHB4 coding region (Figure 1). Other aspects of the invention include the offspring of soybean plants, seeds, and / or regenerable parts of the plants and seeds and offspring comprising the soybean event IND-00410-5, as well as food products for human or animal consumption derived therefrom. The invention also includes parts of plants comprising the IND-00410-5 event, including, but not limited to, pollen, ovules, flowers, buds, roots, leaves, vegetative cell nuclei, and other plant cells comprising the IND-00410-5 event. The invention further relates to soybean plants comprising the IND-00410-5 event that have tolerance to multiple abiotic stresses: drought, salinity, low and high temperatures, excessive radiation, low nutrient availability, soil compaction, etc., and combinations thereof. This invention relates in part to the cultivation of plants tolerant to abiotic stresses. Furthermore, it includes a novel transformation event in soybean plants comprising a polynucleotide, as described herein, inserted at a specific site within the soybean genome that confers particular genetic and phenotypic characteristics. In some embodiments, this event / polynucleotide may be "stacked" with other traits, including, for example, agronomic traits and herbicide and / or insect tolerance. However, the present invention includes plants that have the single event, as described herein. Additional traits can be stacked in the plant genome or at the same locus as the IND-00410-5 event, for example, by means of plant crossing, retransformation of the transgenic plant containing the IND5 event IF-2019-1026218 85 -APN-ANP#INPI Page 5 of 67 00410-5 or addition of new features through homologous recombination-directed integration. In one embodiment, the present invention encompasses a soybean chromosomal site located on chromosome 9. In some embodiments, the targeted site comprises a heterologous nucleic acid. The soybean chromosomal site is located between the flanking sequences established in SEQ ID NO: 2 and SEQ ID NO: 3 In one embodiment, the present invention encompasses a method for producing transgenic soybean plants, comprising inserting a heterologous nucleic acid into a specific position on chromosome 9. In particular, the method involves stably transforming a cell or cell culture with the DNA sequences SEQ ID NO: 43 and regenerating the cell, giving rise to a whole plant. The transformation of this plant cell can be carried out through various techniques, whether physical, viral, or chemical, including bio-ballistics, electroporation, bacterial transformation, or a combination thereof. All these techniques are well known to anyone versed in the subject. The invention further presents a microorganism comprising a nucleic acid molecule having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4. In particular, in the present invention, Agrobacterium tumefaciens transformed with the DNA molecule of SEQ ID NO: 43 is used, more precisely transformed with the plND2-HB4 plasmid (Figure 1). IF-2019-1026218 85 -APN-ANP#INPI Page 6 of 67 Furthermore, the present invention provides assays for detecting the presence of the event described herein in a soybean sample. The assays may be based on the DNA sequence of the recombinant construct inserted into the soybean genome and on the genomic sequences flanking the insertion site. Kits and conditions useful for these assays are also provided. Therefore, the present invention relates in part to the cloning and analysis of the DNA sequences of all or part of the insert and flanking regions (in transgenic soybean lines). These sequences are unique. Based on these inserts and flanking (and junction) sequences, it is possible to generate event-specific primers. Using PCR, it has been demonstrated that these events can be identified by analyzing the amplicons generated with these event-specific primer sets. Therefore, these and related procedures can be used to uniquely identify soybean lines that possess the event of the present invention. The present invention also relates in part to PCR assays. These include, among others, real-time qPCR and end-time PCR for the detection of the IND-00410-5 event, amplicons, and fragments thereof. The invention also features DNA molecules comprising a sufficient portion of the contiguous nucleotide sequence of SEQ ID NO: 4 to function as a DNA probe that hybridizes under rigorous hybridization conditions to a DNA molecule comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and that does not hybridize under rigorous hybridization conditions to a DNA molecule that does not comprise IF-2019-1026218 85 -APN-ANP#INPI Page 7 of 67 a nucleotide sequence selected from the group consisting of SEQ ID NO: 1. In some cases, the probes used may be labeled with molecules that emit a detectable signal. An example of such molecules are fluorochromes. That is, oligonucleotides that have fluorochromes at both ends and a sequence complementary to part of the DNA fragment to be amplified. These include FAM, TET, HEX, JOE, CAL Fluor®, Quasar®, and Pulsar® dyes, among others. The invention further discloses a pair of DNA molecules consisting of a first DNA molecule and a second DNA molecule different from the first DNA molecule, wherein each of the first and second DNA molecules comprises a sufficient stretch of contiguous nucleotides of SEQ ID NO: 1 to function as DNA probes when used together in an amplification reaction with DNA derived from the IND00410-5 event to produce a diagnostic DNA amplicon of the IND-00410-5 soybean transgenic event in a sample. The invention also describes a method for detecting the presence of DNA obtained from the IND-00410-5 event in a sample. The method comprises comparing the sample with the DNA molecules used as probes and primers, subjecting them to rigorous hybridization conditions, and detecting the hybridization of the DNA probe to the DNA in the amplified sample using specific primers, where such hybridization indicates the presence of DNA derived from the IND-00410-5 soybean transgenic event in the sample. The invention also presents a method for detecting the presence of a DNA molecule obtained from the transgenic soybean event IND-00410-5 in IF-2019-1026218 85 -APN-ANP#INPI Page 8 of 67 a sample by comparing the DNA preparation derived therefrom with a pair of oligonucleotides used as primers to perform an amplification reaction sufficient to produce a DNA ampicilment comprising a sequence selected from the group consisting of SEQ ID NO: 1, and detecting the presence of the DNA ampicilment in the reaction, wherein the presence of the DNA ampicilment in the reaction indicates the presence of a DNA molecule derived from IND00410-5 in the sample. The invention further presents a DNA detection kit comprising at least one DNA molecule with a sufficient quantity of contiguous nucleotides of SEQ ID NO: 1 to function as a specific DNA primer or probe to detect the presence of DNA derived from the soybean transgenic event IND-00410-5, where the detection of the DNA is diagnostic of the presence of the soybean transgenic event IND-00410-5 in a sample. The invention further presents a soybean plant, seed, cell, or part thereof comprising a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1. The invention further presents a soybean plant, seed, cell, or part thereof having tolerance to abiotic stresses. The invention further presents a soybean plant, seed, cell, or part thereof, the genome of which produces an amplicon comprising a DNA molecule selected from the group consisting of SEQ ID NO: 1, analyzed in a DNA amplification method. The invention further presents a soybean plant or seed, wherein the soybean plant or seed is generated from the transgenic soybean event IND-00410-5, or is a hybrid or heterozygote having at least one parent derived from the transgenic soybean event IND-00410-5. IF-2019-1026218 85 -APN-ANP#INPI Page 9 of 67 The invention further presents a non-living plant material comprising a recombinant DNA molecule selected from the group consisting of SEQ ID NO: 1. The invention further presents a consumer product produced as a result of the transgenic soybean event IND-00410-5 and comprising a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1, wherein the detection of a nucleotide sequence in a sample derived from a consumer product is determinative that the consumer product is derived from the transgenic soybean event IND-00410-5. The invention further presents a consumer product selected from the group consisting of whole or processed seeds, oil, semolina, flour, flakes, biodiesel, biogas, or other biomaterials, among others. The invention also presents a method for producing a consumer product by obtaining a soybean plant or part thereof comprising the transgenic soybean event IND-00410-5 and producing a soybean consumer product from the soybean plant or part thereof. The invention presents a method for producing a soybean plant that tolerates abiotic stresses by crossing a plant with the transgenic soybean event IND00410-5 comprising a nucleic acid molecule selected from the group consisting of SEQ ID NO: 1 with a second soybean plant, thereby producing seeds, collecting the seeds produced by the cross, cultivating the seed to produce a plurality of progeny plants, and selecting a progeny plant with tolerance to abiotic stresses. IF-2019-1026218 85 -APN-ANP#INPI Page 10 of 67 BRIEF DESCRIPTION OF THE DRAWINGS Fig 1. PlND2-HB4 plasmid map. a) Binary vector plasmid with T-DNA. The fragments obtained from the Ndel digestion are indicated as blue arrows (Left to Right) along with their sizes. LB: left edge; RB: right edge. The probes are shown as thick yellow arrows (Left to Right). b) Detailed portion of the plND2-HB4 plasmid T-DNA. The digested fragments from Hindlll are shown as black arrows along with their respective minimum sizes towards LB and RB, respectively. The digested fragments from Ndel are shown in blue. The expected size of the internal digestion of Ndel was 2703 bp in length. Fig 2 Transformation constructs and expression levels of HB4 events. A - Genetic description of the regulatory elements in the three different plasmids (a, b and c) used to obtain the transgenic events (plND1:HB4=a), (plND2:HB4=b) and (plND3:HB4-c) B - Relative expression levels of Hahb-4 and bar genes. Relative values ​​referred to the water control treatment. Fig 3. Tolerance to water stress under controlled conditions. A - Representative plants after a period of water deprivation during the V2, R2 and R4 development stages. B - Recovery rate as the number of plants without wilting symptoms after a period of irrigation restoration, out of the total number of plants used in the experiment. C - Water loss measured at 1-hour intervals over a 10-hour period, from detached leaves of each transgenic event and the non-transgenic control. Fig. 4. Sensitivity to ethylene and treatment in darkness. A - Evergreen phenotype in leaves after ethephon treatment and in darkness. The evergreen phenotype in leaves treated with water is also shown, as in the IF-2019-1026218 85 -APN-ANP#INPI Page 11 of 67 negative control. B - Hypocotyl hook as part of the triple response to ethylene with five concentrations of ethephon. C - UV / Vis absorption spectra of the leaves presented in A. Photosynthesis-related carotenoids (peak at 480 nm) and chlorophyll from photosynthetic pigments A and B (peaks at 665 nm and 649 nm respectively) for each genotype. The green lines correspond to samples collected from the water treatment and the red lines correspond to samples collected from the ethylene / darkness treatments. D - Quantification of seedlings with hypocotyl hook formation with a 25 μM ethephon solution. Figure 