Methods for dosing and treatment of B cell malignancies in adoptive cell therapy

Abstract

Provided are adoptive cell therapy methods involving the administration of doses of cells for treating disease and conditions, including certain B cell malignancies. The cells generally express recombinant receptors such as chimeric antigen receptors (CARs). In some embodiments, the methods are for treating subjects with chronic lymphocytic leukemia (CLL) and small lymphocytic lymphoma (SLL). In some embodiments, the methods are for treating subjects with relapsed or refractory CLL and SLL. Also provided are articles of manufacture and prophylactic treatments in connection with adoptive therapy methods.

Description

METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY Cross-Reference to Related Applications

[0001] This application claims priority from U.S. provisional application No. 62 / 774,168, filed November 30, 2018, entitled “METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY,” U.S. provisional application No. 62 / 774,858, filed December 3, 2018, entitled “METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY,” U.S. provisional application No. 62 / 847,897, filed May 14, 2019, entitled “METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY,” U.S. provisional application No. 62 / 854,957, filed May 30, 2019, entitled “METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY,” and U.S. provisional application No. 62 / 931,143, filed November 5, 2019, entitled “METHODS FOR DOSING AND TREATMENT OF B CELL MALIGNANCIES IN ADOPTIVE CELL THERAPY,” the contents of which are incorporated by reference in their entirety. Incorporation by Reference of Sequence Listing

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 735042019740SeqList.txt, created November 21, 2019, which is 34.1 kilobytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety. Field

[0003] The present disclosure relates in some aspects to adoptive cell therapy involving the administration of doses of cells for treating subjects with disease and conditions such as certain B cell malignancies, and related methods, compositions, uses and articles of manufacture. The cells generally express recombinant receptors such as chimeric antigen receptors (CARs). In some embodiments, the disease or condition is a chronic lymphocytic leukemia (CLL), such as relapsed or refractory CLL. In some embodiments, the disease or condition is a small lymphocytic lymphoma (SLL). In some embodiments, the subject is of a specific group or subset of CLL or SLL subjects, such as heavily pretreated or poor-prognosis subjects. Background

[0004] Chronic lymphocytic leukemia (and small lymphocytic lymphoma) is an indolent cancer in which immature lymphocytes are found in the blood and bone marrow and / or in the lymph nodes. Chronic lymphocytic leukemia and small lymphocytic lymphoma are the same disease, but in CLL cancer cells are found mostly in the blood and bone marrow. In SLL, cancer cells are found mostly in the lymph nodes. CLL is considered incurable. Patients eventually relapse or become refractory to available therapies. B cell receptor antagonists have shown improved outcomes for patients with relapsed / refractory CLL, however complete remission rates remain low, and patients who progress on or after therapy have poor outcomes. Effective therapies for patients with CLL and SLL who have failed B cell receptor antagonist therapy are needed. Provided are methods and uses that meet such needs. Summary

[0005] Provided herein are methods, uses, compositions, formulations and articles of manufacture for treating subjects having or suspected of having a disease or condition, such as a CLL, SLL, or a subtype thereof. The methods and other embodiments generally relate to administering to the subject T cells, generally engineered T cells, such as those expressing or containing a recombinant receptor such as a chimeric antigen receptor (CAR) or TCR.

[0006] In some embodiments, the dose of cells or cells administered in connection with any embodiments of the provided methods, compositions, articles of manufacture and uses, contains CD4* T cells or a subtype or phenotype thereof (such as engineered or recombinant receptor-expressing CD4* T cells) and / or CD8* T cells or a subtype thereof (such as an engineered or recombinant receptor- expressing CD4* cells). In some embodiments, the CD8* cells or subtype or phenotype are present at a particular dose or amount or number; in some embodiments the CD4* cells or subtype or phenotype are present at a particular dose or amount or number. In some embodiments, the CD8* cells or subtype or phenotype thereof and the CD4* cells or subtype or phenotype thereof, are present in the article or composition or combination, or are administered in the methods, at a defined ratio, such as at or about 1:1, or between at or about 1:3 and at or about 3:1. In some embodiments, the dose or administration contains or is of a particular amount or number of one population of the cells and the ratio is a defined ratio or is a naturally-occurring ratio, such as in the blood of the subject from which the cells are derived or ratio that occurs without selection or control for a particular ratio.

[0007] In some embodiments, the CD4* T cells (or subset thereof) and the CD8* T cells (or subset thereof), individually, contain a receptor that specifically binds to a target antigen expressed by the disease or condition, or a cell or tissue thereof, and / or that is associated with the disease or condition.

[0008] In some embodiments, the method of treating a subject having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), comprises administering to the subject a dose of engineered T cells comprising CD4* and CD8* T cells, the CD4* and the CD8* T cells comprising a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to a Bruton's Tyrosine Kinase inhibitor (BTKi), venetoclax or BTKi and venetoclax. In particular embodiments, the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to treatment with a BTKi and venetoclax. In some embodiments, the BTKi is ibrutinib.

[0009] In some embodiments, the method of treating a subject having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL) comprises administering to the subject a dose of engineered T cells comprising CD4+ and CD8+ T cells, the CD4+ and the CD8+ T cells, comprising a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to ibrutinib and / or venetoclax. In particular embodiments, the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to treatment with ibrutinib and venetoclax.

[0010] In some embodiments, the dose of engineered T cells is enriched for CD4+ and CD8+ primary human T cells.

[0011] In some embodiments, the dose of engineered T cells comprises a defined ratio of CD4+ cells expressing the CAR to CD8+ cells expressing the CAR, optionally wherein the ratio is between approximately 1:3 and approximately 3:1. In some embodiments, the dose of engineered T cells comprises at or about 2.5 x 107 total CAR-expressing cells to at or about 1.5 x 10° total CAR-expressing cells.

[0012] In some embodiments, the administration comprises administering a plurality of separate compositions, wherein the plurality of separate compositions comprising a first composition comprising one of the CD4* T cells and the CD8* T cells and a second composition comprising the other of the CD4* T cells and the CD8"* T cells. In certain embodiments of any of the provided methods, the receptor contained by the CD4* T cells and / or the receptor contained by the CD8* T cells comprises T cells having a recombinant receptor, and / or wherein the CD4* T cells and / or the CD8* T cells are genetically engineered to express the receptor.

[0013] In some aspects, the method comprises treating a subject having or suspected of having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), the method comprising administering to the subject a dose of engineered T cells comprising CD4+ and CD8+ T cells, the CD4+ and CD8+ T cells, comprising a CAR that specifically binds CD19, wherein the administration comprises administering a plurality of separate compositions, the plurality of separate compositions comprising a first composition comprising one of the CD4+ T cells and the CD8+ T cells and a second composition comprising the other of the CD4+ T cells and the CD8+ T cells.

[0014] In some embodiments, the dose of CD4* and CD8" engineered T cells comprises a defined ratio of CD4* cells expressing the CAR to CD8* cells expressing the CAR is between approximately 1:3 and approximately 3:1. In some embodiments, the dose of engineered T cells comprises at or about 2.5 x 107 total CAR-expressing cells to at or about 1.5 x 108 total CAR-expressing cells. In some embodiments, the dose of engineered T cells is enriched for CD4+ and CD8+ primary human T cells.

[0015] In some embodiments, the dose of cells enriched in CD4+ and CD8+ engineered T cells comprises greater than or greater than about 70%, greater than or greater than about 75%, greater than or greater than about 80%, greater than or greater than about 85%, greater than or greater than about 90%, greater than or greater than about 95% or greater than or greater than about 98% CD4+ and CD8+ primary human T cells.

[0016] In some embodiments, the dose of CD4* and CD8* engineered T cells comprises a defined ratio of CD4* cells expressing the CAR to CD8* cells expressing the CAR that is or is approximately 1:1. In some embodiments, the dose of engineered T cells comprises at or about 2.5 x 107 total CAR- expressing cells to at or about 1.0 x 10° total CAR-expressing cells. In some embodiments, the dose of engineered T cells comprises or about 2.5 x 107 total CAR-expressing cells. In some embodiments, the dose of engineered T cells comprises at or about 5 x 107 total cells or total CAR-expressing cells. In some embodiments, the engineered T cells comprises at or about 1 x 108 total cells or total CAR- expressing cells.

[0017] In some embodiments, the CAR comprised by the CD4* T cells and / or the CAR comprised by the CD8"* T cells comprises a CAR that is the same and / or wherein the CD4* T cells and / or the CD8* T cells are genetically engineered to express a CAR that is the same.

[0018] In particular embodiments, the first composition comprises the CD8" T cells and the second composition comprises the CD4+ T cells. In some embodiments, the initiation of the administration of the first composition is carried out prior to the initiation of the administration of the second composition.

[0019] In some embodiments, the administration of the first composition and the administration of the second composition are carried out on the same day, are carried out no more than 36 hours apart, no more than 24 hours apart, no more than 12 hours apart, no more than 6 hours apart, no more than 4 hours apart, no more than 2 hours apart, or no more than 1 hour apart or no more than 30 minutes apart. In some embodiments, the administration of the first composition and the administration of the second composition are carried out between at or about 0 and at or about 48 hours, between at or about 0 and at or about 36 hours, between at or about 0 and at or about 24 hours, between at or about 0 and at or about 12 hours, between at or about 0 and at or about 6 hours, between at or about 0 and at or about 2 hours, between at or about 0 and at or about 1 hours, between at or about 0 and at or about 30 minutes, between at or about 30 minutes and at or about 48 hours, between at or about 30 minutes and at or about 36 hours, between at or about 30 minutes and at or about 24 hours, between at or about 30 minutes and at or about 12 hours, between at or about 30 minutes and at or about 6 hours, between at or about 30 minutes and at or about 4 hours, between at or about 30 minutes and at or about 2 hours, between at or about 30 minutes and at or about 1 hour, between at or about 1 hours and at or about 48 hours, between at or about 1 hour and at or about 36 hours, between at or about 1 hour and at or about 24 hours, between at or about 1 hour and at or about 12 hours, between at or about 1 hour and at or about 6 hours, between at or about 1 hour and at or about 4 hours, between at or about 1 hour and at or about 2 hours, between at or about 2 hours and at or about 48 hours, between at or about 2 hours and at or about 36 hours, between at or about 2 hours and at or about 24 hours, between at or about 2 hours and at or about 12 hours, between at or about 2 hours and at or about 6 hours, between at or about 2 hours and at or about 4 hours, between at or about 4 hours and at or about 48 hours, between at or about 4 hours and at or about 36 hours, between at or about 4 hours and at or about 24 hours, between at or about 4 hours and at or about 12 hours, between at or about 4 hours and at or about 6 hours, between at or about 6 hours and at or about 48 hours, between at or about 6 hours and at or about 36 hours, between at or about 6 hours and at or about 24 hours, between at or about 6 hours and at or about 12 hours, between at or about 12 hours and at or about 48 hours, between at or about 12 hours and at or about 36 hours, between at or about 12 hours and at or about 24 hours, between at or about 24 hours and at or about 48 hours, between at or about 24 hours and at or about 36 hours or between at or about 36 hours and at or about 48 hours.

[0020] In some embodiments, the administration of the first composition and the administration of the second composition are carried out on the same day, are carried out between about 0 and about 12 hours apart, between about 0 and about 6 hours apart or between about 0 to 2 hours apart; or the initiation of administration of the first composition and the initiation of administration of the second composition are carried out between about 1 minute and about 1 hour apart or between about 5 minutes and about 30 minutes apart. In some embodiments, the first composition and second composition are administered no more than 2 hours, no more than 1 hour, no more than 30 minutes, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.

[0021] In some embodiments, the first composition and second composition are administered no more than 2 hours, no more than 1 hour, no more than 30 minutes, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.

[0022] In some embodiments of any of the provided methods, the subject has CLL or is suspected of having CLL; or the subject is identified or selected as having CLL. In some embodiments, the CLL is relapsed or refractory CLL.

[0023] In some embodiments, the subject has SLL or is suspected of having SLL; or the subject is identified or selected as having SLL. In some embodiments, the SLL is a relapsed or refractory SLL.

[0024] In some embodiments, prior to the administration of the dose of engineered T cells, the subject has been treated with one or more prior therapies for the CLL or SLL, other than another dose of cells expressing CAR or a lymphodepleting therapy. In some embodiments, the one or more prior therapy comprises at least two prior therapies, optionally three, four, five, six, seven, eight, nine or more.

[0025] In some embodiments, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with the one or more prior therapies for the CLL or SLL. In some embodiments, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies. In some embodiments, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with three or more prior therapies. In some embodiments, the prior therapies are selected from a kinase inhibitor, optionally an inhibitor of Bruton’s tyrosine kinase (BTK), optionally ibrutinib; venetoclax; a combination therapy comprising fludarabine and rituximab; radiation therapy; and hematopoietic stem cell transplantation (HSCT). In some embodiments, the prior therapies comprise ibrutinib and / or venetoclax. In some embodiments, the prior therapies comprise ibrutinib and venetoclax.

[0026] In some embodiments, the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to ibrutinib and / or venetoclax. In some embodiments, the subject has relapsed following remission after treatment with, become refractory to, failed treatment with and / or is intolerant to ibrutinib and venetoclax.

[0027] In some embodiments, at or prior to the administration of the dose of cells: the subject is or has been identified as having one or more cytogenetic abnormalities, optionally associated with high-risk CLL, optionally selected from among: complex karyotype or cytogenetic abnormalities, del 17p, unmutated IGVH gene, and TP53 mutation; the subject is or has been identified as having high-risk CLL.

[0028] In some embodiments, the subject is or has been identified as having an ECOG status of 0 or 1; and / or the subject does not have an ECOG status of >1. In some embodiments, at or immediately prior to the administration of the dose of engineered cells or the lymphodepleting therapy the subject does not have a Richter’s transformation of the CLL or SLL.

[0029] In some embodiments, the subject is an adult and / or is over at or about 50, 60, or 70 years of age.

[0030] In some embodiments, the T cells are primary T cells obtained from a subject. In some embodiments, the T cells are autologous to the subject. In some embodiments, the dose of engineered cells are viable cells.

[0031] In some embodiments, prior to the administration of the dose of engineered cells, lymphodepleting therapy is administered to the subject. In some embodiments, the subject has been preconditioned with a lymphodepleting therapy. In some embodiment, the lymphodepleting therapy comprises the administration of fludarabine and / or cyclophosphamide. In some embodiments, the lymphodepleting therapy comprises administration of cyclophosphamide at about 200-400 mg / m? optionally at or about 300 mg / m?, inclusive, and / or fludarabine at about 20-40 mg / m?, optionally 30 mg / m? daily for 2-4 days, optionally for 3 days. In some embodiments, the lymphodepleting therapy comprises administration of cyclophosphamide at or about 300 mg / m? and fludarabine at about 30 mg / m?daily for 3 days, optionally wherein the dose of cells is administered at least at or about 2-7 days after the lymphodepleting therapy or at least at or about 2-7 days after the initiation of the lymphodepleting therapy.

[0032] In some embodiments, at or prior to the administration of the dose of cells: the subject is or has been identified as having one or more cytogenetic abnormalities, optionally associated with high-risk CLL or SLL, optionally selected from among: complex karyotype or cytogenetic abnormalities, del 17p, unmutated IGVH gene, and TP53 mutation; and / or the subject is or has been identified as having high- risk CLL or SLL. In some embodiments, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies. In some embodiments, at or prior to the administration of the dose of cells, the subject is or has been identified as having a standard-risk CLL or SLL. In some embodiments, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with three or more prior therapies. In some embodiments, at or prior to the administration of the dose of cells, the subject is or has been identified as being intolerant to an inhibitor of Bruton’s tyrosine kinase (BTK) and has received an inhibitor of BTK for a duration of less than at or about 6 months, and / or is ineligible for treatment with an inhibitor of BTK.

[0033] In some embodiments, (i) the subject is or has been identified as having high-risk CLL or SLL, and at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with one or more prior therapies other than the inhibitor of BTK; or (ii) the subject is or has been identified as having a standard-risk CLL or SLL, and at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies other than the inhibitor of BTK.

[0034] In some embodiments, the administration of the cell dose and / or the lymphodepleting therapy is carried out via outpatient delivery. In some embodiments, the dose of cells is administered parenterally, optionally intravenously.

[0035] In some embodiments, the response in at least 35%, at least 40 %, at least 50%, at least 60% or at least 70% of subjects treated is complete remission (CR) in the subjects treated according to the method. In some embodiments, the duration of the response until progression is durable for greater than 3 months or greater than 6 months. In some embodiments, in the subjects treated according to the method, greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 month after administering the dose of cells.

[0036] In some embodiments, of the subjects treated according to the method, no more than 10% of subjects exhibit a cytokine release syndrome (CRS) higher than grade 2. In some embodiments, of a plurality of subjects treated according to the method, no more than 10%, no more than 20%, no more than 30% or no more than 40% of the subjects exhibit neurotoxicity higher than grade 2. In some embodiments, the plurality of subjects treated according to the method comprises a plurality of subjects that have relapsed following remission after treatment with, become refractory to, failed treatment with and / or is intolerant to ibrutinib and venetoclax.

[0037] In some aspects, the method comprises: assaying a biological sample for the level, amount or concentration of TNF-alpha, wherein the biological sample is from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells; and comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy.

[0038] In some embodiments, the subject is identified as at risk for developing a grade 3 or higher neurotoxicity, and the method further comprises: (i) administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and / or (b) the administering the cell therapy to the subject of the cell therapy is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (ii) administering to the subject an alternative treatment other than the cell therapy for treating the disease or condition.

[0039] In some embodiments, the subject is identified as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy, : (i) the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administration and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.

[0040] In some embodiments, the assaying comprises: (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for TNF-alpha, optionally wherein the one or more reagent comprises an antibody that specifically recognizes TNF-alpha; and (b) detecting the presence or absence of a complex comprising the one or more reagent and TNF-alpha.

[0041] In some aspects, the method comprises administering to a subject a cell therapy for treating a disease or condition, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR, wherein: (1) if the subject has a level, amount or concentration of TNF-alpha in a biological sample from the subject that is at or above a threshold level, the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy, and the method comprises: (i) administering to the subject the cell therapy at a reduced dose, (ii) further administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity; and / or (iii) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (2) if the subject is selected or identified as having a level, amount or concentration of TNF-alpha in a biological sample from the subject that is below a threshold level, the subject is identified as not at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy, (i) not administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administering and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic, wherein the subject is a candidate for treatment with the cell therapy, said biological sample obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells.

[0042] In some embodiments, the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy and the method comprises administering the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, wherein the agent is administered to the subject concurrently with the cell therapy or within three days of administering the cell therapy to the subject.

[0043] In some embodiments, the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and / or is within a standard deviation above the median or mean level, amount or concentration, or is or is about the median or mean level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition; the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the median or mean level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition; the threshold level is at or greater than 1.25-fold higher, at or greater than 1.3-fold higher, at or greater than 1.4-fold higher or at or greater than 1.5-fold higher than the level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.

[0044] In some embodiments, the threshold level is at or greater than 1000 pg / mL of the biological sample, at or greater than 1100 pg / mL of the biological sample, at or greater than 1200 pg / mL of the biological sample, at or greater than 1300 pg / mL of the biological sample, at or greater than 1400 pg / mL of the biological sample, or at or greater than 1500 pg / mL of the biological sample.

[0045] In some aspects, the method comprises: (a) assaying a biological sample from a subject for the level, amount or concentration of IL-16, said subject having received administration of a cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject within one, two, or three days after the initiation of administration of the cell therapy; and (b) comparing the level, amount or concentration of IL-16 to a threshold level, wherein: (1) if the level, amount or concentration of IL-16 is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity; and (2) if the level, amount or concentration of IL-16 is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity.

[0046] In some embodiments, if the subject is identified at risk of developing a grade 3 or higher neurotoxicity, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity is administered.

[0047] In some embodiments, the assaying comprises: (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for IL-16, optionally wherein the one or more reagent comprises an antibody that specifically recognizes IL16; (b) detecting the presence or absence of a complex comprising the reagent and IL-16. In some embodiments, the method further comprises prior to the assaying, administering to the subject the cell therapy.

[0048] In some aspects, the method comprises administering to a subject, identified as at risk of developing a grade 3 or higher neurotoxicity, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, said subject having previously received administration of a cell therapy for treating a disease or condition, wherein, at or immediately prior to administering the agent, the subject is selected or identified as being at risk of developing a grade 3 or higher neurotoxicity if the level or amount or concentration of IL-16 in a biological sample, obtained from the subject within one, two, or three days of the initiation of administration of the cell therapy, is above a threshold level.

[0049] In some embodiments, administering the agent is carried out at a time when the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic. In some embodiments, the administering to the subject the cell therapy was carried out on an outpatient basis and, if the level, amount or concentration of IL-16 is above a threshold level the method comprises admitting the patient to the hospital for one or more days.

[0050] In some embodiments, the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and / or is within a standard deviation above the median or mean level, amount or concentration, or is or is about the median or mean level, amount or concentration, of the IL-16 in a biological sample obtained, from a group of subjects, within one, two or three days after receiving a cell therapy comprising administration of a dose of engineered cells expressing the CAR for treating the same disease or condition, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of the cell therapy.

[0051] In some embodiments, the threshold level is at or greater than 1.3-fold higher, at or greater than 1.4-fold higher, at or greater than 1.5-fold higher, at or greater than 1.6-fold higher, at or greater than 1.7-fold higher, at or greater than 1.8-fold higher, at or greater than 1.9-fold higher or at or greater than 2.0-fold higher than the median or mean level, amount or concentration, of the IL-16 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition.

[0052] In some embodiments, the threshold level is at or greater than 1.3-fold higher, at or greater than 1.4-fold higher, at or greater than 1.5-fold higher, at or greater than 1.6-fold higher, at or greater than 1.7-fold higher, at or greater than 1.8-fold higher, at or greater than 1.9-fold higher or at or greater than 2.0-fold higher than the level, amount or concentration, of the IL-16 in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.

[0053] In some embodiments, the threshold level is at or greater than 1000 pg / mL of the biological sample, at or greater than 1500 pg / mL of the biological sample, at or greater than 2000 pg / mL of the biological sample, at or greater than 2500 pg / mL of the biological sample, or at or greater than 3000 pg / mL of the biological sample.

[0054] In some embodiments, the biological sample is or is obtained from a blood, plasma or serum sample. In some embodiments, the biological sample is a serum sample. In some embodiments, assaying or assessing cells the analyte comprises an immunoassay. In some embodiments, the disease or condition is a cancer. In some embodiments, the disease or condition is a myeloma, leukemia or lymphoma.

[0055] In some embodiments, the antigen is ROR1, B cell maturation antigen (BCMA), carbonic anhydrase 9 (CAIX), tEGFR, Her2 / neu (receptor tyrosine kinase erbB2), L1-CAM, CD19, CD20, CD22, mesothelin, CEA, and hepatitis B surface antigen, anti-folate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), EPHa2, erb-B2, erb-B3, erb-B4, erbB dimers, EGFR VIII, folate binding protein (FBP), FCRL5, FCRHS, fetal acetylcholine receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL-13R-alpha2, kinase insert domain receptor (kdr), kappa light chain, Lewis Y, L1-cell adhesion molecule, (L1-CAM), Melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-AG, Preferentially expressed antigen of melanoma (PRAME), survivin, TAG72, B7-H6, IL-13 receptor alpha 2 (IL-13Ra2), CA9, GD3, HMW-MAA, CD171, G250 / CAIX, HLA-AI MAGE Al, HLA-A2 NY-ESO-1, PSCA, folate receptor-a, CD44v6, CD44v7 / 8, avb6 integrin, 8H9, NCAM, VEGF receptors, 5T4, Foetal AchR, NKG2D ligands, CD44v6, dual antigen, a cancer-testes antigen, mesothelin, murine CMV, mucin 1 (MUC1), MUC16, PSCA, NKG2D, NY- ESO-1, MART-1, gp100, oncofetal antigen, ROR1, TAG72, VEGF-R2, carcinoembryonic antigen (CEA), Her2 / neu, estrogen receptor, progesterone receptor, ephrinB2, CD123, c-Met, GD-2, O- acetylated GD2 (OGD2), CE7, Wilms Tumor 1 (WT-1), a cyclin, cyclin A2, CCL-1, CD138, G Protein Coupled Receptor 5D (GPCRS5D), or a pathogen-specific antigen.

[0056] In some embodiments, the antigen is CD19.

[0057] In some embodiments, the disease or condition is a B cell malignancy and / or is acute lymphoblastic leukemia (ALL), adult ALL, chronic lymphoblastic leukemia (CLL), small lymphocytic lymphoma (SLL), non-Hodgkin lymphoma (NHL), and Diffuse Large B-Cell Lymphoma (DLBCL). In some embodiments, the disease or condition is CLL or SLL.

[0058] In some embodiments, the agent is or comprises tocilizumab, siltuximab or dexamethasone.

[0059] In some embodiments, the CAR comprises an extracellular antigen-binding domain specific for CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, which optionally is a 4-1 BB, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule, which optionally is a CD3zeta; the CAR comprises, in order, an extracellular antigen-binding domain specific for CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule.

[0060] In some embodiments, the antigen-binding domain is an scFv.

[0061] In some embodiments, the scFv comprises a CDRL1 sequence of RASQDISKYLN (SEQ ID NO: 35), a CDRL2 sequence of SRLHSGV (SEQ ID NO: 36), and / or a CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 37) and / or a CDRH1 sequence of DYGVS (SEQ ID NO: 38), a CDRH2 sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and / or a CDRH3 sequence of YAMDYWG (SEQ ID NO: 40); the scFv comprises a variable heavy chain region of FMC63 and a variable light chain region of FMC63 and / or a CDRL1 sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, a CDRH1 sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63 or binds to the same epitope as or competes for binding with any of the foregoing; the scFv comprises a VH set forth in SEQ ID NO:41 and a VL set forth in SEQ ID NO: 42, optionally wherein the VH and VL are separated by a flexible linker, optionally wherein the flexible linker is or comprises the sequence set forth in SEQ ID NO:24; and / or the scFv is or comprises the sequence set forth in SEQ ID NO:43.

