MONO- OR DI-SUBSTITUTED INDOLE DERIVATIVES AS INHIBITORS OF DENGUE VIRAL REPLICATION

AR120158B2Active Publication Date: 2026-08-28JANSSEN PHARMACEUTICALS INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
ARP20200102756
Authority / Receiving Office
AR · AR
Patent Type
Patents
Current Assignee / Owner
Priority Date
2016-03-31
Filing Date
2020-10-05
Publication Date
2026-08-28
Estimated Expiration
2036-05-03

AI Technical Summary

Technical Problem

Current methods for preventing and treating dengue viral infections, such as mosquito eradication and vaccines, are limited in efficacy, especially against multiple serotypes, and there are no specific antiviral drugs available, necessitating the development of broad-spectrum antiviral compounds with good pharmacokinetic properties.

Method used

Development of mono- or disubstituted indole derivatives with potent antiviral activity against all four serotypes of the Dengue virus, demonstrating improved chiral stability and pharmacokinetic profiles, which can be administered in pharmaceutical compositions for prevention and treatment.

Benefits of technology

The indole derivatives effectively inhibit Dengue virus replication, providing a broad-spectrum antiviral solution with low toxicity and improved stability, suitable for use in humans and animals, including those previously unexposed to flaviviruses.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

This document relates to mono- or disubstituted indole compounds, to methods for preventing or treating dengue viral infections using these compounds, and also to these compounds for use as a medicament, more preferably for use as a medicine for treating or preventing dengue viral infections. This document further relates to pharmaceutical compositions or combination preparations of the compounds, to compositions or preparations for use as a medicament, more preferably for the prevention or treatment of dengue viral infections. This document also relates to processes for preparing the compounds.
Need to check novelty before this filing date? Find Prior Art

Description

MONO- OR DISUBSTITUTED INDOLE DERIVATIVES AS INHIBITORS OF DENGUE VIRAL REPLICATION The present invention relates to mono- or disubstituted indole compounds, to methods for preventing or treating dengue viral infections using these compounds, and also to these compounds for use as a medicament, more preferably for use as a medicine for treating or preventing dengue viral infections. The present invention further relates to pharmaceutical compositions or combination preparations of the compounds, to compositions or preparations for use as a medicament, more preferably for the prevention or treatment of dengue viral infections. The invention also relates to processes for preparing the compounds. BACKGROUND OF THE INVENTION Flaviviruses, which are transmitted by mosquitoes or ticks, cause life-threatening infections in humans, such as encephalitis and hemorrhagic fever. Four distinct but closely related serotypes of the dengue flavivirus are known: DENV-1, -2, -3, and -4. Dengue is endemic in most tropical and subtropical regions worldwide, predominantly in urban and semi-urban areas. According to the World Health Organization (WHO), 2.5 billion people, of whom 1 billion are children, are at risk of DENV infection (WHO, 2002). An estimated 50 to 100 million cases of dengue fever (DF) occur, with half a million cases of severe dengue disease (i.e., dengue hemorrhagic fever [DHF] and 235211 1,125,993 of 97 dengue shock syndrome (DSS), and more than 20,000 deaths occur worldwide each year. DHF has become a leading cause of hospitalization and death among children in endemic regions. For all these reasons, dengue is the most common cause of death from arboviral disease. Due to large recent outbreaks in countries located in Latin America, Southeast Asia, and the Western Pacific (including Brazil, Puerto Rico, Venezuela, Cambodia, Indonesia, Vietnam, and Thailand), the number of dengue cases has increased dramatically in recent years. Not only is the number of dengue cases increasing as the disease spreads to new areas, but the outbreaks themselves tend to be more severe. To prevent and / or control dengue-associated disease, the only methods currently available are mosquito eradication strategies to control the vector. Although progress is being made in the development of dengue vaccines, many difficulties have been encountered. These include the existence of a phenomenon called antibody-dependent enhancement (ADE). Recovery from infection with one serotype provides lifelong immunity against that serotype but only confers partial and transient protection against subsequent infection with one of the other three serotypes. After infection with another serotype, pre-existing heterologous antibodies form complexes with the newly infecting dengue virus serotype but do not neutralize the pathogen.Instead, it is believed to facilitate the virus's entry into cells, resulting in uncontrolled viral replication and higher titer peaks. 235211 1,125,993 of 97 viral antibodies. In both primary and secondary infections, higher viral titers are associated with more severe dengue disease. Since maternal antibodies can be easily transmitted to infants through breastfeeding, this may be one reason why children are more severely affected by dengue than adults. In areas where two or more serotypes circulate simultaneously, also known as hyperendemic regions, the risk of severe dengue disease is significantly higher due to an increased risk of experiencing a secondary, even more severe, infection. Furthermore, in a hyperendemic situation, the likelihood of the emergence of more virulent strains increases, which in turn raises the probability of dengue hemorrhagic fever (DHF) or dengue shock syndrome. Mosquitoes, including Aedes aegypti and Aedes albopictus (tiger mosquito), are migrating into the Northern Hemisphere. According to the U.S. Centers for Disease Control and Prevention (CDC), both mosquitoes are currently ubiquitous in South Texas. The northward spread of dengue-carrying mosquitoes is not confined to the U.S.; it has also been observed in Europe. Recently (December 2015), the dengue vaccine produced by Sanofi Pasteur was approved for the first time in Mexico. The vaccine has also been approved in Brazil, the Philippines, and El Salvador. Regulatory review processes are ongoing in other countries where dengue is a public health priority. However, the vaccine leaves considerable room for improvement due to the 235211 1125993 of 97 limited efficacy, especially against DENV-1 and -2, low efficacy in subjects not previously treated for flavivirus and the prolonged dosing regimen. Despite these limitations, the vaccine is a game-changer in endemic areas because it will offer protection to a large part of the population, but probably not to very young infants, who carry the greatest dengue viral load. Furthermore, the dosage schedule and very limited efficacy in individuals not previously treated for the flavivirus make it unsuitable and likely useless / uneconomical for travelers from non-endemic to dengue-endemic areas. The aforementioned limitations of dengue vaccines are the reason why there is a need for a pre-exposure prophylactic dengue antiviral. Furthermore, as of today, there are no specific antiviral drugs available for the treatment or prevention of dengue fever virus infection. Clearly, there remains a significant unmet medical need for therapeutic products for the prevention or treatment of viral infections in animals, particularly in humans, and especially viral infections caused by Flaviviruses, most notably the dengue virus. Compounds with good antiviral potency, minimal or no side effects, broad-spectrum activity against multiple dengue virus serotypes, low toxicity, and / or good pharmacokinetic or pharmacodynamic properties are urgently needed. Now, the present invention provides compounds, mono- or disubstituted indole derivatives, that exhibit a 235211 1125993 of 97 very potent activity against the four (4) serotypes of the Dengue virus. Also, the compounds according to the invention possess a good pharmacokinetic profile and surprisingly these specific compounds show improved chiral stability. SUMMARY OF THE INVENTION The present invention is based on the unexpected finding that at least one of the problems mentioned above can be solved by the current compounds of the invention. The present invention provides compounds that have been observed to possess potent antiviral activity against the four (4) currently known serotypes. The present invention further demonstrates that these compounds effectively inhibit the proliferation of the Dengue virus (DENV). Therefore, these compounds constitute a useful class of potent compounds that can be used in the treatment and / or prevention of viral infections in animals, mammals, and humans, more specifically for the treatment and / or prevention of Dengue virus infection. The present invention further relates to the use of such compounds as medicaments and their use in the manufacture of medicaments for treating and / or preventing viral infections, particularly with viruses belonging to the Dengue virus family in animals or mammals, more particularly in humans. The present invention also relates to methods for preparing all these compounds and pharmaceutical compositions comprising them in an effective amount. The present invention also relates to a method 235211 1125993 of 97 for the treatment or prevention of dengue viral infections in humans by administering an effective amount of one or more of such compounds, or a pharmaceutically acceptable salt thereof, optionally in combination with one or more other drugs, such as another antiviral agent or dengue vaccine, or both, to a patient in need. One aspect of the invention is the provision of compounds of formula (I) a pharmaceutically acceptable stereoisomeric form, salt, solvate or polymorph thereof comprising a mono- or disubstituted indole group; said compound is selected from the group wherein: R1 is H, R2 is F and R3 is H or CH3, R1 is H, CH3 or F, R2 is OCH3 and R3 is H, R1 is H, R2 is OCH3 and R3 is CH3, R1 is CH3, R2 is F and R3 is H, R1 is CF3 or OCF3, R2 is H and R3 is H, R1 is OCF3, R2 is OCH3 and R3 is H and R1 is OCF3, R2 is H and R3 is CH3. In particular, the compounds of the invention or their stereoisomeric form, a pharmaceutically acceptable salt, solvate or polymorph thereof are selected 235211 1125993 out of 97 among the group: 235211 1125993 of 97 Cl Another aspect of the invention is the use of a compound represented by the following (I) structural formula a pharmaceutically acceptable solvate or polymorph thereof comprising a mono- or disubstituted indole group; said compound is selected from the group wherein: R1 is H, R2 is F and R3 is H or CH3, R1 is H, CH3 or F, R2 is OCH3 and R3 is H and R1 is H, R2 is OCH3 and R3 is CH3, R1 is CH3, R2 is F and R3 is H, R1 is CF3 or OCF3, R2 is H and R3 is H, R1 is OCF3, R2 is OCH3 and R3 is Hy R1 is OCF3, R2 is H and R3 is CH3 to inhibit the replication of the dengue virus in a biological sample or patient. Also forming part of the present invention is a pharmaceutical composition comprising a compound of 235211 1125993 of 97 formula (I) or an isomeric form, or one of its pharmaceutically acceptable salts, solvates or polymorphs, together with one or more pharmaceutically acceptable excipients, diluents or carriers. Pharmaceutically acceptable salts of compounds of formula (I) include their acid and base addition salts. Suitable acid addition salts are formed from acids that form non-toxic salts. Suitable base addition salts are formed from bases that form non-toxic salts. The compounds of the invention can also exist in solvated and non-solvated forms. The term solvate is used herein to describe a molecular complex comprising the compound of the invention and one or more pharmaceutically acceptable solvent molecules, for example, ethanol. The term polymorph refers to the ability of the compound of the invention to exist in more than one crystalline form or structure. The compounds of the present invention can be administered as amorphous or crystalline products. They can be obtained, for example, as solid compact masses, powders, or films by methods such as precipitation, crystallization, freeze-drying, spray drying, or evaporation drying. They can be administered alone or in combination with one or more different compounds of the invention or in combination with one or more different drugs. In general, they will be administered as a formulation associated with one or more pharmaceutically acceptable excipients. The term excipient is used herein to describe any ingredient other than the active ingredient(s). 235211 1125993 of 97 compounds of the invention. The selection of the excipient depends largely on factors such as the particular route of administration, the effect of the excipient on solubility and stability, and the nature of the pharmaceutical form. The compounds of the present invention, or any subgroup thereof, can be formulated in various pharmaceutical forms for administration. Suitable compositions include all compositions commonly used for systemic drug administration. To prepare the pharmaceutical compositions of this invention, an effective amount of the particular compound, optionally in the form of an addition salt, as the active ingredient, is intimately mixed with a pharmaceutically acceptable carrier. This carrier may take a variety of forms depending on the desired form of the preparation for administration. These pharmaceutical compositions are desirably in a suitable unit-dose form, for example, for oral or rectal administration.For example, in preparing oral dosage forms, any of the usual pharmaceutical carriers can be used, such as water, glycols, oils, alcohols, and the like in the case of liquid oral preparations such as suspensions, syrups, elixirs, emulsions, and solutions; or solid carriers such as starches, sugars, kaolin, diluents, lubricants, binders, disintegrating agents, and the like in the case of powders, lozenges, capsules, and tablets. Due to their ease of administration, tablets and capsules are the preferred dosage forms. 