5. Yield and differences in yield components across the environmental index for four independent transgenic events. Differences (%) in seed yield (a), seed quantity (b), and seed size (c) between transgenic events and the non-transgenic control in low (L < 2500 kg ha-1), medium (M = 2500–3500 kg ha-1), and high (H > 3500 kg ha-1) yield environments. Stars indicate statistically significant differences with p < 0.05 for mean values. Figure 6. Yield and yield component differences across the environmental index for the selected event (b1). Differences (%) in seed yield (a), seed quantity (b), and seed size (c) between the transgenic event b1 and the non-transgenic control in low (L < 2500 kg ha-1), medium (M = 2500–3500 kg ha-1), and high (H > 3500 kg ha-1) yield environments. Stars indicate statistically significant differences with p < 0.05 for mean values. Fig 7 Venn diagram of differentially expressed genes. A Number of genes expressed differently between stress treatments IF-2019-1026218 85 -APN-ANP#INPI Page 12 of 67 water and with good irrigation for the transgenic event b1 and the non-transgenic control genotype Figure 8. Comparison of GO enrichment in DE genes. The results are summarized in terms of biological process, cellular component, and molecular function. The Y-axis indicates the gene ontology categories; the x-axis indicates the number of DE genes. Figure 9. Southern blots of T5 plant DNA (IND-00410-5) digested with Hindllí and Ndel. The blots were hybridized with DIG-labeled probes for (a) HaHB4 and (b) bar detection, respectively. DNA bands in IND00410-5 digests that hybridize with the indicated probes are highlighted in white boxes. Williams 82 + 200 pg plasmid DNA and 100 pg plasmid DNA were used as positive controls. Band sizes on the DIG-labeled Marker V1 ladder are indicated to the left of the blots in kb. Fig. 10. Analysis of the IND-00410-5 event joining sequence. A vertical line in the sequence alignment indicates the joining between the T-DNA and the soybean chromosome. Columns from left to right: vector name, JS (joining sequence) position in the vector, number of reads supporting the JS, read name, and partial sequence. The last row, fourth column in each JS indicates the element at which the JS begins. The insertion site and structure were confirmed by de novo assembly of the raw sequence data using the Velvet assembly program (sequences were aligned considering only the last 30 bases of the T-DNA insert; all Illumina-generated reads were 101 bp long). Fig 11. Schematic representation of the insertion locus in IND-00410-5 and native allele. A) Schematic of the insertion in IND-00410-5 showing the elements present in T-DNA and the primers used for segregation analysis in IF-2019-1026218 85 -APN-ANP#INPI Page 13 of 67 F2 plants. Labeled primers 868 and 752 were used for the assay to detect the presence of the left-edge junction. B) Native allele diagram showing the elements present in the insertion region (without the T-DNA) and the primers used for the PCR segregation assay in F2 plants. Primers 934 and 935 were used in the assay to determine the presence of the native allele. Gm: Glycine max, Chr9: Chromosome 9, UTR: Untranslated region, CDS: Coding sequence. Fig 12. Schematic of the insertion in IND-00410-5 The schematic shows 4 detection systems of different elements of the insert in the iND-00410-5 event, Three of them correspond to TaqMan detection systems (HaHB4, bar and flank towards the RB) while one corresponds to a final time PCR system (flan towards the LB). Fig 13 Yield of the transgenic event and control for the 16 evaluated sites. Red circles indicate the sites where the transgenic event had a higher yield than the control and yellow circles are the sites where the event had a lower yield than the control. BRIEF DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 DNA sequence corresponding to the Insert and adjacent genomic regions. SEQ ID NO: 2 DNA sequence corresponding to the right flanking sequence SEQ ID NO: 3 DNA sequence corresponding to the left flanking sequence SEQ ID NO: 4 DNA sequence corresponding to the insert SEQ ID NO: 5 DNA sequence corresponding to primer 750 IF-2019-1026218 85 -APN-ANP#INPI Page 14 of 67 SEQ ID NO: 6 DNA sequence corresponding to primer 751 SEQ ID NO: 7 DNA sequence corresponding to primer 752 SEQ ID NO: 8 DNA sequence corresponding to primer 753 SEQ D NO: 9 DNA sequence corresponding to primer 754 SEQ ID NO: 10 DNA sequence corresponding to primer 755 SEQ ID NO: 11 DNA sequence corresponding to primer 756 SEQ ID NO: 12 DNA sequence corresponding to primer 757 SEQ ID NO: 13 DNA sequence corresponding to primer 758 SEQ ID NO: 14 DNA sequence corresponding to primer 759 SEQ ID NO: 15 DNA Sequence SEQ ID NO: 16 DNA Sequence SEQ ID NO: 17 DNA Sequence SEQ ID NO: 18 DNA Sequence SEQ ID NO: 19 DNA Sequence SEQ ID NO: 20 DNA Sequence SEQ ID NO: 21 DNA Sequence SEQ ID NO: 22 DNA Sequence SEQ ID NO: 23 DNA Sequence SEQ ID NO: 24 DNA Sequence SEQ ID NO: 25 DNA Sequence SEQ ID NO: 26 DNA Sequence SEQ ID NO: 27 DNA Sequence SEQ ID NO: 28 DNA Sequence SEQ ID NO: 29 DNA Sequence SEQ ID NO: 30 DNA sequence corresponding to primer 760 corresponding to primer 2527 corresponding to primer 203 corresponding to primer 378 corresponding to primer 1970 corresponding to primer 1747 corresponding to primer 1748 corresponding to primer 1745 corresponding to primer 1746 corresponding to primer 822 corresponding to primer 1127 corresponding to primer 817 corresponding to primer 818 corresponding to probe 819 corresponding to primer 868 corresponding to primer 752 IF-2019-1026218 85 -APN-ANP#INPI Page 15 of 67 SEQ ID NO: 31 DNA sequence corresponding to primer 530 SEQ ID NO: 32 DNA sequence corresponding to primer 531 SEQ ID NO: 33 DNA sequence corresponding to probe 532 SEQ ID NO: 34 DNA sequence corresponding to primer 527 SEQ ID NO: 35 DNA sequence corresponding to primer 523 SEQ ID NO: 36 DNA sequence corresponding to probe 529 SEQ ID NO: 37 DNA sequence corresponding to primer 718 SEQ ID NO: 38 DNA sequence corresponding to primer 719 SEQ ID NO: 39 DNA sequence corresponding to probe 720 SEQ ID NO: 40 DNA sequence corresponding to primer 934 SEQ ID NO: 41 DNA sequence corresponding to primer 935 SEQ ID NO: 42 DNA sequence corresponding to probe 936 SEQ ID NO: 43 DNA sequence corresponding to the plND2-HB4 plasmid DETAILED DESCRIPTION The following definitions and methods are presented to better define the invention and to guide persons skilled in the art in the practice of the invention. Unless otherwise indicated, the terms are to be interpreted according to the conventional usage of persons skilled in the relevant art. IF-2019-1026218 85 -APN-ANP#INPI Page 16 of 67 EXAMPLES Example 1: Construction of the plND2-HB4 plasmid The plND2-HB4 plasmid, which would later be used for the transformation of soybean plants, is derived from the pPZP binary plasmid family, in particular, it is based on the pPZP200 series. The transgenic insert and expression cassette of IND-00410-5 comprises the cauliflower mosaic virus (CaMV) 35S X 2 promoter and the vsp terminator for the bar marker gene. It also comprises the sunflower HaHB4 gene promoter (Promoter Large Fragment, FPL) and the nos terminator for the HaHB4 gene. The resulting plasmid, plND2-HB4, is schematically represented in Figure 1. Example 2; Transformation of soybean plants and selection of the IND00410-5 event Soybean cells can be transformed using a variety of methods. In particular, the disarmed Agrobacterium tumefaciens strain EHA 101 (Hood et al., 1986) was used, transformed with the binary plasmid containing HaHB4 and bar within the T-DNA (transfer DNA) region. The transformation was performed using a modification of the method described by Paz et al. (2004). Briefly, soybean seeds (Glycine max cv. Williams 82) were pre-germinated in a basal medium in the dark. Cotyledonary nodes were isolated from mature seed halves and infected with Agrobacterium. For 5 to 7 days, the explants were co-cultured in the dark with the Agrobacterium strain. The means for shoot initiation, elongation, and rooting were supplemented with cefotaxime, timentin, and vancomycin to inhibit over17 IF-2019-1026218 85 -APN-ANP#INPI Page 17 of 67 Agrobacterium growth. Shoots transformed using glufosinate ammonium (which inhibits the growth of shoots that do not express PAT) were selected. Regenerated explants were maintained at 24°C for two to three weeks under white fluorescent light and with a 16:0 photoperiod. During shoot induction, the explants were subcultured several times in selective shoot induction medium (SISM) containing Gamborg B5 1X basal medium (B5 macronutrients 1X, B5 micronutrients 1X, B5 vitamins 1X, Ferrous 28 mg / L, NaEDTA 38 mg / L), Sucrose 30 g / L, MES 0.59 g / L and type A agar 7 g / L, pH 5.7. After autoclaving the medium, filtered and sterilized BAP (2 mg / L), IBA (0.2 mg / L), timentin (50 mg / L), cefotaximin (100 mg / L), and vancomycin (50 mg / L) and the selective agent were added. As soon as the leaves became visible, their stems were removed and transferred to selective shoot elongation medium (SESM).The elongated shoots (two nodes) were transferred to a semi-solid rooting medium (RM: Gamborg MS vitamin-modified basal medium % X (MS major salts 7 X, MS minor salts 7s X, Vitamin B5 7 X, Ferrous 28 mg / L, NaEDTA 38 mg / L), Sucrose 20 g / L, MES 0.59 g / L, and type A agar 7 g / L, pH 5.6). After autoclaving, filtered and sterilized indole-3-butyric acid (IBA, 2 mg / L) and a selective agent were added to this medium. Rooted plants with normal phenotypic characteristics were transferred to pots containing a substrate mix for seedling acclimatization, inducing their growth for further trials. Macronutrients (ΝΗ4)28Ο4 0.134 g / l kno3 2.528 g / l MgSO47H2O 0.246 g / l CaGb.aq 0.15 g / l KH2PO4 0.15 g / l IF-2019-1026218 85 -APN-ANP#INPI Page 18 of 67 Micronutrients Kl 0 75 mg / | H38O3 3.0 mg / L MnSO4.H2O 10 mg / L ZnSO4 7H20 2.0 mg / L Na2Mo04.2H20 0.25 mg / L CuSO4 5H2O 0 025 mg / L CoCI2.6H2O 0.025 mg / L Na22 37 mg / L. FeSO4.7H2O I 27.8 mg / l Table 1. Micronutrient and macronutrient composition of Gamborg B5 basal medium Plant regeneration and event selection I) Sterilization of seeds: The seeds were washed in a dilute aqueous detergent solution for 5 minutes and then rinsed 6 times with sterile distilled water. Next, the seeds were washed with alcohol (70% ethanol) for one to two minutes with occasional agitation. After decanting the ethanol solution, the seeds were placed in a bell jar desiccator with a steam cover for 10–12 hours for disinfection with chlorine gas. Following gas disinfection, the seeds were soaked for 12 hours in sterile distilled water to soften their seed coats. II) Seed germination: The seeds were hulled and placed in germination medium (GM: Murashige & Skoog basal medium with salts and vitamins, 30 g / L sucrose, and 7 g / L Type A agar, pH 5.8) for approximately 72–96 hours in the dark until radial elongation. After the pre-germination period, the root and hypocotyledonous stem were removed. The adaxial epidermis of both cotyledons was partially removed mechanically to increase contact between the inoculum and the explant cells, thereby increasing the infection efficiency of Agrobacterium tumefaciens. IF-2019-1026218 85 -APN-ANP#INPI Page 19 of 67 III) Transformation procedure a) Expiant ants co-cultured directly with Agrobacterium turne faciens by infiltration Pre-germinated seeds were contacted with a vacuum infiltration infection medium (VIIM: Gamborg B5 1 / 10 X basal medium (large salts B5 1 / 1OX, small salts B5 1 / 1 OX, vitamins B5 1 / 1 OX, Ferrous 2.8 mg / L, NaEDTA 3.8 mg / L), Sucrose 30 g / L, MES 3.9 g / L, pH 