[0062] In some embodiments, the costimulatory signaling region is a signaling domain of CD28 or 4-1BB. In some embodiments, the costimulatory signaling region is a signaling domain of 4-1BB.

[0063] In some embodiments, the costimulatory domain comprises SEQ ID NO: 12 or a variant thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto. In some embodiments, the primary signaling domain is a CD3zeta signaling domain. In some embodiments, the primary signaling domain comprises SEQ ID NO: 13 or 14 or 15 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

[0064] In some embodiments, the CAR further comprises a spacer between the transmembrane domain and the scFv. In some embodiments, the spacer is a polypeptide spacer that comprises or consists of all or a portion of an immunoglobulin hinge or a modified version thereof, optionally an IgG4 hinge, or a modified version thereof. In some embodiments, the spacer is about 15 amino acids or less, and does not comprise a CD28 extracellular region or a CD8 extracellular region. In some embodiments, the spacer is at or about 12 amino acids in length.

[0065] In some embodiments, the spacer has or consists of the sequence of SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or a variant of any of the foregoing having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto; and / or comprises or consists of the formula X;PPX,P, where X is glycine, cysteine or arginine and X; is cysteine or threonine.

[0066] In some of any of the embodiments, the subject is a human subject.

[0067] In some of any of the provided articles of manufacture, the article of manufacture comprises a composition of a cell therapy, or one of a plurality of compositions of a cell therapy, comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), and instructions for administering the cell therapy, wherein the instructions specify administering the T cell composition according to any of the provided methods. Brief Description of the Drawings

[0068] FIG. 1 shows a box plot of the frequency of CAR T cells in whole blood as measured by flow cytometry. The boxes extend from the 1% to the 3" quartile, with the median shown as a horizontal line. The whiskers extend to 1.5 times the inter-quartile range, with measurements outside this range plotted as individual points.

[0069] FIG. 2 shows a graph of the median cells / ul over time by dose level. Patients, N = 16; samples, n. Upper error bar represents the third quartile; lower error bar represents the first quartile. The dose was given on day 1.

[0070] FIG. 3A and FIG. 3B show graphs of the biomarker analysis of IL-16 and TNFa in patients over time. Patients, N = 13. Thirty-nine cytokines were analyzed in 13 patients within the first thirty days of treatment.

[0071] FIG.4A show results of the best overall response in subjects with R / R CLL (N=22) administered anti-CD19 CAR+ T cells at DL1 (5 x 107 CAR-expressing T cells) or DL2 (1 x 10° CAR- expressing T cells). FIG. 4B shows results of undetectable minimal residual disease (uMRD) in blood by flow cytometry or in bone marrow by next generation sequencing (NGS) at any time point following administration to subjects with R / R CLL of anti-CD19 CAR-expressing T cells at DL1 (5 x 10” CAR- expressing T cells) or DL2 (1 x 10° CAR-expressing T cells).

[0072] FIG. 5 shows a swimmer plot of the duration of response over time in subjects with R / R CLL (N=22) administered anti-CD19 CAR+ T cells at DL1 (5 x 10” CAR-expressing T cells) or DL2 (1 x 10% CAR-expressing T cells)..

[0073] FIG. 6 shows a graph of the median cells / ul over time by dose levels in subjects with R / R CLL administered anti-CD19 CAR+ T cells at DL1 (5 x 10” CAR-expressing T cells) or DL2 (1 x 10% CAR-expressing T cells). Upper error bar represents the third quartile, lower error bar represents the first quartile. The dose of anti-CD19 CAR+ T cells was given on day 1.

[0074] FIG. 7A show results of the best overall response in subjects with R / R CLL (N=22) or subjects who have failed prior treatment with both a Bruton’s tyrosine kinase inhibitor (BTKi) and venetoclax (N=9). FIG. 7B shows results of undetectable minimal residual disease (uMRD) in blood by flow cytometry or in bone marrow by next generation sequencing (NGS) at any time point following administration in subjects with R / R CLL (N=20) or subjects who have failed prior treatment with both a BTKi and venetoclax (N=8). “Evaluable for response defined as having a pretreatment assessment and >1 postbaseline assessment; evaluable for MRD was defined as patients with detectable MRD at baseline. One subject was not evaluable for response. “Failed venetoclax defined as discontinuation due to PD or <PR after >3 months of therapy. “Two subjects were not evaluable for MRD. “One subject was not evaluable for MRD. CI, confidence interval; CRi, complete response with incomplete blood count recovery; NGS, next-generation sequencing; nPR, nodular partial response; PD, progressive disease; PR, partial response; SD, stable disease; uMRD, undetectable minimal residual disease.

[0075] FIG. 8 shows a swimmer plot of the duration of response over time in individual subjects with R / R CLL who have failed prior treatment with both a BTKi and venetoclax, and the other treated subjects. *MRD non-evaluable. There were 7 on-study deaths: 5 subjects died from disease progression; 1 subject had grade 5 respiratory failure (DL1) unrelated to CAR+T cells therapy treatment; 1 subject had septic shock, acute kidney injury, and pneumonia (DL2), unrelated to CAR+T cells therapy treatment. No deaths occurred within the first 30 days. ND, not done; RT, Richter Transformation.

[0076] FIG. 9 shows a graph of the median cells / uL over time by dose levels in evaluable treated subjects and subjects who have failed prior treatment with both a BTKi and venetoclax. Upper error bar represents the third quartile, Lower error bar represents the first quartile. CAR+T cells therapy was given on Day 1. AUC. 29, area under the curve from days 0 to 29; Crax, maximum concentration; PK / PD, pharmacokinetic / pharmacodynamic; Q, quartile; Tia, time to maximum concentration. Detailed Description

[0077] Provided herein are methods and uses of engineered cells (e.g., T cells) and / or compositions thereof, for the treatment of subjects having a disease or condition, which generally is or includes a cancer or a tumor, such as a leukemia or a lymphoma, most particularly chronic lymphocytic leukemia (CLL), or small lymphocytic lymphoma (SLL). In some aspects, the methods and uses provide for or achieve improved response and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects, e.g., in particular groups of subjects treated, as compared to certain alternative methods. In some embodiments, the methods are advantageous by virtue of the administration of specified numbers or relative numbers of the engineered cells, the administration of defined ratios of particular types of the cells, treatment of particular patient populations, such as those having a particular risk profile, staging, and / or prior treatment history, and / or combinations thereof.

[0078] Also provided are methods that include assessing particular parameters, e.g., expression of specific biomarkers or analytes, that can be correlated with development of toxicity, and methods for treatment, €.g., intervention therapy, to prevent and / or ameliorate toxicities. Also provided are methods that involve assessing particular parameters, e.g., expression of specific biomarkers or analytes, that can be correlated with an outcome, such as a therapeutic outcome, including a response, such as a complete response (CR) or a partial response (PR); or a safety outcome, such as a development of a toxicity, for example, neurotoxicity or CRS, after administration of an immunotherapy and / or cell therapy. Also provided are methods to assess the likelihood of response and / or likelihood of risk of toxicity, based on assessment of the parameters, such as expression of biomarkers or analytes. Also provided are compositions for use in cell therapy. Also provided are articles of manufacture and kits, e.g., for use in the methods provided herein. In some embodiments, the articles of manufacture and kits optionally contain instructions for using, according to the methods provided herein.

[0079] In particular, among provided embodiments are methods of treating subjects with CLL or SLL. In some aspects, CLL is considered an incurable disease, and subjects eventually relapse or become refractory to available therapies or treatments. In some of any embodiments, the subjects have a high risk disease. In some embodiments of the provided methods, the subjects have a high risk CLL or SLL. In some cases, existing treatment strategies for high risk and very high risk subjects may include fludarabine, cyclophosphamide, and rituximab (FCR), Bruton’s tyrosine kinase (BTK) inhibitors (e.g. ibrutinib), and / or allogeneic stem cell transplantation. (Puiggros et al., BioMed Research International, Volume 2014 (2014), Article ID 435983). Many of the existing therapies include oral-targeted drugs, which have, for some patients with CLL, improved treatment outcomes. Nonetheless, some patients prove intolerant or resistant to therapy and / or fail to achieve complete response with undetectable MRD (uMRD). In some aspects, subjects who have progressive disease after treatment with available therapies have poor outcomes. For instance, in some aspects, subjects treated for CLL exhibit poor long-term outcomes. For example, in some cases, refractory (R / R) high-risk CLL subjects exhibit poor survival after ibrutinib discontinuation (Jain et al. (2015) Blood 125(13):2062-2067). There is a need for improved methods of treating CLL, and in some aspects, for those appropriate for treating high and / or very high-risk CLL and / or subjects having relapsed or become refractory to multiple prior therapies.

[0080] In some embodiments, the methods include administration of cells to a subject selected or identified as having a certain prognosis or risk of CLL. Chronic lymphocytic leukemia (CLL) is a generally a variable disease. Some subjects with CLL may survive without treatment while others may require immediate intervention. In some cases, subjects with CLL may be classified into groups that may inform disease prognosis and / or recommended treatment strategy. In some cases, these groups may be “low risk,” “intermediate risk,” “high risk,” and / or “very high risk” and patients may be classified as such depending on a number of factors including, but not limited to, genetic abnormalities and / or morphological or physical characteristics. In some embodiments, subjects treated in accord with the method are classified or identified based on the risk of CLL. In some embodiments, the subject is one that has high risk CLL.

[0081] In some embodiments, the provided methods and uses provide for or achieve improved or more durable responses or efficacy as compared to certain alternative methods, such as in particular groups of subjects treated, such as in patients with a leukemia, such as CLL or SLL, including those with high-risk disease. In some embodiments, the methods are advantageous by virtue of administering T cell therapy, such as a composition including cells for adoptive cell therapy, e.g., such as a CAR-expressing T cells, e.g. anti-CD19 CAR+ T cells. In some embodiments, the methods also include, prior to the T cell therapy, a lymphodepleting therapy, e.g. such as cyclophosphamide, fludarabine, or combinations thereof.

[0082] In some aspects, the provided embodiments are based on observations, such as those described in the Examples provided herein, that the provided methods can be used to achieve a high response rate with high durability, compared to certain available methods for cell therapy, without an increased risk of toxicity. In some embodiments, the provided methods permit prolonged persistence of adoptively transferred cells for cell therapy, and / or low rate of developing toxicity in the subject. In some embodiments, the methods can be used to select subjects for treatment with cell therapy that are likely or more likely to respond to the therapy and / or to determine appropriate doses or dosing regimen for higher response rate and / or more durable response, while minimizing the risk of toxicity. Such methods can inform rational strategies to facilitate the safe and effective clinical application of adoptive cell therapy, such as CAR-T cell therapy.

[0083] In some embodiments, the provided methods achieve a high response rate in a heavily pretreated population of subjects with high-risk CLL (or SLL), all of whom have received one or more prior therapies including ibrutinib. In some embodiments, the treated subjects include subjects that have relapsed following initial remission on ibrutinib or who are refractory or intolerant to treatment with ibrutinib. In particular embodiments, the treated subjects include subjects that have relapsed following remission or are refractory or intolerant to one or more further prior therapy in addition to ibrutinib, such as 1,2,3, 4, 5 or more prior therapies. In some embodiments, the subjects have relapsed or are refractory to both a prior treatment of ibrutinib and venetoclax. In some embodiments, subjects that are refractory to such treatment have progressed following one or more prior therapy. In some embodiments, subjects treated, including those treated with one or more prior therapies (e.g. ibrutinib and / or venetoclax), include those with a high-risk cytogenetics, including TP53 mutation, complex karyotype (i.e. at least three chromosomal alterations) and del17(p). In some embodiments, subjects for treatment in accordance with the embodiments provided herein include subjects that have failed both a BTK inhibitor (e.g., ibrutinib) and venetoclax. As demonstrated herein, results from an ongoing clinical trial demonstrate a high overall response rate (ORR) of greater than 65% of subjects treated across dose-levels, including complete remission (CR) with incomplete blood count recovery (CR1) in greater than 35% of subjects treated. Of such subjects, all have been previously treated with ibrutinib and approximately half have been previously treated with ibrutinib and venetoclax. In some aspects, the results are associated with achievement of undetectable MRD (uMRD); achievement of uMRD has been reported to correlate with improved outcomes (Kovacs et al. (2016) J. Clin. Oncol., 34:3758-3765; Thompson and Wierda (2016) Blood, 127:279-286). In some embodiments, the provided methods result in a high percentage of sustained responses that continue without progression for greater than 1 month, greater than 3 months, greater than six months or more.

[0084] Such results achieved in high risk subjects are superior compared to certain other alternative therapies. In particular, CLL is generally considered to be incurable and patients often eventually relapse or become refractory to available therapies (Dighiero and Hamblin (2008) The Lancet, 371:1017-1029). In some cases, CR and uMRD are inadequate and / or subjects progress or have poor outcomes following treatment with certain other agents, such as single-agent ibrutinib, venetoclax-Rituximab, Bendamustine- Rituximab or both ibrutinib and venetoclax. Further, reports have indicated that certain other CAR T-cell therapies may not achieve such durable response rates.

[0085] In some embodiments, the methods and uses include administering to the subject cells expressing genetically engineered (recombinant) cell surface receptors in adoptive cell therapy, which generally are chimeric receptors such as chimeric antigen receptors (CARs), recognizing an antigen expressed by, associated with and / or specific to the leukemia or lymphoma and / or cell type from which it is derived. In particular embodiments, the targeted antigen is CLL. The cells are generally administered in a composition formulated for administration; the methods generally involve administering one or more doses of the cells to the subject, which dose(s) may include a particular number or relative number of cells or of the engineered cells, and / or a defined ratio or compositions of two or more sub-types within the composition, such as CD4 vs.CD8 T cell.

[0086] In particular embodiments, methods are carried out with a therapeutic T cell product involving the separate administration of CD4+ and CD8+ CAR T cell compositions administered at a particular or precise number as a flat dose and / or as a defined ratio of CD4+ and CD8+ CAR T cells. In some cases, methods include producing or engineering the CAR T cell composition by a process that includes the separate isolation, selection or enrichment of CD4+ and CD8+ T cells from a biological sample. In some cases, methods for producing a CAR-T cell composition that includes enrichment of CD4+ and CD8+ T cells avoids the risk of including tumor cells in the CAR-T cell product or during the manufacturing of the CAR-T cell product. Compared to other diseases, CLL is a cancer in which the tumor cells are found in the periphery, which, in some contexts may interfere with and / or impact the efficacy of a CAR-T product that may include such cells or be derived from an initial composition containing such cells.

[0087] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0088] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. 1. METHODS AND USES OF CELL THERAPY WITH GENETICALLY ENGINEERED CELLS

[0089] In some embodiments, the methods and uses provided herein include administering to the subject cells expressing genetically engineered (recombinant) cell surface receptors in adoptive cell therapy, which generally are chimeric receptors such as chimeric antigen receptors (CARs), recognizing an antigen expressed by, associated with and / or specific to the leukemia or lymphoma and / or cell type from which it is derived. The cells are generally administered in a composition formulated for administration; the methods generally involve administering one or more doses of the cells to the subject, which dose(s) may include a particular number or relative number of cells or of the engineered cells, and / or a defined ratio or compositions of two or more sub-types within the composition, such as CD4 vs.CD8 T cells.

[0090] In some embodiments, the cells, populations, and compositions are administered to a subject having the particular disease or condition to be treated, e.g., via adoptive cell therapy, such as adoptive T cell therapy. In some embodiments, the methods involve treating a subject having a lymphoma or a leukemia, such as a chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL) with a dose of antigen receptor-expressing cells (e.g. CAR-expressing cells).

[0091] In some embodiments, the provided methods involve treating a specific group or subset of subjects, e.g., subjects identified as having high-risk disease, e.g., high-risk CLL. In some aspects, the methods treat subjects having a form of aggressive and / or poor prognosis CLL, such as CLL that has relapsed or is refractory (R / R) to standard therapy and has a poor prognosis. In some embodiments, the subject has failed one or more prior therapies. In some embodiments, the subject is ineligible for other prior therapy. In some embodiments, the subject has failed a prior therapy with a Bruton's Tyrosine Kinase inhibitor (BTKi), such as ibrutinib. In some embodiments, the subject has failed ibrutinib and venetoclax. In some cases, the overall response rate (ORR; also known in some cases as objective response rate) to available therapies, to a standard of care, or to a reference therapy for the disease and / or patient population for which the therapy is indicated, is less than 40% and / or the complete response (CR; also known in some cases as complete remission) is less than 20%.

[0092] In some embodiments, the methods, uses and articles of manufacture involve, or are used for treatment of subjects involving, selecting or identifying a particular group or subset of subjects, e.g., based on specific types of disease, diagnostic criteria, prior treatments and / or response to prior treatments. In some embodiments, the methods involve treating a subject having relapsed following remission after treatment with, or become refractory to, one or more prior therapies; or a subject that has relapsed or is refractory (R / R) to one or more prior therapies, e.g., one or more lines of standard therapy. In some embodiments, the methods involve treating subjects having chronic lymphocytic leukemia. In some embodiments, the methods involve treating subjects having small lymphocytic lymphoma. In some embodiments, the methods involve treating a subject that has an Eastern Cooperative Oncology Group Performance Status (ECOG) of 0-1. In some embodiments, the methods treat a poor-prognosis population of CLL patients or subject thereof that generally responds poorly to therapies or particular reference therapies, such as one having high-risk cytogenetics (i.., Del(17p), TP53 mutation, mutated IGHV, and complex karyotype).

[0093] In some embodiments, the antigen receptor (e.g. CAR) specifically binds to a target antigen associated with the disease or condition, such as associated with CLL. In some embodiments, the antigen receptor binds to a target antigen associated with SLL. In some embodiments, the antigen associated with the disease or disorder is CD19.

[0094] In some embodiments, the methods include administration of the cells or a composition containing the cells to a subject, tissue, or cell, such as one having, at risk for, or suspected of having the disease, condition or disorder. In some embodiments, the subject is the subject is an adult. In some embodiments, the subject is over at or about 50, 60, or 70 years of age.

[0095] In some embodiments, the subject has been previously treated with a therapy or a therapeutic agent targeting the disease or condition, e.g., CLL or SLL, prior to administration of the cells expressing the recombinant receptor. In some embodiments, the subject has been previously treated with a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT or autologous HSCT. In some embodiments, the subject has had poor prognosis after treatment with standard therapy and / or has failed one or more lines of previous therapy, for example at least at or about 1, 2, 3, 4 or more lines of previous therapy. In some embodiments, the subject has been treated or has previously received at least or about at least or about 1, 2, 3, or 4 other therapies for treating the CLL other than a lymphodepleting therapy and / or the dose of cells expressing the antigen receptor. In some embodiments, the subject has been previously treated with chemotherapy or radiation therapy. In some aspects, the subject is refractory or non-responsive to the other therapy or therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapy or therapeutic intervention, including chemotherapy or radiation. In some embodiments, the subjects have a relapsed or refractory (R / R) chronic lymphocytic leukemia (CLL) and had failed or are ineligible of a Bruton’s Tyrosine Kinase inhibitor (BTKi) therapy.

[0096] In some embodiments, the subject has been previously treated with a therapy or a therapeutic agent targeting the disease or condition, e.g. CLL, prior to administration of the cells expressing the recombinant antigen receptor. In some embodiments, the therapeutic agent is a kinase inhibitor, such as an inhibitor of Bruton’s tyrosine kinase (Btk), for example, ibrutinib. In some embodiments, the therapeutic agent is an inhibitor of B-cell lymphoma-2 (Bcl-2), for example, venetoclax. In some embodiments, the therapeutic agent is an antibody (e.g. monoclonal antibody) that specifically binds to an antigen expressed by the cells of the CLL or NHL, e.g. an antigen from any one or more of CD20, CD19, CD22, ROR1, CD45, CD21, CDS, CD33, Igkappa, Iglambda, CD79a, CD79 or CD30. In some embodiments, the therapeutic agent is an anti-CD20 antibody, e.g., rituximab. In some embodiments, the therapeutic agent is a depleting chemotherapy that is a combination therapy that includes rituximab, e.g., a combination therapy of fludarabine and rituximab or a combination therapy of anthracycline and rituximab. In some embodiments, the subject has been previously treated with hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT or autogenic HSCT. In some embodiments, the subject has been treated or has previously received at least or about at least or about 1, 2, 3, or 4 other therapies for treating the CLL other than the lymphodepleting therapy and / or the dose of cells expressing the antigen receptor. In some embodiments, the subject has been previously treated with chemotherapy or radiation therapy.

[0097] In some aspects, the subject is refractory or non-responsive to the other therapy or therapeutic agent. In some embodiments, the subject has persistent or relapsed disease, e.g., following treatment with another therapy or therapeutic intervention, including chemotherapy or radiation.

[0098] In some embodiments, the subject is one that is eligible for a transplant, such as is eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. In some such embodiments, the subject has not previously received a transplant, despite being eligible, prior to administration of the engineered cells (e.g. CAR-T cells) or a composition containing the cells to the subject as provided herein.

[0099] In some embodiments, the subject is one that is not eligible for a transplant, such as is not eligible for a hematopoietic stem cell transplantation (HSCT), e.g., allogeneic HSCT. In some embodiments, such a subject is administered the engineered cells (e.g. CAR-T cells) or a composition containing the cells according to the provided embodiments herein.

[0100] In some embodiments, the methods include administration of cells to a subject selected or identified as having high-risk CLL. In some embodiments, the subject exhibits one or more cytogenetic abnormalities, such as associated with high-risk CLL. In some aspects, the population to be treated includes subjects having an Eastern Cooperative Oncology Group Performance Status (ECOG) that is anywhere from 0-1.

[0101] In some aspects of any of the embodiments, the subjects to be treated have failed two or more prior therapies. In some aspects of any of the embodiments, the subject to be treated has failed three of more prior therapies. In some embodiments, the prior therapies include any of a therapy with an inhibitor of Bruton’s tyrosine kinase (BTK), such as ibrutinib; venetoclax; a combination therapy comprising fludarabine and rituximab; radiation therapy; and hematopoietic stem cell transplantation (HSCT). In some embodiments, the subject or patient has previously received but has relapsed following remission, is refractory to, has failed and / or is intolerant to treatment with ibrutinib and / or venetoclax. In some embodiments, the subject or patient has previously received but has relapsed following remission, is refractory to, has failed and / or is intolerant to treatment with ibrutinib and venetoclax.

[0102] In some embodiments, provided are methods of treating subjects selected or identified as having relapsed following remission or who are refractory to prior treatment with ibrutinib and venetoclax for treating the CLL or SLL. In some aspects, the selected or identified subjects are administered a CAR T-cell therapy, e.g. anti-CD19 CAR-T cell therapy, in accord with the provided methods.

[0103] In some embodiments, the subject has never achieved a complete response (CR), never received autologous stem cell transplant (ASCT), is refractory to 1 or more second line therapy, has primary refractory disease, and / or has an ECOG performance score that is between 0 and 1.

[0104] In some aspects, subjects to be treated in accordance with the provided embodiments include subjects with a diagnosis of CLL or SLL. In some embodiments, subjects with CLL include those with CLL diagnosis with indication of treatment based on the International Workshop on Chronic Lymphocytic Leukemia (iwCLL) guidelines and clinical measurable disease (bone marrow involvement by > 30% lymphocytes, peripheral blood lymphocytosis > 5x10%L, and / or measurable lymph nodes and / or hepatic or splenomegaly. In some embodiments, subjects with SLL include those with SLL diagnosis is based on lymphadenopathy and / or splenomegaly and < 5x10° CD19+ CD5+ clonal B lymphocytes / L [< 5000 / uL] in the peripheral blood at diagnosis with measurable disease defined as at least one lesion > 1.5 cm in the greatest transverse diameter, and that is biopsy-proven SLL.

[0105] In some aspects, the subjects are either ineligible for treatment with Bruton's tyrosine kinase inhibitor (BTKi, e.g., ibrutinib) due to a requirement for full-dose anticoagulation or history or arrhythmia, or had failed treatment after having been previously administered BTKi as determined by stable disease (SD) or progressive disease (PD) as best response, PD after previous response, or discontinuation due to intolerance (e.g. unmanageable toxicity). In some aspects, the subjects are treated in accordance with the provided embodiments if they had high risk disease (as determined by complex cytogenetic abnormalities (e.g., complex karyotype), del(17p), TP53 mutation, unmutated IGVH) and had failed greater than or equal to (e.g., at least) 2 prior therapies; or if they had standard-risk disease and had failed greater than or equal to (e.g., at least) 3 prior therapies. In some aspects, subjects to be treated in accordance with the provided embodiments exclude subjects with active untreated CNS disease, ECOG >1, or Richter’s transformation.