235211 1125993 of the 97 most convenient oral unit pharmaceuticals, in which case solid pharmaceutical carriers are obviously used. Also included are solid preparations that can be converted into liquid forms shortly before use. It is particularly convenient to formulate the aforementioned pharmaceutical compositions in unit dosage forms due to the uniformity of the dose and ease of administration. The term unit dosage form, as used herein, refers to physically discrete units suitable as unit doses, where each unit contains a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect, associated with the required pharmaceutical carrier. Examples of such unit dosage forms include tablets (including scored or coated tablets), capsules, lozenges, powder sachets, wafers, suppositories, injectable suspensions or solutions, and similar products, as well as segregated multiples thereof. Experts in the treatment of infectious diseases will be able to determine the effective amount from the test results presented later herein. Generally, an effective daily amount is considered to be 0.01 mg / kg to 50 mg / kg of body weight, more preferably 0.1 mg / kg to 10 mg / kg of body weight. It may be appropriate to administer the required dose as two, three, four, or more subdoses at suitable intervals throughout the day. Such subdoses may be formulated as pharmaceutical forms. 235211 1125993 of 97 units, for example, containing from 1 to 1000 mg and, in particular, from 5 to 200 mg of active ingredient per unit pharmaceutical form. The exact dosage and frequency of administration depend on the particular compound of formula (I) used, the specific condition being treated, the severity of the condition being treated, the age, weight, and general physical condition of the individual patient, as well as any other medications the individual may be taking, as those skilled in the art will know. Furthermore, it is obvious that the effective amount may be reduced or increased depending on the response of the treated subject and / or depending on the assessment of the physician prescribing the compounds of the present invention. Therefore, the ranges of effective amounts mentioned above are merely indicative and are not intended to limit the scope or use of the invention in any way. This disclosure is also intended to include any isotopes of the atoms present in the compounds of the present invention. For example, hydrogen isotopes include tritium and deuterium, and carbon isotopes include C-13 and C-14. The compounds used in the present invention may also exist in their stereochemically isomeric forms, which define all possible compounds made of the same atoms linked by the same sequence of bonds but having different, non-interchangeable three-dimensional structures. Unless otherwise stated or indicated, the chemical designation of compounds encompasses the 235211 1125993 of 97 mixture of all possible stereochemically isomeric forms that such compounds may possess. This mixture may contain all diastereomers and / or enantiomers of the basic molecular structure of said compound. It is intended that all stereochemically isomeric forms of the compounds used in the present invention, both in pure form and in mixtures with others, are encompassed within the scope of the present invention, including any racemic mixtures or racemates. The pure stereoisomeric forms of the compounds and intermediates mentioned herein are defined as isomers substantially free from other enantiomeric or diastereomeric forms of the same basic molecular structure of said compounds or intermediates. In particular, the expression stereoisomerically pure refers to compounds or intermediates that have a stereoisomeric excess of at least 80% (i.e., a minimum of 90% of one isomer and a maximum of 10% of the other possible isomers) and up to a stereoisomeric excess of 100% (i.e., 100% of one isomer and none of the others), more specifically, compounds or intermediates that have a stereoisomeric excess from 90% to 100%, even more specifically that have a stereoisomeric excess from 94% to 100%, and even more specifically that have a stereoisomeric excess from 97% to 100%.The expressions enantiomerically pure and diastereomerically pure should be interpreted in a similar way, but referring to the enantiomeric excess and the diastereomeric excess of the mixture in question. 235211 1125993 of 97 respectively. Pure stereoisomeric forms of the compounds and intermediates used in this invention can be obtained by applying known processes in the art. For example, enantiomers can be separated from each other by selective crystallization of their diastereomeric salts with optically active acids or bases. Examples of these include tartaric acid, dibenzoyltartaric acid, ditoluoyltartaric acid, and camphorsulfonic acid. Alternatively, enantiomers can be separated by chromatographic techniques using chiral stationary phases. Such pure stereochemically isomeric forms can also be obtained from the corresponding pure stereochemically isomeric forms of suitable starting materials, provided the reaction is stereospecific. Preferably, if a specific stereoisomer is desired, that compound is synthesized using stereospecific preparation methods.In these methods, enantiomerically pure starting materials will be conveniently used. General synthetic approaches The synthesis of compounds of general formula I can be carried out as shown in Scheme 1. 2-(4-chloro-2-methoxyphenyl)acetic acid (II) can be converted to the corresponding 2-(4-chloro-2-methoxyphenyl)acetyl chloride (III) with a chlorinating reagent such as, for example, thionyl chloride. The Friedel-Crafts reaction of acid chloride III with a substituted indole of general formula IV can be carried out using an acid reagent of 235211 1125993 of 97 Lewis reagents such as Et2AlCl or T1Cl4, in a suitable solvent such as CH2Cl2 or 1,2-dichloroethane, and under suitable reaction conditions typically (but not exclusively) involving refrigeration, to provide the 3-acylated indole of general formula V. The introduction of an aniline moiety in the alpha position relative to the carbonyl moiety of the compounds of formula V can be completed by a reaction sequence involving, for example, bromination of V with a reagent such as, for example, phenyltrimethylammonium tribromide in a suitable solvent such as THF, to provide the compounds of general formula VI, and further reaction of the compounds of general formula VI with 3-methoxy-5-(methylsulfonyl)aniline (VII) in a suitable solvent such as CH3CN, and using typically a base such as TEA or DIPEA, to provide the compounds of general formula I in the form of racemic mixtures.The chiral separation of compounds of general formula I can be carried out 20 by, for example, chiral chromatography to provide the A and B Enantiomers of general formula I. 235211 1125993 of 97 Cl Enantiomers 1(A) and 1(B) Scheme 1 In some cases, the synthesis of the intermediate of general formula V by the Friedel-Crafts synthesis approach benefits from the presence of a protecting group (PG) on the indole-N during the Friedel-Crafts reaction step, as shown in Scheme 2. To this end, the substituted indole of general formula IV can first be converted into an N-protected intermediate of general formula VIII, such as, for example, an N-tosylated intermediate of general formula VIII (PG = Ts), using a reagent such as, for example, tosyl chloride, in the presence of a base such as, for example, sodium hydride. The Friedel-Crafts reaction of substituted indole of general formula IV with acid chloride III can be carried out using a Lewis acid reagent such as, for example, EthAlCl or TiCl4 in a suitable solvent such as, for example, CH2Cl2 or 1,2-dichloroethane, and under suitable reaction conditions that typically (but not exclusively) involve 16 235211 1125993 of 97 refrigeration, to provide the N-protected 3-acylated indole of general formula IX. The removal of the N-protecting group of indole PG from the intermediate of general formula IX can be completed with a reagent such as, for example, LiOH (for PG = Ts) in a solvent mixture such as, for example, THF / water and at a suitable reaction temperature, to provide the 3-acylated indole of general formula V. Scheme 2 As an alternative approach, the intermediate of general formula V can also be prepared as shown in Scheme 3: The N-Boc-protected substituted indole-3-carbaldehyde of general formula X can be converted to the corresponding Strecker intermediate type of general formula XI by reaction with morpholine in the presence of reagents such as, for example, sodium cyanide and potassium bisulfite and in a suitable solvent such as, for example, a mixture of water and a water-miscible organic solvent such as, for example, dioxane. Alkylation of the compound of general formula XI with 4-chloro-2-methoxybenzyl chloride can be achieved in the presence of a base such as, for example, potassium hexamethyldisilazane and in a suitable solvent such as, for example, DMF to give the compound of general formula XII.Subjecting the compound of general formula XII to an aqueous acidic hydrolytic condition, such as by treatment with an aqueous solution of hydrochloric acid at elevated temperature, yields 17 235211. 1125993 of 97 intermediate of general formula V. ci Scheme 3 Examples LC-MS methods High-performance liquid chromatography (HPLC) measurements were performed using an LC pump, a diode beam detector (DAD), or a UV detector and column, as specified in the respective methods. Additional detectors were included where necessary (refer to the methods table below). The flux from the column was fed into a mass spectrometer (MS) configured with an ion source at atmospheric pressure. A technician skilled in the technique was able to set the adjustable parameters (e.g., scan interval, residence time, etc.) to obtain ions that would allow for the identification of the nominal monoisotopic molecular weight (MW) of the compound. Data acquisition was performed using appropriate software. Compounds are described according to their ions and times 235211 1125993 of 97 experimental retention (tn). Unless otherwise specified in the data table, the molecular ion described corresponds to [M+H]+ (protonated molecule) and / or [MH] (deprotonated molecule). If the compound cannot be ionized directly, the type of adduct is specified (i.e., [M+NH4]+, [M+HCOO]-, etc.). For molecules with multiple isotopic standards (Br, Cl), the value shown is that obtained for the lowest isotope mass. All results were obtained with the experimental uncertainties typically associated with the method used. Hereinafter in this document, SQD means single quadrupole detector, MSD means mass selective detector, TA means room temperature, BEH means hybrid with ethylsiloxane / silica bridge 15, DAD means diode beam detector, and HSS means high-strength silica. LCMS method codes (Flow rate expressed in mL / min; column temperature (T) in °C; analysis time in minutes) Method Code Instrument Column Mobile Phase Gradient Flow T col Analysis Time (min) LC-A Waters: Acquity® UPLC® -DAD- SQD Waters: BEH C18 (1.7 pm, 2.1x50 mm) A: CH3COONH4 10 mM in 95% H2O + 5% CH3CN B: CH3CN From 95% A to 5% A in 1.3 min, held for 0.7 min 0.8 mL / min 55°C 2 235211 1125993 of 97 LC-B Waters: Acquity® UPLC® -DAD- SQD Waters: HSS T3 (1.8pm, 2.1x100 mm) A: CH3COONH4 10 mM in 95% H2O + 5% CH3CN B: CH3CN From 100% A to 5% A in 2.10 min, to 0% A in 0.90 min, to 5% A in 0.5 min 0.7 mL / min 55°C 3.5 LC-C Waters: Acquity® UPLC® - DAD-Quattro Micro™ Waters: BEH C18 (1.7pm, 2.1x100mm) A: 95% CH3COONH4 7 mM / 5% CH3CN, B: CH3CN 84.2% A for 0.49 min, a 10.5% A in 2.18 min, held for 1.94 min, back to 84.2% A in 0.73 min, held for 0.73 min 0.343 mL / min 40°C 6.2 LC-D Waters: Detector Acquity® UPLC® - DAD- Acquity® TQ Waters: BEH C18 (1.7 pm, 2.1x50 mm ) A: 10 mM CH3COONH4 (adjusted to pH 10) B: CH3CN From 50% A to 10% A in 3.5 min, held for 1.5 min 0.5 mL / min 40°C 5 SFC-MS Methods 235211 1125993 of 97 SFC measurement was performed using a supercritical fluid chromatography (SFC) system consisting of a binary pump for releasing carbon dioxide (CO2) and a modifier, an autosampler, a column oven, and a diode array detector equipped with a high-pressure flow cell maintained at 400 bar. When configured with a mass spectrometer (MS), the flow from the column is directed to the MS. A technician skilled in the technique will be able to set the adjustable parameters (e.g., scan interval, residence time, etc.) to obtain ions that allow for the identification of the nominal monoisotopic molecular weight (MW) of the compound. Data acquisition was performed using appropriate software. Analytical SFC-MS methods (Flow expressed in mL / min; column temperature (T) in °C; Analysis time in minutes, Back pressure (BPR) in bar. Method Code Column Mobile Phase Gradient Flow Rate T column Analysis Time — BPR SFC-A WHELK-O1 (S,S) 5 pm 250 x 4.6 mm Regis A: CO2 B: MeOH 50% of B held 7 min, 3 7 35 100 SFC-B Daicel Chiralpak® IC-H column (5 μm, 150 x 4.6 mm) A: CO2 B: MeOH 40% of B held 7 min, 3 7 35 100 SFC-C WHELK-O1 (S,S) 5 pm 250 x 4.6 mm Regis A: CO2 B: MeOH 60% of B held 9 min, 3 9 35 100 235211 1125993 of 97 Method Code Column Mobile Phase Gradient Flow Rate T column Analysis Time — BPR SFC-D Daicel Chiralpak® IA-H column (5 pm, 250 x 4.6 mm) A: CO2 B: MeOH 50% B held 7 min, 3 7 35 100 SFC-E Daicel Chiralpak® AS3 column (3.0 pm, 150 x 4.6 mm) A: CO2 B: EtOH +0.2% iPrNH2 +3% H2O 10%-50% B in 6 min, held 3.5 min 2.5 9.5 40 110 SFC-F Daicel Chiralpak® AD-H column (5.0 pm, 150 x 4.6 mm) A: CO2 B: iPrOH +0.3% iPrNH2 30% B held 7 min 3 7 35 100 Melting points The values ​​are peak values ​​or values ​​in melting ranges, and are obtained with experimental uncertainties that are commonly associated with this analytical method. DSC823e (referred to as DSC) For several compounds, melting points were determined using a DSC823e (Mettler-Toledo). Melting points were measured with a temperature gradient of 10 °C / minute. The maximum temperature was 300 °C. Optical rotations: Optical rotations were measured on a Perkin-Elmer 341 polarimeter with a sodium lamp and are presented as follows: [α]° (λ, cg / 100 mL, solvent, T °C). [α]λτ= (100α) / (lxc) : where l is the path length dm and c is the concentration in g / 100 ml for a 235211 Equation 1125993 of 97 shows a temperature T (°C) and a wavelength λ (in nm). If the wavelength of the light used is 589 nm (the sodium D line), then the symbol D could be used instead. The rotation sign (+ or -) should always be provided. When using this equation, the concentration and solvent are always given in parentheses after the rotation. The rotation is indicated using degrees, and concentration units are not given (they are assumed to be g / 100 mL). Example 