5.4). After autoclaving, filtered and sterilized GA3 (0.25 mg / L), BAP (2 mg / L), Silwet L-77 (0.03%), and 40 mg / L acetosyringone, containing a bacterial suspension (direct co-culture), were added to this medium. The vacuum was set to 450 mm Hg. The explants were maintained under vacuum conditions for 5–7 minutes. This process was repeated twice. b) Seed dissection and indirect co-culture of the same with transformed Agrobacterium tumefaciens After the infiltration procedure, the seeds were dried with sterile filter paper and placed on a sterilized flat surface (empty plate) for dissection. The cotyledons were broken apart using a sharp, sterile scalpel, and the plumule was removed. cJExplantosco-cultivadosindirecte An additional treatment was included involving dehydration / rehydration of half of the seed explants to promote bacterial infection. Turgor loss was induced in the dissected seed half explants under a laminar flow hood for 30 minutes. The explants were then rehydrated in infection medium (IM: Gamborg B5 1 / 10X basal medium (large salts B5 1 / 10X, minor salts B5 1 / 1OX, vitamins B5 1 / 1OX, Ferrous 2.8 mg / L, NaEDTA 3.8 mg / L), Sucrose 30 g / L, MES 3.9 g / L, pH 5.4). After autoclaving, filtered and sterilized GA3 (0.25 mg / L), BAP (2 mg / L), and 40 mg / L acetosyringone were added to this medium, which contains a suspension of IF-2019-1026218 85 -APN-ANP#INPI Page 20 of 67 Agrobacterium (OD 0.7) at 24°C for 30 minutes. The explants were dried with sterile paper and immediately transferred to co-culture medium (CCM: Gamborg B5 1 / 10X basal medium (large salts B5 1 / 10X, minor salts B5 1 / 10X, vitamins B5 1 / 1 OX, Ferrous 2.8 mg / L, NaEDTA 3.8 mg / L), Sucrose 30 g / L, MES 3.9 g / L and type A agar 4.25 g / L, pH 5.4. After autoclaving, filtered and sterilized GA3 (0.25 mg / L), BAP (2 mg / L), cisterna (400 mg / L), dithiotriethol (154.2 mg / L) and 40 mg / L acetosyringone were added to this medium for 5-7 days in the dark at 24°C. d)Washing To remove bacteria adhering to the explants, they were gently agitated in sterile water for 10 minutes and then dried with sterile filter paper. Next, the explants were immersed in shoot induction wash medium (SIWM: basal medium· Gamborg B5 1X (large salts B5 1X, minor salts B5 1X, vitamins B5 1X, Ferrous 28 mg / L, NaEDTA 38 mg / L), Sucrose 30 g / L, and MES 0.59 g / L, pH 5.7. After autoclaving the medium, filtered and sterilized BAP (1 mg / L), TDZ (0.1 mg / L), IBA (0.2 mg / L), Timentin (100 mg / L), Gefotaximin (100 mg / L), and Vancomycin (50 mg / L) were added) (25 explants per bottle). Washing was continued for 6-12 hours with continuous stirring (100 rpm) at 24QC, with a photoperiod of 16:8. e) Selection and regeneration of transformed explants The explants were transferred to selective shoot induction medium (SISM) and maintained at 24°G for two weeks under white fluorescent light with a 16:8 photoperiod. They were placed with the adaxial surface facing upwards on the surface of the selective medium. Petri dishes (100 x 25 mm) were used for the selection and regeneration process. Every two weeks, the explants were subcultured in fresh SISH / 1 medium supplemented with phytohormones and antibiotics. When leaves appeared, the stems were removed and transferred to plates containing selective shoot elongation medium (SESM: basal medium). IF-2019-1026218 85 -APN-ANP#INPI Page 21 of 67 modified with Gamborg MS 1 X vitamins (major salts MS 1 After autoclaving this medium, asparagine (50 mg / L), L-pyroglutamic acid (100 mg / L), IAA (0.1 mg / L), GA3 (0.5 mg / L), Zeatin-R (1 mg / L), IBA (0.2 mg / L), Thymentin (50 mg / L), Cefotaximin (100 mg / L), Vancomycin (50 mg / L) were added. f) Rooting of transgenic shoots The elongated shoots (two nodes) were transferred to culture vials (1 plant / vial 250 x 25 mm) containing semi-solid rooting medium (RM). Then, the transgenic plants were transferred to pots in environments subjected to growth conditions to induce further selection and to perform their phenotypic and molecular characterization. The selection was based on the presence of a 'wild' phenotype under normal development conditions and a greater tolerance to environmental stress, manifested through higher production in agricultural areas with less favorable conditions for cultivation. Preliminary selection of the event The transgenic soybean events were generated using the Agrobacterium-mediated protocol in the Williams 82 cultivar. T1 seeds were obtained for 35 independent events using three different expression cassettes and strategies. The first multiplication was carried out in a greenhouse, and ten T1 individuals derived from each event were sampled for a Mendelian segregation assay by PCR determination. After this analysis, lines that did not show Mendelian segregation were discarded. The lines were then sown IF-2019-1026218 85 -APN-ANP#INPI Page 22 of 67 derived from self-fertilization of individuals from selected events (Mendel's segregation 3:1 in T1). During the growing season, off-type phenotypes with penalties were identified and discarded. During the vegetative stages, the plants were sampled for PCR analysis to identify homozygous lines. The increase of seeds (seed T3) from the homozygous and null lines was carried out in a greenhouse. To continue with the selection of events, fifteen selected transgenic events of HB4 soybeans and control lines were evaluated under field conditions. Two irrigation regimes (low and high) were applied. For the low irrigation regime, water supply was suspended from the soybean development stages R1 to R6. Therefore, this regime consisted of only two water applications, one at the beginning of the season and the other at the end. Homozygous transgenic events within or between constructs, and within the same line, had higher yields than non-transgenic lines. Significant yield differences existed between transgenic and non-transgenic lines for two inducible transgenic events, one (b) (plND2:HB4) and one (c) (piND3:H84), within the same line. Likewise, two constitutive transgenic events (a) (plND:HB4) had higher yields than their non-transgenic counterparts. These four events were selected for further characterization, which would allow for the selection of a specific event. Transgenic events and genetic constructs of soybeans. IF-2019-1026218 85 -APN-ANP#INPI Page 23 of 67 The Williams 82 soybean genotype was used for transformation with the Agrobacilli lymefaciens strain EHA101. The transformation vectors consisted of binary piasmid derivatives of the pPZP200 series (Hajdukiewicz et al., 1994). The bar gene from Streptomyces hygroscopicus, present in the piasmids, was used as a selectable marker (Thompson et al., 1987). To evaluate the effect of different expression levels on growth response and tolerance, three different promoters were used for Hahb-4 expression. Constitutive expression of Hahb-4 TF was obtained using the 35S promoter of cauliflower mosaic virus (CaMV), and inducible expression was obtained using two different Hahb-4 promoter regions. The difference between the inducible promoters is the presence or absence of the COX5c intron (Figure 2A).The constructs were similar to those described in Cabello et al. (2007). First-generation transgenic plants (T0) were selected using herbicide sprays (glufosinate ammonium). Subsequent generations (T1 and T2) were selected by detecting cDNA and Hahb-4 regulatory sequences using PCR. Several homozygous lines were obtained, and after preliminary analysis, four independent transgenic events were selected for further evaluation (a1, a2hb1, and yd). The preliminary analyses consisted of visual observations and selection of events with a phenotype without altered morphology. Transcriptional expression analysis of the HaHB4 and bar genes The expression levels of the HaHB4 and bar genes in homozygous lines were evaluated using transcriptional expression analysis. 24 seedlings were treated. IF-2019-1026218 85 -APN-ANP#INPI Page 24 of 67 of each transgenic event, either with a 100 μM ABA solution for 1 hour or with water as the control treatment. The experiment was performed three times, and five seedlings were sampled in each individual experiment. After treatment, the total seedling biomass was harvested and immediately placed in liquid nitrogen. RNA was isolated from the samples for PCR-RT (polymerase chain reaction - reverse transcription) using TriPure reagent (ROCHE). RNA (1 pg) was incubated with DNase RQ1 (Promega, Madison, W1, USA) according to the manufacturer's instructions and then used for reverse transcription reactions using the cDNA first-strand synthesis transcription kit (ROCHE). Quantitative PCRs were performed using the LightCycler® 480 II apparatus (ROCHE) in a fine volume. of 20 μI using the LightCycler® 480 SYBR Green Master Kit. Fluorescence was measured at 80-84 °C for 40 cycles.The primers used for the quantification procedures were designed to work at a mating temperature of 60°C, and melting curves were analyzed to detect unspecified amplification products. In each case, gene expression analyses were performed in triplicate, and the relative expression level of transcripts was calculated using the Ct values ​​obtained for each sample, as described by Pfaffl (2001). Water stress under controlled experimental conditions. The experiment consisted of five genotypes (transgenic events a1, a2, b1, c1 and Williams 82), two water treatments (good irrigation and water stress), and three stress triggering periods: second node (v2), full bloom (R2). 25 IF-2019-1026218 85 -APN-ANP#INPI Page 25 of 67 and full pod (R4) (Fehr and Caviness, 1977), and 15 replicates. Pots (5-L) were filled with commercial GrowMix MultiPro (Terrafertil SA, AR). Three seeds were planted in each individual pot. At emergence, the plants were reduced to one plant per pot. Water stress was imposed from the V2, R2, and R4 developmental stages by stopping irrigation completely. The remaining control pots were maintained at field capacity until maturity. At the first appearance of wilting symptoms in the Hahb-4 plants, the pots were irrigated to field capacity. A recovery rate (%) was calculated after a 7-day recovery period for each genotype and developmental stage as the number of plants without wilting symptoms divided by the total number of plants at the start of the experiment. Experiments on sensitivity to ethylene. Soybean plant leaves (15 leaves per genotype) from the transgenic events a1 and Ó1 and control plants (Williams 82) were separated from plants growing under controlled conditions at the V4 developmental stage. The separated leaves were placed in Petri dishes and incubated with: a- water and left under normal light conditions (control treatment); b- water and covered with aluminum film (dark treatment); and c- with a 100 pM 2-chloroethylphosphonic acid solution (ethephon treatment) (Typhon, Gleba, AR). After a 7-day treatment period, pigment extraction and quantification were performed on the recovered leaves. IF-2019-1026218 85 -APN-ANP#INPI Page 26 of 67 For the determination of chlorophyll (A and B) and photosynthesis-related carotenoids, leaves were ground in liquid nitrogen and left overnight in the dark in a solution containing 99.9% ethanol. An aliquot of the ethanol solution was used for additional quantification by LV / Vis spectroscopy. Serial dilutions of each aliquot were performed to avoid outliers in the absorption spectrum. The visible electronic absorption spectra of chlorophyll A and B and carotenoids were recorded at 15 °C using a JASCO V-550 spectrophotometer (Jasco Analytical Instruments, MD, USA). A spectral scan was performed between 350 nm and 750 nm for each sample. The values ​​for