[0106] In some aspects, provided are compositions, methods and uses for administration of a defined composition of the cell therapy, at particular doses, that are associated with a high response rate and / or high durability of response, and low levels and / or incidence of toxicity. In some embodiments, the composition or dose administered is a flat and / or fixed dose, such as a precise flat dose, of cells and / or of one or more cells having a particular phenotype, such as a particular number of such cells or a number that is within a particular range and / or degree of variability or variance as compared to a target number. In some embodiments, the composition or dose administered contains a defined ratio of CD4* and CD8* cells (e.g., 1:1 ratio of CD4*:CD8* CAR* T cells) and / or contains a ratio that is within a certain degree of variability from such ratio, such as no more than + 10%, such as no more than + 8%, such as a degree of variability or variance of no more than + 10%, such as no more than + 8%. In some embodiments, the CD4* and CD8* cells are individually formulated and administered. In some embodiments, the administered cells exhibit consistent activity and / or function, e.g., cytokine production, apoptosis and / or expansion. In some embodiments, the provided compositions exhibit highly consistent and defined activity, and low variability between cells, e.g., in terms of cell number, cell function and / or cell activity, in the composition or between preparations. In some embodiments, the consistency in activity and / or function, e.g., low variability between preparations of compositions, allows improved efficacy and / or safety. In some embodiments, administration of the defined compositions resulted in low product variability and low toxicity, e.g., CRS or neurotoxicity, compared to administration of cell compositions with high heterogeneity. In some embodiments, the defined, consistent composition also exhibits consistent cell expansion. Such consistency can facilitate the identification of dose, therapeutic window, evaluation of dose response and identification of factors of the subject that may correlate with safety or toxicity outcomes.

[0107] In some embodiments, in a certain cohort of subjects receiving a single infusion of a particular dose level, the subjects in some cohorts can achieve an overall response rate (ORR, in some cases also known as objective response rate) of more than 80%, a complete response (CR) rate of more than 50% at 3 months. In some embodiments, subjects receiving a defined dose show improved safety outcomes. In some aspects, the rate of severe CRS or severe NT is low. In some embodiments, particular factors of the subject, e.g., certain biomarkers (e.g. TNF-alpha or IL-16), can be used to predict the risk of toxicity. In some embodiments, the provided embodiments can be used to achieve high response rate with low risk of toxicity.

[0108] In some embodiments, no more than 25%, no more than 20%, no more than 15%, no more than 10% or no more than 5% of subjects treated using the provided compositions, articles of manufacture, kits, methods and uses are administered an agent (e.g. tocilizumab and / or dexamethasone) to ameliorate, treat or prevent a toxicity, either prior to or subsequent to administration of the cell therapy. In some embodiments, the subject is not administered any prophylaxis treatment prior to receiving the engineered cells (e.g. CAR-T cells).

[0109] In some embodiments, the provided embodiments provide an advantage, e.g., permits administration of the cell therapy on an outpatient basis. In some embodiments, the administration of the cell therapy, e.g. dose of T cells in accord with the provided embodiments, can be performed on an outpatient basis or does not require admission to the subject to the hospital, such as admission to the hospital requiring an overnight stay. In some embodiments, such outpatient administration can allow increased access and decreased costs, while maintaining a high, durable response rate with low toxicity. In some aspects, outpatient treatment can be advantageous for patients who already are otherwise immunocompromised by prior treatments, e.g. post-lymphodepletion, and are at a greater risk for exposures at a hospital stay or in an in-patient setting. In some aspects, outpatient treatments also increases options for treatment for subjects who may not have access to in-patient, hospital settings, or transplant centers, thereby expanding access to the treatment.

[0110] In some embodiments, the methods and uses provide for or achieve a higher response rate and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects that can be associated with cell therapy, such as neurotoxicity (NT) or cytokine release syndrome (CRS). In some aspects, the provided observations indicated a low rate of severe NT (sNT) or severe CRS (sCRS), and a high rate of patients without any toxicities, e.g., NT or CRS.

[0111] In some embodiments, at least at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a complete response (CR). In some embodiments, at least 75%, at least 80%, or at least 90% of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve an objective response (OR). In some embodiments, at least 35%, at least 45%, at least 50%, at least 55%, at least 60% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a CR or OR by one month, by two months or by three months. In some embodiments, at least at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% or more of subjects that had failed prior treatment with a Bruton's Tyrosine Kinase inhibitor (BTKi) and venetoclax treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a complete response (CR). In some embodiments, at least 75%, at least 80%, or at least 90% of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve an objective response (OR). In some embodiments, at least 35%, at least 45%, at least 50%, at least 55%, at least 60% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and / or with the provided articles of manufacture or compositions, achieve a CR or OR by one month, by two months or by three months. In some embodiments, in the subjects treated according to the method, greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 month after administering the dose of cells. In some embodiments, in the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the methods, and / or with the provided articles of manufacture or compositions, greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 month after administering the dose of cells.

[0112] In some embodiments, by three months after initiation of administration of the cell therapy, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, remain in response, such as remain in CR or OR and / or have undetectable MRD. In some embodiments, such response, such as CR or OR, is durable for at least three months. In some embodiments, by three months after initiation of administration of the cell therapy, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and / or with the provided articles of manufacture or compositions, remain in response, such as remain in CR or OR and / or have undetectable MRD. In some embodiments, such response, such as CR or OR, is durable for at least three months.

[0113] In some embodiments, the resulting response observed in such subjects by the treatment in accord with the provided methods, and / or with the provided articles of manufacture or compositions, is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in a majority of the subjects treated. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT). In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit severe CRS or grade 3 or higher CRS. In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects treated according to the provided methods, and / or with the provided articles of manufacture or compositions, do not exhibit severe neurotoxicity or grade 3 or higher neurotoxicity, such as grade 4 or 5 neurotoxicity.

[0114] In some embodiments, the resulting response observed in such subjects that had failed prior treatment with a BTKi and venetoclax by the treatment in accord with the provided methods, and / or with the provided articles of manufacture or compositions, is associated with or results in a low risk of any toxicity or a low risk of severe toxicity in a majority of the subjects treated. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit any grade of CRS or any grade of neurotoxicity (NT). In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods and / or with the provided articles of manufacture or compositions do not exhibit severe CRS or grade 3 or higher CRS. In some embodiments, greater than or greater than about 50%, 60%, 70%, 80% or more of the subjects that had failed prior treatment with a BTKi and venetoclax treated according to the provided methods, and / or with the provided articles of manufacture or compositions, do not exhibit severe neurotoxicity or grade 3 or higher neurotoxicity, such as grade 4 or 5 neurotoxicity.

[0115] In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the method and / or with the provided articles of manufacture or compositions do not exhibit early onset CRS or neurotoxicity and / or do not exhibit onset of CRS earlier than 1 day, 2 days, 3 days or 4 days following initiation of the administration. In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects treated according to the methods, and / or with the provided articles of manufacture or compositions, do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, six days or 7 days following initiation of the administration. In some aspects, the median onset of neurotoxicity among subjects treated according to the methods, and / or with the provided articles of manufacture or compositions, is at or after the median peak of, or median time to resolution of, CRS in subjects treated according to the method. In some cases, the median onset of neurotoxicity among subjects treated according to the method is greater than at or about 8, 9, 10, or 11 days.

[0116] In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the method and / or with the provided articles of manufacture or compositions compositions that had failed prior treatment with a BTKi and venetoclax,do not exhibit early onset CRS or neurotoxicity and / or do not exhibit onset of CRS earlier than 1 day, 2 days, 3 days or 4 days following initiation of the administration. In some embodiments, at least at or about 45%, 50%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the methods, and / or with the provided articles of manufacture or compositions, do not exhibit onset of neurotoxicity earlier than 3 days, 4 days, 5 days, six days or 7 days following initiation of the administration. In some aspects, the median onset of neurotoxicity among subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the methods, and / or with the provided articles of manufacture or compositions, is at or after the median peak of, or median time to resolution of, CRS in subjects treated according to the method. In some cases, the median onset of neurotoxicity among subjects that had failed prior treatment with a BTKi and venetoclax, treated according to the method is greater than at or about 8, 9, 10, or 11 days.

[0117] In some embodiments, such results are observed following administration of from or from about 2.5 x 107 to at or about 1.5 x 108, such as from about 5 x 10’ to at or about 1 x 108 total recombinant receptor-expressing T cells (e.g. CAR+ T cells), such as a dose of T cells including CD4* and CD8* T cells administered at a defined ratio as described herein, e.g. at or about a 1:1 ratio, and / or at a precise or flat or fixed number of CAR" T cells, or precise or flat or fixed number of a particular type of CAR* T cells such as CD4*CAR* T cells and / or CD8*CAR* T cells, and / or a number of any of such cells that is within a specified degree of variance, such as no more than, + or — (plus or minus, in some cases indicated as +), 5, 6,7, 8,9, 10, 11, 12, 13, 14, or 15% as compared to such precise or flat or fixed number. In some embodiments, such flat or fixed number of cells is at or about 2.5 x 10 total CAR* T cells or of CD8* and / or CD4* CAR* T cells, 5x107 total CAR* T cells or of CD8* and / or CD4* CAR* T cells, or 1 x 10% total CAR* T cells or of CD8* and / or CD4* CAR" T cells. In some embodiments, the number of cells in the dose includes or consists of or consists essentially of 2.5 x 107 CAR* T cells (optionally 1.25 x 107 CD4*CAR* T cells and 1.25 x 10” CD8*CAR* T cells); in some embodiments, it includes or consists of or consists essentially of 5 x 107 CAR* T cells (optionally 2.5 x 10 CD4*CAR* T cells and 2.5 x 10” CD8*CAR* T cells); in some embodiments, it includes 1 x 10° CAR+ T cells (optionally 0.5 x 10° CD4*CAR* T cells and 0.5 x 108 CD8*CAR* T cells). In some aspects, the number of cells administered, is within a certain degree of variance of such numbers in the aforementioned embodiments, such as within plus or minus (+) 5, 6, 7, 8, 9, or 10%, such as within plus or minus 8%, as compared to such number(s) of cells. In some aspects, the dose is within a range in which a correlation is observed (optionally a linear relationship) between the number of such cells (e.g., of total CAR* T cells or of CD8* and / or CD4* CAR* T cells) and one or more outcomes indicative of therapeutic response, or duration thereof (e.g., likelihood of achieving a remission, a complete remission, and / or a particular duration of remission) and / or duration of any of the foregoing. In some aspects, it is found that the higher dose of cells administered can result in greater response without or without substantially impacting or affecting the incidence or risk of toxicity (e.g. CRS or neurotoxicity), or degree of incidence or risk of toxicity, in the subject e.g. severe CRS or severe neurotoxicity.

[0118] In some aspects, the subject to be treated in accordance with the provided embodiments have adequate organ function. For example, in some aspects, the subjects exhibit one or more of the following: serum creatinine < 1.5 x age-adjusted upper limit of normal (ULN) or calculated creatinine clearance (Cockcroft and Gault) > 30 mL / min; alanine aminotransferase (ALT) <5 x ULN and total bilirubin < 2.0 mg / dL (or < 3.0 mg / dL for subjects with Gilbert's syndrome or leukemic infiltration of the liver); adequate pulmonary function, defined as < Common Terminology Criteria for Adverse Events (CTCAE) Grade 1 dyspnea and saturated oxygen (Sa0z) > 92% on room air; and / or adequate cardiac function, defined as left ventricular ejection fraction (LVEF) > 40% as assessed by echocardiogram (ECHO) or multiple uptake gated acquisition (MUGA) scan performed within 30 days prior to assessment of the subjects for administration of the engineered cell composition.

[0119] In some aspects, the provided methods can achieve a high or a particular rate of response (such as a rate of response among a population as assessed after a certain period post-administration, such as one month or three months), e.g., ORR (such as a 1-month or 3-month ORR) of at or about 75% or more, 80% or more, 85% or more, and CR rate (such as a 1-month or 3-month CR rate) of at or about 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 71% or more, 72% or more, 73% or more, 74% or more or approximately 75% or more. In some embodiments, such rates of response and durability are received following only a single administration or dose of such therapy. Treatment of such subjects by the provided methods, and / or with the provided articles of manufacture or compositions, in some embodiments, also result in the subjects achieving the high rate of response, yet not exhibiting higher incidence of developing toxicities, such as neurotoxicity or CRS, even at a higher cell dosage.

[0120] Thus, in some embodiments, the provided methods, articles of manufacture and / or compositions, can offer advantages over other available methods or solutions or approaches for treatment such as for adoptive cell therapy. In particular, among the provided embodiments are those that offer an advantage for subjects with high-risk CLL, by achieving a durable response at a high rate, with reduced incidence of toxicities or side effects. A. Method of Treatment

[0121] Provided herein are methods of treatment that involve administering engineered cells or compositions containing engineered cells, such as engineered T cells. Also provided are methods and uses of engineered cells (e.g., T cells) and / or compositions thereof, including methods for the treatment of subjects having a disease or condition such as a leukemia or a lymphoma, e.g., a chronic lymphocytic leukemia (CLL) or a small lymphocytic lymphoma (SLL), that involves administration of the engineered cells and / or compositions thereof. In some embodiments, the provided methods and uses can achieve improved response and / or more durable responses or efficacy and / or a reduced risk of toxicity or other side effects, e.g., in particular groups of subjects treated, as compared to certain alternative methods. In some aspects, also provided are methods of administering engineered cells or compositions containing engineered cells, such as engineered T cells, to a subject, such as a subject that has a disease or disorder. In some aspects, also provided are uses of engineered cells or compositions containing engineered cells, such as engineered T cells for treatment of a disease or disorder. In some aspects, also provided are uses of engineered cells or compositions containing engineered cells, such as engineered T cells for the manufacture of a medicament for the treatment of a disease or disorder. In some aspects, also provided are methods of administering engineered cells or compositions containing engineered cells, such as engineered T cells, for use in treatment of a disease or disorder, or for administration to a subject having a disease or disorder. In some aspects, the uses of the engineered cells or compositions containing engineered cells, such as engineered T cells are in accord with any of the methods described herein.

[0122] The engineered cells expressing a recombinant receptor, such as a chimeric antigen receptor (CAR), or compositions comprising the same, described herein are useful in a variety of therapeutic, diagnostic and prophylactic indications. For example, the engineered cells or compositions comprising the engineered cells are useful in treating a variety of diseases and disorders in a subject. Such methods and uses include therapeutic methods and uses, for example, involving administration of the engineered cells, or compositions containing the same, to a subject having a disease, condition, or disorder, such as a tumor or cancer. In some embodiments, the engineered cells or compositions comprising the same are administered in an effective amount to effect treatment of the disease or disorder. Uses include uses of the engineered cells or compositions in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods. In some embodiments, the engineered cells or compositions comprising the engineered cells are for use in treating a variety of diseases and disorders in a subject, for example, in accordance with the therapeutic methods. In some embodiments, the methods are carried out by administering the engineered cells, or compositions comprising the same, to the subject having or suspected of having the disease or condition. In some embodiments, the methods thereby treat the disease or condition or disorder in the subject.

[0123] General methods for administration of cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, adoptive T cell therapy methods are described, e.g., in US Patent Application Publication No. 2003 / 0170238 to Gruenberg et al; US Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85). See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10): 928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1): 84-9; Davila et al. (2013) PLoS ONE 8(4): e61338.

[0124] The disease or condition that is treated can be any in which expression of an antigen is associated with and / or involved in the etiology of a disease condition or disorder, e.g. causes, exacerbates or otherwise is involved in such disease, condition, or disorder. Exemplary diseases and conditions can include diseases or conditions associated with malignancy or transformation of cells (e.g. cancer), autoimmune or inflammatory disease, or an infectious disease, e.g. caused by a bacterial, viral or other pathogen. Exemplary antigens, which include antigens associated with various diseases and conditions that can be treated, are described above. In particular embodiments, the chimeric antigen receptor or transgenic TCR specifically binds to an antigen associated with the disease or condition.

[0125] Among the diseases, conditions, and disorders are tumors, including solid tumors, hematologic malignancies, and melanomas, and including localized and metastatic tumors, infectious diseases, such as infection with a virus or other pathogen, e.g., HIV, HCV, HBV, CMV, HPV, and parasitic disease, and autoimmune and inflammatory diseases. In some embodiments, the disease, disorder or condition is a tumor, cancer, malignancy, neoplasm, or other proliferative disease or disorder. Such diseases for treatment according to the provided methods herein include but are not limited to leukemia, lymphoma, e.g., chronic lymphocytic leukemia (CLL) and small lymphocytic lymphoma (SLL).

[0126] In some embodiments, the Eastern Cooperative Oncology Group (ECOG) performance status indicator can be used to assess or select subjects for treatment, e.g., subjects who have had poor performance from prior therapies (see, e.g., Oken et al. (1982) Am J Clin Oncol. 5:649-655). The ECOG Scale of Performance Status describes a patient's level of functioning in terms of their ability to care for themselves, daily activity, and physical ability (e.g., walking, working, etc.). In some embodiments, an ECOG performance status of 0 indicates that a subject can perform normal activity. In some aspects, subjects with an ECOG performance status of 1 exhibit some restriction in physical activity but the subject is fully ambulatory. In some aspects, patients with an ECOG performance status of 2 is more than 50% ambulatory. In some cases, the subject with an ECOG performance status of 2 may also be capable of self-care; see e.g., Sgrensen et al., (1993) Br J Cancer 67(4) 773-775. The criteria reflective of the ECOG performance status are described in Table 1 below: Table 1. ECOG Performance Status Criteria Grade | ECOG performance status 0 ECOG performance status Fully active, able to carry on all pre-disease performance without restriction Restricted in physically strenuous activity but ambulatory and able to carry out work of : Restricted in physically strenuous activity but ambulatory and able to carry out work of a light or sedentary nature, e.g., light house work, office work 2 Ambulatory and capable of all self-care but unable to carry out any work activities; up and about more than 50% of waking hours 3 Capable of only limited self-care; confined to bed or chair more than 50% of waking hours 4 Completely disabled; cannot carry on any self-care; totally confined to bed or chair 5 Dead

[0127] Antigens targeted by the receptors (e.g. CAR) in some embodiments include antigens associated with a B cell malignancy, such as any of a number of known B cell marker. In some embodiments, the antigen is or includes CD20, CD19, CD22, ROR1, CD45, CD21, CD5, CD33, Igkappa, Iglambda, CD79a, CD79b or CD30. In some embodiments, the antigen is CD19.

[0128] In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by autologous transfer, in which the cells are isolated and / or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject. Thus, in some aspects, the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.

[0129] In some embodiments, the cell therapy, e.g., adoptive T cell therapy, is carried out by allogeneic transfer, in which the cells are isolated and / or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject. In such embodiments, the cells then are administered to a different subject, e.g., a second subject, of the same species. In some embodiments, the first and second subjects are genetically identical. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0130] The cells can be administered by any suitable means, for example, by bolus infusion, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus administration of the cells. In some embodiments, it is administered by multiple bolus administrations of the cells, for example, over a period of no more than 3 days, or by continuous infusion administration of the cells. In some embodiments, administration of the cell dose or any additional therapies, ¢.g., the lymphodepleting therapy, intervention therapy and / or combination therapy, is carried out via outpatient delivery.

[0131] For the prevention or treatment of disease, the appropriate dosage may depend on the type of disease to be treated, the type of cells or recombinant receptors, the severity and course of the disease, whether the cells are administered for preventive or therapeutic purposes, previous therapy, the subject’s clinical history and response to the cells, and the discretion of the attending physician. The compositions and cells are in some embodiments suitably administered to the subject at one time or over a series of treatments.

[0132] In some embodiments, the methods comprise administration of a chemotherapeutic agent, e.g., a conditioning chemotherapeutic agent.

[0133] Preconditioning subjects with immunodepleting (e.g., lymphodepleting) therapies in some aspects can improve the effects of adoptive cell therapy (ACT).

[0134] Thus, in some embodiments, the methods include administering a preconditioning agent, such as a lymphodepleting or chemotherapeutic agent, such as cyclophosphamide, fludarabine, or combinations thereof, to a subject prior to the initiation of the cell therapy. For example, the subject may be administered a preconditioning agent at least 2 days prior, such as at least 3, 4, 5, 6, or 7 days prior, to the initiation of the cell therapy. In some embodiments, the subject is administered a preconditioning agent no more than 7 days prior, such as no more than 6, 5, 4, 3, or 2 days prior, to the initiation of the cell therapy.

[0135] In some embodiments, the subject is preconditioned with cyclophosphamide at a dose between or between about 20 mg / kg and 100 mg / kg, such as between or between about 40 mg / kg and 80 mg / kg. In some aspects, the subject is preconditioned with or with about 60 mg / kg of cyclophosphamide. In some embodiments, the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, the cyclophosphamide is administered once daily for one or two days. In some embodiments, where the lymphodepleting agent comprises cyclophosphamide, the subject is administered cyclophosphamide at a dose between or between about 100 mg / m? and 500 mg / m?, such as between or between about 200 mg / m? and 400 mg / m? or 250 mg / m? and 350 mg / m? inclusive. In some instances, the subject is administered about 300 mg / m? of cyclophosphamide. In some embodiments, the cyclophosphamide can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, cyclophosphamide is administered daily, such as for 1-5 days, for example, for 3 to 5 days. In some instances, the subject is administered about 300 mg / m? of cyclophosphamide, daily for 3 days, prior to initiation of the cell therapy.

[0136] In some embodiments, where the lymphodepleting agent comprises fludarabine, the subject is administered fludarabine at a dose between or between about 1 mg / m? and 100 mg / m?, such as between or between about 10 mg / m? and 75 mg / m?, 15 mg / m? and 50 mg / m?, 20 mg / m? and 40 mg / m? or 24 mg / m? and 35 mg / m?, inclusive. In some instances, the subject is administered about 30 mg / m? of fludarabine. In some embodiments, the fludarabine can be administered in a single dose or can be administered in a plurality of doses, such as given daily, every other day or every three days. In some embodiments, fludarabine is administered daily, such as for 1-5 days, for example, for 3 to 5 days. In some instances, the subject is administered about 30 mg / m? of fludarabine, daily for 3 days, prior to initiation of the cell therapy.

[0137] In some embodiments, the lymphodepleting agent comprises a combination of agents, such as a combination of cyclophosphamide and fludarabine. Thus, the combination of agents may include cyclophosphamide at any dose or administration schedule, such as those described above, and fludarabine at any dose or administration schedule, such as those described above. For example, in some aspects, the subject is administered 60 mg / kg (~2 g / m?) of cyclophosphamide and 3 to 5 doses of 25 mg / m? fludarabine prior to the first or subsequent dose.

[0138] Following administration of the cells, the biological activity of the engineered cell populations in some embodiments is measured, e.g., by any of a number of known methods. Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry. In certain embodiments, the ability of the engineered cells to destroy target cells can be measured using any suitable known methods, such as cytotoxicity assays described in, for example, Kochenderfer et al., J. Immunotherapy, 32(7): 689-702 (2009), and Herman et al. J. Immunological Methods, 285(1): 25-40 (2004). In certain embodiments, the biological activity of the cells is measured by assaying expression and / or secretion of one or more cytokines, such as CD107a, IFNy, IL-2, and TNF.

[0139] In certain embodiments, the engineered cells are further modified in any number of ways, such that their therapeutic or prophylactic efficacy is increased. For example, the engineered CAR or TCR expressed by the population can be conjugated either directly or indirectly through a linker to a targeting moiety. The practice of conjugating compounds, e.g., the CAR or TCR, to targeting moieties is known. See, for instance, Wadwa et al., J. Drug Targeting 3: 1 1 1 (1995), and U.S. Patent 5,087,616.In some embodiments, the cells are administered as part of a combination treatment, such as simultaneously with or sequentially with, in any order, another therapeutic intervention, such as an antibody or engineered cell or receptor or agent, such as a cytotoxic or therapeutic agent. The cells in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order. In some contexts, the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa. In some embodiments, the cells are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells are administered after the one or more additional therapeutic agents. In some embodiments, the one or more additional agent includes a cytokine, such as IL-2, for example, to enhance persistence. B. Dosing

[0140] In some embodiments, a dose of cells is administered to subjects in accord with the provided methods, and / or with the provided articles of manufacture or compositions. In some embodiments, the size or timing of the doses is determined as a function of the particular disease or condition in the subject. In some cases, the size or timing of the doses for a particular disease in view of the provided description may be empirically determined.

[0141] In certain embodiments, the cells, or individual populations of sub-types of cells, are administered to the subject at a range of about one million to about 100 billion cells and / or that amount of cells per kilogram of body weight, such as, e.g., 1 million to about 50 billion cells (e.g., about 5 million cells, about 25 million cells, about 500 million cells, about 1 billion cells, about 5 billion cells, about 20 billion cells, about 30 billion cells, about 40 billion cells, or a range defined by any two of the foregoing values), such as about 10 million to about 100 billion cells (e.g., about 20 million cells, about 30 million cells, about 40 million cells, about 60 million cells, about 70 million cells, about 80 million cells, about 90 million cells, about 10 billion cells, about 25 billion cells, about 50 billion cells, about 75 billion cells, about 90 billion cells, or a range defined by any two of the foregoing values), and in some cases about 100 million cells to about 50 billion cells (e.g., about 120 million cells, about 250 million cells, about 350 million cells, about 450 million cells, about 650 million cells, about 800 million cells, about 900 million cells, about 3 billion cells, about 30 billion cells, about 45 billion cells) or any value in between these ranges and / or per kilogram of body weight. Dosages may vary depending on attributes particular to the disease or disorder and / or patient and / or other treatments. In some embodiments, such values refer to numbers of recombinant receptor-expressing cells; in other embodiments, they refer to number of T cells or PBMCs or total cells administered. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0142] In some embodiments, the dose of cells is a flat dose of cells or fixed dose of cells such that the dose of cells is not tied to or based on the body surface area or weight of a subject.