1: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6fluoro-lB-indol-3-yl)-2-((3-methoxy-5(methylsulfonyl)phenyl)amino)ethanone (Compound 1) and chiral separation into Enantiomers 1A and IB. Chiral separation ----------------» Enantiomers 1A and 1B Summary of the intermission: 2-(4-chloro-2-methoxyphenyl)acetic acid was added [CAS 170737-95-8] (5.8 g, 28.9 mmol) in small portions to thionyl chloride (50 mL) and the resulting solution was stirred overnight at 60°C. The solvent was concentrated under reduced pressure and co-evaporated with toluene to give 2-(4-chloro-2-methoxyphenyl)acetyl chloride (6.5 g) in the form of an oily residue that was used without further purification in the next step. 235211 1125993 of 97 Summary of Intermediate 1b: Diethylaluminum chloride 1 M in hexane (37.1 mL, 37.1 mmol) was added dropwise at 0°C to a solution of 6fluoro-1 H-indole [CAS 399-51-9] (3.34 g, 24.76 mmol) in CH2Cl2 (100 mL). After 30 min at 0°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (6.3 g, 28.76 mmol) was slowly added to CH2Cl2 (100 mL) at 0°C. The reaction was stirred at 0°C for 3 h. Ice-cooled water was added, and the precipitate was removed by filtration, washed with water and a small amount of CH2Cl2. The solids were dried under vacuum at 70°C overnight to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1-hyndol-3-yl)ethanone 1b (4.9 g). Summary of intermediate 1c: At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (5.8 g, 15.4 mmol) in THF (65 mL) was added dropwise to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone1b (4.9 g, 15.4 mmol) in THF (60 mL). The mixture was stirred at 0°C for 1 h and at room temperature for 2.5 h. The precipitate was removed by filtration and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was collected with EtOAc and washed with water. A precipitate appeared in the organic layer and was removed by filtration and dried to provide a first batch of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1c (4.6 g). The organic phase was separated, dried over MgSO4, filtered, and the solvent evaporated under reduced pressure. The residue was crystallized on EtOAc, the precipitate was removed by filtration, washed with Et2O, and dried under vacuum to provide a second fraction of 224 235211 1125993 97 bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3yl)ethanone 1c (1.6 g). Synthesis of Compound 1 and chiral separation of Enantiomers 1A and 1B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3-yl)ethanone 1c (3 g, 7.56 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.28 g, 11.35 mmol), and diisopropylethylamine (1.95 mL, 11.35 mmol) in CH3CN (60 mL) and THF (30 mL) was stirred at 70°C for 24 h. The reaction was diluted with EtOAc. The organic phase was washed with 1 N HCl (twice) and water, dried over MgSO4, filtered, and the solvent was concentrated under reduced pressure. The residue was purified by flash chromatography on silica gel (15-40 gm, 80 g, Mobile phase: 99.5 / 0.5 of CH2Cl2 / MeOH). A second purification was carried out by ultrafast chromatography on silica gel (15-40 g, 80 g, Mobile phase: 99.7 / 0.3 of CH2Cl2 / MeOH). The pure fractions were combined and concentrated under reduced pressure to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-1H-indol-3yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 1, 2 g) in the form of a racemic mixture. The enantiomers of Compound 1 were separated by chiral SFC (Stationary phase: Chiralpak® AD-H 5 gm 20 x 250 mm, Mobile phase: 50% CO2, 50% MeOH), yielding 740 mg of the first eluted enantiomer and 720 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized in CH3CN / Et2O. The precipitate was removed by filtration and dried to give Enantiomer 1A (645 mg). The second eluted enantiomer was crystallized in CH3CN / Et2O. The precipitate was removed by filtration and dried to give Enantiomer 1B (632 mg). 235211 1125993 of 97 Compuesto 1: 1H RMN (500 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72 (s, H) 4.00 (s, 3 H) 6.24 (d, J=7.9 Hz, 1 H) 6.58 (s, 2 H) 6.91 (s, 1 H) 6.97 (dd, J=8.7, 1.9 Hz, 1 H) 7.02 - 7.09 (m, H) 7.12 (d, J=1.9 Hz, 1 H) 7.27 (dd, J=9.5, 1.9 Hz, 1 H) 7.35 (d, J=8.5 Hz, 1 H) 8.14 (dd, J=8.7, 5.5 Hz, 1 H) 8.44 (s, 1 H) 12.10 (s a, 1 H) LC / MS (método LC-C): TR 3.08 min, MH+517 Punto de fusión: 174°C Enantiómero 1A: 1H RMN (500 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72(s, H) 4.00 (s, 3 H) 6.24 (d, J=7.9 Hz, 1 H) 6.59 (s,2 H) 6.91 (s, 1 H) 6.97 (dd, J=8.8, 2.2 Hz, 1 H) 7.02 - 7.10 (m, H) 7.12 (d, J=2.2 Hz, 1 H) 7.27 (dd, J=9.6, 2.2 Hz, 1 H) 7.35 (d, J=8.2 Hz, 1 H) 8.14 (dd, J=8.8, 5.7 Hz, 1 H) 8.44 (s, 1 H) 12.10 (s a, 1 H) LC / MS (método LC-C): TR 3.09 min, MH+517 [«]d20: +130.3° (c 0.277, DMF) Chiral SFC (SFC-D method): TR 3.41 min, MH+517, chiral purity100%. Melting point:220°C Enantiomer 1B: 1H NMR (400 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72(s, H) 4.00 (s, 3 H) 6.24 (d, J=7.6 Hz, 1 H) 6.53 - 6.65(m, H) 6.91 (s, 1 H) 6.97 (dd, J=8.6, 2.0 Hz, 1 H) 7.01 7.09 (m, 2 H) 7.12 (d, J=2.0 Hz, 1 H) 7.27 (dd, J=9.6, 2.0 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.14 (dd, J=8.6, 5.6 Hz, 1 H) 8.43 (s, 1 H) 12.09 (sa, 1 H) LC / MS (LC-C method): TR 3.09 min, MH+517 [«]d20: -135.3° (c 0.283, DMF) Chiral SFC (SFC-D method): TR 4.89 min, MH+517, 235211 1125993 of 97 with chiral purity 99.35%. Melting point: 218°C Example 1.1: Chiral Stability of Enantiomer 1A at pH 7.4 The chiral stability of Enantiomer 1A (R = OMe) was evaluated by determining the enantiomeric excess (%ee) after incubation for 24 and 48 h in a buffered solution at pH 7.4 at 40°C and 60°C. To ensure the influence of the methoxy substituent of Enantiomer 1A (R = OMe) on stability against racemization, the chiral stability of Enantiomer 1I (R = H) was tested under the same conditions. To this end, 5 μM buffered solutions (pH = 7.4) of 1A and l'A were prepared by mixing 25 pL of a 100 μM solution of 1A or l'A in DMSO with 475 μE of aqueous buffer at pH 7.4. Samples were collected 24 and 48 h after incubation at 40 °C and 60 °C. Analytical samples were analyzed by chiral SEO (MS detection), and chiral purity was expressed as enantiomeric excess (%ee = %enantiomer A - %enantiomer B). Both enantiomers 1A and l'A had 100% chiral purity before incubation. 1A (R = OMe) TA (R = H) Compound Temperature %ee 235211 1125993 of 97 Temporary moments of the mastership (h) 48 40°C 100 100 1A 60°C 95 88 40°C 21 10 l'A 60°C 0 0 Example 2: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 2) and chiral separation into Enantiomers 2A and 2B. Summary of Intermediate 2a: One M dimethylaluminum chloride in hexane (20 mL, 20.0 mmol) was added dropwise at 0°C to a solution of 6-fluoro-7-methyl-1H-indole [CAS 57817-10-4] (1.50 g, 10.1 mmol) in CH2Cl2 (45 mL). After 30 min at 0°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride (3.30 g, 15.1 mmol) was slowly added; synthesis: see 235211 1125993 of 97 Example 1) in dichloromethane (30 mL). The reaction mixture was stirred at 0°C for 3 h. A 1 M Rochelle salt solution (50 mL) was added, and the reaction mixture was stirred at room temperature for 1 h. The solids were removed by filtration and partitioned between EtOAc and 1 N HCl. The phases were separated. The aqueous phase was extracted with EtOAc. The organic phases were combined, washed with brine, dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was ground with EtOAc and heptane. The precipitate was removed by filtration to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1-hyndol-3-yl)ethanone 2a (2.00 g). Summary of intermediate 2b: A solution of phenyltrimethylammonium tribromide [CAS [4207-56-1] (2.49 g, 6.6 mmol) in THF (45 mL) was added dropwise at 0°C to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2a (2.00 g, 6.0 mmol) in THF (65 mL). The mixture was stirred at room temperature overnight. The precipitate was removed by filtration and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was collected with a minimal amount of acetonitrile. The precipitate was removed by filtration, washed with acetonitrile, and dried under high vacuum to give a first batch of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (1.51 g). The filtrate was concentrated under reduced pressure. The residue was collected with a minimal amount of acetonitrile. The precipitate was removed by filtration, washed with acetonitrile, and dried under high vacuum to give a second fraction of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b 235211 1125993 of 97 (0.70 g). Synthesis of Compound 2 and chiral separation of Enantiomers 2A and 2B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)ethanone 2b (1.8 g, 4.36 mmol) and 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.6 g, 13.0 mmol) in THF (9 mL) and CH3CN (9 mL) was heated to 100 °C by microwave radiation for 50 min. The reaction mixture was diluted with EtOAc and washed with 1 N HCl. The phases were separated. The organic phase was washed with a saturated aqueous solution of NaHCO3 and smuera, dried over MgSO4, filtered, and concentrated under reduced pressure. The residue was collected with a minimal amount of acetonitrile. The precipitate was removed by filtration, washed with acetonitrile and dried under high vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-7-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 2, 1.7 g) in the form of a racemic mixture. The chiral separation of the enantiomers of Compound 2 (1.59 g) was performed by preparative SFC (Stationary phase: (S,S)-Whelk-O1 5 pm 250 x 21.1 mm, Mobile phase: 50% CO2, 50% MeOH). The product fractions were combined and evaporated under reduced pressure. The first eluted enantiomer (746 mg) was further purified by column chromatography on silica gel (15–40 pm, 24 g, Mobile phase: 99.5 / 0.5 CH2Cl2 / MeOH). The fractions were combined and evaporated under reduced pressure (560 mg). The residue was solidified by trituration with a mixture of Et2O and a few drops of CH3CN. The solids were removed by filtration and dried under high vacuum to give Enantiomer 2A (473 mg). The second eluted enantiomer 235211 1125993 of 97 (732 mg) was further purified by column chromatography on silica gel (15–40 μm, 24 g, Mobile phase: 99.5 / 0.5 CH2Cl2 / MeOH). The fractions were combined and evaporated under reduced pressure (550 mg). The residue was solidified by grinding with a mixture of Et2O and a few drops of CH3CN. The solids were removed by filtration and dried under high vacuum to give the 2B enantiomer (457 mg). Compound 2: 1H NMR (300 MHz, DMSO-d6) δ ppm 2.38 (d, J=1.5 Hz, 3 H) 3.10 (s, 3 H) 3.73 (s, 3 H) 4.01 (s, 3 H) 6.27 (d, J=7.9 Hz, 1 H) 6.55 - 6.63 (m, 2 H) 6.93 (m, 1 H) 6.94 - 7.09(m, H) 7.13 (d, J=1.9 Hz, 1 H) 7.35 (d, J=8.3 Hz, 1 H) 7.97 (dd, J=8.7, 5.3 Hz, 1 H) 8.45 (s, 1H) 12.23 (sa, 1 H) LC / MS (LC-D method): TR 1.68 min, MH+531 Enantiomer 2A: 1H NMR (500 MHz, DMSO-d6) δ ppm 2.37 - 2.39 (m,3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.01 (s, 3 H) 6.26 (d,J=7.9 Hz, 1 H) 6.54 - 6.63 (m, 2 H) 6.92 (s, 1 H) 6.97 (dd, J=8.4, 1.9 Hz, 1 H) 7.02 (dd, J=9.9, 9.0 Hz, 1 H) 7.07(d, J=7.9 Hz, 1 H) 7.13 (d, J=1.9 Hz, 1 H) 7.35 (d, J=8.4 Hz, 1 H) 7.96 (dd, J=8.5, 5.4 Hz, 1 H) 8.45 (s, 1 H) 12.24 (s a, H) LC / MS (método LC-C): TR 3.20 min, MH+531 [α]η20: +104.5° (c 0.2545, DMF) SFC quiral (método SFC-A): TR 4.22 min, MH+531, pureza quiral 100%. Enantiómero 2B: 1H RMN (500 MHz, DMSO-d6) δ ppm 2.36 - 2.41 (m,3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.01 (s, 3 H) 6.26 (d,J=7.9 Hz, 1 H) 6.57 - 6.64 (m, 2 H) 6.92 (s, 1 H) 6.97 (dd, 235211 1125993 de 97 J=8.2, 1.9 Hz, 1 H) 6.99 - 7.04 (m, 1 H) 7.07 (d, J=1.9 Hz, 1 H) 7.13 (d, J=1.9 Hz, 1 H) 7.35 (d, J=8.2 Hz, 1 H) 7.96 (dd, J=8.7, 5.2 Hz, 1 H) 8.45 (s, 1 H) 12.24 (s a, 1 H) LC / MS (método LC-C): TR 3.20 min, MH+ 531 [a]D20: -104.1° (c 0.2536, DMF) Chiral SFC (SFC-A method): TR 5.12 min, MH+ 531, chiral purity 99.53%. Example 3: synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6methoxy-lH-indol-3-yl)-2-((3-methoxy-510 (methylsulfonyl)phenyl)amino)ethanone (Compound 3) and chiral separation into Enantiomers 3A and 3B. ci Summary of Intermediate 3a: A solution of NaHSOa (5.7 g, 54.5 mmol) in water (45 mL) was added to a stirring solution of tert-butyl 3-formyl-6-methoxy-1A-indol-1-carboxylate [CAS 84744873-1] (10 g, 36.3 mmol) in dioxane (45 mL). After 15 235211 At 1125993, morpholine (4.8 mL, 54.5 mmol) was added after 97 min, and 35 min later, sodium cyanide (NaCN) (1.96 g, 40 mmol) was added. The resulting suspension was stirred at room temperature for 3 days, until the reaction was complete. The product was removed by filtration and washed with a 1:1 dioxane / water mixture (3 x 35 mL), then with water (3 x 45 mL), and dried under vacuum at 60 °C. The solids were stirred in Et2O (125 mL), were removed by filtration, washed with Et2O (3x) and vacuum dried at 50 °C to provide 3-(cyano(morpholino)methyl)-6-methoxy-1 H-indol-1-carboxylate of tere-butyl 3a (12.3 g). Summary of intermediate 3b: A mixture of 3-(cyano(morpholino)methyl)-6-methoxy-1-hyndol-1-carboxylate 3a (6.0 g, 16.2 mmol) in dry DMF (80 mL) was stirred under an N2 atmosphere while being cooled in an ice bath. A 0.5 M KHMDS solution in toluene (35.5 mL, 17.8 mmol) was added dropwise over 10 min. After stirring for a further 10 min, 4-chloro-1-(chloromethyl)-2-methoxybenzene [CAS 10107984-9] (3.09 g, 16.2 mmol) was added, and the resulting mixture was stirred at room temperature for 20 h. The reaction mixture was poured into cold water (400 mL), and the product was extracted with Et2O (2x). The combined organic phases were washed with brine, dried over MgSO4, filtered, evaporated under reduced pressure, and co-evaporated with xylene. The residue was purified by ultrafast chromatography (Stationary phase: Grace Reveleris® silica) 120 g, Mobile phase: heptane / EtOAc gradient of 100 / 0 to 20 / 80). The desired fractions were combined, evaporated under reduced pressure, and co-evaporated with dioxane to give 3-(2-(4-chloro-2-methoxyphenyl)-1-cyano-133 235211 1125993 of 97 morpholinoethyl)-6-methoxy-1H-indole-1-carboxylate butyl 3b (7.75 g). Third Synthesis of intermediate 3c: A stirred suspension of tert-butyl 3b 3-(2-(4-chloro-2-methoxyphenyl)-1-cyano-1-morpholinoethyl)-6-methoxy-1H-indole-1-carboxylate 3b (7.75 g, 14.7 mmol) in dioxane (40 mL) and water (20 mL) was mixed with a 6 M HCl solution in isopropanol (36.8 mL, 220 mmol). The resulting mixture was stirred at 60 °C for 4 h and then at 80 °C for 1 h. After cooling to room temperature, the mixture was allowed to stand for 20 h to permit crystallization of the reaction product. The product was removed by filtration, washed with a 1 / 1 / 1 mixture of i PrOH / H2O / dioxane (2 x 15 mL) and vacuum dried at °C to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1-Hindol-3-yl)ethanone 3c (3.67 g). Synthesis of Compound 3 and chiral separation of Enantiomers 3A and 3B: A stirred mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1H-indol-3-yl)ethanone 3c (2 g, 6.07 mmol) in THF (80 mL) was cooled in an ice bath under an atmosphere of N2. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.39 g, 6.37 mmol) was added, and the reaction mixture was stirred at 0 °C for 1 h and then at room temperature for 1.5 h. 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (3.66 g, 18.2 mmol) was added, and the solvent was evaporated under reduced pressure. The residue was dissolved in CH3CN (100 mL). Diisopropylethylamine (2.09 mL, 12.1 mmol) was added, and the reaction mixture was heated at 55 °C for 27 h. The reaction mixture was allowed to cool to room temperature and poured into water with stirring (400 mL). The product was 235211 1125993 of 97 was extracted with 2-MeTHF (2x). The combined organic phases were washed with brine, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue (8 g) was purified by ultrafast chromatography (stationary phase: Grace Reveleris® silica 120 g, mobile phase: heptane / EtOAc gradient from 100 / 0 to 0 / 100). The desired fractions were combined and evaporated under reduced pressure. The residue (5.4 g) was purified by preparative HPLC (stationary phase: RP XBridge® Prep C18 OBD - 10 µm, 50 x 150 mm, mobile phase: 0.25% NH4HCO3 solution in water, CH3CN). The product fractions were combined and evaporated under reduced pressure and subsequently co-evaporated with MeOH. The residue was crystallized in a mixture of EtOAc (15 mL), CH3CN (2 mL) and MeOH (2 mL). The solids were removed by filtration, washed with EtOAc (3x) and dried under vacuum at 50 °C to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-1 H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 3, 681 mg) as a racemic mixture. Chiral separation of the enantiomers of Compound 3 (0.63 g) was performed by normal-phase chiral separation (Stationary phase: AS 20 μM, Mobile phase: 100% methanol). The product fractions were combined and evaporated under reduced pressure. The first eluted enantiomer was purified by ultrafast chromatography (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: gradient from 100 / 0 / 0 to 40 / 45 / 15 of heptane / EtOAc / EtOH). The desired fractions were combined and evaporated, and co-evaporated with EtOAc. The remaining oil was solidified by stirring in H2O (4 mL) and slow addition of MeOH (1.6 mL). After stirring for 235211 After 97 minutes, the product was removed by filtration, washed (3x) with a 1 / 2 mixture of MeOH / H2O, and vacuum dried at 50 °C to yield Enantiomer 3A (168 mg) as an amorphous solid. The eluted second enantiomer was purified by ultrafast chromatography (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: gradient from 100 / 0 / 0 to 40 / 45 / 15 of heptane / EtOAc / EtOH). The desired fractions were combined, evaporated under reduced pressure, and co-evaporated with EtOAc. The remaining foam was solidified by stirring in H2O (4 mL) and slow addition of MeOH (2 mL). After stirring for 15 minutes, the product was removed by filtration, washed (3x) with a 1 / 2 mixture of MeOH / H2O, and dried at 50 °C under vacuum to provide the 3B enantiomer (14.6 mg) as an amorphous solid. Compound 3: 1H NMR (400 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.72(s, H) 3.77 (s, 3 H) 4.01 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.54 - 6.64 (m, 2 H) 6.83 (dd, J=8.7, 2.3 Hz, 1 H) 6.91 (t, J=1.4 Hz, 1 H) 6.94 - 6.99 (m, 2 H) 7.04 (d, J=7.7 Hz, 1 H) 7.12 (d, J=2.0 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.02(d, J=8.8 Hz, 1 H) 8.30 (s, 1 H) 11.84 (s, 1 H) LC / MS (method LC-A): TR 1.20 min, MH+529 Enantiómero 3A: 1H RMN (360 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72(s, H) 3.77 (s, 3 H) 4.01 (s, 3 H) 6.22 (d, J=8.1 Hz, 1 H) 6.55 - 6.61 (m, 2 H) 6.84 (dd, J=8.8, 2.2 Hz, 1 H) 6.91 (t, J=1.8 Hz, 1 H) 6.94 - 7.00 (m, 2 H) 7.07 (d, J=7.0 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.4 Hz, 1 H) 8.02(d, J=8.8 Hz, 1 H) 8.32 (d, J=2.9 Hz, 1 H) 11.87 (d, J=2.6 Hz, H) 235211 1125993 de 97 LC / MS (método LC-A): TR 1.08 min, MH+ 529 [a]D20: +134.9° (c 0.545, DMF) SFC quiral (método SFC-E) : TR 4.31 min, MH+ 529, pureza quiral 100%. Enantiómero 3B: !H RMN (360 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.72(s, H) 3.77 (s, 3 H) 4.01 (s, 3 H) 6.21 (d, J=8.1 Hz, 1 H) 6.54 - 6.62 (m, 2 H) 6.83 (dd, J=8.6, 2.4 Hz, 1 H) 6.91(t, J=1.5 Hz, 1 H) 6.94 - 6.99 (m, 2 H) 7.07 (d, J=7.0 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 8.02(d, J=8.8 Hz, 1 H) 8.32 (d, J=2.9 Hz, 1 H) 11.87 (yes, J=2.2 Hz, 1 H) LC / MS (LC-A method): TR 1.08 min, MH+ 529 [a]D20: -116.7° (c 0.51, DMF) Chiral SFC (SFC-E method): TR 4.63 min, MH+ 529, chiral purity 94.7%. Example 4: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5 methyl-lH-indol-3-yl)ethanone (Compound 4) and chiral separation into enantiomers 4B and A. Synthesis of intermediate 4a: 235211 1125993 of 97 One M dimethylammonium chloride in hexane (13.5 mL, 13.5 mmol) was added dropwise at 0 °C to a solution of 6-methoxy-5-methyl-1H-indole [CAS 1071973-95-9] (1.45 g, 9 mmol) in CH₂Cl₂ (45 mL). After 30 min at 0 °C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (2.4 g, 10.9 mmol) in CH₂Cl₂ (45 mL) at 0 °C was slowly added. The reaction was stirred at 0 °C for 3 h. Ice-cooled water was added, and the precipitate was removed by filtration and washed with water. The solid was dried in vacuo to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1Hindol-3-yl)ethanone 4a (2.1 g). Summary of intermediate 4b: At 0 °C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.4 g, 6.4 mmol) in THF (65 mL) to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4a (2.1 g, 6.1 mmol) in THF (60 mL). The mixture was stirred at 0°C for 1 h and at room temperature for 2.5 h. The precipitate was removed by filtration and washed with EtOAc. The filtrate was concentrated under reduced pressure. The residue was collected with the minimum amount of diisopropyl ether. The precipitate was removed by filtration and dried under high vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone 4b (2.36 g). Synthesis of Compound 4 and chiral separation of Enantiomers 4A and 4B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6methoxy-5-methyl-1H-indol-3-yl)ethanone 4b (4.0 g, 9.46 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.86 g, 14.2 mmol) and diisopropylethylamine (2.44 mL, 14.2 mmol) in CH3CN / THF (1 / 1) (100 mL) was stirred at 45 °C for 72 h. The 235211 1125993 of 97 solvents were removed under reduced pressure. The residue was dissolved in EtOAc. The organic phase was washed twice with 1 N HCl, washed with water, dried over MgSO4, filtered, and concentrated under reduced pressure. The compound was crystallized from CH3CN / diisopropyl ether to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-methyl-1H-indol-3-yl)ethanone (Compound 4, 1.1 g) in the form of a racemic mixture. The chiral separation of the enantiomers of Compound 4 was performed by preparative chiral SFC (Stationary phase: (S,S)-Whelk-O1 5 pm 250 x 21.1 mm, Mobile phase: 45% CO2, 55% MeOH) yielding 500 mg of the first eluted enantiomer and 531 mg of the second eluted enantiomer. The first eluted enantiomer was crystallized in CH3CN / Et2O to provide Enantiomer 4A (401 mg). The second eluate was crystallized in CH3CN / Et2O to provide Enantiomer 4B (396 mg). Compound 4: 1H RMN (500 MHz, DMSO-d e) δ ppm 2.21 (s, 3 H) 3.09 (s, H) 3.72 (s, 3 H) 3.79 (s, 3 H) 4.01 (s, 3 H) 6.20(d, J=7.9 Hz, 1 H) 6.58 (s, 2 H) 6.88 - 6.93 (m, 2 H) 6.96 (dd, J=8.5, 1.9 Hz, 1 H) 7.02 (d, J=7.9 Hz, 1 H) 7.12 (d, J=1.9 Hz, 1 H) 7.34 (d, J=8.5 Hz, 1 H) 7.89 (s, 1 H) 8.24(s, 1 H) 11.78 (s a, 1 H) LC / MS (método LC-C): TR 3.16 min, MH+543 Punto de fusión: 208°C Enantiómero 4A: 1H RMN (500 MHz, DMSO-d6) δ ppm 2.21 (s, 3 H) 3.09(s, H) 3.72 (s, 3 H) 3.79 (s, 3 H) 4.01 (s, 3 H) 6.20(d, J=7.6 Hz, 1 H) 6.58 (d, J=1.6 Hz, 2 H) 6.87 - 6.93 (m, 2 H) 6.96 (dd, J=8.2, 1.9 Hz, 1 H) 7.02 (d, J=7.6 Hz, 1 H) 7.12 235211 1125993 de 97 (d, J=1.9 Hz, 1 H) 7.34 (d, J=8.2 Hz, 1 H) 7.89 (s,1 H) 8.25 (s, 1 H) 11.78 (s a, 1 H) LC / MS (método LC-C): TR 3.15 min, MH+543 [α]η20: +141.8° (c 0.3936, DMF) Chiral SFC (SFC-C method): TR 4.95 min, MH+543, chiral purity100%. Melting point:173°C Enantiomer 4B: 1H NMR (500 MHz, DMSO-d e) δ ppm 2.21 (s, 3 H) 3.09(s, 3 H) 3.72 (s, 3 H) 3.79 (s, 3 H) 4.01 (s, 3 H) 6.20(d, J=7.9 Hz, 1 H) 6.58 (s, 2 H) 6.88 - 6.93 (m, 2 H) 6.96 (dd, J=8.2, 1.9 Hz, 1 H) 7.02 (d, J=7.9 Hz, 1 H) 7.12 (d,J=1.9 Hz, 1 H) 7.34 (d, J=8.2 Hz, 1 H) 7.90 (s, 1 H) 8.25 (s,1 H) 11.79 (sa, 1 H) LC / MS (LC-C method): TR 3.15 min, MH+543 [«]d20: -142.2 ° (c 0.3909, DMF) Chiral SFC (SFC-C method): TR 6.84 min, MH+543, chiral purity100%. Melting point:174°C Example 5: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(5fluoro-6-methoxy-1 H-indol-3-yl)-2-((3-methoxy-5(methylsulfonyl)phenyl)amino)ethanone (Compound 5)and chiral separation into 5B enantiomers. 235211 1125993 of 97 Summary of Intermediate 5a: One M dimethylaluminum chloride (15.7 mL, 15.7 mmol) was added dropwise at 0°C to a solution of 5-fluoro-6-methoxy-1H-indole [CAS 1211595-72-0] (2 g, 12.1 mmol) in CH₂Cl₂ (50 mL). After 30 min at 0°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride (3.2 g, 14.6 mmol) in CH₂Cl₂ (50 mL) was slowly added at 0°C. The reaction was stirred at 0°C for 3 h. Ice-cooled water was added, and the precipitate was removed by filtration, washed with water, and the minimum amount of CH₂Cl₂ was added. The solid was dried under vacuum to give 2-(4-chloro-2-methoxyphenyl)1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5a (2.82 g). Summary of Intermediate 5b: At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.5 g, 8.1 mmol) in THE (20 mL) was added dropwise to a solution of 2—(4—chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5a (2.82 g, 8.1 mmol) in THE (46 mL). The mixture was stirred at 0°C for 1 h and at room temperature for 4 h. The precipitate was removed by filtration and washed with 235211 1125993 of 97 EtOAc. The filtrate was concentrated under reduced pressure. The residue was dissolved in EtOAc and washed with water. The organic phase was dried over MgSO4, filtered, and the solvent evaporated under reduced pressure. The residue was collected with the minimum amount of EtOAc. The precipitate was removed by filtration and dried under high vacuum to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5b (2.5 g). Synthesis of Compound 5 and chiral separation of the 5A and 5B Enantiomers: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)ethanone 5b (2.5 g, 5.86 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.415 g, 7.03 mmol), and diisopropylethylamine (1.515 mL, 8.79 mmol) in CH3CN (55 mL) and THF (100 mL) was stirred at 50°C for 10 days. The solvents were removed under reduced pressure. The residue was purified by ultrafast chromatography on silica gel (15–40 pm, 80 g, Mobile phase: CH2Cl2 / CH3OH 99.25 / 0.75). The pure fractions were combined and evaporated. The compound was dissolved in EtOAc and stirred with 1 N HCl for 15 min. A precipitate appeared and was removed by filtration and dried under high vacuum to give 2-(4-chloro-2-methoxyphenyl)-1-(5-fluoro-6-methoxy-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 5, 1.3 g) as a racemic mixture. The chiral separation of the enantiomers of Compound 5 was performed by preparative chiral SFC (Stationary phase: Chiralpak® IC 5 pm 250 x 20 mm, Mobile phase: 55% CO2, 45% MeOH). The product fractions were combined and evaporated. The first eluted enantiomer was 235211 1125993 of 97 was solidified by trituration with heptane / diisopropyl ether. The solids were removed by filtration and vacuum dried to yield Enantiomer 5A (502 mg) as a white amorphous powder. The second eluted enantiomer was solidified by trituration with heptane / diisopropyl ether. The solids were removed by filtration and vacuum dried to yield Enantiomer 5B (490 mg) as a white amorphous powder. Compound 5: 1H NMR (500 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72 (s, H) 3.85 (s, 3 H) 4.00 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd, J=8.2, 1.9 Hz, 1 H) 7.06 (d, J=7.9 Hz, 1 H) 7.10 - 7.18 (m, 2 H) 7.34 (d, J=8.2 Hz, 1 H) 7.82 (d, J=12.0 Hz, 1 H) 8.35 (s, 1 H) 11.98 (s a, 1 H) LC / MS (método LC-C): TR 3.01 min, MH+547 Punto de fusión: 182°C Enantiómero 5A: 1H RMN (500 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72 (s, H) 3.85 (s, 3 H) 4.00 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd, J=8.2, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.11 - 7.17 (m, 2 H) 7.34 (d, J=8.2 Hz, 1 H) 7.82 (d, J=11.7 Hz, 1 H) 8.35 (s, 1 H) 11.98 (s a, 1 H) LC / MS (método LC-C): TR 3.00 min, MH+547 [α]η20: +136.4 ° (c 0.28, DMF) SFC quiral (método SFC-B): TR 3.43 min, MH+547, pureza quiral 100%. Enantiómero 5B: 1H RMN (500 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72(s, H) 3.85 (s, 3 H) 4.00 (s, 3 H) 6.21 (d, J=7.9 Hz, 1 H) 235211 1125993 of 97 6.58 (d, J=1.3 Hz, 2 H) 6.90 (s, 1 H) 6.97 (dd, 0=8.2, 2.0 Hz, 1 H) 7.07 (d, 0=7.9 Hz, 1 H) 7.11 - 7.19 (m, 2 H) (d, 2 H= 1.04 Hz). H) 7.82 (d, 0=11.7 Hz, 1 H) 8.35 (s, 1 H) 11.95 (sa, 1 H) LC / MS (LC-C method): TR 3.00 min, MH+ 547 [a]D20: -126.3° (c 0.2755, DMF) Chiral SFC (SFC-B method) : TR 4.80 min, MH+ 547, chiral purity 98.06%. Example 6 : Synthesis of 2-(4-chloro-2-methoxyphenyl)-2((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-7methyl-lH-indol-3-yl)ethanone (Compound 6) and chiral separation into enantiomers 6B and 6B. Synthesis of intermediate 6a: One M diethylaluminum chloride (1 M) in hexane (32.8 mL, 32.8 mmol) was added dropwise to a cooled (-30°C) solution of 6-methoxy-7-methyl-1H-indole [CAS 19500-05-1] (3.53 g, 21.9 mmol) in CH₂Cl₂ (150 mL). After stirring for 15 min at -30°C, a solution of 2-(4-chloro-2-methoxyphenyl)acetyl chloride (6.71 g, 30.6 mmol) in CH₂Cl₂ (150 mL) at -30°C was slowly added. The reaction 235211 1125993 of 97 was stirred at -30°C for 1 h and then allowed to warm to room temperature while stirring for 2 h. The reaction mixture was poured into ice-cooled water / Rochelle salt. The mixture was filtered over a short bed of dicalite® and the filter cake was rinsed several times with THF. The layers were separated. The aqueous phase