the entire experiment are the average of three independent experiments. To evaluate one of the morphological effects of the triple response to ethylene, soybean seeds of genotypes a1, b1, and control were placed in seedbeds lined with filter paper containing either water or a 25 pM solution of 2-chloroethylphosphoric acid. A total of 3 seedbeds (20 seeds each) were used per genotype and treatment. The seedbeds were covered with aluminum film for 48 hours. After hypocotyl emergence, the number of seeds with hook formation was quantified. Experiment with water loss. Three plants of each transgenic soybean event (a 1, a2, b1 and c1) and the non-transgenic control (Williams 82) were grown in 5 L pots with GrowMix MultiPro 27 soil IF-2019-1026218 85 -APN-ANP#INPI Page 27 of 67 under normal irrigation conditions. At the beginning of flowering (R1) (Fehr and Caviness, 1977), 10 leaves were separated from each plant and immediately weighed on an analytical balance isolated from air at 1 hour intervals for 10 hours. Field experiments under dryland conditions The transgenic events a1, a2, b1, c1, and the wild type (Williams 82) were evaluated to determine yield and yield components in 12 environments during the 2012–13 growing season. Environments were defined as a combination of location and planting date, since in some locations, planting occurred on two different dates. The field trial locations were Monte Buey (Córdoba), Chilibroste (Córdoba), Corral de Bustos (Córdoba), Villa Saboya (Buenos Aires), Carmen de Areco (Buenos Aires), San Agustín (Buenos Aires), Landeta (Santa Fe), Hughes (Santa Fe), and Aranguren (Entre Ríos). In San Agustín, Carmen de Areco, and Aranguren, planting took place on two different dates. The environments were grouped based on the yield of the wild-type genotype (Environmental Index).Three environmental indices (low, medium and high) were defined considering different criteria: 1) allowing the selection of the event maximizing the yield difference between the events and the non-transgenic control; 2) representing the average national yield of the Argentine Republic (upper limit for the low environmental index) and the average yield of the two most productive areas of the Argentine Republic (lower limit for the high environmental index) in the year of the selection of the event (Bolsa de Cereales, Panorama Agrícola Semanal 2013, May 30, retrieved from. IF-2019-1026218 85 -APN-ANP#INPI Page 28 of 67 www.boisadecereales.com / pas); 3) balance the number of environments within each group. Thus, the low environmental index comprises environments where the yield of the wild type was less than 2,500 kg ha1 (San Agustín, both planting dates, Aranguren, both planting dates and Landeta); the medium environmental index covers environments where the yield of the wild type was between 2,500-3,500 kg ha1 (Carmen de Areco, both planting dates and Villa Saboya); and finally, the high environmental index includes environments where the yield of the wild type was greater than 3,500 kg ha1 (Corral de Bustos, Hughes, Monte Buey and Chilibroste). The selection of the event was carried out on the basis of the relative performance of the seed yield and the yield components (number of seeds per square meter and weight of 100 seeds) of the transgenic events and the wild type.The relative transgenic performance for the wild type was calculated as a relative difference between the transgenic event and the wild type. Field trials were planted using a randomized complete block design with 4 to 7 replicates, depending on the site. Plots consisted of 4 rows, 5 to 6 meters long, with 0.4 to 0.67 meters between rows. The two central rows of each plot were harvested at full maturity (R8) (Fehr and Caviness, 1977). Yield was expressed on a 13% moisture basis. The number of seeds per square meter was calculated based on the weight and yield of 100 seeds. Seed yield, number of seeds, and seed weight were analyzed using ANOVA with SAS software. The statistical model included an environmental index, nested environment with index 29 IF-2019-1026218 85 -APN-ANP#INPI Page 29 of 67 environmental, nested block with environment, genotype, and interaction terms (genotype by environmental index and environment by genotype) After selecting the event, additional field trials were conducted in six environments during the 2013-14 growing season. The field trial locations were Monte Buey (Córdoba), Aranguren (Entre Ríos), Roldán (Santa Fe), and Villa Saboya (Buenos Aires). In Aranguren, two experiments were sown, differing in the fertilization treatment at planting: a) 100 kg ha⁻¹ of monoammonium phosphate fertilizer and b) 0 kg ha⁻¹ of monoammonium phosphate. In Roldán, planting took place on two dates (December and January). The experimental design for the 2013-14 field trials was the same as in 2012-13. Data from both years were pooled, and all environments were analyzed together for comparison between the transgenic event b1 and the non-transgenic control. The field trials within the low environmental index were conducted in Aranguren under two fertilization conditions. Field tests with a medium environmental index were conducted in Monte Buey and Roldán (two planting dates).Finally, Villa Saboya was classified as the medium environment index test. The data were analyzed using the same statistical model as for the previous dataset. Building gene libraries and sequencing [Ilumina] Leaf tissue was collected from Williams 82 and the transgenic b1 event from three plants under two different water treatments (well-irrigated and water-stressed plants), as described in the section "Experiment with water stress under controlled conditions." Tissue samples were collected at stage R2. 30 IF-2019-1026218 85 -APN-ANP#INPI Page 30 of 67 Total RNA extraction from leaf tissue was performed as described in the section Hahb and bar gene expression levels, using the SV Total RNA Isolation System (Promega, Madison, WI, USA). RNA quality was assessed using the Agilent 2100 Bioanalyzer Eukaryote Total RNA Nano (Agilent, Santa Clara, California, USA), and RNA concentration was determined using the Quant-iT RiboGreen RNA assay kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA). A differential expression assay for RNA sequencing was designed using a single-factor, two-level (water stress and good irrigation) scheme with three biological replicates for each factor level. RNA sequencing libraries were constructed using the TruSeq RNA Library Prep Kit v2 according to the manufacturer's recommendations (Illumina, San Diego, CA, USA). Library quality control was performed using the Agilent 2100 DNA 1000 chip bioanalyzer (Agilent, Santa Clara, California, USA). Libraries were quantified using KAPA Library Quantification Kits for Illumina platforms (KAPA Biosystems, Wilmington, Massachusetts, USA).), were pooled, diluted and loaded for further sequencing on an Illumina HÍSeq 1500 RR sequencer 2x100 bp line. All samples were sequenced using next generation facilities at the Rosario Agrobiotechnology Institute (Rosario, Argentina). Ñapeo, differential expression analysis and gene ontology enrichment (GO) IF-2019-1026218 85 -APN-ANP#INPI Page 31 of 67 Quality control of the raw data was performed using FastQC vO.11.4 (Andrews, S. 2010). Trimming and adapter removal were performed using Trimmomatic v0.33. RNA sequence reads with paired ends were mapped to the Glycine_max reference genome (phytozome Gmax_275_Wm82.a2.v1) using Bowtie? v2.2.6 (Langmead and Salzberg, 2012) included in TopHat v2.1O (Trapnell et al., 2009) using the default parameters. For transcript assembly, Cufflinks v2.2 1 (Trapnelí et al., 2012) was used, abundance estimation was measured using 10 fragments per kilobase of transcripts per million mapped reads (FPKM), and differential expression analysis (FDR=0.05) was performed using Cuffdiff. Differentially expressed genes were annotated with gene ontology (GO) terms.A singular enrichment analysis (SEA) (Fisher's exact test; significance level 0.05) was performed using the agriGO web server (http: / / bioinfo.cau.edu cn / agriGO) (Zhou D„ ef a / , 20W) with the Glycine max Wm82.a2.v1 gene as background. To obtain a broad overview of transcript functions, GO terms were mapped to GO slime plant categories using the GOSIimViewer tool (http: / / www agbase.msstate edu / ). Gene IDs were obtained using the phytozome 11.0v repository. Selection of event between two constitutive transgenic events (a1 and a2) and two inducible transgenic events (b) and (c) Four independent transgenic lines (a1, a2, b1, and c1), belonging to three different constructs, were evaluated to determine the relative levels of 32 IF-2019-1026218 85 -APN-ANP#INPI Page 32 of 67 HaHB4 expression (Figure 2B). As expected, the b1 and a2 transgenic events with the inducible promoter showed higher levels of HaHB4 expression when exposed to abscisic acid (ABA) compared to control groups without phytohormone exposure. In contrast, the a1 and a2 transgenic events with the constitutive promoter showed similar HaHB4 expression for both treatments. Expression levels for the bar gene remained similar under both conditions, as expected. Following the expression analysis, drought tolerance experiments were conducted under controlled conditions. Three different developmental stages were evaluated in the four independent transgenic lines (a1, a2, b1, and c1). After a period of water deprivation, all transgenic lines showed fewer wilted plants compared to non-transgenic plants (Williams 82) (Figure 3A). Observations of recovery after wilting (recovery rate) were made following a period of water deprivation followed by irrigation for each independent transgenic line (Figure 3B).In V2, the second node of the developmental stage (Fehr and Caviness, 1977), only 7% of the control plants showed tissue recovery, while the average recovery rate for the transgenic events was 67%. Similar results were found in the developmental stages R2 (full bloom) and R4 (full pod) (Fehr and Caviness, 1977), where the recovery rate for the control plants was 12% and 13%, while the transgenic events showed values ​​of 68% and 65%, respectively. A recovery rate was calculated for all developmental stages (final recovery rate). 