[0143] In some embodiments, the dose of genetically engineered cells comprises from at or about 1 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 1 x 108 total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 107 total CAR-expressing T cells, from at or about 1 x 10° to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 1 x 10° to at or about 1 x 107 total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 1 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 10% total CAR-expressing T cells, from at or about 1 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 1 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 107 total CAR-expressing T cells, from at or about 1x 10° to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 1 x 10° to at or about 1 x 10 total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 1 x 10° total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 5 x 107 total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 1 x 107 total CAR-expressing T cells, from at or about 2.5 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 5 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 5 x 10° to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 5 x 10° to at or about 1 x 10° total CAR-expressing T cells, from at or about 5 x 10° to at or about 5 x 107 total CAR-expressing T cells, from at or about 5 x 10° to at or about 2.5 x 10” total CAR-expressing T cells, from at or about 5 x 10° to at or about 1 x 107 total CAR-expressing T cells, from at or about 1 x 107 to at or about 5 x 10° total CAR-expressing T cells, from at or about 1 x 107 to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 1 x 107 to at or about 1 x 108 total CAR-expressing T cells, from at or about 1 x 107 to at or about 5 x 10” total CAR-expressing T cells, from at or about 1 x 107 to at or about 2.5 x 107 total CAR-expressing T cells, from at or about 2.5 x 107 to at or about 5 x 10° total CAR-expressing T cells, from at or about 2.5 x 107 to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 2.5 x 107 to at or about 1 x 108 total CAR-expressing T cells, from at or about 2.5 x 107 to at or about 5 x 107 total CAR-expressing T cells, from at or about 5 x 107 to at or about 5 x 10° total CAR-expressing T cells, from at or about 5 x 107 to at or about 2.5 x 10° total CAR-expressing T cells, from at or about 5 x 107 to at or about 1 x 10° total CAR-expressing T cells, from at or about 1 x 10° to at or about 5 x 10° total CAR-expressing T cells, from at or about 1 x 10% to at or about 2.5 x 10° total CAR-expressing T cells, or from at or about 2.5x 10° to at or about 5 x 10° total CAR-expressing T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0144] In some embodiments, the dose of genetically engineered cells comprises from at or about 2.5 x 107 to at or about 1.5 x 10° total CAR-expressing T cells, such as 5 x 107 to 1 x 10° total CAR- expressing T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 10” CAR-expressing cells, at least or at least about 5 x 10” CAR-expressing cells, or at least or at least about 1 x 108 CAR-expressing cells. In some embodiments, the dose of T cells comprises: at or about 2.5 x 10” CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 1 x 108 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 5 x 107 CAR-expressing T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0145] In some embodiments, the number is with reference to the total number of CD3*, CD8*, or CD4* and CD8*, in some cases also recombinant receptor-expressing (e.g. CAR") cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0146] In some embodiments, the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10° to or to about 5 x 10° CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, from or from about 5 x 10° to or to about 1 x 107 CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, or from or from about 1 x 10° to or to about 1 x 107 CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, each inclusive. In some embodiments, the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10° to or to about 5 x 10° total CD3* / CAR*, CD8* / CAR* or CD4* / CD8* / CAR* cells, from or from about 5 x 10° to or to about 1 x 107 total CD3* / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* cells, or from or from about 1 x 10° to or to about 1 x 107 total CD3* / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* cells, each inclusive. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0147] In some embodiments, the dose of genetically engineered cells comprises from or from about 2.5x 107 to 1.5 x 10° total CD3+ / CAR?*, CD8* / CAR*, or CD4* / CD8* / CAR* T cells, such as 5x 107 to 1 x 10° total CD3+ / CAR*, CD8* / CAR, or CD4* / CD8* / CAR* T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 10” CD3+ / CAR*, CD8* / CARY, or CD4* / CD8* / CAR* T cells, at least or at least about 5 x 107 CD3+ / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* T cells, or at least or at least about 1 x 10° CD3+ / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* T cells. In some embodiments, the dose of genetically engineered cells comprises at or about 2.5 x 10” CD3+ / CAR*, CD8* / CARY, or CD4* / CD8* / CAR* T cells, at or about 5 x 107 CD3+ / CAR?, CD8* / CAR?, or CD4* / CD8* / CAR* T cells, or at or about 1 x 10° CD3+ / CAR*, CDB8* / CAR?, or CD4* / CD8&* / CAR* T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0148] In some embodiments, the dose of T cells comprises: at or about 5 x 10” recombinant receptor (e.g. CAR)-expressing T cells or at or about 2.5 x 107 recombinant receptor (e.g. CAR)- expressing CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1 x 10° recombinant receptor (e.g. CAR)-expressing T cells or at or about 5 x 107 recombinant receptor (e.g. CAR)-expressing CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1.5 x 10° recombinant receptor (e.g. CAR)-expressing T cells or at or about 0.75 x 10° recombinant receptor (e.g. CAR) -expressing CD8" T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0149] In some embodiments, the T cells of the dose include CD4* T cells, CD8* T cells or CD4* and CD8* T cells. In some embodiments, for example, where the subject is human, the CD8* T cells of the dose, including in a dose including CD4* and CD8* T cells, includes between about 2.5 x 107 and 1 x 10° total recombinant receptor (e.g., CAR)-expressing CD8*cells, or a fraction thereof such as present at a ratio of 1:3 to 3:1 CD4+ cells to CD8+ T cell, optionally at or about 1:1.

[0150] In some embodiments, the patient is administered multiple doses, and each of the doses or the total dose can be within any of the foregoing values. In some embodiments, the dose of cells comprises the administration of from or from about 1 x 10° to or to about 5 x 10° total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x 10° to or to about 1.5 x 10° total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x 10° to or to about 1 x 108 total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 5 x 10° to or to about 1 x 107 total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, or from or from about 1 x 10° to or to about 1 x 107 total recombinant receptor (e.g. CAR)- expressing T cells or total T cells, each inclusive.

[0151] In some embodiments, the dose of cells is a flat dose of cells or fixed dose of cells such that the dose of cells is not tied to or based on the body surface area or weight of a subject.

[0152] In some embodiments, the dose of genetically engineered cells comprises from or from about 1x 10° to 5 x 10° total CAR-expressing T cells, 1 x 10° to 2.5 x 10° total CAR-expressing T cells, 1 x 10° to 1 x 10° total CAR-expressing T cells, 1 x 10° to 5 x 107 total CAR-expressing T cells, 1 x 10° to 2.5 x 107 total CAR-expressing T cells, 1 x 10° to 1 x 107 total CAR-expressing T cells, 1 x 10° to 5 x 10° total CAR-expressing T cells, 1 x 10° to 2.5 x 10° total CAR-expressing T cells, 1 x 10° to 1 x 10° total CAR- expressing T cells, 1 x 10° to 5 x 108 total CAR-expressing T cells, 1 x 10° to 2.5 x 10° total CAR- expressing T cells, 1 x 10° to 1 x 10° total CAR-expressing T cells, 1 x 10° to 5 x 107 total CAR- expressing T cells, 1 x 10° to 2.5 x 107 total CAR-expressing T cells, 1 x 10° to 1 x 107 total CAR- expressing T cells, 1 x 10° to 5 x 10° total CAR-expressing T cells, 1 x 10° to 2.5 x 10° total CAR- expressing T cells, 2.5 x 10° to 5 x 108 total CAR-expressing T cells, 2.5 x 10° to 2.5 x 108 total CAR- expressing T cells, 2.5 x 10° to 1x 10° total CAR-expressing T cells, 2.5 x 10° to 5 x 107 total CAR- expressing T cells, 2.5 x 10° to 2.5 x 107 total CAR-expressing T cells, 2.5 x 10° to 1 x 107 total CAR- expressing T cells, 2.5 x 10° to 5 x 10° total CAR-expressing T cells, 5 x 10° to 5 x 108 total CAR- expressing T cells, 5 x 10° to 2.5 x 108 total CAR-expressing T cells, 5 x 10° to 1 x 108 total CAR- expressing T cells, 5 x 10° to 5 x 107 total CAR-expressing T cells, 5 x 10° to 2.5 x 107 total CAR- expressing T cells, 5x 10° to 1 x 107 total CAR-expressing T cells, 1 x 107 to 5 x 10° total CAR- expressing T cells, 1 x 107 to 2.5 x 10° total CAR-expressing T cells, 1 x 107 to 1 x 10° total CAR- expressing T cells, 1 x 107 to 5 x 107 total CAR-expressing T cells, 1 x 107 to 2.5 x 10 total CAR- expressing T cells, 2.5 x 107 to 5 x 10° total CAR-expressing T cells, 2.5 x 10” to 2.5 x 10° total CAR- expressing T cells, 2.5 x 107 to 1x 108 total CAR-expressing T cells, 2.5 x 10” to 5 x 107 total CAR- expressing T cells, 5 x 107 to 5 x 10° total CAR-expressing T cells, 5 x 107 to 2.5 x 10° total CAR- expressing T cells, 5x 107 to 1 x 10° total CAR-expressing T cells, 1 x 10° to 5 x 10° total CAR- expressing T cells, 1 x 10° to 2.5 x 10° total CAR-expressing T cells, or 2.5x 10° to 5 x 10° total CAR- expressing T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0153] In some embodiments, the dose of genetically engineered cells comprises from at or about 2.5x 107 to at or about 1.5 x 10° total CAR-expressing T cells, such as 5x 107 to 1 x 10% total CAR- expressing T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 107 CAR-expressing cells, at least or at least about 5 x 107 CAR-expressing cells, or at least or at least about 1 x 108 CAR-expressing cells. In some embodiments, the dose of T cells comprises: at or about 2.5 x 107 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 1 x 108 CAR-expressing T cells. In some embodiments, the dose of T cells comprises at or about 5 x 107 CAR-expressing T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0154] In some embodiments, the number is with reference to the total number of CD3*, CD8*, or CD4* and CD8*, in some cases also recombinant receptor-expressing (e.g. CAR") cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0155] In some embodiments, the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10° to or to about 5 x 10° CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, from or from about 5 x 10° to or to about 1 x 107 CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, or from or from about 1 x 10° to or to about 1 x 10” CD3*, CD8*, or CD4* and CD8* total T cells or CD3*, CD8*, or CD4* and CD8* recombinant receptor (e.g. CAR+)-expressing cells, each inclusive. In some embodiments, the cell therapy comprises administration of a dose comprising a number of cell from or from about 1 x 10% to or to about 5 x 10° total CD3* / CAR*, CD8* / CAR* or CD4* / CD8* / CAR* cells, from or from about 5 x 10° to or to about 1 x 107 total CD3* / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* cells, or from or from about 1 x 106 to or to about 1 x 107 total CD3* / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* cells, each inclusive. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0156] In some embodiments, the dose of genetically engineered cells comprises from or from about 2.5 x 107 to 1.5 x 10° total CD3+ / CAR*, CD8* / CARY, or CD4* / CD8* / CAR* T cells, such as 5 x 10" to 1 x 108 total CD3+ / CAR*, CD8* / CARY, or CD4* / CD8* / CAR* T cells. In some embodiments, the dose of genetically engineered cells comprises at least or at least about 2.5 x 10” CD3+ / CAR*, CD8* / CAR, or CD4* / CD8* / CAR* T cells, at least or at least about 5 x 107 CD3+ / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* T cells, or at least or at least about 1 x 10° CD3+ / CAR*, CD8* / CAR®, or CD4* / CD8* / CAR* T cells. In some embodiments, the dose of genetically engineered cells comprises at or about 2.5 x 10” CD3+ / CAR*, CD8* / CARY, or CD4* / CD8&* / CAR* T cells, at or about 5 x 107 CD3+ / CAR*, CD8* / CAR*, or CD4* / CD8* / CAR* T cells, or at or about 1 x 108 CD3+ / CAR", CDB8* / CAR*, or CD4* / CDR* / CAR* T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0157] In some embodiments, the dose of T cells comprises: at or about 5 x 107 recombinant receptor (e.g. CAR)-expressing T cells or at or about 2.5 x 10” recombinant receptor (e.g. CAR)- expressing CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1 x 10° recombinant receptor (e.g. CAR)-expressing T cells or at or about 5 x 107 recombinant receptor (e.g. CAR)-expressing CD8* T cells. In some embodiments, the dose of T cells comprises: at or about 1.5 x 10° recombinant receptor (e.g. CAR)-expressing T cells or at or about 0.75 x 10® recombinant receptor (e.g. CAR) -expressing CD8* T cells. In some embodiments, the number of cells is the number of such cells that are viable cells.

[0158] In some embodiments, the patient is administered multiple doses, and each of the doses or the total dose can be within any of the foregoing values. In some embodiments, the dose of cells comprises the administration of from or from about 1 x 10° to or to about 5 x 10° total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x 10° to or to about 1.5 x 10° total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 1 x 10° to or to about 1 x 10° total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, from or from about 5 x 10° to or to about 1 x 107 total recombinant receptor (e.g. CAR)-expressing T cells or total T cells, or from or from about 1 x 10° to or to about 1 x 10 total recombinant receptor (e.g. CAR)- expressing T cells or total T cells, each inclusive.

[0159] In some embodiments, the T cells of the dose include CD4* T cells, CD8* T cells or CD4* and CDR&* T cells.

[0160] In some embodiments, the dose of cells, e.g., recombinant receptor-expressing T cells, is administered to the subject as a single dose or is administered only one time within a period of two weeks, one month, three months, six months, 1 year or more.

[0161] In the context of adoptive cell therapy, administration of a given “dose” encompasses administration of the given amount or number of cells as a single composition and / or single uninterrupted administration, e.g., as a single injection or continuous infusion, and also encompasses administration of the given amount or number of cells as a split dose or as a plurality of compositions, provided in multiple individual compositions or infusions, over a specified period of time, such as over no more than 3 days. Thus, in some contexts, the dose is a single or continuous administration of the specified number of cells, given or initiated at a single point in time. In some contexts, however, the dose is administered in multiple injections or infusions over a period of no more than three days, such as once a day for three days or for two days or by multiple infusions over a single day period.

[0162] Thus, in some aspects, the cells of the dose are administered in a single pharmaceutical composition. In some embodiments, the cells of the dose are administered in a plurality of compositions, collectively containing the cells of the dose.

[0163] In some embodiments, cells of the dose may be administered by administration of a plurality of compositions or solutions, such as a first and a second, optionally more, each containing some cells of the dose. In some aspects, the plurality of compositions, each containing a different population and / or sub-types of cells, are administered separately or independently, optionally within a certain period of time. For example, the populations or sub-types of cells can include CD8* and CD4* T cells, respectively, and / or CD8*- and CD4*-enriched populations, respectively, e.g., CD4* and / or CD8"* T cells each individually including cells genetically engineered to express the recombinant receptor. In some embodiments, the administration of the dose comprises administration of a first composition comprising a dose of CD8* T cells or a dose of CD4* T cells and administration of a second composition comprising the other of the dose of CD4* T cells and the CD&* T cells.

[0164] In some embodiments, the administration of the composition or dose, €.g., administration of the plurality of cell compositions, involves administration of the cell compositions separately. In some aspects, the separate administrations are carried out simultaneously, or sequentially, in any order. In particular embodiments, the separate administrations are carried out sequentially by administering, in any order, a first composition comprising a dose of CD8* T cells or a dose of CD4* T cells and a second composition comprising the other of the dose of CD4* T cells and the CD8* T cells. In some embodiments, the dose comprises a first composition and a second composition, and the first composition and second composition are administered within 48 hours of each other, such as no more than 36 hours of each other or not more than 24 hours of each other. In some embodiments, the first composition and second composition are administered at or about 0 to at or about 12 hours apart, from at or about 0 to at or about 6 hours apart or from at or about 0 to at or about 2 hours apart. In some embodiments, the initiation of administration of the first composition and the initiation of administration of the second composition are carried out no more than at or about 2 hours, no more than at or about 1 hour, or no more than at or about 30 minutes apart, no more than at or about 15 minutes, no more than at or about 10 minutes or no more than at or about 5 minutes apart. In some embodiments, the initiation and / or completion of administration of the first composition and the completion and / or initiation of administration of the second composition are carried out no more than at or about 2 hours, no more than at or about 1 hour, or no more than at or about 30 minutes apart, no more than at or about 15 minutes, no more than at or about 10 minutes or no more than at or about 5 minutes apart.

[0165] In some composition, the first composition, e.g., first composition of the dose, comprises CD4* T cells. In some composition, the first composition, e.g., first composition of the dose, comprises CD8* T cells. In some embodiments, the first composition is administered prior to the second composition. In particular embodiments, the CD8+ T cells are administered prior to the CD4+ T cells.

[0166] In some embodiments, the dose or composition of cells includes a defined or target ratio of CD4* cells expressing a recombinant receptor (e.g. CAR) to CD8* cells expressing a recombinant receptor (e.g. CAR) and / or of CD4* cells to CD8* cells, which ratio optionally is approximately 1:1 or is between approximately 1:3 and approximately 3:1, such as approximately 1:1. In some aspects, the administration of a composition or dose with the target or desired ratio of different cell populations (such as CD4*:CD8" ratio or CAR*CD4*:CAR*CD8" ratio, e.g., 1:1) involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio. In some aspects, administration of a dose or composition of cells at a defined ratio leads to improved expansion, persistence and / or antitumor activity of the T cell therapy.

[0167] In some embodiments, the dose or composition of cells includes a defined or target ratio of CD4* cells expressing a recombinant receptor to CD8* cells expressing a recombinant receptor and / or of CD4* cells to CD8* cells, which ratio optionally is approximately 1:1. In some aspects, the administration of a composition or dose with the target or desired ratio of different cell populations (such as CD4*:CD8* ratio or CAR*CD4*:CAR*CD8"* ratio, e.g., 1:1) involves the administration of a cell composition containing one of the populations and then administration of a separate cell composition comprising the other of the populations, where the administration is at or approximately at the target or desired ratio. In some aspects, administration of a dose or composition of cells at a defined ratio leads to improved expansion, persistence and / or antitumor activity of the T cell therapy.

[0168] In particular embodiments, the numbers and / or concentrations of cells refer to the number of recombinant receptor (e.g., CAR)-expressing cells or the number of recombinant receptor (e.g., CAR)- expressing T cell or CD3+ T or a CD4+ and / or CD8+ T cell subset thereof. In some embodiments, the number and / or concentration of cells refers to such number of cells that are viable cells.

[0169] In some embodiments, the dose of genetically engineered cells is or is about 5 x 10” CD3+ CAR+ viable cells, that includes a separate dose of at or about 2.5 x 107 CD4+ CAR+ viable cells and at or about 2.5 x 10” CD8+CAR+ viable cells. In some embodiments, the dose of genetically engineered cells is or is about 1 x 10° CD3+CAR+ viable cells, that includes a separate dose of at or about 5 x 107 CD4+CAR+ viable cells and at or about 5 x10” CD8+CAR+ viable cells. In some embodiments, the dose of genetically engineered cells is or is about 1.5 x 10° CD3+CAR+ viable cells, that includes a separate dose of at or about 0.75 x 10® CD4+CAR+ viable cells and at or about 0.75 x10 CD8+CAR+ viable cells. C. Response, Efficacy, and Survival

[0170] In some embodiments, the administration effectively treats the subject despite the subject having failed, having become refractory to and / or resistant to another therapy. In some embodiments, the administration effectively treats the subject despite the subject having become resistant to another therapy. In some embodiments, at least 30% of subjects treated according to the method achieve complete remission (CR); and / or at least about 75% of the subjects treated according to the method achieve an objective response (OR). In some embodiments, at least or about at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects treated according to the method achieve CR and / or at least or about at least 50%, 60%, 70%, or 80% achieve an objective response (OR). In some embodiments, at least 30% of subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve complete remission (CR); and / or at least about 75% of the subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve an objective response (OR). In some embodiments, at least or about at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects that have failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method achieve CR and / or at least or about at least 50%, 60%, 70%, or 80% achieve an objective response (OR). In some embodiments, criteria assessed for effective treatment includes overall response rate (ORR; also known in some cases as objective response rate), complete response (CR; also known in some cases as complete response), complete remission with incomplete blood count recovery (CRi), stable disease (SD), and / or partial disease (PD).

[0171] In some embodiments, the duration of the response before progression is for greater than 1 month, greater than 2 months, greater than 3 months, greater than 6 months or more. In some embodiments, at least 35%, 40%, 45%, 50%, 55%, 60% or more of subjects treated according to the methods provided herein achieve complete remission (CR; also known in some cases as complete response) at or about 3 months or at or about 6 months after administration of the cell therapy.

[0172] In some aspects, the administration in accord with the provided methods, and / or with the provided articles of manufacture or compositions, generally reduces or prevents the expansion or burden of the disease or condition in the subject. For example, where the disease or condition is a tumor, the methods generally reduce tumor size, bulk, metastasis, percentage of blasts in the bone marrow or molecularly detectable cancer and / or improve prognosis or survival or other symptom associated with tumor burden.

[0173] Disease burden can encompass a total number of cells of the disease in the subject or in an organ, tissue, or bodily fluid of the subject, such as the organ or tissue of the tumor or another location, e.g., which would indicate metastasis. For example, tumor cells may be detected and / or quantified in the blood or bone marrow in the context of certain hematological malignancies. Disease burden can include, in some embodiments, the mass of a tumor, the number or extent of metastases and / or the percentage of blast cells present in the bone marrow.

[0174] In some embodiments, a subject has leukemia. The extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.

[0175] In some aspects, response rates in subjects, such as subjects with CLL, are based on the International Workshop on Chronic Lymphocytic Leukemia (TW CLL) response criteria (Hallek, et al., Blood 2008, Jun 15; 111(12): 5446-5456). In some aspects, response rates in subjects, such as subjects with CLL, are based on the International Workshop on Chronic Lymphocytic Leukemia (TWCLL) response criteria (Hallek et al., Blood 2018 131 (25): 2745-2760). In some aspects, these criteria are described as follows: complete remission (CR; also known in some cases as complete response), which in some aspects requires the absence of peripheral blood clonal lymphocytes by immunophenotyping, absence of lymphadenopathy, absence of hepatomegaly or splenomegaly, absence of constitutional symptoms and satisfactory blood counts; complete remission with incomplete marrow recovery (CRi), which in some aspects is described as CR above, but without normal blood counts; partial remission (PR; also known in some cases as partial response), which in some aspects is described as > 50% fall in lymphocyte count, > 50% reduction in lymphadenopathy or > 50% reduction in liver or spleen, together with improvement in peripheral blood counts; progressive disease (PD), which in some aspects is described as > 50% rise in lymphocyte count to > 5 x10°%L, > 50% increase in lymphadenopathy, > 50% increase in liver or spleen size, Richter’s transformation, or new cytopenias due to CLL; and stable disease, which in some aspects is described as not meeting criteria for CR, CRi, PR or PD.

[0176] In some embodiments, the subjects exhibits a CR or OR if, within 1 month of the administration of the dose of cells, lymph nodes in the subject are less than at or about 20 mm in size, less than at or about 10 mm in size or less than at or about 10 mm in size.

[0177] In some embodiments, an index clone of the CLL is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods. In some embodiments, an index clone of the CLL is assessed by IgH deep sequencing. In some embodiments, the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.

[0178] In some embodiments, a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow. In some embodiments, a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.

[0179] In some embodiments, a subject has leukemia. The extent of disease burden can be determined by assessment of residual leukemia in blood or bone marrow.

[0180] In some embodiments, a subject exhibits morphologic disease if there are greater than or equal to 5% blasts in the bone marrow, for example, as detected by light microscopy, such as greater than or equal to 10% blasts in the bone marrow, greater than or equal to 20% blasts in the bone marrow, greater than or equal to 30% blasts in the bone marrow, greater than or equal to 40% blasts in the bone marrow or greater than or equal to 50% blasts in the bone marrow. In some embodiments, a subject exhibits complete or clinical remission if there are less than 5% blasts in the bone marrow.

[0181] In some embodiments, a subject may exhibit complete remission, but a small proportion of morphologically undetectable (by light microscopy techniques) residual leukemic cells are present. A subject is said to exhibit minimum residual disease (MRD) if the subject exhibits less than 5% blasts in the bone marrow and exhibits molecularly detectable cancer. In some embodiments, molecularly detectable cancer can be assessed using any of a variety of molecular techniques that permit sensitive detection of a small number of cells. In some aspects, such techniques include PCR assays, which can determine unique Ig / T-cell receptor gene rearrangements or fusion transcripts produced by chromosome translocations. In some embodiments, flow cytometry can be used to identify cancer cell based on leukemia-specific immunophenotypes. In some embodiments, molecular detection of cancer can detect as few as 1 leukemia cell in 100,000 normal cells. In some embodiments, a subject exhibits MRD that is molecularly detectable if at least or greater than 1 leukemia cell in 100,000 cells is detected, such as by PCR or flow cytometry. In some embodiments, the disease burden of a subject is molecularly undetectable or MRD, such that, in some cases, no leukemia cells are able to be detected in the subject using PCR or flow cytometry techniques.

[0182] In some embodiments, an index clone of the leukemia, e.g. CLL, is not detected in the bone marrow of the subject (or in the bone marrow of greater than 50%, 60%, 70%, 80%, 90% or more of the subjects treated according to the methods. In some embodiments, an index clone of the leukemia, e.g. CLL, is assessed by IGH deep sequencing. In some embodiments, the index clone is not detected at a time that is at or about or at least at or about 1, 2, 3, 4, 5, 6, 12, 18 or 24 months following the administration of the cells.

[0183] In some aspects MRD is detected by flow cytometry. Flow cytometry can be used to monitor bone marrow and peripheral blood samples for cancer cells. In particular aspects, flow cytometry is used to detect or monitor the presence of cancer cells in bone marrow. In some aspects, multiparameter immunological detection by flow cytometry is used to detect cancer cells (see for example, Coustan- Smith et al., (1998) Lancet 351:550-554). In some aspects, multiparameter immunological detection by mass cytometry is used to detect cancer cells. In some examples, 1, 2, 3,4, 5,6,7, 8,9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45 or 50 parameters can be used to detect cancer cells. The antigens used for detection are selected based on the cancer being detected (Foon and Todd (1986) Blood 68:1-31). In some embodiments, MRD is described as subjects who have no evidence of CLL in peripheral blood or marrow, i.e., CR or PR based on residual lymphadenopathy or splenomegaly. In some aspects, MRD is measured via flow cytometry of peripheral blood and IgHV deep sequencing of bone marrow.