was extracted with THF. The combined organic phases were washed with brine, water, dried over MgSO4, filtered, and evaporated under reduced pressure. The solid residue was suspended in CH2Cl2 (50 mL), and the solids were removed by filtration, washed with a small amount of CH2Cl2, and dried under vacuum at 50°C to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.85 g) as a whitish solid. Summary of Intermediate 6b: At 0°C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (8.2 g, 21.8 mmol) in THF (150 mL) was added dropwise to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6a (6.8 g, 19.8 mmol) in THF (250 mL). The mixture was stirred at room temperature for 2 h. The precipitate was removed by filtration and washed with THF. The filtrate was concentrated under reduced pressure. The residue was crystallized in CH2Cl2. The precipitate was removed by filtration, washed with CH2Cl2 (2x), and dried under vacuum at 50°C to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-7-methyl-1H-indol-3-yl)ethanone 6b (5.38 g). Synthesis of Compound 6 and chiral separation of the 6A and 6B Enantiomers: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6methoxy-7-methyl-1H-indol-3-yl)ethanone 6b (1.96 g, 4.65 235211 1125993 (97 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.40 g, 6.97 mmol), and diisopropylethylamine (1.20 mL, 6.97 mmol) in CH3CN (50 mL) was heated overnight under reflux. The solvents were removed under reduced pressure. The residue was dissolved in CH2Cl2 and washed with 0.5 N HCl and water, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by ultrafast chromatography on silica gel (Stationary phase: Biotage® SNAP Ultra 100 g, Mobile phase: 0 / 100 to 50 / 50 gradient of EtOAc:EtOH(3:1) / heptane). The fractions were combined and evaporated under reduced pressure to give 2(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-7-methyl-1 H-indol-3-yl)ethanone (Compound 6, 1.0 g) in the form of a racemic mixture. Chiral separation of the enantiomers of Compound 6 (1.0 g) was performed using preparative chiral SFC (Stationary phase: Chiralcel® Diacel OD 20 x 250 mm, Mobile phase: CO2, EtOH containing 0.2% i PrNH2). The product fractions were combined and evaporated. The first eluted enantiomer was solidified by trituration with a 1:1 mixture of MeOH / water. The solids were removed by filtration and dried under vacuum at 50°C to yield Enantiomer 6A (368 mg) as a white amorphous powder. The second eluted enantiomer was solidified by trituration with a 1:1 mixture of MeOH / water. The solids were removed by filtration and dried under vacuum at 50°C to yield Enantiomer 6B (303 mg) as a white amorphous powder. Enantiomer 6A: 1H NMR (360 MHz, DMSO-d e) δ ppm 2.29 (s, 3 H) 3.10 (s, 235211 1125993 of 97 H) 3.72 (s, 3 H) 3.80 (s, 3 H) 4.02 (s, 3 H) 6.24(d, J=7.7 Hz, 1 H) 6.56 - 6.59 (m, 1 H) 6.59 - 6.62 (m,1 H) 6.92 (t, J=1.6 Hz, 1 H) 6.93 - 6.99 (m, 2 H) 7.06 (d, J=7.7 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.4 Hz, 1 H) 7.94 (d, J=8.4 Hz, 1 H) 8.35 (s, 1 H) 11.91 (s a, 1 H) LC / MS (método LC-A): TR 1.18 min, MH+543 [«]d20: +122.9° (c 0.48, DMF) SFC quiral (método SFC-E): TR 4.15 min MH+543, pureza quiral 100%. Enantiómero 6B: 1H RMN (360 MHz, DMSO-d e) δ ppm 2.29 (s, 3 H) 3.10(s, H) 3.72 (s, 3 H) 3.80 (s, 3 H) 4.02 (s, 3 H) 6.24(d, J=7.7 Hz, 1 H) 6.57 - 6.59 (m, 1 H) 6.59 - 6.62 (m,1 H) 6.92 (t, J=1.8 Hz, 1 H) 6.93 - 7.00 (m, 2 H) 7.06 (d, J=7.7 Hz, 1 H) 7.13 (d, J=1.8 Hz, 1 H) 7.35 (d, J=8.1 Hz, 1 H) 7.94 (d, J=8.8 Hz, 1 H) 8.35 (d, J=2.2 Hz, 1 H) 11.91 (s a, H) LC / MS (método LC-A): TR 1.22 min, MH+543 [«]d20: -120.6° (c 0.2755, DMF) Chiral SFC (SFC-E method): TR 4.50 min, MH+543, chiral purity 99.35%. Example 7: Synthesis of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 7) and chiral separation into Enantiomers 7A and 7B. 235211 1125993 of 97 Summary of Interlude 7a: A solution of 6-fluoro-5-methyl-1A-indole [CAS 16210095-0] (1.7 g, 11.4 mmol) in CH2Cl2 (100 mL) was cooled to 0°C in a nitrogen atmosphere. A 1 M diethylaluminum chloride solution in hexane (17.1 mL, 17.1 mmol) was added dropwise, and the resulting mixture was maintained at 0°C for 15 min. A solution of 2-(1 / 2-methoxypheni)acetyl chloride (3.50 g, 16 mmol) in CH2Cl2 (50 mL) was added dropwise. Stirring continued at 0°C for 1 h and at room temperature for 2 h. The reaction mixture was poured into an ice / Rochelle salt solution under stirring. After the ice melted, the mixture was filtered over dicalite® and the filter cake was washed several times with THF. The filtrates were combined. The phases were separated, and the organic phase was washed with brine, dried over MgSCg, filtered, and evaporated under reduced pressure.The solid residue was suspended in CH2CI2 (30 mL), the precipitate was removed by filtration and dried under vacuum at 50°C to provide 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1A-indol-3-yl)ethanone 7a (2.76 g). 235211 1125993 of 97 Summary of Interlude 7b: A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7a (2.76 g, 8.32 mmol) in THF (350 mL) was cooled to 0 °C. A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (3.44 g, 9.15 mmol) was added dropwise in THF (50 mL). The reaction mixture was stirred at 0 °C for 2 h and at room temperature for 2 h. The solids were removed by filtration and washed with THF. The combined filtrates were evaporated under reduced pressure. The residue was mixed with EtOAc (50 mL). The solids were isolated by filtration, washed with a small amount of EtOAc, and dried under vacuum at 50 °C to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)ethanone 7b (3.21 g) as a white solid, which was used without further purification in the next step. Synthesis of Compound 7 and chiral separation of Enantiomers 7A and 7B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6fluoro-5-methyl-1H-indol-3-yl)ethanone 7b (1.6 g, 3.90 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.18 g, 5.84 mmol) and diisopropylethylamine (671 pL, 3.90 mmol) in CH3CN (100 mL) was stirred overnight at 85 °C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH2Cl2 (100 mL), washed with 1 N HCl (100 mL) and water (100 mL), dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by column chromatography (Stationary phase: Grace Reveleris® silica 120 g, Mobile phase: 0 / 100 to 50 / 50 gradient of EtOAc:EtOH (3:1) / heptane). The desired fractions were 235211 1125993 of 97 were combined and evaporated under reduced pressure. The residue was precipitated in CH2Cl2 / heptane. The solids were isolated by filtration and washed with CH2Cl2 / heptane (1 / 1). The crude product was purified by preparative HPLC (Stationary phase: Uptisphere® C18 ODB - 10 pm, 200 g, 5 cm, Mobile phase: 0.25% NH4HCO3 solution in water, CH3CN). The product fractions were combined and evaporated under reduced pressure. The solid residue was mixed with EtOAc (20 mL), and the solids were isolated by filtration and washed with a small amount of EtOAc to yield 2-(4-chloro-2-methoxyphenyl)-1-(6-fluoro-5-methyl-1H-indol-3-yl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)ethanone (Compound 7, 341 mg) as a racemic mixture. The filtrate was evaporated under reduced pressure, and the residue was collected with MeOH. After shaking for 30 min, the solids were isolated by filtration to provide a second culture of Compound 7 (92 mg). Chiral separation of the enantiomers of Compound 7 (402 mg) was performed by normal-phase chiral separation (Stationary phase: (S,S)-Whelk-O1, Mobile phase: 100% methanol). The product fractions were combined and evaporated to yield Enantiomer 7A as the first eluted product and Enantiomer 7B as the second eluted product. Enantiomer 7A was purified by ultrafast chromatography on silica gel (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: 100 / 0 / 0 to 40 / 45 / 15 heptane / EtOAc / EtOH). The desired fractions were combined and evaporated under reduced pressure. The residue was ground with H₂O (1.75 mL) and MeOH (0.75 mL). The solids were removed by filtration, washed (2x) with H2O / MeOH 7 / 3, and vacuum dried at 50 235211 1125993 at 97 °C to provide Enantiomer 7A (48 mg). Enantiomer 7B was further purified by ultrafast chromatography on silica gel (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: 100 / 0 / 0 to 40 / 45 / 15 heptane / EtOAc / EtOH). The desired fractions were combined and evaporated under reduced pressure. The residue was ground with H2O (1.75 mL) and MeOH (0.75 mL). The solids were removed by filtration, washed (2x) with H2O / MeOH 7 / 3, and dried under vacuum at 50 °C to provide Enantiomer 7B (43 mg). Compound 7: 1H NMR (400 MHz, DMSO-d e) δ ppm 2.30 (d, J=0.9 Hz, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.22 (d,J=7.7 Hz, 1 H) 6.54 - 6.63 (m, 2 H) 6.92 (t, J=1.5 Hz, 1 H) 6.97 (dd, J=8.3, 1.9 Hz, 1 H) 7.01 (d, J=7.7 Hz, 1 H) 7.12(d, J=1.8 Hz, 1 H) 7.22 (d, J=10.2 Hz, 1 H) 7.35 (d, J=8.4Hz, H) 8.02 (d, J=7.7 Hz, 1 H) 8.37 (s, 1 H) 11.97 (sa, 1 H) LC / MS (method LC-A): TR 1.19 min, MH+531 Enantiomer 7A: 1H NMR (400 MHz, DMSO-d6) δ ppm 2.30 (d, J=1.5Hz, 3 H) 3.09 (s, 3 H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.22 (d,J=7.9 Hz, 1 H) 6.56 - 6.60 (m, 2 H) 6.91 (t, J=1.7 Hz, 1 H) 6.97 (dd, J=8.3, 2.1 Hz, 1 H) 7.01 (d, J=7.7 Hz, 1 H) 7.12(d, J=2.0 Hz, 1 H) 7.22 (d, J=10.1 Hz, 1 H) 7.34 (d, J=8.1 Hz, H) 8.02 (d, J=7.7 Hz, 1 H) 8.37 (s, 1 H) 11.96 (s, 1 H) LC / MS (method LC-A): TR 1.15 min, MH+531 [a]D20: -163.2° (c 0.435, DMF) SFC chiral (method SFC-E): TR 4.26 min, MH+531, purity chiral 100%. Enantiomer 7B: 1H NMR (400 MHz, DMSO-d6) δ ppm 2.30 (d, J=1.5 Hz, 3 235211 1125993 of 97 Η) 3.09 (s, 3 Η) 3.72 (s, 3 Η) 4.00 (s, 3 Η) 6.22 (d, J=7.7 Hz, 1 H) 6.57 - 6.61 (m, 2 H) 6.92 (t, J=1.8 Hz, 1 H) 6.97 (dd, J=8.1, 2.0 Hz, 1 H) 7.01 (d, J=7.7 Hz, 1 H) 7.12 (d, J=2.0 Hz, 1 H) 7.22 (d, J=10.0 Hz, 1 H) 7.35 (d, J=8.4 Hz, H) 8.02 (d, J=7.9 Hz, 1 H) 8.37 (d, J=2.4 Hz, 1 H) 11.97 (s, 1 H) LC / MS (LC-A method): TR 1.15 min, MH+ 531 [a]D20: +1 66.6° (c 0.5, DMF) Chiral SFC (SFC-E method) : TR 3.78 min, MH+ 531, chiral purity 100%. Example 8 : synthesis of 2-(4-chloro-2-methoxyphenyl)-2((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5(trifluoromethyl)-lH-indol-3-yl)ethanone (Compound 8) and chiral separation into the 8B enantiomers. there Synthesis of intermediate 8a: At 0 °C, in a stream of N2, sodium hydride (2.48 g, 64.8 mmol) was added in portions to a mixture of 552 235211 1125993 of 97 (trifluoromethyl)-1H-indole [CAS 100846-24-0] (10 g, 54.0 mmol) in DMF (150 mL) and the reaction mixture was stirred at 0°C for 30 min. A solution of tosyl chloride (11.3 g, 59.4 mmol) in DMF (50 mL) was added in portions and the resulting mixture was stirred at room temperature for 3 h. At 0°C, the mixture was inactivated by the addition of water. The precipitate was removed by filtration and dried overnight under vacuum at 70°C to give 1-tosyl-5-(trifluoromethyl)-1H-indole 8a (18.4 g). Summary of Intermediate 8b: Titanium(IV) chloride (2.4 mL, 21.9 mmol) was added dropwise at room temperature to a solution of 1-tosyl-5-(trifluoromethyl)-1H-indole 8a (3.7 g, 10.95 mmol) and 2-(4-chloro-2-methoxyphenyl)acetyl chloride 1a (4.8 g, 21.9 mmol; synthesis: see Example 1) in 1,2-dichloroethane (120 mL). The reaction was stirred at room temperature for 2 h. Ice-cooled water was added. The reaction mixture was extracted with EtOAc. The organic phase was dried over MgSO4, filtered, and the solvent was concentrated under reduced pressure. The residue was purified by column chromatography on silica gel (15–40 μm, 80 g, Mobile phase: 99.5 / 0.5 CH₂Cl₂ / MeOH). The fractions containing Compound 8b were combined and the solvent evaporated under reduced pressure. The residue was collected with CHaCN / diisopropyl ether. The precipitate was removed by filtration and dried to give 2-(4-chloro-2-methoxyphenyl)-1(1-tosyl-5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8b (2.8 g). Summary of intermediate 8c: Lithium hydroxide (0.64 g, 15.3 mmol) was added to a solution of 2-(4-chloro-2-methoxyphenyl)-1-(1-tosyl-553 235211 1125993 of 97 (trifluoromethyl)-1H-indol-3-yl)ethanone 8b (3.2 g, 6.13 mmol) in THF (18 mL) and water (6 mL). The mixture was stirred at 30 °C for 1 h. Water and EtOAc were added. The organic phase was separated, dried over MgSO4, filtered, and the solvent evaporated under reduced pressure. The solid was collected with diisopropyl ether. The precipitate was removed by filtration and dried to give 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8c (2.1 g). Summary of Intermediate 8d: At 0 °C, a solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.1 g, 5.7 mmol) in THF (60 mL) was added dropwise to a mixture of 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8c (2.15 g, 5.7 mmol) in THF (60 mL). The mixture was stirred at 0°C for 1 h and at room temperature for 4 h. The precipitate was removed by filtration and washed with EtOAc. The combined filtrates were concentrated under reduced pressure. The residue was dissolved in EtOAc. The organic phase was washed with water, dried over MgSO4, filtered, and the solvent evaporated under reduced pressure. The residue was collected with diisopropyl ether. The precipitate was removed by filtration and dried to give 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone 8d (2.5 g). Synthesis of Compound 8 and chiral separation into Enantiomers 8A and 8B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5(trifluoromethyl)-1H-indol-3-yl)ethanone 8d (1 g, 2.24 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (496 mg, 2.46 mmol) and diisopropylethylamine (0.38 mL, 2.24 mmol) in CH3CN (50 mL) and THF (25 mL) was stirred at 70 °C for 24 h. 235211 1125993 of 97 The solution was concentrated under reduced pressure. The residue was dissolved in EtOAc and the solution was washed with 1 N HCl. The organic phase was separated, dried over MgSO4, filtered, and evaporated from the solvent under reduced pressure. The compound was crystallized from diisopropyl ether / CH3CN to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoromethyl)-1H-indol-3-yl)ethanone (Compound 8, 310 mg) in the form of a racemic mixture. The enantiomers of Compound 8 were separated by preparative chiral SFC (Stationary phase: Chiralpak® AD-H pm 250 x 20 mm, Mobile phase: 70% CO2, 30% i PrOH + 0.3% i PrNH2) to give, after crystallization in petroleum ether / diisopropyl ether, 122 mg of the first eluted Enantiomer 8A and 128 mg of the second eluted Enantiomer 8B. Compuesto 8: 1H RMN (500 MHz, DMSO-de) δ ppm 3.10 (s, 3 H) 3.72(s, H) 3.99 (s, 3 H) 6.29 (d, J=7.9 Hz, 1 H) 6.56 - 6.62 (m, H) 6.92 (s, 1 H) 6.98 (dd, J=8.4, 2.0 Hz, 1 H) 7.09(d, J=7.9 Hz, 1 H) 7.13 (d, J=1.9 Hz, 1 H) 7.36 (d, J=8.5 Hz, 1 H) 7.54 (dd, J=8.5, 1.6 Hz, 1 H) 7.69 (d, J=8.5 Hz, 1 H) 8.48 (s, 1 H) 8.61 (s, 1 H) 12.45 (s a, 1 H) LC / MS (método LC-C): TR 3.19 min, MH+567 Punto de fusión: 168°C Enantiómero 8A: 1H RMN (400 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.73(s, H) 3.99 (s, 3 H) 6.29 (d, J=7.6 Hz, 1 H) 6.60 (s a, 2 H) 6.92 (s, 1 H) 6.98 (dd, J=8.3, 1.8 Hz, 1 H) 7.07 (d,J=8.1 Hz, 1 H) 7.13 (d, J=1.5 Hz, 1 H) 7.36 (d, J=8.1 Hz, 1 H) 7.54 (d, J=8.1 Hz, 1 H) 7.69 (d, J=8.6 Hz, 1 H) 8.49(s, 1 H) 8.60 (s, 1 H) 12.41 (s a, 1 H) 235211 1125993 de 97 LC / MS (LC-C method): TR 3.25 min, MH+ 567 [a]D20: -119.2° (c 0.2727, DMF) Chiral SFC (SFC-F method) : TR 2.64 min, MH+ 567, chiral purity 100%. Enantiomer 8B: 2H NMR (400 MHz, DMSO) δ ppm 3.09 (s, 3 H) 3.73 (s, 3 H) 3.99 (s, 3 H) 6.29 (d, J=8 . 