33 IF-2019-1026218 85 -APN-ANP#INPI. Page 33 of 67 to estimate the average performance of each transgenic event. The results show some differences between the transgenic events, where events a1 and b1 show higher final recovery values ​​than events a2 and c1 (Figure 38). Furthermore, the rate of water loss from detached soybean leaves was measured at 1-hour intervals for 10 hours to test whether the regulation of stomatal closure contributes to the stress tolerance of the transgenic lines. The results showed that water loss was similar in all independent lines and the wild type (Figure 3C), demonstrating that early stomatal closure is not a mechanism involved in HaHB4-mediated drought tolerance. Evaluation of ethylene sensitivity and senescence delay in HaHB4 transgenic plants Reduced sensitivity to ethylene, and consequently, delayed senescence, are the main mechanisms conferring greater drought tolerance in transgenic Arabidopsis HaHB4 plants (Manavella et al., 2006; Cabello et al., 2007). To evaluate this physiological mechanism in soybeans, two independent transgenic lines with different promoters, a1 constitutive and b1 inducible, were selected for evaluation. The transgenic b1 line maintained a longer photosynthetic activity than the non-transgenic control (Williams 82) when both were exposed to exogenous applications of ethephon (2-chloroethylphosphonic acid) or to darkness to activate the 34 IF-2019-1026218 85 -APN-ANP#INPI Page 34 of 67 Tissue senescence. Transgenic b1 leaves treated with ethephon or kept in darkness showed similar abundances of chlorophyll A and B, and photosynthesis-related carotenoids as unstressed leaves (Figure 4C). In contrast, the non-transgenic control genotype showed lower levels of chlorophyll and carotenoids A and B when leaves were treated with ethephon or kept in darkness, compared to unstressed leaves. An intermediate response was found in the transgenic event with a constitutive response (a1). A longer senescence delay was also observed in transgenic b1 leaves when exposed to ethephon or darkness (Figure 4A). Therefore, while transgenic b1 leaves showed the evergreen phenotype, the non-transgenic line showed yellowing symptoms under these treatments. On the other hand, the application of ethylene to seedlings resulted in pronounced curvature of the apical hook. This effect, known as the triple response, causes inhibition of stem elongation, radial stem thickening, and the absence of a normal geotropic response (Guzman and Ecker, 1990). Figure 4B shows the lower sensitivity to ethephon in the transgenic lines a1 and b1 compared to the non-transgenic line, indicating differences in the timing of ethephon sensitivity in soybeans. Furthermore, seedlings of the transgenic lines exposed to different ethephon concentrations showed hypocotyl hook formation at higher concentrations than the non-transgenic line. At the same time, the first symptoms of hook formation in the transgenic lines were observed at ethephon concentrations of 25 μM, while a concentration of 10 μM was 35 μM higher. IF-2019-1026218 85 -APN-ANP#INPI Page 35 of 67 sufficient for hook formation in the non-transgenic control. Similarly, the transgenic lines showed 17% (line b1) and 9% (line a1) of seedlings with hook formation at concentrations of 25 μM of ethephon, while in the non-transgenic control almost 50% of the seedlings showed hook formation at this concentration (Figure 4D). Therefore, the lower sensitivity to ethylene of the transgenic soybean events compared to the non-transgenic control is demonstrated by the maintenance of chlorophyll levels and the observation of higher hypocotyls without hook formation in ethephon treatments and in the dark. Performance of independent transgenic events HaHB4 under rainfed conditions Four independent transgenic events were initially evaluated under field conditions in 12 trials during the 2012–2013 growing season. The trials were grouped into low, medium, and high yield environments based on the yield of the non-transgenic control. All transgenic events showed lower 100-seed weight than the non-transgenic control (main genotype effect: p < 0.0001). Furthermore, the number of seeds per square meter and seed yield showed a significant genotype-environment interaction (p = 0.013 for seed yield and p = 0.033 for number of seeds). The seed yield of events a2 and b1 was significantly higher than the control in the low-yield environment (Figure 5A). The seed yield was higher than that of the non-transgenic control. IF-2019-1026218 85 -APN-ANP#INPI Page 36 of 67, showing a 9.4% increase for a2 and an 11.2% decrease for b1. These differences in performance in the low-yield environment were less the result of a significant increase in the number of seeds than a proportional reduction in seed weight. The transgenic event a2 showed a 15.3% increase in the number of seeds (Figure 5B) and a 4.8% decrease in seed weight (Figure 5G), while the transgenic event b1 showed a 20.6% increase in the number of seeds (Figure 5B) and a 7.6% decrease in seed weight (Figure 5C). In the medium and high-yield environments, there were no differences in seed yield for any of the events except c1. The transgenic event d showed a significant reduction in yield (-8.4%) (Figure 5A) which is explained by significant reductions in the number of seeds (-5.8%) (Figure 5B) and the weight of the seeds (-2.6%) (Figure 5C).Based on the improved performance of event b1 in the low-yield environment and the absence of penalty on seed yield in the high-yield environment, event b1 was selected for further field trials. Further evaluation of the selected transgenic event b1 in an expanded set of environments during the 2013-14 growing season showed homogeneous results compared to the previous year. A combined analysis of event b1 and the non-transgenic control for both growing seasons showed a statistically significant genotype-environment interaction for seed yield (p = 0.048) and number of seeds (p = 0.050), while seed weight showed a significant main effect of genotype (p < 0.0001). 37 IF-2019-1026218 85 -APN-ANP#INPI Page 37 of 67. Seed yield was significantly different between the two genotypes in the low-yield environment (Figure 6A). The increase in the number of seeds (23.3%) was proportionally higher than the decrease in seed weight (-6.7%), resulting in a significant increase in seed yield (14.9%) (Figure 6A, B, C). For medium- and high-yield environments, there was a trade-off between seed weight and number of seeds. The decreases in seed weight (-6.8% and -4.2% for medium- and high-yield environments, respectively) (Figure 6C) were of a similar magnitude to the increases in the number of seeds (7.3% and 6.2% for medium- and high-yield environments, respectively) (Figure 6B). Classification and identification of differentially expressed genes To evaluate the transcriptional-clonal changes that confer drought resistance in the b1 transgenic soybean event, transcriptomic RNA sequencing was performed using Illumina technology in the b1 event and the non-transgenic control (Williams 82). A first approach comparing irrigated treatments against drought identified 1931 differentially expressed (DE) genes (FC ≥ ± 2) in the HaHB4 genotype. A similar number of DE genes were found for the wild-type genotype, with 2215 DE genes (FC ≥ ± 2) in response to water stress. 866 DE genes were shared between the two genotypes (Figure 7B). A second approach was carried out, comparing genotypes within treatments to identify DE genes associated with the HaHB4 transgene. As expected, due to the inducible nature of the HaHB4l promoter, only 38 IF-2019-1026218 85 -APN-ANP#INPI were observed Page 38 of 67 298 DE genes (FC >= + / - 2) when transgenic and non-transgenic plants were compared in irrigated plants. Gene Ontology (GO)-enhanced annotation comparing genotypes under irrigated conditions identified 941 GO terms associated with DE genes in the biological processes category, while 9931 GO terms were identified in DE genes under drought treatment (Figure 7). Furthermore, the largest proportion of DE genes associated with water stress corresponded to metabolic and biological processes, while cellular and biosynthetic processes also showed a considerable number of DE genes among the genotypes (Figure 8). Within the main group of biological processes, DE genes associated with water stress were mostly involved in photosynthesis, plant defense responses, transcription factors, and signal transduction (Table 2). Within this category, a second selection of DE genes was performed based on the number of times the initial value increased.The values ​​of FC <- -2 (downward regulation) or FC >= 2 (upward regulation) were selected for further identification and analysis. A total of 12 genes related to photosynthesis were downregulated, 9 of which were exclusively associated with proteins of the photosystem II (PSh) reaction center. Specifically, downregulation was detected in genes encoding photosystem II reaction center proteins A, B, C, D, E, and M (Tikkanen et al., 2014). Regarding the genes involved in the plant's defensive response to stress, lipoxygenase 1 (LOX1), lipoxygenase 2 (LOX2), and beta39 were upregulated. IF-2019-1026218 85 -APN-ANP#INPI Page 39 of 67 3-glucanase 1 when transgenic and non-transgenic plants were compared under water stress conditions. In addition, a set of genes involved with water transport were also DE. In this regard, three proteins of the aquaporin superfamily were considerably repressed in the transgenic plants (Johansson et al., 2000; Sade and Moshelion, 2017). Soybean transcription factors (Wang et al., 2010) were differentially expressed between transgenic and non-transgenic genotypes under drought conditions, involving genes that play important roles in developmental processes and in response to environmental stress (Table 2). In this regard, some elements of the K-box and MADS-box regions (Shu et al., 2013), such as the Squamosa promoter-binding protein (Tripathi et al., 2017), the basic helix-loop-helix (Hudson and Hudson, 2015), and Myb-type transcription factors (Du et al., 2012) were downregulated, while others were upregulated when comparing genotypes under water stress conditions. On the other hand, the salinity tolerance zinc fingers (Yuan et al., 2018), the DNA-binding protein WRKY (Yin et al., 2013; Yang et al., 2017), the basic leucine zipper (Zhanq et al., 2018), and the Arabidopsis homolog of GBF proline-rich region interaction factor 1 (Tokumaru et al., 2017) and the integrase-like DNA-binding protein superfamily (Licausl et al., 2010; Yan, 2014), were upregulated. Finally, the genes encoding proteins involved in signal transduction (Ahanger et al., 2018) showed changes when compared to genotypes under water stress conditions. In particular, these genes are 40 IF-2019-1026218 85 -APN-ANP#INPI Page 40 of 67 calcium-binding phosphatase and kinase proteins, from the EF family, whose expression was considerably higher in HaHB4 compared to the control genotype under stress conditions (Table 2). Gene ID Slab gene annotation (FC) p-val Glyma.09G160500 Surface protein mi Ila of the acuapcrine type -6 3430 0.0120505 Glyma 10G174400 Protein of :a superfamily of the acuapcrine type -6 Glyma.16G210000 Prote 1 na of the aupada mi ha of the type acuapcrina_____ _ -5..3523 0.0010792 Glyma.01G058600 transference of electrons photos in (ethical B -5.3466 0.0010792 Glyma. reaction of photosystem II thiazole biosynthetic enzyme the plaster (ARA6) (THI1) -5.1410 0.0064869 Glyma.D6G2697C0 (THI4) -4.4056 0.0010792 Glyma.D4G 0950 II reaction of the proteolytic center. -4.1302 0.0010792 Glyma.11G1622C0 protein A of the reaction center of the photosystem H -4.1066 0.0010792 Glyma.l3G02820D protein A of the reaction center of the fctc system í| Glyma.06G2179C0 photosystem 1 reaction center protein D -3.B959 0.0010792 Glyma.61G153506 photosystem II reaction center protein D -3.6724 0.0064069 Glyma. 12G 2 32706 protein E of the reaction center of the photosystem II -3.6514 0 0281353 Glyma.006201300 protein B of the reaction center of the photosystem II -3.0341 0.0137509 Glyma D5074 protein C! photosystem II reaction center -2.6759 0.0010792 Gíyma.12G2329QQ electron transfer photcslntétlccs A -2.3301 0.0058637 Gly m a. 0BG139500 ti poxig enasa 1 2,1110 0.6180400 Glyma.12G05470ü lipexigenase 2 2,7721 0,0010792 G ly m a. 03G132900 beta-I.Í-glucanase 1_______________ protein of the family of transcription factors of the ___2.2403__ 0.0010792 Glyma. 19G034 500 MADS box and ia region of the K box protein of the family of transcription factors of the type -3.6906 0.0028364 Glyma. 04G197100 promoter binding protein Squamosa protein of the helix-loop-3 DNA binding superfamily.2,4033 0.0175182 Glyma. 13G360 500 basic helix (bHLH) -2.3053 0.0010792 Glyma 12G226D00 Squamosa promoter binding type protein 12 DNA binding superfamily helix-loop protein -2 2374 0.0010792 Glyma. 17G156000 basic helix (bHLH) -2,0947 0,0422725 Garría. 17 G236200 fingers of ene salt tolerance 2,0543 0,0010792 G!ym a. U 025800 promoter-binding type protein ce Squamosa 12 transcription phaeton family protein of the 2,0921 0,0312612 Gfyma.20G153700 MADS box and K box region 2,2592 6,0043799 Glyma. 