[0184] In some examples, bone marrow is harvested by bone marrow aspirates or bone marrow biopsies, and lymphocytes are isolated for analysis. Monoclonal and / or polyclonal antibodies conjugated to a fluorochrome (e.g., fluorescein isothiocyanate (FITC), phycoerythrin, peridinin chlorophyll protein, or biotin) can be used to detect epitopes, such as terminal deoxynucleotidyl transferase (TdT), CD3, CD10, CD11¢, CD13, CD14, CD33, CD19, CD20, CD21, CD22, CD23, CD34, CD45, CD56, CD79, IgM, and / or KORSA3544, on isolated lymphocytes. Labeled cells can then be detected using flow cytometry, such as multiparameter flow cytometry, or mass cytometry, to detect multiple epitopes.

[0185] Lymphoid cells can be identified and gated based on a light-scatter dot plot and then secondarily gated to identify cell populations expressing the immunophenotypic features of interest. Exemplary epitopes are set forth in Table 2 below. Other immunologic classification of leukemias and lymphomas are provided by Foon and Todd (Blood (1986) 68(1): 1-31). In some aspects, flow cytometric assessment of MRD can be achieved by quantifying live lymphocytes bearing one or more CLL immunophenotypes (e.g., low forward / side scatter; CD3"%; CD5*, CD14%; CD19*; CD23*; CD45*; CD56™#). Table 2. Exemplary Immnunophenotype and Cytogentics Characteristics Disease Tmmunophenotype Cytogenetics Chronic | Pan-B+; CD5+; Trisomy12 del(13)(q14.3) ee ALIELL Lafl=l0Ty Wel? Ty Lymphocytic CD23+; CD79b / CD22 Leukemia (CLL) weak; FMC7-; sIg weak | del 11g22-g23 del 17p13 (p53) t(11;14)(q13;q32) BCL1 / IgH rearrangement t(14;19)(q32:q13) IgH deletion (14q32) del(6q) +8q24 +3 +18 del 6g21 Pan-B+; CD5+; del(6)(q21-23) SALLREAL a, f AML ILM | lymphoma (SLL) Small lymphocytic Pan-B+; CD5+; lymphoma (SLL) CD23+; CD10-; sIgM+ faint +: positive in >90% of the cases +-: positive in more than 50% of the cases Table 2. Exemplary Immnunophenotype and Cytogentics Characteristics Disease Immunophenotype Cytogenetics - / +: positive in less than 50% of cases -: positive in <10% of the cases Pan-B markers: e.g., CD19, CD20, CD79a SIG: surface immunoglobulins cylg: cytoplasmic immunoglobulins

[0186] In some aspects, deep sequencing of the immunoglobulin heavy chain (IGH) locus of harvested B cells can be used to detect minimal residual disease (MRD). Clonal presence of a particular IgG rearrangement can provide a marker to detect the presence of B cell malignancies, such as CLL and / or residual presence of malignant cells thereof. In some aspects cells such as a population containing or suspected of containing B cells are harvested and isolated from blood. In some aspects, cells are harvested and isolated from bone marrow, e.g., from bone marrow aspirates or bone marrow biopsies and / or from other biological samples. In some aspects, polymerase chain reaction (PCR) amplification of the complementarity determining region 3 (CDR3) is achieved using primers to highly conserved sequences within the V and J regions of the gene locus, which may be used to identify clonal populations of cells for purposes of assessing minimal residual disease. Other methods for detecting clonal populations, such as single cell sequencing approaches, including those providing information regarding number of cells of a particular lineage and / or expressing a particular variable chain such as variable heavy chain or binding site thereof, such as a clonal population, may be used. In some aspects, the IGH DNA is amplified using a degenerate primers or primers recognizing regions of variable chains shared among different cell clones, such as those recognizing consensus V and degenerate consensus J region of the IGH sequence. An exemplary sequence of the V region is ACACGGCCTCGTGTATTACTGT (SEQ ID NO: 57). An exemplary degenerate consensus sequence of the J region is ACCTGAGGAGACGGTGACC (SEQ ID NO: 58).

[0187] The PCR product or sequencing result in some aspects is specific to the rearranged allele and serves as a clonal marker for MRD detection. Following PCR amplification of the CDR3 region, PCR products can be sequenced to yield patient-specific oligonucleotides constructed as probes for allele- specific PCR for sensitive detection of MRD following treatment of B-cell malignancies with CAR-T cell therapy, e.g. CD19 CAR- T cell therapy. In examples where a PCR product is not generated using the consensus primers, V region family-specific primers for the framework region 1 can be used instead.

[0188] In some aspects, persistence of PCR-detectable tumor cells such as cells of the B cell malignancy such as the CLL, such as detectable IGH sequences corresponding to the malignant or clonal IGH sequences, after treatment is associated with increased risk of relapse. In some aspects, patients who are negative for malignant IGH sequences following treatment (in some aspects, even in the context of other criteria indicating progressive disease or only a partial response, such as persistence of enlarged lymph nodes or other criteria that may in some contexts be associated with disease or lack of complete response) may be deemed to have increased likelihood to enter into CR or durable CR or prolonged survival, compared to patients with persistent malignant IGH sequences. In some embodiments, such prognostic and staging determinations are particularly relevant for treatments in which clearance of malignant cells is observed within a short period of time following administration of the therapy, e.g., in comparison to resolution of other clinical symptoms such as lymph node size or other staging criteria. For example, in some such aspects, absence of detectable IGH or minimal residual disease in a sample such as the bone marrow may be a preferred readout for response or likelihood of response or durability thereof, as compared to other available staging or prognostic approaches. In some aspects, results from MRD, e.g., IGH deep sequencing information, may inform further intervention or lack thereof. For example, the methods and other provided embodiments in some contexts provide that a subject deemed negative for malignant IGH may in some aspects be not further treated or not be further administered a dose of the therapy provided, or that the subject be administered a lower or reduced dose. Conversely, it may be provided or specified that a subject exhibiting MRD via IGH deep sequencing be further treated, e.g., with the therapy initially administered at a similar or higher dose or with a further treatment. In some aspects, the disease or condition persists following administration of the first dose and / or administration of the first dose is not sufficient to eradicate the disease or condition in the subject.

[0189] In some embodiments, the method reduces the burden of the disease or condition, e.g., number of tumor cells, size of tumor, duration of patient survival or event-free survival, to a greater degree and / or for a greater period of time as compared to the reduction that would be observed with a comparable method using an alternative dosing regimen, such as one in which the subject receives one or more alternative therapeutic agents and / or one in which the subject does not receive a dose of cells and / or a lymphodepleting agent in accord with the provided methods, and / or with the provided articles of manufacture or compositions. In some embodiments, the burden of a disease or condition in the subject is detected, assessed, or measured. Disease burden may be detected in some aspects by detecting the total number of disease or disease-associated cells, e.g., tumor cells, in the subject, or in an organ, tissue, or bodily fluid of the subject, such as blood or serum. In some aspects, survival of the subject, survival within a certain time period, extent of survival, presence or duration of event-free or symptom-free survival, or relapse-free survival, is assessed. In some embodiments, any symptom of the disease or condition is assessed. In some embodiments, the measure of disease or condition burden is specified.

[0190] In some embodiments, following treatment by the method, the probability of relapse is reduced as compared to other methods, for example, methods in which the subject receives one or more alternative therapeutic agents and / or one in which the subject does not receive a dose of cells and / or a lymphodepleting agent in accord with the provided methods, and / or with the provided articles of manufacture or compositions.

[0191] In some cases, the pharmacokinetics of administered cells, e.g., adoptively transferred cells are determined to assess the availability, e.g., bioavailability of the administered cells. Methods for determining the pharmacokinetics of adoptively transferred cells may include drawing peripheral blood from subjects that have been administered engineered cells, and determining the number or ratio of the engineered cells in the peripheral blood. Approaches for selecting and / or isolating cells may include use of chimeric antigen receptor (CAR)-specific antibodies (e.g., Brentjens et al., Sci. Transl. Med. 2013 Mar; 5(177): 177ra38) Protein L (Zheng et al., J. Transl. Med. 2012 Feb; 10:29), epitope tags, such as Strep-Tag sequences, introduced directly into specific sites in the CAR, whereby binding reagents for Strep-Tag are used to directly assess the CAR (Liu et al. (2016) Nature Biotechnology, 34:430; international patent application Pub. No. W02015095895) and monoclonal antibodies that specifically bind to a CAR polypeptide (see international patent application Pub. No. W02014190273). Extrinsic marker genes may in some cases be utilized in connection with engineered cell therapies to permit detection or selection of cells and, in some cases, also to promote cell suicide. A truncated epidermal growth factor receptor (EGFRt) in some cases can be co-expressed with a transgene of interest (a CAR or TCR) in transduced cells (see e.g. U.S. Patent No. 8,802,374). EGFRt may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti-EGFR antibody or binding molecule, which can be used to identify or select cells that have been engineered with the EGFRt construct and another recombinant receptor, such as a chimeric antigen receptor (CAR), and / or to eliminate or separate cells expressing the receptor. See U.S. Patent No. 8,802,374 and Liu et al., Nature Biotech. 2016 April; 34(4): 430-434).

[0192] In some embodiments, the number of CAR* T cells in a biological sample obtained from the patient, e.g., blood, can be determined at a period of time after administration of the cell therapy, e.g., to determine the pharmacokinetics of the cells. In some embodiments, number of CAR* T cells, optionally CAR* CD8"* T cells and / or CAR* CD4* T cells, detectable in the blood of the subject, or in a majority of subjects so treated by the method, is greater than 1 cells per uL, greater than 5 cells per uL or greater than per 10 cells per uL. D. Toxicity

[0193] In some embodiments, the provided methods are designed to or include features that result in a lower rate and / or lower degree of toxicity, toxic outcome or symptom, toxicity-promoting profile, factor, or property, such as a symptom or outcome associated with or indicative of cytokine release syndrome (CRS) or neurotoxicity, for example, compared to administration of an alternative cell therapy, such as an alternative CAR* T cell composition and / or an alternative dosing of cells, e.g. a dosing of cells that is not administered at a defined ratio.

[0194] In some embodiments, the provided methods do not result in a high rate or likelihood of toxicity or toxic outcomes, or reduces the rate or likelihood of toxicity or toxic outcomes, such as neurotoxicity (NT), cytokine release syndrome (CRS), such as compared to certain other cell therapies. In some embodiments, the methods do not result in, or do not increase the risk of, severe NT (sNT), severe CRS (sCRS), macrophage activation syndrome, tumor lysis syndrome, fever of at least at or about 38 degrees Celsius for three or more days and a plasma level of CRP of at least at or about 20 mg / dL. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity. In some embodiments, no more than 50% of subjects treated (e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated) exhibit a cytokine release syndrome (CRS) higher than grade 2 and / or a neurotoxicity higher than grade 2. In some embodiments, at least 50% of subjects treated according to the method (e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated) do not exhibit a severe toxic outcome (e.g. severe CRS or severe neurotoxicity), such as do not exhibit grade 3 or higher neurotoxicity and / or does not exhibit severe CRS, or does not do so within a certain period of time following the treatment, such as within a week, two weeks, or one month of the administration of the cells.. In some embodiments, greater than or greater than about 30%, 35%, 40%, 50%, 55%, 60% or more of the subjects that had failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the provided methods do not exhibit any grade of CRS or any grade of neurotoxicity. In some embodiments, no more than 50% of subjects treated (e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated that had failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax) exhibit a cytokine release syndrome (CRS) higher than grade 2 and / or a neurotoxicity higher than grade 2. In some embodiments, at least 50% of subjects that had failed both a prior BTK inhibitor (e.g., ibrutinib) therapy and venetoclax, treated according to the method (e.g. at least 60%, at least 70%, at least 80%, at least 90% or more of the subjects treated) do not exhibit a severe toxic outcome (e.g. severe CRS or severe neurotoxicity), such as do not exhibit grade 3 or higher neurotoxicity and / or does not exhibit severe CRS, or does not do so within a certain period of time following the treatment, such as within a week, two weeks, or one month of the administration of the cells. In some embodiments, parameters assessed to determine certain toxicities include adverse events (AEs), treatment-emergent adverse events, dose- limiting toxicities (DLTs), CRS, neurologic events and NT.

[0195] Administration of adoptive T cell therapy, such as treatment with T cells expressing chimeric antigen receptors, can induce toxic effects or outcomes such as cytokine release syndrome and neurotoxicity. In some examples, such effects or outcomes parallel high levels of circulating cytokines, which may underlie the observed toxicity.

[0196] In some aspects, the toxic outcome is or is associated with or indicative of cytokine release syndrome (CRS) or severe CRS (sCRS). CRS, e.g., sCRS, can occur in some cases following adoptive T cell therapy and administration to subjects of other biological products. See Davila et al., Sci Transl Med 6, 224ra25 (2014); Brentjens et al., Sci. Transl. Med. 5, 177ra38 (2013); Grupp et al., N. Engl. J. Med. 368, 1509-1518 (2013); and Kochenderfer et al., Blood 119, 2709-2720 (2012); Xu et al., Cancer Letters 343 (2014) 172-78.

[0197] Typically, CRS is caused by an exaggerated systemic immune response mediated by, for example, T cells, B cells, NK cells, monocytes, and / or macrophages. Such cells may release a large amount of inflammatory mediators such as cytokines and chemokines. Cytokines may trigger an acute inflammatory response and / or induce endothelial organ damage, which may result in microvascular leakage, heart failure, or death. Severe, life-threatening CRS can lead to pulmonary infiltration and lung injury, renal failure, or disseminated intravascular coagulation. Other severe, life-threatening toxicities can include cardiac toxicity, respiratory distress, neurologic toxicity and / or hepatic failure.

[0198] CRS may be treated using anti-inflammatory therapy such as an anti-IL-6 therapy, e.g., anti- IL-6 antibody, e.g., tocilizumab, or antibiotics or other agents as described. Outcomes, signs and symptoms of CRS are known and include those described herein. In some embodiments, where a particular dosage regimen or administration effects or does not effect a given CRS-associated outcome, sign, or symptom, particular outcomes, signs, and symptoms and / or quantities or degrees thereof may be specified.

[0199] In the context of administering CAR-expressing cells, CRS typically occurs 6-20 days after infusion of cells that express a CAR. See Xu et al., Cancer Letters 343 (2014) 172-78. In some cases, CRS occurs less than 6 days or more than 20 days after CAR T cell infusion. The incidence and timing of CRS may be related to baseline cytokine levels or tumor burden at the time of infusion. Commonly, CRS involves elevated serum levels of interferon (IFN)-y, tumor necrosis factor (TNF)-o, and / or interleukin (IL)-2. Other cytokines that may be rapidly induced in CRS are IL-1B, IL-6, IL-8, and IL-10.

[0200] Exemplary outcomes associated with CRS include fever, rigors, chills, hypotension, dyspnea, acute respiratory distress syndrome (ARDS), encephalopathy, ALT / AST elevation, renal failure, cardiac disorders, hypoxia, neurologic disturbances, and death. Neurological complications include delirium, seizure-like activity, confusion, word-finding difficulty, aphasia, and / or becoming obtunded. Other CRS- related outcomes include fatigue, nausea, headache, seizure, tachycardia, myalgias, rash, acute vascular leak syndrome, liver function impairment, and renal failure. In some aspects, CRS is associated with an increase in one or more factors such as serum-ferritin, d-dimer, aminotransferases, lactate dehydrogenase and triglycerides, or with hypofibrinogenemia or hepatosplenomegaly. Other exemplary signs or symptoms associated with CRS include hemodynamic instability, febrile neutropenia, increase in serum C-reactive protein (CRP), changes in coagulation parameters (for example, international normalized ratio (INR), prothrombin time (PTI) and / or fibrinogen), changes in cardiac and other organ function, and / or absolute neutrophil count (ANC).

[0201] In some embodiments, outcomes associated with CRS include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5, and / or tumor necrosis factor alpha (TNFa)), or a max fold change, e.g., of at least at or about 250 of at least one of such cytokines; and / or at least one clinical sign of toxicity, such as hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxia (e.g., plasma oxygen (PO) levels of less than at or about 90%); and / or one or more neurologic disorders (including mental status changes, obtundation, and seizures).

[0202] Exemplary CRS-related outcomes include increased or high serum levels of one or more factors, including cytokines and chemokines and other factors associated with CRS. Exemplary outcomes further include increases in synthesis or secretion of one or more of such factors. Such synthesis or secretion can be by the T cell or a cell that interacts with the T cell, such as an innate immune cell or B cell.

[0203] In some embodiments, the CRS-associated serum factors or CRS-related outcomes include inflammatory cytokines and / or chemokines, including interferon gamma (IFN-y), TNF-a, IL-1B, IL-2, IL- 6, IL-7, IL-8, IL-10, IL-12, sIL-2Ra, granulocyte macrophage colony stimulating factor (GM-CSF), macrophage inflammatory protein (MIP)-1, tumor necrosis factor alpha (TNFa), IL-6, and IL-10, IL-1, IL-8, IL-2, MIP-1, Flt-3L, fracktalkine, and / or IL-5. In some embodiments, the factor or outcome includes C reactive protein (CRP). In addition to being an early and easily measurable risk factor for CRS, CRP also is a marker for cell expansion. In some embodiments, subjects that are measured to have high levels of CRP, such as > 15 mg / dL, have CRS. In some embodiments, subjects that are measured to have high levels of CRP do not have CRS. In some embodiments, a measure of CRS includes a measure of CRP and another factor indicative of CRS.

[0204] In some embodiments, one or more inflammatory cytokines or chemokines are monitored before, during, or after CAR treatment. In some embodiments, TNF-alpha or IL-16 is assessed or monitored in a subject, such as in accord with the methods herein.

[0205] CRS criteria that appear to correlate with the onset of CRS to predict which patients are more likely to be at risk for developing sCRS have been developed (see Davilla et al. Science translational medicine. 2014;6(224):224ra25). Factors include fevers, hypoxia, hypotension, neurologic changes, elevated serum levels of inflammatory cytokines, such as a set of seven cytokines (IFNy, IL-5, IL-6, IL- 10, Flt-3L, fractalkine, and GM-CSF) whose treatment-induced elevation can correlate well with both pretreatment tumor burden and sCRS symptoms. Other guidelines on the diagnosis and management of CRS are known (see e.g., Lee et al, Blood. 2014;124(2):188-95). In some embodiments, the criteria reflective of CRS grade are those detailed in Table 3 below. Table 3: Exemplary Grading Criteria for CRS Grade Description of Symptoms Not life-threatening, require only symptomatic treatment such as antipyretics | i ES Mild and anti-emetics (e.g., fever, nausea, fatigue, headache, myalgias, malaise) 2 Require and respond to moderate intervention: Moderate Oxygen requirement < 40%, or Hypotension responsive to fluids or low dose of a single vasopressor, | or Grade 2 organ toxicity (by CTCAE v4.0) 3 Require and respond to aggressive intervention: Severe Oxygen requirement > 40%, or Hypotension requiring high dose of a single vasopressor (e.g., AL pen AR HA ME Hiptt MBL UAL a olliplt Yao bool Ape norepinephrine > 20 pg / kg / min, dopamine > 10 pg / kg / min, phenylephrine > 200 pg / kg / min, or epinephrine > 10 pg / kg / min), or Hypotension requiring multiple vasopressors (e.g., vasopressin + one iid Sari a a Gl of the above agents, or combination vasopressors equivalent to > 20 pg / kg / min norepinephrine), or Grade 3 organ toxicity or Grade 4 transaminitis (by CTCAE v4.0) 4 Life-threatening: Life- Requirement for ventilator support, or threatening Grade 4 organ toxicity (excluding transaminitis) 5 Death Fatal

[0206] In some embodiments, outcomes associated with severe CRS or grade 3 CRS or greater, such as grade 4 or greater, include one or more of: persistent fever, e.g., fever of a specified temperature, e.g., greater than at or about 38 degrees Celsius, for two or more, e.g., three or more, e.g., four or more days or for at least three consecutive days; fever greater than at or about 38 degrees Celsius; elevation of cytokines, such as a max fold change, e.g., of at least at or about 75, compared to pre-treatment levels of at least two cytokines (e.g., at least two of the group consisting of interferon gamma (IFNy), GM-CSF, IL-6, IL-10, Flt-3L, fracktalkine, and IL-5, and / or tumor necrosis factor alpha (TNFa)), or a max fold change, e.g., of at least at or about 250 of at least one of such cytokines; and / or at least one clinical sign of toxicity, such as hypotension (e.g., as measured by at least one intravenous vasoactive pressor); hypoxia (e.g., plasma oxygen (PO2) levels of less than at or about 90%); and / or one or more neurologic disorders (including mental status changes, obtundation, and seizures). In some embodiments, severe CRS includes CRS that requires management or care in the intensive care unit (ICU).

[0207] In some embodiments, the CRS, such as severe CRS, encompasses a combination of (1) persistent fever (fever of at least 38 degrees Celsius for at least three days) and (2) a serum level of CRP of at least at or about 20 mg / dL. In some embodiments, the CRS encompasses hypotension requiring the use of two or more vasopressors or respiratory failure requiring mechanical ventilation. In some embodiments, the dosage of vasopressors is increased in a second or subsequent administration.

[0208] In some embodiments, severe CRS or grade 3 CRS encompasses an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, left ventricular dysfunction, encephalopathy, hydrocephalus, and / or tremor.

[0209] The method of measuring or detecting the various outcomes may be specified.

[0210] In some aspects, the toxic outcome is or is associated with neurotoxicity. In some embodiments, symptoms associated with a clinical risk of neurotoxicity include confusion, delirium, aphasia, expressive aphasia, obtundation, myoclonus, lethargy, altered mental status, convulsions, seizure-like activity, seizures (optionally as confirmed by electroencephalogram [EEG]), elevated levels of beta amyloid (Ap), elevated levels of glutamate, and elevated levels of oxygen radicals. In some embodiments, neurotoxicity is graded based on severity (e.g., using a Grade 1-5 scale (see, e.g., Guido Cavaletti & Paola Marmiroli Nature Reviews Neurology 6, 657-666 (December 2010); National Cancer Institute—Common Toxicity Criteria version 4.03 (NCI-CTCAE v4.03).

[0211] In some instances, neurologic symptoms may be the earliest symptoms of sCRS. In some embodiments, neurologic symptoms are seen to begin 5 to 7 days after cell therapy infusion. In some embodiments, duration of neurologic changes may range from 3 to 19 days. In some cases, recovery of neurologic changes occurs after other symptoms of sCRS have resolved. In some embodiments, time or degree of resolution of neurologic changes is not hastened by treatment with anti-IL-6 and / or steroid(s).

[0212] In some embodiments, a subject is deemed to develop “severe neurotoxicity” in response to or secondary to administration of a cell therapy or dose of cells thereof, if, following administration, the subject displays symptoms that limit self-care (e.g. bathing, dressing and undressing, feeding, using the toilet, taking medications) from among: 1) symptoms of peripheral motor neuropathy, including inflammation or degeneration of the peripheral motor nerves; 2) symptoms of peripheral sensory neuropathy, including inflammation or degeneration of the peripheral sensory nerves, dysesthesia, such as distortion of sensory perception, resulting in an abnormal and unpleasant sensation, neuralgia, such as intense painful sensation along a nerve or a group of nerves, and / or paresthesia, such as functional disturbances of sensory neurons resulting in abnormal cutaneous sensations of tingling, numbness, pressure, cold and warmth in the absence of stimulus. In some embodiments, severe neurotoxicity includes neurotoxicity with a grade of 3 or greater, such as set forth in Table 4. Table 4: Exemplary Grading Criteria for neurotoxicity Grade Description of Symptoms Mild or asymptomatic symptoms Asymptomatic or Mild 2 , Presence of symptoms that limit instrumental activities of daily Moderate A LROLALA VL oils ial aaa Alsi Aid ail vitibe Ul all, living (ADL), such as preparing meals, shopping for groceries or clothes, using the telephone, managing money 3 Presence of symptoms that limit self-care ADL, such as bathing, Severe Ri aie ali SL rl fh GL 1 EL Ss ae a a dressing and undressing, feeding self, using the toilet, taking medications 4 Symptoms that are life-threatening, requiring urgent intervention Life-threatening 5 Death Fatal

[0213] In some embodiments, the methods reduce symptoms associated with CRS or neurotoxicity compared to other methods. In some aspects, the provided methods reduce symptoms, outcomes or factors associated with CRS, including symptoms, outcomes or factors associated with severe CRS or grade 3 or higher CRS, compared to other methods. For example, subjects treated according to the present methods may lack detectable and / or have reduced symptoms, outcomes or factors of CRS, e.g. severe CRS or grade 3 or higher CRS, such as any described, e.g. set forth in Table 3. In some embodiments, subjects treated according to the present methods may have reduced symptoms of neurotoxicity, such as limb weakness or numbness, loss of memory, vision, and / or intellect, uncontrollable obsessive and / or compulsive behaviors, delusions, headache, cognitive and behavioral problems including loss of motor control, cognitive deterioration, and autonomic nervous system dysfunction, and sexual dysfunction, compared to subjects treated by other methods. In some embodiments, subjects treated according to the present methods may have reduced symptoms associated with peripheral motor neuropathy, peripheral sensory neuropathy, dysethesia, neuralgia or paresthesia.

[0214] In some embodiments, the methods reduce outcomes associated with neurotoxicity including damages to the nervous system and / or brain, such as the death of neurons. In some aspects, the methods reduce the level of factors associated with neurotoxicity such as beta amyloid (Ap), glutamate, and oxygen radicals.