1 Hz, 1 H) 6.60 (s, 2 H) 6.92 (s, 6.9 H) (dd, 6.98 H). J=8.6, 2.0 Hz, 1 H) 7.07 (d, J=8.1 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.36 (d, J=8.6 Hz, 1 H) 7.54 (dd, J=8.6, 1.5 Hz, 1 Hz, 6.6 Hz. 1 H) 8.49 (s, 1 H) 8.60 (s, 1 H) 12.40 (sa, 1 H) LC / MS (LC-C method): TR 3.25 min, MH+ 567 [a]D20: +125.1 ° (c 0.2455, DMF) Chiral SFC (SFC-F method) : TR 3.44 min, MH+ 567, chiral purity 100%. Example 9 : Synthesis of 2-(4-chloro-2-methoxyphenyl)-2((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5(trifluoromethoxy)-lH-indol-3-yl)ethanone (Compound 9) and Chiral Separation into Enantiomers 9A and 9B. Synthesis of intermediate 9a: A solution of 5-(trifluoromethoxy)-IH-indole [CAS 235211 1125993 of 97 [262593-63-5] (3 g, 14.9 mmol) in CH2Cl2 (150 mL) was cooled to 0 °C in an N2 atmosphere. A 1 M diethylaluminum chloride solution in hexane (22.4 mL, 22.4 mmol) was added dropwise, and the resulting mixture was maintained at 0 °C for 15 min. A 1a 2-(4-chloro-2-methoxyphenyl)acetyl chloride solution (4.57 g, 20.9 mmol) in CH2Cl2 (100 mL) was added dropwise. Stirring continued at 0 °C for 1 h, and the reaction mixture was subsequently stirred at room temperature for 4 h. The reaction mixture was poured into an ice / Rochelle salt solution under stirring. After the ice melted, the mixture was filtered through dicalite® and the filter cake was washed several times with THF. The filtrates were combined. The phases were separated, and the organic phase was washed with brine, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was ground with CH2Cl2 (50 mL).The resulting precipitate was removed by filtration and dried under vacuum at 50 °C to provide 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9a (4.39 g). 235211 1125993 of 97 Summary of Intermediate 9b: A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9a (4.39 g, 11.4 mmol) in THF (200 mL) was cooled to 0°C. A solution of phenyltrimethylammonium tribromide [CAS 4207-56-1] (4.73 g, 12.6 mmol) was added dropwise in THF (100 mL). The resulting suspension was stirred at room temperature for 2 h. The solids were removed by filtration and washed with THF. The combined filtrates were evaporated under reduced pressure. The residue was mixed with EtOAc (30 mL). The solids were isolated by filtration, washed with a small amount of EtOAc, and dried under vacuum at 50 °C to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9b (5.0 g) as a white solid, which was used without further purification in the next step. Synthesis of Compound 9 and chiral separation of Enantiomers 9A and 9B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 9b (2.5 g, 5.40 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (1.49 g, 7.38 mmol), and diisopropylethylamine (931 pL, 5.40 mmol) in CH3CN (100 mL) was stirred overnight at 90°C. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in CH2Cl2 (100 mL), washed with 1 N HCl (100 mL) and water (100 mL), dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by column chromatography (Stationary phase: Grace Reveleris® 120 g silica, Mobile phase: 0 / 100 to 50 / 50 gradient of EtOAc:EtOH(3:1) / heptane). The desired fractions were 235211 1125993 of 97 were combined and evaporated under reduced pressure. The residue was precipitated in EtOAc (10 mL) while stirring. The solids were isolated by filtration and washed with a small amount of EtOAc to give 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 9, 477 mg) in the form of a racemic mixture. The filtrate was evaporated under reduced pressure and the residue was collected with EtOAc (5 mL). After shaking overnight, the solids were isolated by filtration and washed with EtOAc to provide a second culture of Compound 9 (216 mg). The chiral separation of the enantiomers of Compound 9 (663 mg) was performed using normal-phase chiral separation (Stationary phase: AS 20 pm, Mobile phase: 100% methanol). The product fractions were combined and evaporated to yield Enantiomer 9A as the first eluted product and Enantiomer 9B as the second eluted product. Enantiomer 9A was stirred in H₂O (2 mL) and MeOH (3 mL) at 40 °C. The solids were removed by filtration, washed (3x) with 1:1 H₂O / MeOH, and dried under vacuum at 45 °C to yield Enantiomer 9A (151 mg). Enantiomer 9B was further purified by ultrafast chromatography on silica gel (Stationary phase: Grace Reveleris® silica 12 g, Mobile phase: 100 / 0 / 0 to 40 / 45 / 15 heptane / EtOAc / EtOH). The desired fractions were combined, evaporated under reduced pressure, and co-evaporated with EtOAc. The residue was stirred in MeOH (5 mL) and precipitated by slow addition of H₂O (4 mL).The solids were removed by filtration, washed (3x) with H2O / MeOH 1 / 1 and dried in vacuum at 50 °C for. 235211 1125993 of 97 to provide Enantiomer 9B (132 mg). Compound 9: 1H NMR (400 MHz, DMSO-d e) δ ppm 3.09 (s, 3 H) 3.73 (s, H) 3.99 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.57 - 6.62 (m, H) 6.91 (t, J=1.9 Hz, 1 H) 6.98 (dd, J=8.4, 2.0 Hz, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.22 (dd, J=8.6, 2.2 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J=8.8 Hz, 1 H) 8.06 (d, J=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.28 (sa, H) LC / MS (LC-A method): TR 1.31 min, MH+583 Enantiomer 9A: 1H NMR (400 MHz, DMSO-d 6) δ ppm 3.09 (s, 3 H) 3.73(s, H) 3.99 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.55 - 6.62(m, H) 6.91 (t, J=1.5 Hz, 1 H) 6.98 (dd, J=8.4, 2.0 Hz, 1 H) .07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.21 (dd, J=8.8, 1.8 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J=8.8 Hz, 1 H) 8.07 (d, J=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.29 (s a, H) LC / MS (método LC-A): TR 1.20 min, MH+583 [«]d20: +130.3° (c 0.555, DMF) SFC quiral (método SFC-E): TR 3.10 min, MH+583, pureza quiral 100%. Enantiómero 9B: 1H RMN (400 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.73(s, H) 3.99 (s, 3 H) 6.26 (d, J=7.9 Hz, 1 H) 6.56 - 6.62(m, H) 6.92 (t, J=2.0 Hz, 1 H) 6.98 (dd, J=8.1, 2.0 Hz, 1 H) .07 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.0 Hz, 1 H) 7.22 (dd, J=8.8, 1.8 Hz, 1 H) 7.36 (d, J=8.4 Hz, 1 H) 7.59 (d, J=8.8 Hz, 1 H) 8.07 (d, J=0.9 Hz, 1 H) 8.55 (s, 1 H) 12.30 (s a, H) LC / MS (método LC-A): TR 1.20 min, MH+583 235211 1125993 de 97 [a]D20: -133.2° (c 0.5, DMF) SFC quiral (método SFC-E): TR 3.50 min, MH+ 583, pureza quiral 100%. Example 10: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2( (3-methoxy-5-(methylsulfonyl)phenyl) amino)-1-(6-methoxy-5(trifluoromethoxy)-lH-indol-3-yl)ethanone (B0Chiral compound 10 in Enan.An f3co MeO P3CO MeO EtOH, NaOEt, −15 °C for 2 h, which is 12 h Co, quinoline 220-230'C 12h 10c □ IPEA CHjCN, which lasts 2 days Chiral separation Enantiomers 10A and 10B Synthesis of intermediate 10a: To a cooled (-15 °C) solution of 3-methoxy-4-(trifluoromethoxy)benzaldehyde [CAS 853771-90-1] (50 q, 230 mmol) and ethyl azidoacetate (89 q, 690 mmol) in EtOH (400 mL), a solution of NaOEt (0.69 mol, prepared from 15.9 q of Na and 700 mL of EtOH) was added bit by bit over a period of 2 h. The reaction mixture was stirred at room temperature overnight. After cooling in an ice bath, the reaction was stopped with a saturated solution of NH4Cl (1.2 L) and stirred for 1 min. The precipitate was removed by filtration, washed with water, and stirred to give 2-azido-3-(3-methoxy-461 235211 1125993 of 97 (trifluoromethoxy)phenyl)acrylate of (Z)-ethyl 10a (32 g) in the form of a yellowish solid. Summary of Intermediate 10b: A solution of (Z)-ethyl 2-azido-3-(3-methoxy-4-(trifluoromethoxy)phenyl)acrylate 10a (3 g, 10 mmol) in xylene (40 mL) was heated under reflux overnight. After cooling to room temperature, the solvent was evaporated to dryness. The residue was ground with hexane (50 mL) and the precipitate was removed by filtration to give methyl 6-methoxy-5-(trifluoromethoxy)-1H-indol-2-carboxylate 10b (yield: 1.4–1.6 g) as a yellow solid. Summary of intermediate 10c: To a mixture of methyl 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylate 10b (25 g, 87 mmol) in MeOH / H2O (2 / 1, 300 mL) NaOH (7 g, 175 mmol) was added, and the mixture was heated under reflux until a clear solution was obtained. After cooling to room temperature, most of the methanol was removed under reduced pressure, and the remaining aqueous solution was acidified with concentrated HCl to pH 34. The product was extracted with EtOAc (2 x 250 mL). The combined organic phases were washed with brine, dried, and evaporated under reduced pressure to give 6-methoxy-5-(trifluoromethoxy)-1H-indole-2-carboxylic acid 10c (22.7 g) as a gray solid. Summary of Intermediate 10d: A suspension of 6-methoxy-5-(trifluoromethoxy)1H-indole-2-carboxylic acid 10c (7.5 g, 27 mmol) and Cu (1.22 g, 0.7 equiv.) in quinoline (150 mL) was heated to 220-230 °C in an inert atmosphere for 12 h. After cooling to room temperature, the mixture was diluted with methyl tert-62 235211 1125993 of 97 butyl ether (MTBE, 400 mL) was washed with a saturated aqueous solution of NaHSO4 (2 x 500 mL). The organic phase was dried over MgSO4, filtered through a short bed of silica gel, and evaporated under reduced pressure. The residue was purified by column chromatography to give 6-methoxy-5-(trifluoromethoxy)-1H-indole 10d (3.75 g) as a yellow solid. Summary of Intermediate 10e: A solution of 6-methoxy-5-(trifluoromethoxy)-1H-indole 10d (1.61 g, 6.96 mmol) in CH2Cl2 (150 mL) was cooled to 0 °C in a nitrogen atmosphere. A 1 M diethylaluminum chloride solution in hexane (10.4 mL, 10.4 mmol) was added dropwise, and the resulting mixture was maintained at 0 °C for 30 min. A 1a 2-(4-chloro-2-methoxyphenyl)acetyl chloride solution (2.28 g, 10.4 mmol) in CH2Cl2 (75 mL) was added dropwise. Stirring continued at 0 °C for 1 h and at room temperature for 1 h. The reaction mixture was cooled to 0 °C, and a potassium tartrate tetrahydrate solution (Rochelle salt, 3.93 g, 13.9 mmol) in water (6 mL) was added dropwise. The reaction mixture was stirred for 30 min at 0 °C. THF (200 mL) was added, and the reaction mixture was stirred at room temperature for 20 min. Na₂SO₄ (25 g) was added, the mixture was stirred overnight, filtered over Dicalite®, and the filter cake was washed several times with THF (4 x 150 mL). The filtrates were combined and evaporated under reduced pressure.The solid residue was stirred in a mixture of diisopropyl ether (25 mL) and EtOAc (2 mL). The solids were removed by filtration, washed with DIPE (3x) and dried under vacuum at 50 °C to give 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10e (3.6 g). 235211 1125993 of 97 Summary of intermission 10f: A stirred solution of 2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10e (3.6 g, 6.53 mmol) in THF (130 mL) was cooled to 0 °C in an atmosphere of N2. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.58 g, 6.85 mmol) was added and the reaction mixture was stirred at 0 °C for 45 min and at room temperature for 1.5 h. The solids were removed by filtration and washed with THF (2x). The combined filtrates were evaporated at reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10f (4.16 g), which was used without further purification in the next stage. Synthesis of Compound 10 and chiral separation of Enantiomers 10A and 10B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 10f (4.16 g, 6.50 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.62 g, 13.0 mmol), and diisopropylethylamine (2.24 mL, 13.0 mmol) in CH3CN was stirred at room temperature for 2 days in a nitrogen atmosphere. Water (250 mL) was added, and the product was extracted with Et2O (2x). The combined organic phases were dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by column chromatography (Stationary phase: Silica Grace Revelieris® 100 g, Mobile phase: gradient of 100 / 0 / 0 to 40 / 45 / 15 heptane / EtOAc / EtOH). The desired fractions were combined and evaporated under reduced pressure. The residue was further purified by preparative HPLC (Stationary phase: RP XBridge® Prep C18 OBD 10 pm, 50 x 150 mm, Mobile phase: NH4HCO3 solution at 235211 1125993 of 97 0.25% in water, CH3CN). The desired fractions were combined and evaporated under reduced pressure. The residue, containing racemic 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(6-methoxy-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 10, 380 mg), was subjected to chiral separation by preparative SFC (Stationary phase: Chiralpak® Diacel AS 20 x 250 mm, Mobile phase: CO2, EtOH + 0.4% iPrNH2). The product fractions were combined, evaporated under reduced pressure, and co-evaporated with MeOH to provide Enantiomer 10A as the first eluted product and Enantiomer 10B as the second eluted product. Both enantiomers were precipitated in a solvent mixture of MeOH and water, removed by filtration, and dried at 50 °C under vacuum to provide Enantiomer 10A (135 mg) and Enantiomer 10B (144 mg). Enantiomer 10A: 1H NMR (360 MHz, DMSO-de) δ ppm 3.09 (s, 3 H) 3.72 (s, H) 3.87 (s, 3 H) 3.99 (s, 3 H) 6.22 (d, J=7.7 Hz, 1 H) 6.55 - 6.59 (m, 2 H) 6.88 - 6.91 (m, 1 H) 6.98 (dd, J=8.1, 1.8 Hz, 1 H) 7.08 (d, J=7.7 Hz, 1 H) 7.13 (d, J=2.2 Hz, 1 H) 7.21 (s, 1 H) 7.34 (d, J=8.1 Hz, 1 H) 8.02 (d, J=1.5 Hz, 1 H) 8.41 (s, 1 H) 12.05 (s a, 1 H) LC / MS (método método LC-A): TR 1.20 min, MH+613 [u]d20: +81.4° (c 0.29, DMF) SFC quiral (método SFC-E): TR 3.34 min, MH+613, pureza quiral 100%. Enantiómero 10B: 1H RMN (360 MHz, DMSO-d6) δ ppm 3.09 (s, 3 H) 3.72(s, H) 3.87 (s, 3 H) 3.99 (s, 3 H) 6.22 (d, J=7.7 Hz, 1 H) 6.55 - 6.60 (m, 2 H) 6.90 (t, J=1.6 Hz, 1 H) 6.98 (dd, 235211 1125993 de 97 J=8.2, 2.0 Hz, 1 H) 7.08 (d, J=7.8 Hz, 1 H) 7.13 (d, J=2.2 Hz, 1 H) 7.21 (s, 1 H) 7.34 (d, J=8.4 Hz, 1 H) 8.01 (d, J=l.l Hz, 1 H) 8.41 (s, 1 H) 12.08 (s a, 1 H) LC / MS (method LC-A): TR 1.20 min, MH+ 613 [a]D20: -99.6° (c 0.261, DMF) Chiral SFC (SFC-E method): TR 3.69 min, MH+613, chiral purity 100%. Example 11: Synthesis of 2-(4-chloro-2-methoxyphenyl)-2((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone (Compound 11) and chiral separation into Enantiomers 11A and 11B. NaBH4tBuOH. H2O 90°C 2 5h EtjAICI CH2CI2, from 0 °C to 1 h Chiral separation 11A and 11B Enantiomers Summary of Intermediate 11a: A mixture of boron(III) chloride M in CH2CI2 (25.5 mL, 25.5 mmol) and aluminum chloride (III) (3.40 g, 25.5 mmol) was diluted with CH2CI2 (20 mL) and cooled in an ice bath under an N2 atmosphere. A solution of 2-methyl-4-(trifluoromethoxy)aniline [CAS 86256-59-9] (4.88 g, 25.5 mmol) and chloroacetonitrile (3.24 mL, 51.0 mmol) in CH2CI2 (7.5 mL). After the addition, 235211 1125993 of 97 The ice bath was removed and the mixture was heated under reflux for 8 h. The mixture was then cooled back to 0 °C using an ice bath. 2 N HCl (75 mL) was added dropwise, causing heavy precipitation. The resulting suspension was heated under reflux for 90 min and cooled to room temperature. The solids were removed by filtration. The filter cake was washed with CH2CX (4x). The filtrates were combined and the phases separated. The organic phase was isolated, washed with an aqueous solution of NaHCO3, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by ultrafast chromatography (Stationary phase: Biotage® SNAP Ultra Silica 100 g, Mobile phase: 100 / 0 to 0 / 100 heptane / CH2Cl2 gradient). The desired fractions were combined and concentrated to a residual volume of 30 mL.The precipitate was removed by filtration, washed with heptane and CH2Cl2, and dried under vacuum at 50°C to provide 1-(2-amino-3-methyl-5-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.37. g) The filtrate was concentrated under reduced pressure. The solid residue was stirred in a mixture of heptane (20 mL) and diisopropyl ether (3 mL), removed by filtration, washed with heptane (3x) and dried under vacuum at 50 °C to provide a second fraction of 11a (0.24 g). Summary of Interlude 11b: Sodium borohydride (326 mg, 8.61 mmol) was added to a stirred solution of 1-(2-amino-3-methyl-5-(trifluoromethoxy)phenyl)-2-chloroethanone 11a (1.92 g, 7.17 mmol) in tert-butanol (50 mL) and water (5 mL). The reaction mixture was stirred at room temperature for 30 min and at 90 °C for 2.5 h. Water (50 mL) was added, and the product was extracted with diethyl ether (2x). The organic phases 235211 1125993 of 97 combined samples were washed with brine, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by ultrafast chromatography (Stationary phase: Biotage® SNAP Ultra 25 g Silica, Mobile phase: gradient from 100 / 0 to 20 / 80 of heptane / EtOAc). The desired fractions were combined, concentrated under reduced pressure, co-evaporated with heptane and vacuum dried at 50 °C to provide 7-methyl-5(trifluoromethoxy)-1H-indole 11b (1.2 g). Summary of intermediate 11c: A mechanically stirred solution of 7-methyl-5-(trifluoromethoxy)-1H-indole 11b (1.5 g, 6.97 mmol) in CH2Cl2 (100 mL) was cooled to 0 °C in a nitrogen atmosphere. A 1 M diethylaluminum chloride solution in hexane (10.5 mL, 10.5 mmol) was added dropwise, and the resulting mixture was maintained at 0 °C for 25 min. A 2-(4-chloro-2-methoxyphenyl)acetyl chloride solution (2.29 g, 10.5 mmol) in CH2Cl2 (40 mL) was added dropwise while maintaining the reaction temperature below 6 °C. Stirring continued at 0 °C for 1 h, and the reaction mixture was subsequently stirred at room temperature for 1 h. The reaction mixture was cooled to 0 °C and a Rochelle salt solution [CAS 6100-16-9] (3.94 g, 13.9 mmol) in water (4 mL). After stirring for 1 h, the reaction mixture was filtered over dicalite® and the filter cake was washed with THF (5 x 100 mL). The combined filtrates were evaporated under reduced pressure. The residue solidified after standing overnight. The solids were stirred in CH3CN (5 mL), removed by filtration, washed with CH3CN (3 x 1.5 mL), and dried under vacuum at 50°C to provide 2-(4-chloro-268 235211 1125993 97 methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3yl)ethanone 11c (1.9g). Summary of Interlude 11d: A stirred solution of 2-(4-chloro-2-methoxyphenyl)-15 (7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone11c (2.13 g, 5.35 mmol) in THF (80 mL) was cooled to 0 °C in an N2 atmosphere. Phenyltrimethylammonium tribromide [CAS 4207-56-1] (2.11 g, 5.62 mmol) was added and the reaction mixture was stirred at 0 °C for 40 min and at room temperature for 2 h. The solids were removed by filtration and washed with THF (2x). The combined filtrates were evaporated at reduced pressure to provide 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 11d (3.45 g), which was used without further purification in the next stage. 235211 1125993 of 97 Synthesis of Compound 11 and chiral separation of Enantiomers 11A and 11B: A mixture of 2-bromo-2-(4-chloro-2-methoxyphenyl)-1-(7-methyl-5-(trifluoromethoxy)-1H-indol-3-yl)ethanone 11d (3.45 g, 6.87 mmol), 3-methoxy-5-(methylsulfonyl)aniline [CAS 62606-02-4] (2.76 g, 13.7 mmol), and diisopropylethylamine (2.37 mL, 13.7 mmol) in CH3CN (60 mL) was stirred at room temperature for 2 days in an atmosphere of N2. Water (125 mL) was added, and the product was extracted with Et2O (2x). The combined organic phases were washed with brine, dried over MgSO4, filtered, and evaporated under reduced pressure. The residue was purified by preparative HPLC (Stationary phase: RP XBridge® Prep C18 OBD - 10 gm, 50 x 150 mm, Mobile phase: solution of NH4HCO3 at 0.25% in water, CH3CN). The product-containing fractions were combined and evaporated under reduced pressure to provide racemic 2-(4-chloro-2-methoxyphenyl)-2-((3-methoxy-5-(methylsulfonyl)phenyl)amino)-1-(7-methyl-5-(trifluoromethoxy)-1-H-indol-3-yl)ethanone (Compound 11, 1.74 g). Chiral separation of the enantiomers of Compound 11 (1.74 g) was made by preparative SFC (Stationary phase: Chiralpak® Diacel AS 20 x 250 mm, Mobile phase: CO2, EtOH + 0.4% iPrNH2). The product fractions were combined and evaporated under reduced pressure to yield Enantiomer 11A as the first eluted product and Enantiomer 11B as the second eluted product. Both enantiomers were precipitated in a solvent mixture of MeOH and water, removed by filtration, and dried at 50 °C under vacuum to yield Enantiomer 11A (777 mg) and Enantiomer 11B (777 mg). 11B (712 mg). 235211 1125993 of 97 Enantiómero 11A: 1H RMN (600 MHz, DMSO-d6 δ ppm 2.50 (s, 3 H) 3.09 (s, H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.28 (d, J=7.8 Hz, 1 H) 6.56 - 6.63 (m, 2 H) 6.92 (s a, 1 H) 6.97 (dd, J=8.4, 1.9 Hz, 1 H) 7.05 (s a, 1 H) 7.07 (d, J=7.9 Hz, 1 H) 7.13(d, J=1.9 Hz, 1 H) 7.35 (d, J=8.4 Hz, 1 H) 7.90 (s a, 1 H) 8.53 (s, 1 H) 12.41 (s a, 1 H) LC / MS (método método LC-A): TR 1.26 min, MH+597 [«]d20: +81.3° (c 0.3455, DMF) SFC quiral (método SFC-E): TR 2.96 min, MH+597, pureza quiral 100%. Enantiómero 11B: 1H RMN (600 MHz, DMSO-d6) δ ppm 2.51 (s, 3 H) 3.09 (s, H) 3.72 (s, 3 H) 4.00 (s, 3 H) 6.28 (d, J=7.9 Hz, 1 H) 6.58 - 6.60 (m, 2 H) 6.92 (t, J=1.8 Hz, 1 H) 6.97 (dd, J=8.4, 1.9 Hz, 1 H) 7.05 (s a, 1 H) 7.06 (d, J=7.9 Hz, 1 H) 7.13 (d, J=2.1 Hz, 1 H) 7.35 (d, J=8.2 Hz, 1 H) 7.89 (s a, H) 8.53 (s, 1 H) 12.37 (s a, 1 H) LC / MS (LC-A method): TR 1.26 min, MH+597 [«]d20: -87.4° (c 0.342, DMF) Chiral SFC (SFC-E method): TR 3.44 min, MH+597, chiral purity 100%. ANTIVIRAL ACTIVITY OF THE COMPOUNDS OF THE INVENTION DENV-2 antiviral assay The antiviral activity of all compounds of the invention was tested against DENV-2 strain 16681, which was labeled with enhanced green fluorescent protein (eGPF; Table 1). The culture medium consisted of a minimal essential medium supplemented with 2% heat-inactivated fetal bovine serum, 0.04% gentamicin (50 mg / mL), and 2 mM L-glutamine. Vero cells were suspended, 235211 1125993 of 97 obtained from ECACC, in the culture medium, and pL were added to 384-well plates (2500 cells / well), which still contained the antiviral compounds. Typically, these plates contain serial dilutions with a factor of 5, of 9 dilution steps of the assay compound to 200 times the final concentration in 100% DMSO (200 nL). In addition, each compound concentration is assayed in quadruplicate (final concentration range: 25 μM ± 0.000064 μM or 2.5 μM ± 0.0000064 μM for the most active compounds). Finally, each plate contains wells designated as virus controls (containing cells and virus in the absence of the compound), cell controls (containing cells in the absence of both virus and compound), and medium controls (containing medium in the absence of cells, virus, and compound). In the wells designated as medium controls, 25 μL of culture medium was added instead of Vero cells.Once the cells were added to the plates, the plates were incubated for 30 minutes at room temperature to allow the cells to distribute homogeneously within the wells. The plates were then incubated (37 °C, 5% CO2) overnight. Next, the eGFP-labeled DENV-2 strain 16681 was added at a multiplicity of infection (MOI) of 0.5. Therefore, 15 μL of virus suspension was added to all wells containing assay compounds and to the wells designated as virus controls. In parallel, 15 μL of culture medium was added to the medium and cell controls. The plates were then incubated for 3 days in a fully humidified incubator (37 °C, 5% CO2). On the day of reading, eGFP fluorescence was measured. 235211 1125993 of 97 using an automated fluorescence microscope at 488 nm (blue laser). Using a proprietary LIMS system, inhibition dose response curves were calculated for each compound, and the effective concentration that produces half the maximum effect (EC50) was determined. Therefore, the percentage inhibition (I) for each assay concentration is calculated using the following formula: I = 100*(St-Scc) / (Svc-Scc); St, Scc, and Svc are the eGFP signal amounts in the assay compound, cell control, and virus control wells, respectively. cE50 represents the concentration of a compound at which virus replication is inhibited by 50%, as measured by a 50% reduction in eGFP fluorescence intensity compared to the virus control. cE50 is calculated using linear interpolation. In parallel, the toxicity of the compounds is tested on the same plates. Once the eGFP signal is read, 40 pL of ATPlite, a cell viability dye, is added to all wells of the 384-well plates. ATP is present in all metabolically active cells, and its concentration decreases very rapidly when cells undergo necrosis or apoptosis. The ATPlite assay system is based on the light production triggered by the reaction of ATP with the addition of luciferase and D-luciferin. The plates were incubated for 10 minutes at room temperature. The plates were then measured using a ViewLux analyzer. Half the maximum cytotoxic concentration (CC50) was also determined, defined as the concentration required to reduce the luminescence signal by 50% compared to the initial concentration. 235211 1125993 of 97 with that of the cell control wells. Finally, the selectivity index (SI) for the compounds was determined, which was calculated as follows: SI = CC50 / CE50. Table 1: CE50, CC50 and SI for the compounds of the invention in the DENV-2 antiviral assays compound# EC50 CC50 SI N (μΜ) N (μΜ) N 1 0.00052 5 5.5 4 11500 4 1A 0.00026 8 4.3 8 19700 8 1B 0.012 6 6.5 6 530 6 2 0.00060 4 5.0 4 8410 4 2A 0.00026 4 4.8 4 22000 4 2B 0.026 4 7.4 4 285 4 3 0.00058 4 >11 6 37700 4 3A 0.00025 5 7.2 5 29800 5 3B 0.0038 3 >9.7 5 2480 3 4 0.00039 4 5.9 4 14900 4 4A 0.00027 11 4.2 13 16900 11 4B 0.036 5 12 5 341 5 5 0.00062 4 5.5 4 8780 4 5A 0.00041 5 5.0 5 12900 5 5B 0.068 4 13 4 206 4 6A 0.000068 8 >25 8 >65500 8 6B 0.019 4 11 4 603 4 7 0.00047 4 3.2 3 >7040 3 7A 0.013 3 6.8 3 538 3 7B 0.00020 5 3.2 5 18500 5 8 0.00013 6 2.9 7 30400 6 8A 0.0030 3 7.4 3 2510 3 8B 0.000069 5 3.4 5 >40900 5 235211 1125993 of 97 compound# EC50 CC50 (μM) N SI N (μM) N 9 0.000074 6 3.1 8 >39100 6 9A 0.000067 9 2.9 9 >37500 9 9B 0.0038 5 6.2 6 1480 5 10A 0.00012 3 2.6 3 22600 3 10B 0.0039 3 9.8 3 2530 3 11A 0.000085 3 2.6 3 30100 3 11B 0.0041 3 9.2 3 2220 3 N = the number of independent experiments in the that the compounds were tested. Tetravalent reverse transcriptase assay-quantitative PCR (RT-qPCR): Protocol A. The antiviral activity of the compounds of the invention was tested against DENV-1 strain TC974#666 (NCPV; Table 6), DENV-2 strain 16681 (Table 7), DENV-3 strain H87 (NCPV; Table 8), and DENV-4 strains H241 (NCPV; Table 9A) and SG / 06K2270DK1 / 2005 (Eden; Table 9B) in an RT-qPCR assay. Therefore, Vero cells were infected with DENV-1, -2, -3, or -4 in the presence or absence of the test compounds. On day 3 post-infection, the cells were lysed and the cell lysates were used to prepare cDNA from a viral target (the 3'UTR 15 of DENV; Table 2) and a cellular reference gene (β-actin, Table 2). Subsequently, a real-time hybrid PCR was performed on a Lightcycler480 instrument. The generated Cp value is inversely proportional to the amount of RNA expression of these targets. Inhibition of DENV replication by the assay compound results in a Cp shift for the 3'UTR gene. Furthermore, if an assay compound is toxic to the 235211 1125993 of 97 cells, a similar effect on β-actin expression will be observed. The comparative AACp method is used to calculate CE50, which is based on the relative gene expression of the target gel (3'UTR) normalized with the cellular constitutive gene (β-actin). Table 2: Primers and probes used for quantitative real-time RT-PCR. Primer / probe Target Sequence^ b F3utr258 DENV UTR 3' - 5'-CGGTTAGAGGAGACCCCTC-3' R3utr425 DENV UTR 3' - 5'-GAGACAGCAGGATCTCTGGTC-3' P3utr343 DENV UTR 3' - FAM-5'-AAGGACTAG-ZEN- AGGTTAGAGGAGACCCCCC-3'-lABkFQ Factin743 β-actin 5'-GGCCAGGTCATCACCATT-3' Ractin876 β-actin 5'-ATGTCCACGTCACACTTCATG-3' Pactin773 β-actin HEX-5'-TTCCGCTGC-ZEN- CCTGAGGCTCTC-3'-lABkFQ The marker dyes (FAM, HEX) and the inactivating elements (ZEN and IABkFQ) are indicated in bold and italics. The primer and probe nucleotide sequences were selected from the conserved region in the 3'UTR region of the dengue virus genome, based on 300 nucleotide sequences from the four dengue serotypes deposited in Genbank (Gong et al., 2013, Methods Mol Biol, Chapter 16). The culture medium consisted of a minimal essential medium supplemented with 2% heat-inactivated fetal bovine serum, 0.04% gentamicin (50 mg / mL), and 2 mM L-glutamine. Vero cells were suspended, 235211 1125993 of 97 