17G097900 DMA binding protein WRKY 72 2.3047 0.0338911 Glyma.02Gl26160 leucioa basic zipper 42 2.3690 0.0253307 Glyma 17GO990OO Myb domain protein 94 2.3312 0 0276323 Glyma.15G063000 protein of the helix-loop DNA-binding superfamily 2.5315 0.0053037. IF-2019-1026218 85 -APN-ANP#INPI Page 41 of 67 basic helix (bHLH) factor 1 interaction with the proline-rich region of the Glyma 120206600 GBF 2.7909 0.0010792 Glyma.17G 047300 proteina déla su perfa milis de unión al ADN tipo integrasa 2.2079 0.0064669 Glyma.09G 072090 protea déla saperíamiúade unión al ADNtipo integrasa 2.5076 0.0010792 Glyma 13G112400 proteina déla superfamilia de unión al ADN tipo integrase 2.0309 0.0010792 Glyma.15G 180000 proteina de la superfamiiia de_ unión al ADN tipo integrasa 3.2130 0.0076017 Glyma 09G210900 phosphocribulokinase 2.0034 0.0261353 Glyma.06G 159400 GTP-binding protein small family protein of the internal sodium / calcium 1 2.0096 0.0010792 Glyma.12G22780C family protein binding EF to calcium 2.0401 0.0010792 Glyma. 14G157700 kinase 2 associated with wall 2.0608 0.0294783 G ly m a. C6G 061800 protein from the kinase superfamily con CBL 2.1669 0.0256477 Glyma.11G157100 41 type calcdulin 2,2133 0.0164572 Glyma.C3G001600 HAD superfamily, acid phosphatase subfamily IIIB 2,2990 0 0442716 Glyma.02G044600 protein of the protein kinase family 2,4190 0,0285638 Glyma.06G200100 HAD superfamily. acid phosphatase subfamily IIIB 6,7805 0,0010792 Glyma. 17G112000 . .protect from the family hand EF calcium binding__ inf 0 0010792. Table 2 - Fold change (fe) of a selection of differentially expressed genes between transgenic and non-transgenic genotypes under water stress conditions. The gene groups correspond, from top to bottom, to (A) aquaporin-related genes, (B) photosynthesis-related genes, (C) plant defense response genes, (D) transcription factors, and (E) signal transducers. IF-2019-1026218 85 -APN-ANP#INPI Page 42 of 67 The differences between the effectiveness of transgenic events in the low-yield environment and the existence of a yield penalty in the high-yield environment suggest that the type of promoter (inducible or constitutive) and the level of expression of HaHB4 contribute to the final response to environmental conditions and performance. Our results in the transgenic event b1 selected with an inducible promoter showed that the physiological responses induced by HaHB4 could translate into higher yields in low-yield environments without a yield penalty in high-yield environments (Figure 6). Example 3: Characterization of the DNA sequences of the soybean event IND00410-5 The soybean event IND-00410-5, inserted into the plant's genomic DNA, as well as the flanking genomic sequences, was characterized using molecular techniques. To this end, the DNA sequence of the IND-00410-5 event was performed, the number of transgenic inserts (number of integration sites within the soybean genome) was determined, as well as the number of copies of the transgenes in the insert, and the integrity and stability of the sequence was analyzed over 6 generations. Furthermore, next-generation sequencing (NGS) technology was used in parallel with conventional technologies to describe the IND00410-5 event. NGS was used to determine the whole-genome sequence of IND-00410-5; this includes the T-DNA sequence and the junction sequences (JS) between the T-DNA and the native soybean genome. The flanking sequences allowed monitoring of the stability and integrity of the T-DNA insertion. IF-2019-1026218 85 -APN-ANP#INPI Page 43 of 67 of six self-fertilized generations, as well as in plants that resulted from crossing with other soybean varieties. DNA was isolated from leaf tissue of plants homozygous for the IND00410-5 event (from greenhouse or field) or from soybean plants of the Williams-82 variety for analysis by Southern blot. For whole genome sequencing and segregation analyses in F2 plants, DNA was obtained from embryonic tissue. For the crossing of plants carrying the IND-00410-5 event, a commercially available soybean crop, Bio 6.5 (Bioceres Semillas SA, Ocampo 210 bis, Rosario, Argentina), was used. In general, prior to extraction, leaf tissues frozen in liquid nitrogen were ground into powder using a mortar or '96 ml' tubes for miniprep. Depending on the amount of plant DNA required for the experiment, the following extraction techniques were used: - OTAS Method (Hexadecyltrimethylammonium bromide or Cetyltrimethylammonium bromide): This method was used to extract genomic DNA from plant samples (http: / / ire.igd.com / 11.edu / Protocois / DoyIeProtocoI.pdf). Approximately 100 mg of ground leaf tissue was mixed with 600 μg of CTAB buffer (2% w / v CTAB, 100 mM Tris HCl, 20 mM EDTA, 1.4 M NaCl, and β-mercaptoethanol) and 5 pg of RNase A; the homogenate was incubated at 55–60°C for 15–20 minutes under intermittent mixing. 600 pL of chloroform were added to the samples and mixed by hand for 2–3 minutes, then centrifuged at 10,000 rpm for 8 minutes. The upper aqueous phase was placed in a clean microtube and the DNA was precipitated with 400 pJ of isopropanol. The sample was centrifuged at 12,500 rpm for 10 IF-2019-1026218 85 -APN-ANP#INPI Page 44 of 67 minutes to form a pellet with the DNA precipitate. These pellets were washed with 300 ml of 70% ethanol by centrifuging the samples at 12,500 rpm (5 minutes). The DNA pellets were air-dried, then resuspended in 100 µL of TE buffer (10 mM Tris HCl, 1 mM EDTA, pH 8.0). The extracted DNA was stored in the refrigerator at 4°C or in the freezer at -2°C. - Qiagen DNeasy Plant Maxi kit (Valencia, CA) for large volumes (Southern blot analysis) or QIAprep® Miniprep (Qiagen Inc.) for smaller volumes. DNA isolated from embryonic tissue was used for Illumina-based sequencing and for segregation studies of the F2 progeny from crosses of the IND-00410-5 and Bio 6.5 events. Prior to extraction, seeds carrying the IND-00410-5, Williams 82, and F2 events were incubated in water at 37°C to facilitate their disruption. The embryos were then separated from the cotyledons, and their DNA was extracted using the CTAB method. The DNA was quantified using Quanti-IT™ PicoGreen® (Invitrogen, Carlsbad, CA) or by QuBit fluorometry (Invitrogen) and the Quanti-IT™ dsDNA BR Kit (Invitrogen). The DNA was then stored at 4X or -20°C. DNA was seeded onto 0.8% (w / v) agarose gels to assess sample integrity. The gel was prepared with 1X TAE buffer (40mM Tris, 20mM acetic acid, and 1mM EDTA) and run at 120v. DNA samples were diluted in 6X loading buffer (30% glycerol and bromophenol blue) and Gel Red™ Nucleic Acid Gel Strain 200x (Biotium, Inc., Hayward, CA). 1.5% (w / v) agarose gels were used to analyze amplicons between 200 bp and 1500 bp in length, while 1% (w / v) agarose gels were used for larger DNA fragments. Electrophoresis was performed in 1x TAE buffer and run at 120 V. The samples were processed as described above. IF-2019-1026218 85 -APN-ANP#INPI Page 45 of 67 According to the size of the amplicon, different molecular weight markers were selected: from 1Q0bp (from 100 to 2080 bp) and / or Lambda SsMl (from 117bp to 14140 bp) (P-BL Argentina). Standard PCR reactions performed in most assays were conducted using 100 ng of genomic DNA as a template in a 40 μL reaction volume with final concentrations of 1.8 mM MgCl₂, 2 mM DMSO, 0.4 μM primers, 50 μM dNTPs, and 1 U FastStart High Fidelity (Roche, Indianapolis, IN). The following cycling schedule was used for ampiciles between 400 bp and 700 bp: cycle of 95°C for 30 seconds; skies of: 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds; final extension: 1 cycle of 72DC for 10 minutes. For the production of ampicons with sizes from 1100bp to 1300bp, the duration of the extension step at 72°C was increased from 30 seconds to 60 seconds. For complete amplification of the insert with Expand Long Range polymerase, the final concentrations used were MgCl2 2.5 mM, 6% DMSO, 0.3 pM each primer, 500 μM dNTPs, and Expand Long Range 3.5 U (Roche, Indianapolis, IN). Amplification was performed under the following conditions: cycle of 92eC for 2 minutes; cycles of: 92°C for 10 seconds, 55°C for 15 seconds, 68°C for 10 minutes; IF-2019-1026218 85 -APN-ANP#INPI Page 46 of 67 cycles of: 92°C for 10 seconds, 55X for 15 seconds, 68'0 for 10 minutes increasing the time of this final step by 20 seconds for each cycle; 68X cycle for 7 minutes. Amplicons for determining the T-DNA insertion sequence were produced using Phusion® High-Fidelity DNA polymerase from New England BioLabs (Ipswich, MA). All sequenced PCR products were analyzed by electrophoresis on agarose gel as described above; in addition, they were purified using the 11lustra GFX PCR DNA and Gel Band Purification kit (GE, Piscataway, NJ). Amplicons were cloned (TOPO TA Cloning ® kit by Invitrogen) to determine the T-DNA sequence by the Sanger method. Primer Name SEQ ID NO: Primer Sequence 5 -3' 750 - 5 ACGC A ACTG A AtlTC AG ACC A 751 6 A AGTG GCG ATATGGTTCC Λ G 752 7 GGCTG C ​​AAGTTTTG GTCAAT 753 8 1TCGG CT AC ATTTCTC A GCA 754 - 9 AGCC A ATGA ATCC J CACCAG 755 10 AITAGÜCGAGTAÜGC A GC Λ A 756 11 CAACACACCTA CA A ACGTGTCA 757 12 GGGTGGG GGCT ACT ACTTTT 758 -- 13 CTTCAG CAGGTGGGTGTA GAG 759 ___11 . J AGJCGACCGTGT ACGl 'CTCC IF-2019-1026218 85 -APN-ANP#INPI Page 47 of 67 760 G TTG GG1C AG C Cl G AG IG AT Table 3. List of primers used to determine the insert sequence in the IND-00410-5 event through conventional Sanger sequencing method. The clones were then purified using the Qiagen QIAprep Miniprep Spin Kit (Valencia, CA). Plasmid DNA was sent for sequencing to Davis Sequencing (Davis, CA). The sequences were analyzed using DNASTAR SeqMan Pro software (Madison, WI). At least three clones were sequenced per amplicon. a) Southern blot analysis The number of T-DNA inserts was determined in homozygous T5 IND-00410-5 plants by Southern blot analysis. The DNA from this event was digested with two enzymes: Hind and Λ / del. There are two Hindi II sites in the T-DNA, located close to each other (Figures 1A and 18). Assuming only one complete copy of the IND-00410-5 T-DNA is present in the genome, the minimum fragment size detectable by HaHB4 probe hybridization would be 1.85 kb. On the other hand, the probe for the bar selector gene would detect digestion fragments comprising the left border of the soybean genome. These fragments would be larger than 2.6 kb (Figure 18). In the Southern blot shown in Figure 9, the highlighted fragments are of the expected size and were consistent with a single T-DNA insert. There are four Λ / ctel restriction sites in the construct (Figure 1Aa): two in the T-DNA and two in the binary vector. Complete digestion of Ndel in the T-DNA should release a precise DNA segment 2703 bp in length containing 48 IF-2019-1026218 85 -APN-ANP#INPI Page 48 of 67, the target binding site for the bar probe. The HaHB4 probe was expected to detect a DNA fragment of at least 1.35 kb in size, assuming a single, intact T-DNA. The hybridization band in the Mtel digestion was larger than 8.6 kb (Figure 9A), which is consistent with the presence of a single, intact T-DNA insert. One gram of leaf tissue from either IND-00410-5 or Williams 82 was flash-frozen using liquid nitrogen and ground to a fine powder using a pre-cooled mortar and pestle. DNA was extracted using the Qiagen DNeasy Maxi Prep Kit following the manufacturer's protocol. After eluviation, the DNA was precipitated by adding 1 / 10 volume of 3M sodium acetate and 2–3 volumes of 100% ethanol. The pellet was washed with 70% ethanol and suspended in 80 µL of 1x TE buffer. DNA was quantified using a QuBit fluorometer. The DNA concentration for IND-00410-5 was 1120 ng / µL and for Williams 82 was 800 ng / µL. To obtain the restriction enzyme-digested fragments, for every 50 μL of digestion reaction, 5 pg of genomic DNA were mixed with HindiH enzyme or Ndel enzyme at concentrations of 10 U / pg of DNA. The samples were digested overnight (~16 hours) at 37°C. To digest the control plasmid, 100-200 picograms of plasmid DNA were used. Digested fragments of genomic DNA from IND-00410-5 and Williams 82 were plated onto 0.7% agarose gels along with the molecular weight marker DIG Vil (Roche Cat No. 1669940910). The samples were run overnight at 50 V. The gel was incubated twice in denaturing buffer for 30 minutes each time. The denatured gel was washed in transfer buffer for 15 minutes before alkaline transfer. IF-2019-1026218 85 -APN-ANP#INPI Page 49 of 67 Molecular probes for the HaHB4 and bar genes were synthesized (Table 4) following the procedure detailed in the Roche POR DIG primer synthesis kit (cat No. 11636090910). Probe Tamafio (bp) Location in ei Vector Hybridization (°C) Primer Type First Number Sequence HB4 liar sia'” 226 10159..1(1510 45 Direct Reverse 2527 (SEQ ID NO: 16) 203 (SEQ ID NO: 17) CGCTTGCGTCT AA ATCCG AGTCTC CAAGACCGGCAACAGGATÍC 448 7267.7714 55 Direct 3?8(SEQ ID NO; 18) ATATGG C GCTG ATC'I 'CTGCT Reverse 1970( SEQ ID NO; 19) GGCGGTC1GCA CCATCGTCA 357 1229.. 