[0215] In some embodiments, the toxicity outcome is a dose-limiting toxicity (DLT). In some embodiments, the toxic outcome is a dose-limiting toxicity. In some embodiments, the toxic outcome is the absence of a dose-limiting toxicity. In some embodiments, a dose-limiting toxicity (DLT) is defined as any grade 3 or higher toxicity as assessed by any known or published guidelines for assessing the particular toxicity, such as any described above and including the National Cancer Institute (NCI) Common Terminology Criteria for Adverse Events (CTCAE) version 4.0.

[0216] In some aspects, a DLT can be described as any treatment-emergent grade 4 or 5 AEs, except those listed in the exceptions below; any treatment-emergent grade 3 AEs that do not resolve to grade <2 within 7 days, except those listed in the exceptions below; any treatment-emergent grade 3 seizures that do not resolve to grade <2 within 3 days; and any treatment-emergent autoimmune toxicity grade >3, with the exception of B-cell aplasia (which is an expected risk associated with administration of engineered cell); exceptions listed below are not considered DLTs: any treatment-emergent AE that is clearly unrelated to the administration of the engineered cells (e.g., motor vehicle accident); grade 4 infusional toxicities that are reversible to grade <2 in 8 hours; grade 3 or 4 fever or febrile neutropenia for <2 weeks; grade 4 transaminitis that is considered a symptom of CRS; grade 3 transaminitis for <2 weeks; grade 3 bone pain due to T-cell expansion in marrow compartments for <2 weeks; grade 3 or 4 TLS for <7 days; grade 3 or 4 hypotension (without other CRS symptoms) requiring a single vasopressor for support that resolves to grade <3 in <72 hours; grade 3 or 4 CRS with hypotension alone requiring a single vasopressor for support (not requiring intubation) that resolves to grade <3 in <72 hours, or grade 3 CRS with severity based on grade 4 transaminitis; grade 3 or 4 encephalopathy for <7 days that resolves to baseline in <14 days from the beginning of the grade >3 event; grade 3 chills; grade 3 or 4 lymphopenia; grade 3 or 4 leukopenia; grade 3 or 4 asymptomatic electrolyte abnormalities that resolve with replacement; grade 3 or 4 thrombocytopenia; grade 3 or 4 anemia; and grade 3 or 4 B-cell aplasia and hypogammaglobulinemia.

[0217] In some embodiments, the low rate, risk or likelihood of developing a toxicity, e.g. CRS or neurotoxicity or severe CRS or neurotoxicity, e.g. grade 3 or higher CRS or neurotoxicity, observed with administering a dose of T cells in accord with the provided methods, and / or with the provided articles of manufacture or compositions, permits administration of the cell therapy on an outpatient basis. In some embodiments, the administration of the cell therapy, e.g. dose of T cells (e.g. CAR+ T cells) in accord with the provided methods, and / or with the provided articles of manufacture or compositions, is performed on an outpatient basis or does not require admission to the subject to the hospital, such as admission to the hospital requiring an overnight stay.

[0218] In some aspects, subjects administered the cell therapy, e.g. dose of T cells (e.g. CAR+ T cells) in accord with the provided methods, and / or with the provided articles of manufacture or compositions, including subjects treated on an outpatient basis, are not administered an intervention for treating any toxicity prior to or with administration of the cell dose, unless or until the subject exhibits a sign or symptom of a toxicity, such as of a neurotoxicity or CRS. Exemplary agents for treating, delaying, attenuating or ameliorating a toxicity are described in Section IL

[0219] In some embodiments, if a subject administered the cell therapy, e.g. dose of T cells (e.g. CAR+ T cells), including subjects treated on an outpatient basis, exhibits a fever the subject is given or is instructed to receive or administer a treatment to reduce the fever. In some embodiments, the fever in the subject is characterized as a body temperature of the subject that is (or is measured at) at or above a certain threshold temperature or level. In some aspects, the threshold temperature is that associated with at least a low-grade fever, with at least a moderate fever, and / or with at least a high-grade fever. In some embodiments, the threshold temperature is a particular temperature or range. For example, the threshold temperature may be at or about or at least at or about 38, 39, 40, 41, or 42 degrees Celsius, and / or may be arange of at or about 38 degrees Celsius to at or about 39 degrees Celsius, a range of at or about 39 degrees Celsius to at or about 40 degrees Celsius, a range of at or about 40 degrees Celsius to at or about 41 degrees, or a range of at or about 41 degrees Celsius to at or about 42 degrees Celsius.

[0220] In some embodiments, the treatment designed to reduce fever includes treatment with an antipyretic. An antipyretic may include any agent, e.g., compound, composition, or ingredient, that reduces fever, such as one of any number of agents known to have antipyretic effects, such as NSAIDs (such as ibuprofen, naproxen, ketoprofen, and nimesulide), salicylates, such as aspirin, choline salicylate, magnesium salicylate, and sodium salicylate, paracetamol, acetaminophen, Metamizole, Nabumetone, Phenaxone, antipyrine, febrifuges. In some embodiments, the antipyretic is acetaminophen. In some embodiments, acetaminophen can be administered at a dose of 12.5 mg / kg orally or intravenously up to every four hours. In some embodiments, it is or comprises ibuprofen or aspirin.

[0221] In some embodiments, if the fever is a sustained fever, the subject is administered an alternative treatment for treating the toxicity, such as any described in Section II below. For subjects treated on an outpatient basis, the subject is instructed to return to the hospital if the subject has and / or is determined to or to have a sustained fever. In some embodiments, the subject has, and / or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject is not reduced, or is not reduced by or by more than a specified amount (e.g., by more than 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C), following a specified treatment, such as a treatment designed to reduce fever such as treatment with an antipyretic, e.g. NSAID or salicylates, e.g. ibuprofen, acetaminophen or aspirin. For example, a subject is considered to have a sustained fever if he or she exhibits or is determined to exhibit a fever of at least at or about 38 or 39 degrees Celsius, which is not reduced by or is not reduced by more than at or about 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C, or by at or about 1%, 2%, 3%, 4%, or 5%, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours, even following treatment with the antipyretic such as acetaminophen. In some embodiments, the dosage of the antipyretic is a dosage ordinarily effective in such as subject to reduce fever or fever of a particular type such as fever associated with a bacterial or viral infection, e.g., a localized or systemic infection.

[0222] In some embodiments, the subject has, and / or is determined to or considered to have, a sustained fever if he or she exhibits a fever at or above the relevant threshold temperature, and where the fever or body temperature of the subject does not fluctuate by about, or by more than about, 1 °C, and generally does not fluctuate by about, or by more than about, 0.5 °C, 0.4 °C, 0.3 °C, or 0.2 °C. Such absence of fluctuation above or at a certain amount generally is measured over a given period of time (such as over a 24-hour, 12-hour, 8-hour, 6-hour, 3-hour, or 1-hour period of time, which may be measured from the first sign of fever or the first temperature above the indicated threshold). For example, in some embodiments, a subject is considered to or is determined to exhibit sustained fever if he or she exhibits a fever of at least at or about or at least at or about 38 or 39 degrees Celsius, which does not fluctuate in temperature by more than at or about 0.5°C, 0.4 °C, 0.3 °C, or 0.2 °C, over a period of 6 hours, over a period of 8 hours, or over a period of 12 hours, or over a period of 24 hours.

[0223] In some embodiments, the fever is a sustained fever; in some aspects, the subject is treated at a time at which a subject has been determined to have a sustained fever, such as within one, two, three, four, five six, or fewer hours of such determination or of the first such determination following the initial therapy having the potential to induce the toxicity, such as the cell therapy, such as dose of T cells, e.g. CAR+ T cells.

[0224] In some embodiments, one or more interventions or agents for treating the toxicity, such as a toxicity-targeting therapies, is administered at a time at which or immediately after which the subject is determined to or confirmed to (such as is first determined or confirmed to) exhibit sustained fever, for example, as measured according to any of the aforementioned embodiments. In some embodiments, the one or more toxicity-targeting therapies is administered within a certain period of time of such confirmation or determination, such as within 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, or 8 hours thereof. E. Biomarkers

[0225] Among the provided methods are methods of treatment that involves assessing a risk for developing toxicity associated with cell therapy in a subject that involves assessing or detecting biomarkers (e.g., analytes) or parameters that are associated with the toxicity, e.g., neurotoxicity, such as severe neurotoxicity, and / or CRS, such as severe CRS. In some aspects, the subject is administered a therapy, e.g., engineered T cell therapy, based on the assessment. In some embodiments, the biomarkers include TNF-alpha (TNFa) and interleukin-16 (IL-16).

[0226] In some embodiments, the methods involve assessing or detecting the presence or absence of biomarkers (e.g. TNFa or IL-16) and / or parameters (e.g. concentration, amount, level or activity) associated with biomarkers (e.g. TNFa or IL-16). In some cases, the methods can include comparing the one or more parameters to a particular reference value, such as a threshold level (also called “threshold value” herein), e.g., those associated with a risk for developing toxicity, such as CRS or NT, and / or severe toxicity, e.g., severe CRS or NT. In some embodiments, the methods also involve selecting subjects for treatment with a cell therapy based on the assessment of the presence or absence of the biomarker and / or comparison of the biomarkers to a reference value or threshold level of the biomarker. In some embodiments, the methods also involve administering an agent or a therapy that can treat, prevent, delay and / or attenuate development of the toxicity, e.g., based on the assessment of the presence or absence of the biomarker and / or comparison of the biomarkers to a reference value or threshold level of the biomarker.

[0227] In some embodiments, the methods involve assessing the risk of development of a toxicity, before and / or after administration of a cell therapy. In some embodiments, the methods involve assessing the level, amount or concentration of the biomarkers (e.g. TNFa or IL-16) in a biological sample, wherein the biological sample is from a subject that is a candidate for treatment with the cell therapy, said cell therapy optionally comprising a dose or composition of genetically engineered cells expressing a recombinant receptor; and the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the recombinant receptor and / or said engineered cells. In some aspects, the methods involve comparing, individually, the level, amount or concentration of the analyte in the sample to a threshold level, thereby determining a risk of developing a toxicity after administration of the cell therapy. In some aspects, the comparisons can be used to determine the risk of development of a toxicity, after administration of a cell therapy.

[0228] In some embodiments, the methods involve assaying a biological sample for the level, amount or concentration of TNF-alpha, wherein the biological sample is from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells; and comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy.

[0229] In some embodiments, if the subject is identified as at risk for developing a grade 3 or higher neurotoxicity, the method further involves: (i) administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and / or (b) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (ii) administering to the subject an alternative treatment other than the cell therapy for treating the disease or condition.

[0230] In some embodiments, if the subject is identified as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy: (i) the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administration and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.

[0231] In some embodiments, the the assaying method involves: (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for TNF-alpha, optionally wherein the one or more reagent comprises an antibody that specifically recognizes TNF-alpha; and (b) detecting the presence or absence of a complex comprising the one or more reagent and TNF-alpha.

[0232] In some embodiments, the method involves administering to a subject a cell therapy for treating a disease or condition, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR, wherein: (1) if the subject has a level, amount or concentration of TNF-alpha in a biological sample from the subject that is at or above a threshold level, the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy: (i) administering to the subject the cell therapy at a reduced dose, (ii) further administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity; and / or (iii) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (2) if the subject is selected or identified as having a level, amount or concentration of TNF-alpha in a biological sample from the subject that is below a threshold level, the subject is identified as not at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy: (i) not administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administering and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic, wherein the subject is a candidate for treatment with the cell therapy, said biological sample obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells.

[0233] In some embodiments, if the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy, the method involves administering the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, wherein the agent is administered to the subject concurrently with the cell therapy or within three days of administering the cell therapy to the subject.

[0234] In some embodiments, the method includes (a) assaying a biological sample from a subject for the level, amount or concentration of IL-16, said subject having received administration of a cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject within one, two, or three days after the initiation of administration of the cell therapy; and (b) comparing the level, amount or concentration of IL-16 to a threshold level, wherein: (1) if the level, amount or concentration of IL-16 is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity; and (2) if the level, amount or concentration of IL-16 is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity.

[0235] In some embodiments, if the subject is identified at risk of developing a grade 3 or higher neurotoxicity, the method involves administering an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity. In some embodiments, the assaying involves (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for IL-16, optionally wherein the one or more reagent comprises an antibody that specifically recognizes IL-16; and (b) detecting the presence or absence of a complex comprising the one or more reagent and IL-16. In some embodiments, the method involves prior to the assaying, administering to the subject the cell therapy.

[0236] In some embodiments, the method involves administering to a subject, identified as at risk of developing a grade 3 or higher neurotoxicity, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, said subject having previously received administration of a cell therapy for treating a disease or condition, wherein, at or immediately prior to administering the agent, the subject is selected or identified as being at risk of developing a grade 3 or higher neurotoxicity if the level or amount or concentration of IL-16 in a biological sample, obtained from the subject within one, two, or three days of the initiation of administration of the cell therapy, is above a threshold level. In some embodiemtns, the administering the agent is carried out at a time when the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic. In some embodiemnents, the administering to the subject the cell therapy was carried out on an outpatient basis and, if the level, amount or concentration of IL-16 is above a threshold level the method comprises admitting the patient to the hospital for one or more days.

[0237] In some embodiments, the biological sample is or is obtained from a blood, plasma or serum sample. In some embodiments, the assaying comprises an immunoassay.In some embodiments, provided is a cell therapy for use in a method of treatment, wherein the method comprises: assaying a biological sample for the level, amount or concentration of TNF-alpha, wherein the biological sample is from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells; comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and / or (b) the administering to the subject of the cell therapy is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days.

[0238] In some of any embodiments, provided herein is an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a neurotoxicity for use in a method of reducing neurotoxicity after administration of a cell therapy, wherein the method comprises: assaying a biological sample for the level, amount or concentration of TNF-alpha, wherein the biological sample is from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells; comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and administering to the subject the agent or other treatment and cell therapy, optionally at a reduced dose and / or (b) the administering to the subject of the cell therapy is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days.

[0239] In some embodiments, provided herein is a cell therapy for use in a method of treatment, wherein the method comprises administering to a subject the cell therapy, optionally at a reduced dose, optionally wherein (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and / or (b) the administering to the subject of the cell therapy is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days, wherein said patient has been identified as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy on the basis of a method comprising: assaying a biological sample from the subject that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells for the level, amount or concentration of TNF-alpha, and comparing the level, amount or concentration of TNF- alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy.

[0240] In some embodiments, provided herein is an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a neurotoxicity for use in a method of reducing neurotoxicity after administration of a cell therapy, wherein the method comprises: administering to a subject the cell therapy, optionally at a reduced dose, and the agent or other treatment, optionally wherein the administering to the subject of the cell therapy and the agent or other treatment is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days, wherein said patient has been identified as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy on the basis of a method comprising: assaying a biological sample from the subject that is a candidate for treatment with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells for the level, amount or concentration of TNF-alpha, and comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy. 11. INTERVENTIONS OR AGENTS THAT TREAT OR AMELIORATE SYMPTOMS OF TOXICITY

[0241] In some embodiments, the provided methods and articles of manufacture can be used in connection with, or involve or include, one or more agents or treatments for treating, preventing, delaying, or attenuating the development of a toxicity. In some examples, the agent or other treatment capable of treating, preventing, delaying, or attenuating the development of a toxicity is administered prior to and / or concurrently with administration of a therapeutic cell composition comprising the genetically engineered cells.

[0242] In some embodiments, the agent, €.g., a toxicity-targeting agent, or treatment capable of treating, preventing, delaying, or attenuating the development of a toxicity is a steroid, is an antagonist or inhibitor of a cytokine receptor, such as IL-6 receptor, CD122 receptor (IL-2Rbeta receptor), or CCR2, or is an inhibitor of a cytokine, such as IL-6, MCP-1, IL-10, IFN-y, IL-8, or IL-18. In some embodiments, the agent is an agonist of a cytokine receptor and / or cytokine, such as TGF-B. In some embodiments, the agent, e.g., agonist, antagonist or inhibitor, is an antibody or antigen-binding fragment, a small molecule, a protein or peptide, or a nucleic acid.

[0243] In some embodiments, a fluid bolus can be employed as an intervention, such as to treat hypotension associated with CRS. In some embodiments, the target hematocrit levels are >24%. In some embodiments, the intervention includes the use of absorbent resin technology with blood or plasma filtration. In some cases, the intervention includes dialysis, plasmapheresis, or similar technologies. In some embodiments, vasopressors or acetaminophen can be employed.

[0244] In some embodiments, the agent can be administered sequentially, intermittently, or at the same time as or in the same composition as the therapy, such as cells for adoptive cell therapy. For example, the agent can be administered before, during, simultaneously with, or after administration of the immunotherapy and / or cell therapy.

[0245] In some embodiments, the agent is administered at a time as described herein and in accord with the provided methods, and / or with the provided articles of manufacture or compositions. In some embodiments, the toxicity-targeting agent is administered at a time that is within, such as less than or no more than, 3,4, 5, 6, 7, 8, 9 or 10 days after initiation of the immunotherapy and / or cell therapy. In some embodiments, the toxicity-targeting agent is administered within or within about 1 day, 2 days or 3 days after initiation of administration of the immunotherapy and / or cell therapy.

[0246] In some embodiments, the agent, e.g., toxicity-targeting agent, is administered to a subject after initiation of administration of the immunotherapy and / or cell therapy at a time at which the subject does not exhibit grade 2 or higher CRS or grade 2 or higher neurotoxicity. In some aspects, the toxicity- targeting agent is administered after initiation of administration of the immunotherapy and / or cell therapy at a time at which the subject does not exhibit severe CRS or severe neurotoxicity. Thus, between initiation of administration of the immunotherapy and / or cell therapy and the toxicity-targeting agent, the subject is one that does not exhibit grade 2 or higher CRS, such as severe CRS, and / or does not exhibit grade 2 or higher neurotoxicity, such as severe neurotoxicity.

[0247] Non-limiting examples of interventions for treating or ameliorating a toxicity, such as severe CRS (sCRS) or severe neurotoxicity, are described in Table 5. In some embodiments, the intervention includes tocilizumab or other toxicity-targeting agent as described, which can be at a time in which there is a sustained or persistent fever of greater than or about 38 °C or greater than or greater than about 39 °C in the subject. In some embodiments, the fever is sustained in the subject for more than 10 hours, more than 12 hours, more than 16 hours, or more than 24 hours before intervention. Table 5. Exemplary Interventions. Symptoms related to CRS Suggested Intervention Fever of > 38.3°C Acetaminophen (12.5 mg / kg) PO / IV up to every four hours Persistent fever of > 39°C for 10 hours that is Tocilizumab (8-12 mg / kg) IV unresponsive to acetaminophen Persistent fever of > 39°C after tocilizumab , Dexamethasone 5-10 mg IV / PO up to every 6- aS sat al ai aa ER ES Ce sd rr, Aap tee Taner 12 hours with continued fevers Recurrence of symptoms 48 hours after initial Tocilizumab (8-12 mg / kg) IV dose of tocilizumab Hypotension Fluid bolus, target hematocrit >24% Persistent / recurrent hypotension after initial Tocilizumab (8-12 mg / kg) IV fluid bolus (within 6 hours) Use of low dose pressors for hypotension for Dexamethasone 5-10 mg IV / PO up to every 6 longer than 12 hours hours with continued use of pressors Initiation of higher dose pressors or addition of Dexamethasone 5-10 mg IV / PO up to every 6 a second pressor for hypotension hours with continued use of pressors a second pressor for hypotension hours with continued use of press Initiation of oxygen supplementation Tocilizumab (8-12 mg / kg) IV Increasing respiratory support with concern for Dexamethasone 5-10 mg IV / PO up to every 6 impending intubation hours with continued use of pressors Recurrence / Persistence of symptoms for which Tocilizumab (8-12 mg / kg) IV tocilizumab was given > 48 hours after initial dose was administered

[0248] In some cases, the agent or therapy or intervention, e.g., toxicity-targeting agent, is administered alone or is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation, as described herein. Thus, the agent alone or as part of a pharmaceutical composition can be administered intravenously or orally, or by any other acceptable known route of administration or as described herein.

[0249] In some embodiments, the dosage of agent or the frequency of administration of the agent in a dosage regimen is reduced compared to the dosage of the agent or its frequency in a method in which a subject is treated with the agent after grade 2 or higher CRS or neurotoxicity, such as after severe, e.g., grade 3 or higher, CRS or after severe, e.g., grade 3 or higher neurotoxicity, has developed or been diagnosed (e.g. after physical signs or symptoms of grade 3 or higher CRS or neurotoxicity has manifested). In some embodiments, the dosage of agent or the frequency of administration of the agent in a dosage regimen is reduced compared to the dosage of the agent or its frequency in a method in which a subject is treated for CRS or neurotoxicity greater than 3 days, 4 days, 5 days, 6 days, 1 week, 2 weeks, three weeks, or more after administration of the immunotherapy and / or cell therapy. In some embodiments, the dosage is reduced by greater than or greater than about 1.2-fold, 1.5-fold, 2-fold, 3- fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold or more. In some embodiments, the dosage is reduced by greater than or about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the frequency of dosing is reduced, such as the number of daily doses is reduced or the number of days of dosing is reduced. A. Steroid

[0250] In some embodiments, the agent, .g., toxicity-targeting agent, that treats and / or that prevents, delays, or attenuates the development of or risk for developing a toxicity to an immunotherapy and / or a cell therapy, is a steroid, e.g., corticosteroid. Corticosteroids typically include glucocorticoids and mineralocorticoids.

[0251] Any corticosteroid, e.g., glucocorticoid, can be used in the methods provided herein. In some embodiments, glucocorticoids include synthetic and non-synthetic glucocorticoids. Exemplary glucocorticoids include, but are not limited to: alclomethasones, algestones, beclomethasones (e.g. beclomethasone dipropionate), betamethasones (e.g. betamethasone 17-valerate, betamethasone sodium acetate, betamethasone sodium phosphate, betamethasone valerate), budesonides, clobetasols (e.g. clobetasol propionate), clobetasones, clocortolones (e.g. clocortolone pivalate), cloprednols, corticosterones, cortisones and hydrocortisones (e.g. hydrocortisone acetate), cortivazols, deflazacorts, desonides, desoximethasones, dexamethasones (e.g. dexamethasone 21-phosphate, dexamethasone acetate, dexamethasone sodium phosphate), diflorasones (e.g. diflorasone diacetate), diflucortolones, difluprednates, enoxolones, fluazacorts, flucloronides, fludrocortisones (e.g., fludrocortisone acetate), flumethasones (e.g. flumethasone pivalate), flunisolides, fluocinolones (e.g. fluocinolone acetonide), fluocinonides, fluocortins, fluocortolones, fluorometholones (e.g. fluorometholone acetate), fluperolones (e.g., fluperolone acetate), fluprednidenes, fluprednisolones, flurandrenolides, fluticasones (e.g. fluticasone propionate), formocortals, halcinonides, halobetasols, halometasones, halopredones, hydrocortamates, hydrocortisones (e.g. hydrocortisone 21-butyrate, hydrocortisone aceponate, hydrocortisone acetate, hydrocortisone buteprate, hydrocortisone butyrate, hydrocortisone cypionate, hydrocortisone hemisuccinate, hydrocortisone probutate, hydrocortisone sodium phosphate, hydrocortisone sodium succinate, hydrocortisone valerate), loteprednol etabonate, mazipredones, medrysones, meprednisones, methylprednisolones {methylprednisolone aceponate, methylprednisolone acetate, methylprednisolone hemisuccinate, methylprednisolone sodium succinate), mometasones (e.g., mometasone furoate), paramethasones (e.g., paramethasone acetate), prednicarbates, prednisolones (e.g. prednisolone 25-diethylaminoacetate, prednisolone sodium phosphate, prednisolone 21-hemisuccinate, prednisolone acetate; prednisolone farnesylate, prednisolone hemisuccinate, prednisolone-21 (beta-D- glucuronide), prednisolone metasulphobenzoate, prednisolone steaglate, prednisolone tebutate, prednisolone tetrahydrophthalate), prednisones, prednivals, prednylidenes, rimexolones, tixocortols, triamcinolones (e.g. triamcinolone acetonide, triamcinolone benetonide, triamcinolone hexacetonide, triamcinolone acetonide 21-palmitate, triamcinolone diacetate). These glucocorticoids and the salts thereof are discussed in detail, for example, in Remington's Pharmaceutical Sciences, A. Osol, ed., Mack Pub. Co., Easton, Pa. (16th ed. 1980).

[0252] In some examples, the glucocorticoid is selected from among cortisones, dexamethasones, hydrocortisones, methylprednisolones, prednisolones and prednisones. In a particular example, the glucocorticoid is dexamethasone.

[0253] In some embodiments, the agent is a corticosteroid and is administered in an amount that is therapeutically effective to treat, ameliorate or reduce one or more symptoms of a toxicity to an immunotherapy and / or a cell therapy, such as CRS or neurotoxicity. In some embodiments, indicators of improvement or successful treatment include determination of the failure to manifest a relevant score on toxicity grading scale (e.g. CRS or neurotoxicity grading scale), such as a score of less than 3, or a change in grading or severity on the grading scale as discussed herein, such as a change from a score of 4 to a score of 3, or a change from a score of 4 to a score of 2, 1 or 0.

[0254] In some aspects, the corticosteroid is provided in a therapeutically effective dose. Therapeutically effective concentration can be determined empirically by testing in known in vitro or in vivo (e.g. animal model) systems. For example, the amount of a selected corticosteroid to be administered to ameliorate symptoms or adverse effects of a toxicity to an immunotherapy and / or a cell therapy, such as CRS or neurotoxicity, can be determined by standard clinical techniques. In addition, animal models can be employed to help identify optimal dosage ranges. The precise dosage, which can be determined empirically, can depend on the particular therapeutic preparation, the regime and dosing schedule, the route of administration and the seriousness of the disease.