obtained from ECACC, in the culture medium, and 75 pL / well were added to 96-well plates (10,000 cells / well) that already contained the antiviral compounds. Typically, these plates contain serial dilutions with a factor of 5 of 9 dilution steps of the assay compound to 200 times the final concentration in 100% DMSO (500 nL; final concentration range: 25 μM - 0.000064 μM or 2.5 μM - 0.0000064 μM for the most active compounds). In addition, each plate contains wells that are designated as virus controls (containing cells and virus in the absence of compound) and cell controls (containing cells in the absence of virus and compound). Once the cells were added to the plates, the plates were incubated in a fully humidified incubator (37 °C, 5% CO2) until the following day. Dengue virus serotypes -1, 2, 3, and 4 were diluted to obtain a Cp of ~22–24 in the assay.Therefore, 25 μL of virus suspension was added to all plates containing the assay compound and to the wells designated as virus controls. In parallel, 25 μL of culture medium was added to the cell controls. The plates were then incubated for 3 days in a fully humidified incubator (37 °C, 5% CO2). After 3 days, the supernatant was removed from the wells and the cells were washed twice with ice-cooled PBS (~100 μL). The cell pellets in the 96-well plates were stored at -80 °C for at least 1 day. RNA was then extracted using the Cells-to-CT™ lysis kit, according to the manufacturer's guidelines (Life Technologies). The cell lysates can be stored at -80 °C or used 235211 1125993 of 97 immediately in the reverse transcription stage. In the preparation of the reverse transcription step, mixture A (Table 3A) was prepared and 7.57 pL / well was dispensed into a 96-well plate. After the addition of 5 pL of cell lysates, a five-minute denaturation step was performed at 75 °C (Table 3B). Then, 7.43 pL of mixture B (Table 3C) was added, and the reverse transcription step (Table 3D) was initiated to generate cDNA. Finally, an RT-qPCR mixture, mixture C (Table 4A), was prepared and 22.02 pL / well was dispensed into 96-well LightCycler qPCR plates into which 3 pL of cDNA was added and qPCR was performed according to the conditions in Table 4B in a LightCycler 480. Using LightCycler software and a proprietary LIMS system, dose response curves were calculated for each compound and the effective concentration that produces half of the maximum effect (EC50) and half of the maximum cytotoxic concentration (CC50) were determined. 235211 1125993 of 97 Table 3: cDNA synthesis using Mixture A, denaturation, Mixture B and 235211 1125993 of 97 Expand RT RNase Inhibitor dNTPs Buffer 2 Expand HIFI Mixing Element Samples mM mM Unit Concentration 864 Total Mixing Volume (mL) 50.00 40.00 10.00 25.00 10.00 Reserve 0.33 1.00 1.00 3.50 1.00 Final 7.43 0.13 0.50 2.00 2.80 2.00 1 sample Volume for (mL) 112.3 432.0 1728.0 2419.2 1728.0 x samples co Retention Denaturation Stage OQ 75°C Temp. Retention (_n Time 235211 1125993 of 97 Retention Denaturation Transc. Inv. Stage or Q IO LO or Q 42°C Temp. Retention (_n 30' Time D cDNA synthesis protocol 235211 1125993 of 97 Pactin773 Ractin876 Factin743 P3utr343 R3utr425 F3utr258 Roche Mix 2xMM H2O Roche PCR Quality Mixing Element Samples Mixture Volume / Tube (µL) µL µL µL µL µL µL µL Unit Concentration 00 ω ω 20 20 20 20 20 20 Reserve 0.1 0.3 0.3 0.1 0.3 0.3 Final 22.02 0.13 0.38 0.38 0.13 0.38 0.38 12.50 7.74 1 sample Volume for (µL) Reaction Vol. (µL) 108.29 316.54 316.54 108.29 316.54 316.54 10412.50 6447.42 x samples 25 Table 4: qPCR protocol and mixture. 235211 1125993 of 97 Cooling Elongation Hybridization Preincubation denaturation / denat. OQ stage 72°C ΟΊ CO or Q ΙΟ Cn or Q <O Cn O Q Temp. 10 sec 1 sec 1 min 10 sec 10 min Tiempo 1.5 4.4 2.2 4.4 4.4 Índice de rampa 40 ciclos cDNA 3.00 235211 1125993 of 97 Quantitative tetravalent reverse transcriptase-PCR assay (RT-qPCR): Protocol B. The antiviral activity of the compounds of the invention was tested against the Djibouti strain of DENV-1 (D1 / H / IMTSSA / 98 / 606; Table 6), the NGC strain of DENV-2 (Table 7), the H87 strain of DENV-3 (Table 8), and the SG / 06K2270DK1 / 2005 strain of DENV-4 (Table 9B) in an RTqPCR assay. Vero-B or Vero-M cells (5 × 10⁴) were seeded in 96-well plates. One day later, the culture medium was replaced with 100 pL of test medium containing a 2χ, 3χ or 5χ serial dilution of the compound (concentration range: 50 pg / mL - 0.00038 pg / mL, 50 pg / mL - 0.0076 pg / mL and 50 pg / mL - 0.00013 pg / mL, respectively) and 100 pL of dengue virus (DENV) inoculum.After a 2-hour incubation period, the cell monolayer was washed three times with assay medium to remove residual non-adsorbed virus, and the cultures were further incubated for 4 days (DENV-2 NGC) or 7 days (DENV-1 Djibouti strain D1 / H / IMTSSA / 98 / 606, DENV-3 prototype strain H87, DENV-4 strain H241, and DENV-4 strain EDEN) in the presence of the inhibitor. The supernatant was collected, and the viral RNA load was determined by quantitative real-time RT-PCR. The 50% effective concentration (EC50), defined as the concentration of compound required to inhibit viral RNA replication by 50%, was determined using logarithmic interpolation. RNA was isolated from 100 pL (or in some circumstances 150 pL) of supernatant using the NucleoSpin 96 Virus kit (Filter Service, Düren, Germany) as described by the manufacturer. The sequences of the TaqMan primers (DENV84) 235211 1125993 of 97 For DENV-Rev (Table 5) and TaqMan probes (DENV-Probe Table 5) were selected from nonstructural gene 3 (NS3) or NS5 of the respective flaviviruses using Primer Express software (version 2.0; Applied Biosystems, Lennik, Belgium). The TaqMan probe was fluorescently labeled with 6-carboxyfluorescein (FAM) at the 5' end as the label dye, and with minor groove ligand (MGB) at the 3' end as the inactivator (Table 5). One-step quantitative RT-PCR was performed in a total volume of 25 pL, containing 13.9375 pL of H2O, 6.25 pL of master mix (Eurogentec, Seraing, Belgium), 0.375 pL of forward primer, 0.375 pL of reverse primer, 1 pL of probe, 0.0625 pL of reverse transcriptase (Eurogentec), and 3 pL of sample. RT-PCR was performed using the ABI 7500 Fast Real-Time PCR System (Applied Biosystems, Branchburg, New Jersey, USA) under the following conditions: 30 min at 48 °C and 10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.The data were analyzed using ABI software. PRISM 7500 SDS (version 1.3.1; Applied Biosystems). For quantification, standard curves were generated using dilutions with a dilution factor of 10 from model preparations of known concentrations. Table 5: Primers and probes used for quantitative real-time RT-PCR. Primer / Probe Sequence (5' ^ 3') a Source b Target DENV-Dir TCGGAGCCGGAGTTTACAAA (SEQ ID N.1) DENV 2 NGC NS3 DENV-Inv TCTTAACGTCCGCCCATGAT (SEQ ID N.2) DENV-Probe FAM- ATTCCACACAATGTGGCAT- MGB (SEQ ID N.3) 235211 1125993 of 97 Primer / Probe Sequence (5' ^ 3') a Source b Diana DenS GGATAGACCAGAGATCCTGCTGT (SEQ ID N.4) DENV-1, -3, -4 NS5 DenAS1-3 CATTCCATTTTCTGGCGTTC (SEQ ID N.5) DENV-1, -3 DenAS4 CAATCCATCTTGCGGCGCTC (SEQ ID N.6) DENV-4 DEN_1-3 probe FAM-CAGCATCATTCCAGGCACAG- MGB (SEQ ID N.7) DENV-1, -3 DEN_4 probe FAM- CAACATCAATCCAGGCACAG- MGB (SEQ ID N.8) DENV-4 The marker dye (FAM) and the inactivating element (MGB / TAMRA) are indicated in bold and italics. b The nucleotide sequence and position of the primers and probes within the genome were deduced from the nucleotide sequence of DENV 2 NGC (accession number) GenBank M29095; Irie et al., 1989), Djibouti strain D1 / H / IMTSSA / 98 / 606 of dengue virus serotype 1 (Genbank Accession Number AF298808), prototype strain H87 of dengue virus serotype 3 (c93130), strain H241 of dengue virus serotype 4 (no sequences available), EDEN strain of dengue virus serotype 4 (no sequences available) Cytotoxic assay The potential cytotoxic effects of the compounds were evaluated in inactivated, uninfected Vero-B or Vero-M cells. Cells were seeded at 5 × 10⁴ cells / well in a 96-well plate in the presence of serial dilutions with a dilution factor of two, three, or five (ranging from 50 gg / mL ≥ 0.0038 gg / mL, 50 gg / mL ≥ 0.0076 gg / mL, and 50 gg / mL ≥ 0.0076 gg / mL, respectively). 235211 1125993 of 97 pg / mL - 0.00013 pg / mL, respectively) of compound and were incubated for 4 to 7 days. The culture medium was discarded and 100 pL of 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H5 tetrazolium / phenazine methosulfate (MTS / PMS; Promega, Leiden, The Netherlands) in PBS was added to each well. After an incubation period of 2 hours at 37 °C, the optical density was determined at 498 nm. Cytotoxic activity was calculated using the following formula: % cell viability = 100 χ (OD compound / ODcc), where OD compound and ODcc correspond to the optical density at 498 nm of uninfected cell cultures treated with the compound and that of untreated, uninfected cell cultures, respectively. The cytotoxic concentration at 50% (i.e., the concentration that reduces the total number of cells by 50%; cc5ü) was calculated using linear interpolation. 235211 1125993 of 97 Table 6: CE50, CC50 and SI for compounds against serotype 1 in RT-qPCR assays 235211 1125993 of 97 Table 7: CE50, CC50 and SI for compounds against serotype 2 in RT-qPCR assays 235211 1125993 of 97 OH U CD Η3 was OH II (D (D OH U (D X Ό (D H3 (D 3 The ω 11A V0I 9A CO ro 7B 6A 5A 4A 3A 1A compuesto# 0.0012 0.0037 0.0021 Cn CO CO 0.019 0.053 0.015 CO 0.019 0.023 (μΜ) EC50 H87 de CO CO CO 4^ co 4^ 4^ 0 4^ 4^ 0 3 serotipo Protocolo >2.5 1.0 1.6 2.1 1.6 O 4.4 3.1 4.1 4.3 3.7 (μΜ) CC50 CO co I—1 CO CO CO to 4^ CO CO Cn 3 3 de >2630 to co 4^=. <0 to CO CO Cn IO Cn to to 169 IS RT-qPCR CO co I—1 co co CO to 4^> co co Cn 3 ND ND ND ND ND <0.014 0.022 <0.014 ND <0.014 <0.015 (μΜ) EC50 co ND ND ND ND ND I—1 I—1 I—1 ND I—1 CO 3 de serotipo ND ND ND ND ND > 92 9.2 4.3 ND 7.3 co (μΜ) CC50 Protocolo B ND ND ND ND ND CO to 4^ ND CO 0 3 3 de ND ND ND ND ND >6571 422 >307 ND >521 >533 IS RT-qPCR 3 ü 3 ü 3 ü 3 ü 3 ü I—1 I—1 I—1 3 ü I—1 CO 3 Tabla 8: CE50, CC50 y SI para los compuestos frente a serotipo 3 en los ensayos RT-qPCR 235211 1125993 de 97 Tabla 9: CE50, CC50 y SI para los compuestos frente a serotipo 4 en los ensayos RT-qPCR A RT-qPCR Serotype 4 Protocol A H241 EC50 CC50 compound# (μΜ) N (μΜ) N YES N 1A 0.093 10 3.0 9 30 9 2A 0.083 6 3.7 6 42 6 3A 0.11 6 3.8 4 37 4 4A 0.053 11 2.5 11 54 11 5A 0.10 6 4.0 6 39 6 6A 0.095 7 7.7 5 69 5 7B 0.044 5 2.2 5 53 5 8B 0.015 5 1.7 3 122 3 9A 0.012 5 1.5 5 121 5 10A 0.011 3 1.6 2 127 2 11A 0.011 3 3.1 3 >250 3 N = the number of independent experiments in the 5 in which the compounds were tested. B RT-qPCR Serotype 4 EDEN Protocol A EC50 CC50 compound# (μΜ) N (μΜ) N YES N 1A 0.0024 5 4.6 5 1927 5 2A 0.0013 2 5.0 2 3913 2 3A 0.0030 2 5.4 2 1802 2 > 4A 0.00055 2 > 2.5 1 4520 1 5A 0.0029 2 5.5 2 1878 2 235211 1125993 of 97 6A 0.00042 2 > 10 2 > 24085 2 N = the number of independent experiments in the that the compounds were tested. It is hereby stated that, as of this date, the best method known to the applicant to put the aforementioned invention into practice is the one that is clear from the present description of the invention. 235211 1125993 of 97 LIST OF SEQUENCES <110> Janssen Pharmaceuticals, Inc Katholieke Universiteit Leuven <120> Mono- or disubstituted indole derivatives as inhibitors of dengue viral replication <130> TIP 328 PCT <150> EP15166900.9 <151> 08-05-2015 <150> EP16163342.5 <151> 31-03-2016 <160> 14 <170> BiSSAP 1.2 <210> 1 <211> 20 <212> DNA <213> Dengue virus <220> <221> fountain <222> 1..20 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 1 tcggagccgg agtttacaaa20 <210> 2 <211> 20 <212> DNA < 213> Dengue virus <220> < 221> source < 222>1..20 < 223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 2 tcttaacgtc cgcccatgat < 210>3 < 211>19 < 212> DNA < 213> Dengue virus < 220> < 221> source < 222>1..19 < 223> / organism=Dengue virus / mol_type=unassigned DNA < 400>3 attccacaca atgtggcat19 235211 1125993 of 97 < 210> 4 < 211> 23 < 212> DNA <213> Dengue virus <220> <221> fountain <222> 1..23 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 4 ggatagacca gagatcctgc tgt23 <210> 5 <211> 20 <212> DNA < 213> Dengue virus <220> < 221> source < 222>1..20 < 223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 5 cattccattt tctggcgttc < 210>6 < 211>20 < 212> DNA < 213> Dengue virus < 220> < 221> source < 222>1..20 < 223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 6 caatccatct tgcggcgctc20 <210> 7 <211> 20 <212> DNA < 213> Dengue virus <220> < 221> source < 222>1..20 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 7 cagcatcatt ccaggcacag <210> 8 <211> 20 <212> DNA <213> Dengue virus 235211 1125993 of 97 <220> <221> fountain <222> 1..20 <223> / orgam'smo=Dengue virus / type_mol=Unassigned DNA <400> 8 caacatcaat ccaggcacag20 <210> 9 <211> 19 <212> DNA < 213> Dengue virus <220> < 221> source < 222>1..19 < 223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 9 cggttagagg agacccctc < 210>10 < 211>21 < 212> DNA < 213> Dengue virus < 220> < 221> source < 222>1..21 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 10 gagacagcag gatctctggt c21 <210> 11 <211> 28 <212> DNA < 213> Dengue virus <220> < 221> source < 222>1..28 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 11 aaggactaga ggttagagga gacccccc <210> 12 <211> 18 <212> DNA <213> Dengue virus <220> <221> fountain <222> 1..18 235211 1125993 of 97 <223> / orgam'smo=Dengue virus / type_mol=Unassigned DNA <400> 12 ggccaggtca tcaccatt <210> 13 <211> 21 <212> DNA <213> Dengue virus <220> <221> fountain <222> 1..21 <223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 13 atgtccacgt cacacttcat g21 <210> 14 <211> 21 <212> DNA < 213> Dengue virus <220> < 221> source < 222> 1..21 < 223> / organism=Dengue virus / mol_type=Unassigned DNA <400> 14 ttccgctgcc ctgaggctct c 235211 1125993 of 97 20225952036 CRISTIAN DANIEL BITTEL - 20225952036 Digitally signed by PORTALTRAMITES - INPI Date: 2020.10.05 12:56:41 -03:00 Reason: Digitally Signed by the INPI Location: Buenos Aires, Argentina 1125993

Claims

1. A compound of formula (I), a stereoisomeric form, a pharmaceutically acceptable salt, solvate, or polymorph thereof; said compound being selected from the group wherein: R1 is H, R2 is F, and R3 is H or CH3; R1 is H, CH3, or F; R2 is OCH3 and R3 is H; R1 is H, R2 is OCH3 and R3 is CH3; R1 is CH3, R2 is F, and R3 is H; R1 is CF3 or OCF3; R2 is H and R3 is H; R1 is OCF3; R2 is OCH3 and R3 is H; and R1 is OCF3; R2 is H and R3 is CH3. Nine claims follow.