1585 54 Direct Í747(SEQ ID ΝΌ: 20) A AGA C GACCATCGCAACCCA l'CTA Reverse 1748(SEQ ID NO: 21) T AGCCTTCC ATCCGTG A CCTC A AT REP 258 2979..3236 50 Direct 1745(SF.Q ID NO: 22) AGCTG ATTGG ATGT A CCG CG AG AT Reverse 1746(SEQ ID NO: 23) TTC AA ATCGTACTCCGGC AGGTC A aadA 229 5935..6163 50 Direct 822(SEQ ID NO: 24) A TCA AAC A TCGACCCACGGCGTA A Reverse 1127(SEQ ID NO: .. 25); .G ATC A ATICGG GC ACG AGI Table 4. List of primers used for the preparation of the probes used in the Southern blot analyses. Alkaline DNA transfer from the agarose gel was performed using the Turbo Blotter-Rapid system (Whatman). The DNA was transferred to a 12x12cm nylon membrane (Nytran™ SuPerCharge, Sigma50). IF-2019-1026218 85 -APN-ANP#INPI Page 50 of 67 Aidrich Co, St. Louis, MO) for 4 hours. The membrane was washed in neutralizing buffer (0.2M sodium phosphate, pH 6.8). The DNA was permanently crosslinked to the membrane by Ultraviolet Crosslinker (CL-1000) with 2 exposures of 1500 mJ. The membrane was incubated in 50ml of Roche DIG hybridization buffer EasyHyb (Cat. No. 11 603 558 001) at pre-calculated hybridization temperatures (45X and 55CC for bar gene probes and HaHB4, respectively) in an orbital mixer. Aliquots of 35 µL and 45 µL of the bar and HaHB4 probes were diluted in 1x TE buffer by adding 65 µL and 55 µL, respectively. The probe solutions were incubated at 95°C for 10 minutes and cooled to 4x for 2 minutes. These solutions were added to 8.75 mL of DIG hybridization buffer and seeded to the bottom of hybridization tubes. The membranes were incubated at the described hybridization temperatures for 16 hours in a hybridization oven (VWR Scientific Products) with an orbital mixer. After hybridization, the membranes were washed with wash buffer according to the Roche instructions for the DIG Luminescent Detection Kit. After blocking for 1 hour with 1x blocking reagent, the membrane was incubated for 30 minutes in a solution containing 50 ml of 1x blocking reagent and 5 µL of anti-digoxigenin-AP. The membrane was washed twice with wash buffer for 30 minutes each time and finally treated with detection buffer for 5 minutes. At this point, the membrane was placed in a KPL Hybridization Bag (KLP Cat. No. 6000-51). 5 ml of CSPD solution from the DIG Luminescent Detection Kit was applied evenly across the membrane. The membrane was incubated with CSPD solution for 5 minutes at room temperature. The hybridization bag containing the membrane was then sealed. IF-2019-1026218 85 -APN-ANP#INPI Page 51 of 67 with heat and incubated at 37°C for 15 minutes. The hybridization bag was placed in a cassette with Kodak Biomax light film (Cat. No. 178 8207) in a darkroom and exposed for 20 minutes. The photographic membranes were developed in the dark using a KoniKa QX-60A X-ray processor. Subsequent exposures were made at 1 or 2 hours as required. b) Analysis of the junction sequence (JSA) and the T-DNA sequence of the IND-00410-5 event The junction sequence analysis (JSA) of IND-00410-5, performed using the Illumina-generated sequence, was consistent with the integration of a single copy of the insert at a single locus. This result is supported by the existence of only two junction sequences in the entire sequenced genome containing the IND-00410-5 event. The junction sequences (JS) were named using the chromosome in which the T-DNA integrated. The positions in the soybean genome, according to SoyBase information, are JS-9L-32743826 and JS-9R-32743683. The JSAs are presented in Figure 10. The complete sequence of the T-DNA insert and flanking soybean sequences (SEQ iD NO: 1) were assembled from nova from Illumina-generated DNA sequence reads. The sequence of the T-DNA insert at event IND00410-5 was confirmed to be identical to the T-DNA sequence in the binary plasmid, with a single copy of each gene and each regulatory element, except for the almost complete absence of RB (Figure 1B). The JS analysis of the Illumina-generated sequence was confirmed by conventional Sanger sequencing of multiple amplicons covering the entire insert and its sequences. IF-2019-1026218 85 -APN-ANP#INPI Page 52 of 67 flanking sequences. Additionally, a single 4710 bp amplicon was generated, using ExpandLongRange PCR, with a set of primers complementary to the flanking sequences. Using IND-00410-5 soybean DNA or Williams 82 as a template, amplicons of the expected size were obtained and the DNA sequence of the IND-00410-5 amplicon was identical to the T-DNA sequence derived from the slow sequence of the entire genome. c) Location of the IND-00410-5 T-DNA in the soybean genome: The flanking sequences were mapped to the soybean genome by homology search using BLA.STN (Altschul et al. 1990). The T-DNA insertion occurred at a single location on chromosome 9. The insertion was made 752 bp downstream of the last exon (Exon 5) of the putative F-box gene At1g60400like (corresponding to the Glvma,09^142000 gene in the reference genome (Williams 82), formerly known as Glyma09g26270), and 405,138 bp upstream of the nearest confirmed gene, the ubiquitin ligase ATLG-like E3. It should be noted that a 142 bp fragment of the soybean chromosome was lost at the T-DNA insertion site. The insertion did not disrupt any genes or other known features in the soybean genome (Figure 11). d) Absence of transgenic elements of the binary plasmid: In principle, Agrobactenum should only transfer into the host cell the portion of the plasmid containing the left (LB) and right (RB) borders of its T-DNA sequence. However, it has been reported that Agrobacíerium can also transfer a portion of the binary plasmid, which does not correspond to the T-DNA, or even the entire sequence (De Buck et al. 2000). Assays performed in the IF-20 f 9- f 0262 f 8 85 -APN-ANP#INPI Page 53 of 67 The genome of the soybean IND-00410-5 in search of the presence of said unwanted DNA were negative. The entire genome was sequenced using Illumina NGS technology to unequivocally determine the absence of plasmid sequence remnants in the IND-00410-5 event. Additionally, Southern blot assays were performed to provide a second assay to test the absence of vector sequence remnants. None of the probes specific for non-T-DNA plasmid sequences (aadA, STA, and REP) hybridized with the genomic DNA of IND00410-5. e) Stability of the insertion locus in IND-00410-5 and integrity of the ADNT: The position of the IND-00410-5 T-DNA was monitored for six generations. A set of PCR primer pairs was selected to provide overlapping amplicons across the IND-00410-5 T-DNA insertion locus, including flanking sequences on soybean chromosome 9. The contiguous sequences assembled from these overlapping PCR products suggested that the T-DNA was intact and stable. The organization of genetic elements at the soybean IND-00410-5 event was the same as that present in the binary plasmid T-DNA used in transformation to obtain this transgenic line. No changes in the DNA sequence were detected during the six generations tested. f) Segregation of T-DNA in sexual transfer; T-DNA segregation was tested in the F2 offspring of plants crossed between IND-00410-5 and a commercial soybean crop (Bio 6 5) using PCR. A set of PCR reactions, diagnostic of the binding of IF-2019-1026218 85 -APN-ANP#INPI Page 54 of 67 T-DNA on the left edge and the native soybean allele clearly showed that T-DNA segregated as a single locus. A homozygous transgenic plant, IND-00410-5, was crossed with Bio 6.5 to produce F1 progeny. Four F1 plants were self-pollinated to produce F2 seeds, which were used for segregation analysis. AON isolation and corresponding experiments were conducted using 73 F2 seeds. F2 plants were labeled homozygous for the IND-00410-5 T-DNA (1) when the amplicon for the left margin was present and the amplicon for the native allele was absent. F2 plants were labeled hemizygous (H) when both of the above amplicons were present. F2 plants were labeled homozygous for the native Williams 82 allele when the amplicon for the left margin was absent and the amplicon for the native allele was present (W). These results support the conclusion that the T-DNA of IND-00410-5 is located at a single locus within the soybean genome and is inherited according to Mendel's laws. The selected transgenic event ND-00410-5 differs from its parent Williams 82 by a single T-DNA. This T-DNA carries a single copy of the bar gene and a single copy of the HaHB4 gene along with their respective regulatory sequences. The T-DNA was integrated into chromosome 9 between two native genes encoding F-box-like proteins At1g60400 and an E3-like ubiquitin iigasse AtLG. The integration did not disrupt any known genes or sequences but caused the loss of 142 base pairs corresponding to an intergene region. The insertion locus and T-DNA structure were stable for six generations of self-pollination. The T-DNA insertion segregates according to the Laws IF-2019-1026218 85 -APN-ANP#INPI Page 55 of 67 of Mendel No external sequences were integrated into the edges of the T-DNA in the IND-00410-5 event Example 4: Useful methods for identifying IND-00410-5 in a sample The following example describes a site-specific detection system useful for identifying DNA from the IND-00410-5 event in a soybean sample. This method is site-specific and therefore amplifies only sequences from one of the IND-00410-5 event insertion sites. Multiplex qPCR of HaHB4 and Le1 (soybean lectin 1 reference gene) was performed using specific oligonucleotides and different fluorescent probes linked to FAM and HEX for HaHB4 and Le1, respectively. Multiplex qPCR was also used for the RB of the IND-00410-5 event and the bar transgene using probes labeled with FAM and HEX, respectively. The LB of the event was detected by endpoint PCR, while the wild-type (WT) allele was detected using qPCR with a HEX-labeled probe. Figure 12 shows a schematic of the insertion in IND-00410-5 and the positions of the oligonucleotides and probes used for the detection of the different elements of the construct. - Detection of the insertion site towards the RB During the insertion process, a large part of the RB (right edge of TON A) was lost, leaving only 3 bp. This is mentioned to help us understand the insert's position relative to the original construct. IF-2019-1026218 85 -APN-ANP#INPI Page 56 of 67 Oligonucleotides 817 (SEQ ID NO; ) and 818 (SEQ ID NO: ) amplify a 200 bp chimeric fragment formed by the left flanking sequences (Gm chr9 soybean genome”) and part