[0255] The corticosteroid can be administered in any amount that is effective to ameliorate one or more symptoms associated with the toxicity, such as with the CRS or neurotoxicity. The corticosteroid, e.g., glucocorticoid, can be administered, for example, at an amount between at or about 0.1 and 100 mg, per dose, 0.1 to 80 mg, 0.1 to 60 mg, 0.1 to 40 mg, 0.1 to 30 mg, 0.1 to 20 mg, 0.1 to 15 mg, 0.1 to 10 mg, 0.1 to 5 mg, 0.2 to 40 mg, 0.2 to 30 mg, 0.2 to 20 mg, 0.2 to 15 mg, 0.2 to 10 mg, 0.2 to 5 mg, 0.4 to 40 mg, 0.4 to 30 mg, 0.4 to 20 mg, 0.4 to 15 mg, 0.4 to 10 mg, 0.4 to 5 mg, 0.4 to 4 mg, 1 to 20mg, 1 to 15 mg or 1 to 10 mg, to a 70 kg adult human subject. Typically, the corticosteroid, such as a glucocorticoid is administered at an amount between at or about 0.4 and 20 mg, for example, at or about 0.4 mg, 0.5 mg, 0.6 mg, 0.7 mg, 0.75 mg, 0.8 mg, 0.9 mg, 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg or 20 mg per dose, to an average adult human subject.

[0256] In some embodiments, the corticosteroid can be administered, for example, at a dosage of at or about 0.001 mg / kg (of the subject), 0.002 mg / kg, 0.003 mg / kg, 0.004 mg / kg, 0.005 mg / kg, 0.006 mg / kg, 0.007 mg / kg, 0.008 mg / kg, 0.009 mg / kg, 0.01 mg / kg, 0.015 mg / kg, 0.02 mg / kg, 0.025 mg / kg, 0.03 mg / kg, 0.035 mg / kg, 0.04 mg / kg, 0.045 mg / kg, 0.05 mg / kg, 0.055 mg / kg, 0.06 mg / kg, 0.065 mg / kg, 0.07 mg / kg, 0.075 mg / kg, 0.08 mg / kg, 0.085 mg / kg, 0.09 mg / kg, 0.095 mg / kg, 0.1 mg / kg, 0.15 mg / kg, 0.2 mg / kg, 0.25 mg / kg, 0.30 mg / kg, 0.35 mg / kg, 0.40 mg / kg, 0.45 mg / kg, 0.50 mg / kg, 0.55 mg / kg, 0.60 mg / kg, 0.65 mg / kg, 0.70 mg / kg, 0.75 mg / kg, 0.80 mg / kg, 0.85 mg / kg, 0.90 mg / kg, 0.95 mg / kg, 1 mg / kg, 1.05 mg / kg, 1.1 mg / kg, 1.15 mg / kg, 1.20 mg / kg, 1.25 mg / kg, 1.3 mg / kg, 1.35 mg / kg or 1.4 mg / kg, to an average adult human subject, typically weighing about 70 kg to 75 kg.

[0257] The corticosteroid, or glucocorticoid, for example dexamethasone, can be administered orally (tablets, liquid or liquid concentrate), PO, intravenously (IV), intramuscularly or by any other known route or route described herein (e.g., with respect to pharmaceutical formulations). In some aspects, the corticosteroid is administered as a bolus, and in other aspects it may be administered over a period of time.

[0258] In some aspects, the glucocorticoid can be administered over a period of more than one day, such as over two days, over 3 days, or over 4 or more days. In some embodiments, the corticosteroid can be administered one per day, twice per day, or three times or more per day. For example, the corticosteroid, e.g., dexamethasone, may in some examples be administered at 10 mg (or equivalent) IV twice a day for three days.

[0259] In some embodiments, the dosage of corticosteroid, e.g., glucocorticoid, is administered in successively lower dosages per treatment. Hence, in some such treatment regimes, the dose of corticosteroid is tapered. For example, the corticosteroid may be administered at an initial dose (or equivalent dose, such as with reference to dexamethasone) of 4 mg, and upon each successive administration the dose may be lowered, such that the dose is 3 mg for the next administration, 2 mg for the next administration, and 1 mg for the next administration

[0260] Generally, the dose of corticosteroid administered is dependent upon the specific corticosteroid, as a difference in potency exists between different corticosteroids. It is typically understood that drugs vary in potency, and that doses can therefore vary, in order to obtain equivalent effects. Table 6 shows equivalence in terms of potency for various glucocorticoids and routes of administration. Equivalent potency in clinical dosing is well known. Information relating to equivalent steroid dosing (in a non-chronotherapeutic manner) may be found in the British National Formulary (BNF) 37, March 1999. Table 6: Glucocorticoid administration Glucocorticoid (Route) Equivalency Potency Hydrocortisone (IV or PO) 20 Prednisone 5 Prednisolone (IV or PO 5 Methylprednisolone sodium succinate (IV. 4 Dexamethasone (IV or PO) 0.5-0.75

[0261] Thus, in some embodiments, the steroid is administered in an equivalent dosage amount of from or from about 1.0 mg to 20 mg dexamethasone per day, such as 1.0 mg to 15 mg dexamethasone per day, 1.0 mg to 10 mg dexamethasone per day, 2.0 mg to 8 mg dexamethasone per day, or 2.0 mg to 6.0 mg dexamethasone per day, each inclusive. In some cases, the steroid is administered in an equivalent dose of at or about 4 mg or at or about 8 mg dexamethasone per day.

[0262] In some embodiments, the steroid is administered if fever persists after treatment with tocilizumab. For example, in some embodiments, dexamethasone is administered orally or intravenously at a dosage of 5-10 mg up to every 6-12 hours with continued fevers. In some embodiments, tocilizumab is administered concurrently with or subsequent to oxygen supplementation. B. Microglial Cell Inhibitor

[0263] In some embodiments, the inhibitor in the combination therapy is an inhibitor of a microglial cell activity. In some embodiments, the administration of the inhibitor modulates the activity of microglia. In some embodiments, the inhibitor is an antagonist that inhibits the activity of a signaling pathway in microglia. In some embodiments, the microglia inhibitor affects microglial homeostasis, survival, and / or proliferation. In some embodiments, the inhibitor targets the CSFIR signaling pathway. In some embodiments, the inhibitor is an inhibitor of CSFIR. In some embodiments, the inhibitor is a small molecule. In some cases, the inhibitor is an antibody.

[0264] In some aspects, administration of the inhibitor results in one or more effects selected from an alteration in microglial homeostasis and viability, a decrease or blockade of microglial cell proliferation, a reduction or elimination of microglial cells, a reduction in microglial activation, a reduction in nitric oxide production from microglia, a reduction in nitric oxide synthase activity in microglia, or protection of motor neurons affected by microglial activation. In some embodiments, the agent alters the level of a serum or blood biomarker of CSFIR inhibition, or a decrease in the level of urinary collagen type 1 cross-linked N-telopeptide (NTX) compared to at a time just prior to initiation of the administration of the inhibitor. In some embodiments, the administration of the agent transiently inhibits the activity of microglia activity and / or wherein the inhibition of microglia activity is not permanent. In some embodiments, the administration of the agent transiently inhibits the activity of CSFIR and / or wherein the inhibition of CSF1R activity is not permanent.

[0265] In some embodiments, the agent that reduces microglial cell activity is a small molecule, peptide, protein, antibody or antigen-binding fragment thereof, an antibody mimetic, an aptamer, or a nucleic acid molecule. In some embodiments, the method involves administration of an inhibitor of microglia activity. In some embodiments, the agent is an antagonist that inhibits the activity of a signaling pathway in microglia. In some embodiments, the agent that reduces microglial cell activity affects microglial homeostasis, survival, and / or proliferation.

[0266] In some embodiments, the agent that reduces microglial cell activation is selected from an anti-inflammatory agent, an inhibitor of NADPH oxidase (NOX2), a calcium channel blocker, a sodium channel blocker, inhibits GM-CSF, inhibits CSF1R, specifically binds CSF-1, specifically binds IL-34, inhibits the activation of nuclear factor kappa B (NF-«B), activates a CB; receptor and / or is a CB» agonist, a phosphodiesterase inhibitor, inhibits microRNA-155 (miR-155), upregulates microRNA-124 (miR-124), inhibits nitric oxide production in microglia, inhibits nitric oxide synthase, or activates the transcription factor NRF2 (also called nuclear factor (erythroid-derived 2)-like 2, or NFE2L2).

[0267] In some embodiments, the agent that reduces microglial cell activity targets CSF1 (also called macrophage colony-stimulating factor MCSF). In some embodiments, the agent that reduces microglial cell activity affects MCSF-stimulated phosphorylation of the M-CSF receptor (Pryer et al. Proc Am Assoc Cancer Res, AACR Abstract nr DDT02-2 (2009)). In some cases, the agent that reduces microglial cell activity is MCS110 (international patent application publication number W02014001802; Clinical Trial Study Record Nos.:A1 NCT00757757; NCT02807844; NCT02435680; NCT01643850).

[0268] In some embodiments, the agent that reduces microglial cell activity is a small molecule that targets the CSF1 pathway. In some embodiments, the agent is a small molecule that binds CSFIR. In some embodiments, the agent is a small molecule which inhibits CSF1R kinase activity by competing with ATP binding to CSFIR kinase. In some embodiments, the agent is a small molecule which inhibits the activation of the CFSIR receptor. In some cases, the binding of the CSF-1 ligand to the CSFIR is inhibited. In some embodiments, the agent that reduces microglial cell activity is any of the inhibitors described in US Patent Application Publication Number US20160032248.

[0269] In some embodiments, the agent is a small molecule inhibitor selected from PLX-3397, PLX7486, INJ-40346527, INJ28312141, ARRY-382, PLX73086 (AC-708), DCC-3014, AZD6495, GW2580, Ki20227, BLZ945, PLX647, PLX5622. In some embodiments, the agent is any of the inhibitors described in Conway et al., Proc Natl Acad Sci U S A, 102(44):16078-83 (2005); Dagher et al., Journal of Neuroinflammation, 12:139 (2015); Ohno et al., Mol Cancer Ther. 5(11):2634-43 (2006); von Tresckow et al. Clin Cancer Res.,21(8) (2015); Manthey et al. Mol Cancer Ther. (8(11):3151-61 (2009); Pyonteck et al., Nat Med. 19(10): 1264-1272 (2013); Haegel et al., Cancer Res AACR Abstract nr 288 (2015); Smith et al., Cancer Res AACR Abstract nr 4889 (2016); Clinical Trial Study Record Nos.: NCT01525602; NCT02734433; NCT02777710; NCT01804530; NCT01597739; NCT01572519; NCT01054014; NCT01316822; NCT02880371; NCT02673736; international patent application publication numbers W02008063888A2, WO2006009755A2, US patent application publication numbers US20110044998, US 2014 / 0065141, and US 2015 / 0119267.

[0270] In some embodiments, the agent that reduces microglial cell activity is 4-((2-(((1R,2R)-2- hydroxycyclohexyl)amino)benzo[d]thiazol-6-yl)oxy)-N-methylpicolinamide (BLZ945) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: Lo NY Rr? NON NS ™ J AON A i wherein R1 is an alkyl pyrazole or an alkyl carboxamide, and R2 is a hydroxycycloalkyl or a pharmaceutically acceptable salt thereof.

[0271] In some embodiments, the agent that reduces microglial cell activity is 5-((5-chloro-1H- pyrrolo[2,3-b]pyridin-3-yl)methyl)-N-((6-(trifluoromethyl)pyridin-3-yl)methyl)pyridin-2-amine, N-[5- [(5-Chloro- 1H-pyrrolo[2,3-b]pyridin-3-yl)methyl]-2-pyridinyl]-6-(trifluoromethyl)-3- pyridinemethanamine) (PLX 3397) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is 5-(1H-Pyrrolo[2,3-b]pyridin-3-ylmethyl)-N-[[4- (trifluoromethyl)phenyl]methyl]-2-pyridinamine dihydrochloride (PLX647) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent that reduces microglial cell activity is the following compound: F% SF 2 £ Na were, i i Nh Ey SO are: an wal ru veve a senate rves War rere srt] or a pharmaceutically acceptable salt thereof. In some embodiments, the agent that reduces microglial cell activity is the following compound: Lp CF, NUN ee ITN INH dy, i ct NN 1 oT 3 “N y ~r 2 nharmacanticallv acrcantahles « or a pharmaceutically acceptable salt thereof. In some embodiments, the agent is any of the inhibitors described in US patent number US7893075.

[0272] In some embodiments, the agent that reduces microglial cell activity is 4-cyano-N-[2-(1- cyclohexen-1-yl)-4-[1-[(dimethylamino)acetyl]-4-piperidinyl]Jphenyl]- IH-imidazole-2-carboxamide monohydrochloride (JNJ28312141) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: BEL eS ne on oy ~~ avn HE orl, & TERN Fe ne : WL Sn oy 8 or a pharmaceutically acceptable salt thereof. In some embodiments, the agent is any of the inhibitors described in US patent number US7645755.

[0273] In some embodiments, the agent that reduces microglial cell activity is 1H-Imidazole-2- carboxamide, 5-cyano-N-(2-(4,4-dimethyl-1-cyclohexen-1-yl)-6-(tetrahydro-2,2,6,6-tetramethyl-2H- pyran-4-yl)-3-pyridinyl)-, 4-Cyano-1H-imidazole-2-carboxylic acid N-(2-(4,4-dimethylcyclohex-1-enyl)- 6-(2,2,6,6-tetramethyltetrahydropyran-4-yl)pyridin-3-yl)amide, 4-Cyano-N-(2-(4,4-dimethylcyclohex-1- en-1-yl)-6-(2,2,6,6-tetramethyl-tetrahydro-2H-pyran-4-yl)pyridin-3-yl)- IH-imidazole-2-carboxamide (JNJ-40346527) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: So fw EN FY Ado SLY ed x or a pharmaceutically acceptable salt thereof.

[0274] In another embodiment, the agent that reduces microglial cell activity is 5-(3- Methoxy-4- ((4-methoxybenzyl)oxy)benzyl)pyrimidine-2,4-diamine (GW2580) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: NH; NTR Ry HN Ae “0 CL Hoo ® = 0 CH, or a pharmaceutically acceptable salt thereof (international patent application publication number W02009099553).

[0275] In some embodiments, the agent that reduces microglial cell activity is 4-(2,4- difluoroanilino)-7-ethoxy-6-(4-methylpiperazin-1-yl)quinoline-3-carboxamide (AZD6495) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: 7 § A ; 2 5% et oN 8 Yo NR, I | ! Re epg § Nm ro] PE i, hs Ne a, HN ea 4 ur ~ Nyy § NEE or a pharmaceutically acceptable salt thereof.

[0276] In some embodiments, the agent that reduces microglial cell activity is N-{4-[(6,7- dimethoxy-4-quinolyl)oxy]-2-methoxyphenyl }-N0-[1-(1,3-thiazole-2-yl)ethylJurea (Ki20227) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: ome 3 i) i 3 Bb Pa AA NPN > Lrroe a" Ayer” ° Ay Ube LJ EE NEE ne or a pharmaceutically acceptable salt thereof.

[0277] In some embodiments, the agent that reduces microglial cell activation is an antibody that targets the CSF1 pathway. In some embodiments, the agent is an antibody that binds CSFIR. In some embodiments, the anti-CSF1R antibody blocks CSF1R dimerization. In some embodiments, the anti- CSFIR antibody blocks the CSFIR dimerization interface that is formed by domains D4 and D5 (Ries et al. Cancer Cell 25(6):846-59 (2014)). In some cases, the agent is selected from emactuzumab (RG7155; R0O5509554), Cabiralizumab (FPA-008), LY-3022855 (IMC-CS4), AMG-820, TG-3003, MCS110, H27K15, 12-2D6, 2-4A5 (Rovida and Sbarba, J Clin Cell Immunol.6:6 (2015); Clinical Trial Study Record Nos.: NCT02760797; NCT01494688; NCT02323191; NCT01962337; NCT02471716; NCT02526017; NCT01346358; NCT02265536; NCT01444404; NCT02713529, NCT00757757; NCT02807844; NCT02435680; NCT(01643850).

[0278] In some embodiments, the agent that reduces microglial cell activation is a tetracycline antibiotic. For example, the agent affects IL-1b, IL-6, TNF-c, or iNOS concentration in microglia cells (Yrjanheikki et al. PNAS 95(26): 15769-15774 (1998); Clinical Trial Study Record No: NCT01120899). In some embodiments, the agent is an opioid antagonist (Younger et al. Pain Med. 10(4):663-672 (2009.) In some embodiments, the agent reduces glutamatergic neurotransmission (US Patent Number 5,527,814). In some embodiments, the agent modulates NFkB signaling (Valera et al J. Neuroinflammation 12:93 (2015); Clinical Trial Study Record No: NCT00231140). In some embodiments, the agent targets cannabinoid receptors (Ramirez et al. J. Neurosci 25(8):1904-13(2005)). In some embodiments, the agent is selected from minocycline, naloxone, riluzole, lenalidomide, and a cannabinoid (optionally WINS5 or 212-2).

[0279] Nitric oxide production from microglia is believed, in some cases, to result in or increase neurotoxicity. In some embodiments, the agent modulates or inhibits nitric oxide production from microglia. In some embodiments, the agent inhibits nitric oxide synthase (NOS). In some embodiments, the NOS inhibitor is Ronopterin (VAS-203), also known as 4-amino-tetrahydrobiopterin (4-ABH4). In some embodiments, the NOS inhibitor is cindunistat, A-84643, ONO-1714, L-NOARG, NCX-456, VAS- 2381, GW-273629, NXN-462, CKD-712, KD-7040, or guanidinoethyldisulfide. In some embodiments, the agent is any of the inhibitors described in Hoing et al., Cell Stem Cell. 2012 Nov 2;11(5):620-32.

[0280] In some embodiments, the agent blocks T cell trafficking, such as to the central nervous system. In some embodiments, blocking T cell trafficking can reduce or prevent immune cells from crossing blood vessel walls into the central nervous system, including crossing the blood-brain barrier. In some cases, activated antigen-specific T cells produce pro-inflammatory cytokines, including IFN-y and TNF, upon reactivation in the CNS, leading to activation of resident cells such as microglia and astrocytes. See Kivisikk et al., Neurology. 2009 Jun 2; 72(22): 1922-1930. Thus, in some embodiments, sequestering activated T cells from microglial cells, such as by blocking trafficking and / or inhibiting the ability of such cells to cross the blood-brain barrier, can reduce or eliminate microglial activation. In some embodiments, the agent inhibits adhesion molecules on immune cells, including T cells. In some embodiments, the agent inhibits an integrin. In some embodiments, the integrin is alpha-4 integrin. In some embodiments, the agent is natalizumab (Tysabri®). In some embodiments, the agent modulates a cell surface receptor. In some embodiments, the agent modulates the sphingosine-1- phosphate (S1P) receptor, such as SIPR1 or SIPRS. In some embodiments, the agent causes the internalization of a cellular receptor, such as a sphingosine-1-phosphate (S1P) receptor, such as SIPR1 or S1PRS. In some embodiments, the agent is fingolimod (Gilenya®) or ozanimod (RPC-1063).

[0281] The transcription factor NRF2 is believed to regulate the anti-oxidant response, for example, by turning on genes that contain a cis-acting element in their promoter region. An example of such an element includes an antioxidant response element (ARE). In some embodiments, the agent activates NRF2. In some embodiments, activating NRF2 in microglial cells reduces the microglial cells’ responsiveness to IFN and LPS. In some embodiments, activating NRF2 inhibits, slows, or reduces demyelination, axonal loss, neuronal death, and / or oligodendrocyte death. In some embodiments, the agent upregulates the cellular cytoprotective pathway regulated by NRF2. In some embodiments, the agent that activates NRF2 is dimethyl fumarate (Tecfidera®). In some embodiments, the agent is any of the inhibitors described in US patent number 8,399,514. In some embodiments, the agent is any of the inhibitors described in Hoing et al., Cell Stem Cell. 2012 Nov 2;11(5):620-32.

[0282] In some embodiments, the agent that reduces microglial cell activation is (4S,4aS,5aR,12aS)- 4,7-bis(dimethylamino)-3,10,12,12a-tetrahydroxy-1,11-dioxo-1,4,4a,5,5a,6,11,12a-octahydrotetracene-2- carboxamide (Minocycline) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is any of the compounds described in US patent application publication number US20100190755. In some embodiments, the agent is the following compound: bs 8 IL ? be oF ( Fy A = HO ~~ b ~ : H LAN ANC LAN or a pharmaceutically acceptable salt thereof.

[0283] In some embodiments, the agent that reduces microglial cell activation is 3-(7-amino-3-oxo- 1H-isoindol-2-yl)piperidine-2,6-dione (lenalidomide) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is the following compound: J=0 = / I ) NH 0o NH, or a pharmaceutically acceptable salt thereof.

[0284] In some embodiments, the agent that reduces microglial cell activation is 4R,4aS,7aR,12bS)- 4a,9-dihydroxy-3-prop-2-enyl-2,4,5,6,7a,13-hexahydro-1H-4,12-methanobenzofuro[3,2-e]isoquinoline- 7-one (naloxone) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is any of the compounds described in US patent number US8247425. In some embodiments, the agent is the following compound: CoN hd q \ K or AN pe New, or a pharmaceutically acceptable salt thereof.

[0285] In some embodiments, the agent that reduces microglial cell activation is 2-amino-6- (trifluoromethoxy)benzothiazole, 6-(trifluoromethoxy)benzo[d]thiazol-2-amine, or 6-(trifluoromethoxy)- 1,3-benzothiazol-2-amine (riluzole) or a pharmaceutically acceptable salt thereof or derivatives thereof as described in US patent number US55278 14. In some embodiments, the agent is the following compound: N.._# F HNC | 8 AF S Ang F or a pharmaceutically acceptable salt thereof.

[0286] In some embodiments, the agent that reduces microglial cell activation is a modulator of a signaling pathway in microglia. In some cases, the agent reduces microglia singling. In some embodiments, the agent is a GM-CSF (CSF2) inhibitor. In other embodiments, the agent that reduces microglial cell activation is an ion channel blocker. In some specific embodiments, the agent is a calcium channel blocker. For example, in some specific examples, the agent is a dihydropyridine calcium channel blocker. In some embodiments, the agent is a microRNA inhibitor. For example, the agent targets miR-155. In some embodiments, the agent that reduces microglial cell activation is selected from MOR103, Nimodipine, IVIg, and LNA-anti-miR-155 (Butoxsky et al. Ann Neurol., 77(1):75-99 (2015) and Sanz et al., Br J Pharmacol. 167(8): 1702-1711 (2012); Winter et al., Ann Clin and Transl Neurol. 2328-9503 (2016); Clinical Trial Study Record Nos.: NCT01517282, NCT00750867).

[0287] In some embodiments, the agent that reduces microglial cell activation is 3-(2-methoxyethyl) 5-propan-2-yl 2,6-dimethyl-4-(3-nitrophenyl)- 1,4-dihydropyridine-3,5-dicarboxylate (nimodipine) or a pharmaceutically acceptable salt thereof or derivatives thereof. In some embodiments, the agent is any of the inhibitors described in US patent number US3799934. In some embodiments, the agent is the following compound: a OW No fe] EU NW ar INGE pe ON a. JL or a pharmaceutically acceptable salt thereof.

[0288] In some cases, the agent that reduces microglial cell activation is administered in a form that only affects to central nervous system and / or does not affect tumor-associated macrophages. In some embodiments, the agent promotes microglia quiescence but does not eliminate or reduce the number of microglia. In some embodiments, the method involves inhibiting microglia activity specifically in the brain such as described in Ponomarev et al., Nature Medicine, (1):64-70 (2011)

[0289] Exemplary agents that reduce microglial cell activation, and exemplary dosing regimens for administering such agents, are set forth in Table 7 below. Table 7. Exemplary microglia inhibitors and dosage regimens Aer etn ve Yea sray Perrers rod AA decree lor we Exemplary Type of Molecular Inhibitor Molecule Target(s) Exemplary Dosing Regimen(s) CSFIR,; c-Kit; 200 mg tablets, twice daily for 28 Tr FP AL I RR RR ST Pexidartinib small CSFIR,; c-Kit; 200 mg tablets, twice daily for 28 (PLX3397) molecule FLT3 days; Administer daily as split dose regimen, five dose-levels possible in Ap lAAALy ALFA AIDA IM YAAD peel AE dose escalation part: 400mg 5 days on 2 days off (intermittent schedule), 400 mg, I BIN eee TINPNIR rc 0 ForSE 600 mg, 800 mg or 1000 mg; 1000 a el EE el | mg / day for 2 weeks then 800 mg / day for | 22 weeks Emactuzumab monoclonal CSFIR 100-3000 mg once every 2 weeks Emactuzumab monoclonal CSFIR 100-3000 mg once every 2 weeks (RG1755; antibody RO5509554) Cabiralizumab antibody CSFIR Intravenous infusion over 30 minutes FPA-008 ! every 2 weeks Table 7. Exemplary microglia inhibitors and dosage regimens pS —— a utr A Exemplar Type of Molecular plary Inhibitor Molecule Target(s) Exemplary Dosing Regimen(s) LY-3022855 monoclonal CSFIR 1.25 mg / kg intravenous delivery (IMC-CS4) antibody every 2 weeks for 6 weeks INJ-40346527 small CSFIR 100 mg twice daily for 12 weeks; molecule MCS110 antibody 100-1000 mg capsule dail MCSF (CSF1) Up to 4 doses of 10 mg / kg MCS110 administered intravenously once every 4 ! weeks starting at Day 1 ! MOR103 antibody GM-CSF 6 doses of 0.5-2.0 mg / kg over 70 MT Ta mar TT Tr Legit ailad Si a Tor TTT Ta Rn A a CP i STS Te ar days IVIg immunoglob Unknown Intravenous infusion of 0.4g / kg each } ulin ! month for 6 months ' Minocyline small broad Oral dose of 100 mg of minocycline molecule . spectrum . twice daily for 24 months | antibiotic: IL-1b; | IL-6, TNF-a; iNOS Naloxone small Opioid 4.5 mg naltrexone hydrochloride molecule receptors capsules once / day for 8 weeks Lenalidomide / th small NFkB 100-400 mg daily alidomide ! molecule signaling Riluzole small Glutamate 50 mg twice daily molecule release by microglia ———— — Cannabinoids / ca small cannabinoid | Orally 10 mg / kg / day for 6 weeks nnabidiol ! molecule receptors : (average of 700 mg / day) (e.g. WINSS,212-2) Tecfidera®). Dimethyl small Nrf2 signaling Starting dose of 120 mg taken orally fumarate molecule twice / day for 7 days. Dose increased to ecfidera®). 240 mg taken orally twice / day thereafter natalizumab antibody alpha-4 300 mg infused intravenously over natalizumab antibody alpha-4 300 mg infused intravenously over (Tysabri®) integrin one hour, every four weeks fingolimod small S1P receptors, 0.5 mg orally once-daily (Gilenya®) molecule | including S1PR1 ————— — —————m— ozanimod small S1PR1 and 0.25 mg, 0.5 mg, or 1 mg once daily (RPC-1063) molecule S1PRS C. Other Agents (e.g., cytokine targeting agents)

[0290] In some embodiments, the agent, e.g. toxicity-targeting agent, that treats or ameliorates symptoms of a toxicity of immunotherapy and / or a cell therapy, such as CRS or neurotoxicity, is one that targets a cytokine, e.g., is an antagonist or inhibitor of a cytokine, such as transforming growth factor beta (TGF-beta), interleukin 6 (IL-6), interleukin 10 (IL-10), IL-2, MIP1B (CCL4), TNF alpha, IL-1, interferon gamma (IFN-gamma), or monocyte chemoattractant protein-1 (MCP-1). In some embodiments, the agent that treats or ameliorates symptoms of a toxicity of an immunotherapy and / or a cell therapy, such as CRS or neurotoxicity, is one that targets (e.g. inhibits or is an antagonist of) a cytokine receptor, such as IL-6 receptor (IL-6R), IL-2 receptor (IL-2R / CD25), MCP-1 (CCL2) receptor (CCR2 or CCR4), a TGF-beta receptor (TGF-beta I, II, or III), IFN-gamma receptor (IFNGR), MIP1§ receptor (e.g., CCR5), TNF alpha receptor (e.g., TNFR1), IL-1 receptor (IL1-Ro / IL-1RB), or IL-10 receptor (IL-10R).