of the inserted construct. Oligonucleotides and probe: 817(SEQ ID NO; 26): 5 GGAACTGAAGTCAGACGAGTG 3 818 (SEQ ID NO: 27): 5 GAGGTTGAGCTTGGATGAGA 3 819 (SEQ ID NO: 28): 5-FAM- TTGTCGTTTCCCGCCTTCAGTTTAA-BHQV 3 qPCR protocol: 2ul genomic DNA (1 OOng / ul) 5.9 µl m³H₂O 10ul qPCR SuperMix Roche (2X) 0.5ul Probe (10uM) 0.8ul Primer F (10uM) O.fiul Primer R (10 uM) 20ul Amplification program: Temp. (°C) 95 Time (min) Variation (°C / s) Denaturation 4.4 Temp _JDC) Time (s) Variation 95 10 4.4 35 cycles - qPCR 55 30 2.2 72 10 4.4 Temp. Time (min) Variation (°C / s) | Cooling IF-2019-1026218 85 -APN-ANP#INPI Page 57 of 67 2.2 - Detection of the insertion site towards the LB Oligonucleotides 868 (SEQ ID NO: 29) and 752 (SEQ ID NO: 30) amplify a 356 bp chimeric fragment formed by the right flanking sequences (Gm chríT soybean genome) and part of event IND-00410-5 Oligonucleotides: 868 (SEQ ID NO: 29): 5 CCGCAATGTGTTATTAAGTTGTC 3 752 (SEQ ID NO: 30): 5 GGCTGCAAGTTTTGGTCAAT 3 PCR protocol; 2ul genomic DNA (WOng / ul) 10X buffer solution of 2ul PCR 1.6ul MgCI2 (25mM) 1ul of F(10uM) Tracer 1ul Receptor R(10uM) 0.4ul dNTPs (10mM) 0.1 ul Taq 11.9ul mqH20 _____________ 20ui Amplification program: 94°C 4min 94°C 30sec 55°C 30sec °C 30sec 4DC 2min cycles - Detection of HaHB4 IF-2019-1026218 85 -APN-ANP#INPI Page 58 of 67 Oligonucleotides 530 (SEQ ID NO: 31) and 531 (SEQ ID NO: 32) amplify a 68-bp fragment within the HaHb4 transgene. Oligonucleotides and probe: 530 (SEQ ID NO: 31): 5 CGCCACTTGACGAGGATGA 3 531 (SEQ ID NO: 32): 5 CGAGACCCGAGTTAAGGATGAAAC 532 (SEQ ID NO: 33): 5-FAM-AGCCGGAGTTTATGTGCCAACTGGT-BHQ1 -3 qPCR protocol: 2ul genomic DNA (1 OOng / ul) 5.9 µl m³H₂O 10ul qPCR SuperMix Roche (2X) 0.5ul Probe (10uM) 0.8ul Primer F (10uM) 0.8ui Primer R (10 uM) 20ul Amplification program: Temp (°C) Time (min) Change (°C / s) Denaturation 95 5 4.4 Temp TO Time (s) Change (°C / s) 35 cycles - qPCR 95 10 4.4 55 30 2.2 IF-2019-1026218 85 -APN-ANP#INPI Page 59 of 67 Temp, re) _ 10 4.4 Time (min) Change (°C / s) Cooling 2.2 Bar detection Oligonucleotides 527 (SEQ ID NO: 34) and 528 (SEQ ID NO: 35) amplify an 84 bp fragment within the bar transgene. Oligonucleotides and probe: 527 (SEQ ID NO: 34): 5 CTGCACCATCGTCAACCACTAC 3 528 (SEQ ID NO: 35): 5 GGTCGTCCGTCCACTCCTG 3 529 (SEQ ID NO: 36): 5-HEX-TCGAGACAAGCACGGTCAACTTCC-BHQ1-3' qPCR protocol: 2ul genomic DNA (100ng / ul) 5.9 µl m³H₂O 10ul qPCR SuperMIX Roche (2X) 0.5ul Probe (10uM) 0.8ul Primer F (10uM) 0.3ul Primer R (10 uM) 20ul IF-2019-1026218 85 -APN-ANP#INPI Page 60 of 67 Amplification program: Temp. (°C) 95 Time (min) 5 Change (°C / s) 4.4 Denaturation Temp. (°C) Time (s) Change (°C / s) 95 55 10 30 4.4 2.2 35 cycles - qPCR 72 1 4.4 Temp. (°C) Time (min) Change (°C / s) Cooling 10 5 2.2 If detection of HaHB4 and bar is required, it can be performed simultaneously using multiplex qPCR with the two systems. The HaHB4 probe contains the FAM fluorophore, while the bar probe contains the HEX fluorophore, allowing for the detection of both amplifications with different filters. Likewise, both HaHB4 and bar (separately) can be detected simultaneously with an endogenous control using multiplex qPCR, provided that the control has a fluorophore different from that of the gene of interest. An example of an endogenous control is the soybean-specific lectin gene. The amplification protocol and program for multiplex PCR are detailed below. multiplex qPCR protocol; 2ul genomic DNA (100ng / ul) 3.8ul dd(H2O) IF-2019-1026218 85 -APN-ANP#INPI Page 61 of 67 10ul qPCR SuperMix Roche (2X) 0.5ul Probe Gen 1 (10uM) 0.3ul Primer Gen 1 F (10uM) OSul Primer Gen 1 R (10 uM) 0.5ui Probe Gen 2 (1 OuM) 0.8ul Primer Gen 2 F (1 OuM) 0.8ul Primer Gen 2 F (10 uM) Amplification Program: 20 uM. (°C) Time (min Variation (°C / s) Denaturing 95 5 4.4 Temp (°C) Time (s) Variation (°C / s) 95 55 10 30 4.4 2.2 35 cycles - qPCR 72 1 4.4 Time (°C) Variation (fl / s) Cooling 10 5 2.2 Detection of Ie1 Oligonucleotides 719 (SEQ ID NO: 37) and 719 (SEQ ID NO: 38) amplify a 118-bp fragment within the Lectin 1 gene Oiigonucleotides and probe: 718 (SEQ ID NO: 37): 5 C TACT G AC C AG CA AG G CAA A 3 IF-2019-1026218 85 -APN-ANP#INPI Page 62 of 67 719 (SEQ ID NO: 38): 5 TCACAATAGCGTCTCCTTGG 3 720 (SEQ ID NO: 39): 5 -HEX-TCGTGCCGAAGCAACCAAACA-SHQ1-3 qPCR protocol: 2ul genomic DNA (100ng / ul) 5.9ul dd(H2O) 10ul qPCR SuperMix Roche (2X) 0.5ul Probe (10uh / l) 0.8ul Primer F ¢1 OuM) 0.8ul Primer R (10 uM) 20ul Amplification program: Temp. (°C) Time (min) Change (DC / s) Denaturation 95 5 4.4 Temp. (°C) Time <s) Variación (QC / s) 95 10 4,4 55 30 2,2 35 ciclos - qPCR 72 1 4,4 Temp. (°C) Tiempo (min) Variación (DC / s) Enfriamiento 10 5 2,2 IF-2019-1026218 85 -APN-ANP#INPI Page 63 of 67 Detection of hetero individuals drops The insertion event is located adjacent to the 3'UTR region of the Gíyma.09g 142000 gene, formerly known as Gíyma09g26270. Using oligonucleotides that hybridize in the sequences flanking the insertion sites, it was possible to differentiate the wild-type allele (these amplify a 205 bp fragment) from the allele that has the IND-00410-5 insertion (in this case, they amplify 471 bp). For the detection of heterozygous individuals, the IND-00410-5 event was first detected using one of the two event-specific systems mentioned above, and then a qPCR was performed to detect the wild allele. Oligonucleotides 934 (SEQ ID NO: 40) and 935 (SEO ID NO: 41) amplify a 205 bp fragment formed by the flanking sequences of the insertion site of event IND-00410-5 and a 142 bp portion lost during transformation (absent in event IND-00410-5). Oligonucleotides and probe: 934 (SEO ID NO: 40): 5 AGACCACTGAAATAGAGAGAAAG 3 935 (SEO ID NO: 41): GGAGTTCTGATAATTGTTATCGTC 936 (SEQ ID NO: 42): 5 HEX-TGAAGTGAGATGATTGAGGGTGGG-BHQ1 3 POR Protocol: 2ul genomic DNA (100ng / ul) 5.9ul mq(H2O) 10ul qPCR SuperMix (2X) IF-2019-1026218 85 -APN-ANP#INPI Page 64 of 67 0.5ul Probe (10uM) 0.8ul Primer F (10uM) OBul Primer R (10uM) 20ul Amplification program: Temp (°C) 95 Time (min) Change (flC / s) Denaturation 5 4.4 Temp. (°C) Time (s) Change (flC / s) 95 55 10 30 4.4 2.2 35 cielos - qPCR 72 10 4.4 Temp (°C) Time (min) Change (°C / s) Cooling 40 5 1.9 Example 5: Susceptibility to abiotic stress factors and performance The environments in which the IND-00410-5 event and the control were evaluated differed with respect to their productive potential probably due to the combination of stress factors such as drought, salinity and low temperatures (osmotic stresses), high temperatures, excessive radiation, low nutrient availability, soil compaction that prevents the growth of thinnings, etc. The effectiveness of the transgenic event was evaluated over three campaigns in different locations and planting dates, with a total of 16 sites evaluated. IF-2019-1026218 85 -APN-ANP#INPI Page 65 of 67 The combination of these stress factors allowed, in turn, the separation of environments into high, medium, and low power performance categories. The transgenic event resulted in a higher yield than the control, with a significance level of 10% (p=0.09) for sites with yields below 2000 kg ha-1 (W1, W2, P, II, and J1). The yield difference was 12% in favor of the transgenic event. For higher yield categories, no significant differences were found between the event and the control, demonstrating that there is no penalty under medium yield potential conditions (2000-3000 kg ha-1) (I2, G1, G2, J2, and K) or high yield potential conditions (>3000 kg ha-1) (D2, C, Q2, L, A, and F) (Table 5). These results confirmed the presence of genotype-by-environment interaction (p~0.02) expected due to the different combination of abiotic stresses specific to each site or environment and demonstrated that susceptibility to these factors in the transgenic event is specifically associated with characteristics related to the mode of action of the gene The observed performance of the IND-00410-5 event and its control was analyzed at individual sites, as specific environmental conditions play a significant role in the expression of the phenotype associated with the introduced gene. The efficacy of the introduced gene was evaluated over three growing seasons at different locations and planting dates, with a total of 16 sites assessed. Of the 16 sites, 12 correspond to the 2012-2013 growing season, in which all agronomic parameters were measured for the transgenic event, the control, and the reference varieties. In that season, yields in the North and South core zones were higher than in previous seasons, and isolated plots even achieved historically unprecedented yields (Bolsa de Cereales, 2013). The remaining four sites correspond to trials conducted in previous seasons where the objective was to determine the efficacy of the transgenic event compared to the control. These four trials are located in Hughes, Santa Fe (Site L, 2011-2012), Quimilí, Santiago del Estero (2009-2010, Site K), and Líborio Luna, San Luis (2009-2010), under two water conditions: low availability (J1) and high availability. IF-2019-1026218 85 -APN-ANP#INPI Page 66 of 67 (J2). Data were analyzed using an analysis of variance with sites and genotypes as factors, and the significance of the genotype-by-environment interaction was assessed. Post-hoc comparisons were performed using a least significant difference (LSD) test. The results confirmed the presence of genotype-by-environment interaction (p=0.02) for the evaluated sites. Of the 16 sites, the transgenic event had a superior yield in eleven of them, with an average difference of 11% for the sites with positive differences (Figure 13). The response of the introduced gene in terms of yield was also evaluated at sites grouped by yield categories compared to the control. Grouping sites with similar yield ranges allows for the evaluation of the event's response under conditions with different yield potential. With the transgenic event, a higher yield than the control was obtained with a significance level of 10% (p~0.09) for sites with yields below 2000 kg ha-1 (W1, W2, P, II, and J1). The yield difference was 12% in favor of the transgenic event. For higher yield categories, no significant differences were found between the event and the control, demonstrating that there is no penalty under medium (2000-3000 kg ha-1) (I2, G1, G2, J2, and K) or high yield potential (>3000 kg ha-1) (D2, C, Q2, L, A, and F) conditions (Table 5). Environments Media (EE) Sites IND-00410-5 1 Williams 82 Low potential 19IJÜ.4 (86.6) J 699.1 (βθ) * Wl, W2, P, [ 1, .11 Medium [ potential 2646 (104.2 ) 2649.3 (82.5) NS Gl. G2, i2, J2. KI Ai to potential 4209.6 (131) 4117.4 (123.8) NS C, D2, Q2, A, F, L *: indicates significant differences (a= 0.1) NS: not significant differences labia 5, Average yields for» the transgenic event and the control for low, medium and high yield potential environments. LIST OF SEQUENCES IF-2019-1026218 85 -APN-ANP#INPI Page 67 of 67 Argentine Republic - National Executive Branch 2019 - Year of Exports Additional Signature Sheet Graphic Report Number: IF-2019-1026218 85 -APN-ANP#INPI CITY OF BUENOS AIRES Friday, November 15, 2019 Reference: 20190102884 The document was imported by the GEDO system with a total of 67 page(s). Digitally signed by GESTION DOCUMENTAL ELECTRONICA- GDE Date: 2019.11.15 22:35:11 -03:00 Mariela Flavia Gonnet Administrative Advisor National Patent Administration National Institute of Industrial Property Digitally signed by DOCUMENTAL MANAGEMENT ELECTRONICS-GDE Date: 2019.11.15 22:35:12-03:00

Claims

1. An isolated recombinant DNA molecule characteristic of the soybean transgenic event IND-ØØ41Ø-5 deposited under accession number ATCC PTA-125535, characterized in that it comprises the sequence SEQ ID NO:

1. Claim 1 follows