[0291] The amount of a selected agent that treats or ameliorates symptoms of a toxicity of an immunotherapy and / or a cell therapy, such as CRS or neurotoxicity to be administered to ameliorate symptoms or adverse effects of a toxicity to an immunotherapy and / or a cell therapy, such as CRS or neurotoxicity, can be determined by standard clinical techniques. Exemplary adverse events include, but are not limited to, an increase in alanine aminotransferase, an increase in aspartate aminotransferase, chills, febrile neutropenia, headache, hypotension, left ventricular dysfunction, encephalopathy, hydrocephalus, seizure, and / or tremor.

[0292] In some embodiments, the agent is administered in a dosage amount of from or from about 30 mg to 5000 mg, such as 50 mg to 1000 mg, 50 mg to 500 mg, SO mg to 200 mg, 50 mg to 100 mg, 100 mg to 1000 mg, 100 mg to 500 mg, 100 mg to 200 mg, 200 mg to 1000 mg, 200 mg to 500 mg or 500 mg to 1000 mg.

[0293] In some embodiments, the agent is administered from or from about 0.5 mg / kg to 100 mg / kg, such as from or from about 1 mg / kg to 50 mg / kg, 1 mg / kg to 25 mg / kg, 1 mg / kg to 10 mg / kg, 1 mg / kg to 5 mg / kg, 5 mg / kg to 100 mg / kg, 5 mg / kg to 50 mg / kg, 5 mg / kg to 25 mg / kg, 5 mg / kg to 10 mg / kg, 10 mg / kg to 100 mg / kg, 10 mg / kg to 50 mg / kg, 10 mg / kg to 25 mg / kg, 25 mg / kg to 100 mg / kg, 25 mg / kg to 50 mg / kg to 50 mg / kg to 100 mg / kg. In some embodiments, the agent is administered in a dosage amount of from or from about 1 mg / kg to 10 mg / kg, 2 mg / kg to 8 mg / kg, 2 mg / kg to 6 mg / kg, 2 mg / kg to 4 mg / kg or 6 mg / kg to 8 mg / kg, each inclusive. In some aspects, the agent is administered in a dosage amount of at least or at least about or about 1 mg / kg, 2 mg / kg, 4 mg / kg, 6 mg / kg, 8 mg / kg, 10 mg / kg or more. In some embodiments, the agent is administered at a dose of 4 mg / kg or 8 mg / kg.

[0294] In some embodiments, the agent is administered by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon's injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.

[0295] In some embodiments, the amount of the agent is administered about or approximately twice daily, daily, every other day, three times a week, weekly, every other week or once a month.

[0296] In some embodiments, the agent is administered as part of a composition or formulation, such as a pharmaceutical composition or formulation as described below. Thus, in some cases, the composition comprising the agent is administered as described below. In other aspects, the agent is administered alone and may be administered by any known acceptable route of administration or by one described herein, such as with respect to compositions and pharmaceutical formulations.

[0297] In some embodiments, the agent that treats or ameliorates symptoms of a toxicity of the immunotherapy and / or cell therapy, such as CRS or neurotoxicity, is an antibody or antigen binding fragment. In some embodiments, the agent is tocilizumab, siltuximab, sarilumab, olokizumab (CDP6038), elsilimomab, ALD518 / BMS-945429, sirukumab (CNTO 136), CPSI-2634, ARGX-109, FE301, or FM101.

[0298] In some embodiments, the agent is an antagonist or inhibitor of IL-6 or the IL-6 receptor (IL- 6R). In some aspects, the agent is an antibody that neutralizes IL-6 activity, such as an antibody or antigen-binding fragment that binds to IL-6 or IL-6R. For example, in some embodiments, the agent is or comprises tocilizumab (atlizumab) or sarilumab, anti-IL-6R antibodies. In some embodiments, the agent is an anti-IL-6R antibody described in U.S. Patent No: 8,562,991. In some cases, the agent that targets IL-6 is an anti-IL-6 antibody, such as siltuximab, elsilimomab, ALD518 / BMS-945429, sirukumab (CNTO 136), CPSI-2634, ARGX-109, FE301, FM101, or olokizumab (CDP6038). In some aspects, the agent may neutralize IL-6 activity by inhibiting the ligand-receptor interactions. The feasibility of this general type of approach has been demonstrated with a natural occurring receptor antagonist for interleukin-1. See Harmurn, C. H. et al., Nature (1990) 343:336-340. In some aspects, the IL-6 / IL-6R antagonist or inhibitor is an IL-6 mutein, such as one described in U.S. Patent No. 5591827. In some embodiments, the agent that is an antagonist or inhibitor of IL-6 / IL-6R is a small molecule, a protein or peptide, or a nucleic acid.

[0299] In some embodiments, the agent is tocilizumab. In some embodiments, tocilizumab is administered as an early intervention in accord with the provided methods, and / or with the provided articles of manufacture or compositions, at a dosage of from or from about 1 mg / kg to 12 mg / kg, such as at or about 4 mg / kg, 8 mg / kg, or 10 mg / kg. In some embodiments, tocilizumab is administered by intravenous infusion. In some embodiments, tocilizumab is administered for a persistent fever of greater than 39°C lasting 10 hours that is unresponsive to acetaminophen. In some embodiments, a second administration of tocilizumab is provided if symptoms recur after 48 hours of the initial dose.

[0300] In some embodiments, the agent is an agonist or stimulator of TGF-f or a TGF-B receptor (e.g., TGF-B receptor I, II, or IID). In some aspects, the agent is an antibody that increases TGF-p activity, such as an antibody or antigen-binding fragment that binds to TGF-p or one of its receptors. In some embodiments, the agent that is an agonist or stimulator of TGF-p and / or its receptor is a small molecule, a protein or peptide, or a nucleic acid.

[0301] In some embodiments, the agent is an antagonist or inhibitor of MCP-1 (CCL2) or a MCP-1 receptor (e.g., MCP-1 receptor CCR2 or CCR4). In some aspects, the agent is an antibody that neutralizes MCP-1 activity, such as an antibody or antigen-binding fragment that binds to MCP-1 or one of its receptors (CCR2 or CCR4). In some embodiments, the MCP-1 antagonist or inhibitor is any described in Gong et al. J Exp Med. 1997 Jul 7; 186(1): 131-137 or Shahrara et al. J Immunol 2008; 180:3447-3456. In some embodiments, the agent that is an antagonist or inhibitor of MCP-1 and / or its receptor (CCR2 or CCR4) is a small molecule, a protein or peptide, or a nucleic acid.

[0302] In some embodiments, the agent is an antagonist or inhibitor of IFN-y or an IFN-y receptor (IFNGR). In some aspects, the agent is an antibody that neutralizes IFN-y activity, such as an antibody or antigen-binding fragment that binds to IFN-y or its receptor (IFNGR). In some aspects, the IFN- gamma neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995 Feb;160(2):185-92 or Ozmen et al. J Immunol. 1993 Apr 1;150(7):2698-705. In some embodiments, the agent that is an antagonist or inhibitor of IFN-y / IFNGR is a small molecule, a protein or peptide, or a nucleic acid.

[0303] In some embodiments, the agent is an antagonist or inhibitor of IL-10 or the IL-10 receptor (IL-10R). In some aspects, the agent is an antibody that neutralizes IL-10 activity, such as an antibody or antigen-binding fragment that binds to IL-10 or IL-10R. In some aspects, the IL-10 neutralizing antibody is any described in Dobber et al. Cell Immunol. 1995 Feb;160(2):185-92 or Hunter et al. J Immunol. 2005 Jun 1;174(11):7368-75. In some embodiments, the agent that is an antagonist or inhibitor of IL- 10 / IL-10R is a small molecule, a protein or peptide, or a nucleic acid.

[0304] In some embodiments, the agent is an antagonist or inhibitor of IL-1 or the IL-1 receptor (IL- IR). In some aspects, the agent is an IL-1 receptor antagonist, which is a modified form of IL-1R, such as anakinra (see, €.g., Fleischmann et al., (2006) Annals of the rheumatic diseases. 65(8):1006-12). In some aspects, the agent is an antibody that neutralizes IL-1 activity, such as an antibody or antigen- binding fragment that binds to IL-1 or IL-1R, such as canakinumab (see also EP 2277543). In some embodiments, the agent that is an antagonist or inhibitor of IL-1 / IL-1R is a small molecule, a protein or peptide, or a nucleic acid.

[0305] In some embodiments, the agent is an antagonist or inhibitor of a tumor necrosis factor (TNF) or a tumor necrosis factor receptor (TNFR). In some aspects, the agent is an antibody that blocks TNF activity, such as an antibody or antigen-binding fragment that binds to a TNF, such as TNFa, or its receptor (TNFR, e.g., TNFRp55 or TNFRp75). In some aspects, the agent is selected from among infliximab, adalimumab, certolizumab pegol, golimumab and etanercept. In some embodiments, the agent that is an antagonist or inhibitor of TNF / TNFR is a small molecule, a protein or peptide, or a nucleic acid. In some embodiments, the agent is a small molecule that affects TNF, such as lenalidomide (see, e.g., Muller et al. (1999) Bioorganic & Medicinal Chemistry Letters. 9 (11):1625).

[0306] In some embodiments, the agent is an antagonist or inhibitor of signaling through the Janus kinase (JAK) and two Signal Transducer and Activator of Transcription (STAT) signaling cascade. JAK / STAT proteins are common components of cytokine and cytokine receptor signaling. In some embodiments, the agent that is an antagonist or inhibitor of JAK / STAT, such as ruxolitinib (see, e.g., Mesa et al. (2012) Nature Reviews Drug Discovery. 11(2):103-104), tofacitinib (also known as Xeljanz, Jakvinus tasocitinib and CP-690550), Baricitinib (also known as LY-3009104, INCB-28050), Filgotinib (G-146034, GLPG-0634), Gandotinib (LY-2784544), Lestaurtinib (CEP-701), Momelotinib (GS-0387, CYT-387), Pacritinib (SB1518), and Upadacitinib (ABT-494). In some embodiments, the agent is a small molecule, a protein or peptide, or a nucleic acid.

[0307] In some embodiments, the agent is a kinase inhibitor. In some embodiments, the agent is an inhibitor of Bruton’s tyrosine kinase (BTK). In some embodiments, the inhibitor is or comprises ibrutinib or acalabrutinib (see, e.g., Barrett et al., ASH 58" Annual Meeting San Diego, CA December 3-6, 2016, Abstract 654; Ruella et al., ASH 58% Annual Meeting San Diego, CA December 3-6, 2016, Abstract 2159). In some embodiments, the agent is an inhibitor as described in U.S. Patent No. 7,514,444; 8,008,309; 8,476,284; 8,497,277; 8,697,711; 8,703,780; 8,735,403; 8,754,090; 8,754,091; 8.957,079; 8,999,999; 9,125,889; 9,181,257; or 9,296,753.

[0308] In some embodiments, a device, such as absorbent resin technology with blood or plasma filtration, can be used to reduce cytokine levels. In some embodiments, the device used to reduce cytokine levels is a physical cytokine absorber, such as an extracorporeal cytokine absorber. In some embodiments, a physical cytokine absorber can be used to eliminate cytokines from the bloodstream in an ex vivo, extracorporeal manner. In some embodiments, the agent is a porous polymer. In some embodiments, the agent is CytoSorb (see, ¢.g., Basu et al. Indian J Crit Care Med. (2014) 18(12): 822— 824). III. RECOMBINANT ANTIGEN RECEPTORS EXPRESSED BY THE CELLS

[0309] In some embodiments, the cells for use in or administered in connection with the provided methods contain or are engineered to contain an engineered receptor, €.g., an engineered antigen receptor, such as a chimeric antigen receptor (CAR), or a T cell receptor (TCR). Also provided are populations of such cells, compositions containing such cells and / or enriched for such cells, such as in which cells of a certain type such as T cells or CD8* or CD4* cells are enriched or selected. Among the compositions are pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy. Also provided are therapeutic methods for administering the cells and compositions to subjects, e.g., patients, in accord with the provided methods, and / or with the provided articles of manufacture or compositions.

[0310] In some embodiments, the cells include one or more nucleic acids introduced via genetic engineering, and thereby express recombinant or genetically engineered products of such nucleic acids. In some embodiments, gene transfer is accomplished by first stimulating the cells, such as by combining it with a stimulus that induces a response such as proliferation, survival, and / or activation, e.g., as measured by expression of a cytokine or activation marker, followed by transduction of the activated cells, and expansion in culture to numbers sufficient for clinical applications.

[0311] The cells generally express recombinant receptors, such as antigen receptors including functional non-TCR antigen receptors, e.g., chimeric antigen receptors (CARs), and other antigen- binding receptors such as transgenic T cell receptors (TCRs). Also among the receptors are other chimeric receptors. A. Chimeric Antigen Receptors (CARs) In some embodiments of the provided methods and uses, chimeric receptors, such as a chimeric antigen receptors, contain one or more domains that combine a ligand-binding domain (e.g. antibody or antibody fragment) that provides specificity for a desired antigen (e.g., tumor antigen) with intracellular signaling domains. In some embodiments, the intracellular signaling domain is a stimulating or an activating intracellular domain portion, such as a T cell stimulating or activating domain, providing a primary activation signal or a primary signal. In some embodiments, the intracellular signaling domain contains or additionally contains a costimulatory signaling domain to facilitate effector functions. In some embodiments, chimeric receptors when genetically engineered into immune cells can modulate T cell activity, and, in some cases, can modulate T cell differentiation or homeostasis, thereby resulting in genetically engineered cells with improved longevity, survival and / or persistence in vivo, such as for use in adoptive cell therapy methods.

[0312] Exemplary antigen receptors, including CARs, and methods for engineering and introducing such receptors into cells, include those described, for example, in international patent application publication numbers W0200014257, W02013126726, W02012 / 129514, W02014031687, WO02013 / 166321, W02013 / 071154, W0O2013 / 123061 U.S. patent application publication numbers US2002131960, US2013287748, US20130149337, U.S. Patent Nos.: 6,451,995, 7,446,190, 8,252,592, 8,339,645, 8,398,282, 7,446,179, 6,410,319, 7,070,995, 7,265,209, 7,354,762, 7,446,191, 8,324,353, and 8,479,118, and European patent application number EP2537416,and / or those described by Sadelain et al., Cancer Discov. 2013 April; 3(4): 388-398; Davila et al. (2013) PLoS ONE 8(4): e61338; Turtle et al., Curr. Opin. Immunol., 2012 October; 24(5): 633-39; Wu et al., Cancer, 2012 March 18(2): 160-75. In some aspects, the antigen receptors include a CAR as described in U.S. Patent No.: 7,446,190, and those described in International Patent Application Publication No.: W0 / 2014055668 Al. Examples of the CARs include CARs as disclosed in any of the aforementioned publications, such as W02014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, U.S. Patent No.: 7,446,190, US Patent No.: 8,389,282, Kochenderfer et al., 2013, Nature Reviews Clinical Oncology, 10, 267-276 (2013); Wang et al. (2012) J. Immunother. 35(9): 689-701; and Brentjens et al., Sci Transl Med. 2013 5(177). See also W02014031687, US 8,339,645, US 7,446,179, US 2013 / 0149337, U.S. Patent No.: 7,446,190, and US Patent No.: 8,389,282.

[0313] The chimeric receptors, such as CARs, generally include an extracellular antigen binding domain, such as a portion of an antibody molecule, generally a variable heavy (Vg) chain region and / or variable light (V1) chain region of the antibody, e.g., an scFv antibody fragment.

[0314] In some embodiments, the antigen targeted by the receptor is a polypeptide. In some embodiments, it is a carbohydrate or other molecule. In some embodiments, the antigen is selectively expressed or overexpressed on cells of the disease or condition, e.g., the tumor or pathogenic cells, as compared to normal or non-targeted cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or is expressed on the engineered cells.

[0315] In some embodiments, the antigen targeted by the receptor is or comprises selected from among avf6 integrin (avb6 integrin), B cell maturation antigen (BCMA), B7-H3, B7-H6, carbonic anhydrase 9 (CA9, also known as CAIX or G250), a cancer-testis antigen, cancer / testis antigen 1B (CTAG, also known as NY-ESO-1 and LAGE-2), carcinoembryonic antigen (CEA), a cyclin, cyclin A2, C-C Motif Chemokine Ligand 1 (CCL-1), CD19, CD20, CD22, CD23, CD24, CD30, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD123, CD133, CD138, CD171, chondroitin sulfate proteoglycan 4 (CSPG4), epidermal growth factor protein (EGFR), type III epidermal growth factor receptor mutation (EGFR VIII), epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), ephrinB2, ephrin receptor A2 (EPHa2), estrogen receptor, Fc receptor like 5 (FCRLS; also known as Fc receptor homolog 5 or FCRHS5), fetal acetylcholine receptor (fetal AchR), a folate binding protein (FBP), folate receptor alpha, ganglioside GD2, O-acetylated GD2 (OGD?2), ganglioside GD3, glycoprotein 100 (gp100), glypican-3 (GPC3), G protein-coupled receptor class C group 5 member D (GPRC5D), Her2 / neu (receptor tyrosine kinase erb-B2), Her3 (erb-B3), Her4 (erb-B4), erbB dimers, Human high molecular weight-melanoma-associated antigen (HMW-MAA), hepatitis B surface antigen, Human leukocyte antigen Al (HLA-A1), Human leukocyte antigen A2 (HLA-A2), IL-22 receptor alpha (IL-22Ra), IL-13 receptor alpha 2 (IL-13Ra2), kinase insert domain receptor (kdr), kappa light chain, L.1 cell adhesion molecule (L1-CAM), CE7 epitope of L1-CAM, Leucine Rich Repeat Containing 8 Family Member A (LRRC8A), Lewis Y, Melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MAGE-A10, mesothelin (MSLN), c-Met, murine cytomegalovirus (CMV), mucin 1 (MUC1), MUCI16, natural killer group 2 member D (NKG2D) ligands, melan A (MART-1), neural cell adhesion molecule (NCAM), oncofetal antigen, Preferentially expressed antigen of melanoma (PRAME), progesterone receptor, a prostate specific antigen, prostate stem cell antigen (PSCA), prostate specific membrane antigen (PSMA), Receptor Tyrosine Kinase Like Orphan Receptor 1 (ROR1), survivin, Trophoblast glycoprotein (TPBG also known as 5T4), tumor-associated glycoprotein 72 (TAG72), Tyrosinase related protein 1 (TRP1, also known as TYRP1 or gp75), Tyrosinase related protein 2 (TRP2, also known as dopachrome tautomerase, dopachrome delta-isomerase or DCT), vascular endothelial growth factor receptor (VEGFR), vascular endothelial growth factor receptor 2 (VEGFR2), Wilms Tumor 1 (WT-1), a pathogen-specific or pathogen-expressed antigen, or an antigen associated with a universal tag, and / or biotinylated molecules, and / or molecules expressed by HIV, HCV, HBV or other pathogens. Antigens targeted by the receptors in some embodiments include antigens associated with a B cell malignancy, such as any of a number of known B cell marker. In some embodiments, the antigen targeted by the receptor is CD20, CD19, CD22, ROR1, CD45, CD21, CDS, CD33, Igkappa, Iglambda, CD79a, CD79 or CD30. In some embodiments, the antigen is or includes a pathogen-specific or pathogen-expressed antigen. In some embodiments, the antigen is a viral antigen (such as a viral antigen from HIV, HCV, HBV, etc.), bacterial antigens, and / or parasitic antigens.

[0316] In some embodiments, the antigen is CD19. In some embodiments, the scFv contains a Vy and a Vy derived from an antibody or an antibody fragment specific to CD19. In some embodiments, the antibody or antibody fragment that binds CD19 is a mouse derived antibody such as FMC63 and SJ25C1. In some embodiments, the antibody or antibody fragment is a human antibody, e.g., as described in U.S. Patent Publication No. US 2016 / 0152723.

[0317] In some embodiments the scFv and / or Vx domains is derived from FMC63. FMC63 generally refers to a mouse monoclonal IgG1 antibody raised against Nalm-1 and -16 cells expressing CD19 of human origin (Ling, N. R., et al. (1987). Leucocyte typing III. 302). In some embodiments, the FMC63 antibody comprises a CDR-H1 and a CDR-H2 set forth in SEQ ID NOS: 38 and 39, respectively, and a CDR-H3 set forth in SEQ ID NO: 40 or 54; and a CDR-L1 set forth in SEQ ID NO: 35 and a CDR- L2 set forth in SEQ ID NO: 36 or 55 and a CDR-L3 set forth in SEQ ID NO: 37 or 56. In some embodiments, the FMC63 antibody comprises a heavy chain variable region (Vu) comprising the amino acid sequence of SEQ ID NO: 41 and a light chain variable region (V1) comprising the amino acid sequence of SEQ ID NO: 42.

[0318] In some embodiments, the scFv comprises a variable light chain containing a CDR-L1 sequence of SEQ ID NO:35, a CDR-L2 sequence of SEQ ID NO:36, and a CDR-L3 sequence of SEQ ID NO:37 and / or a variable heavy chain containing a CDR-H1 sequence of SEQ ID NO:38, a CDR-H2 sequence of SEQ ID NO:39, and a CDR-H3 sequence of SEQ ID NO:40. In some embodiments, the scFv comprises a variable heavy chain region set forth in SEQ ID NO:41 and a variable light chain region set forth in SEQ ID NO:42. In some embodiments, the variable heavy and variable light chains are connected by a linker. In some embodiments, the linker is set forth in SEQ ID NO:24. In some embodiments, the scFv comprises, in order, a Vy, a linker, and a V1. In some embodiments, the scFv comprises, in order, a V1, a linker, and a Vi. In some embodiments, the scFv is encoded by a sequence of nucleotides set forth in SEQ ID NO:25 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%. 97%, 98%. or 99% sequence identity to SEQ ID NO:25. In some embodiments, the scFv comprises the sequence of amino acids set forth in SEQ ID NO:43 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:43.

[0319] In some embodiments the scFv is derived from SJ25C1. SJ25C1 is a mouse monoclonal IgG1 antibody raised against Nalm-1 and -16 cells expressing CD19 of human origin (Ling, N. R., et al. (1987). Leucocyte typing III. 302). In some embodiments, the SJ25C1 antibody comprises a CDR-H1, a CDR-H2 and a CDR-H3 sequence set forth in SEQ ID NOS: 47-49, respectively, and a CDR-L1, a CDR- L2 and a CDR-L3 sequence set forth in SEQ ID NOS: 44-46, respectively. In some embodiments, the SJ25C1 antibody comprises a heavy chain variable region (Vy) comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable region (V1) comprising the amino acid sequence of SEQ ID NO: 51.

[0320] In some embodiments, the scFv comprises a variable light chain containing a CDR-L1 sequence of SEQ ID NO:44, a CDR-L2 sequence of SEQ ID NO: 45, and a CDR-L3 sequence of SEQ ID NO:46 and / or a variable heavy chain containing a CDR-H1 sequence of SEQ ID NO:47, a CDR-H2 sequence of SEQ ID NO:48, and a CDR-H3 sequence of SEQ ID NO:49. In some embodiments, the scFv comprises a variable heavy chain region set forth in SEQ ID NO:50 and a variable light chain region set forth in SEQ ID NO:51. In some embodiments, the variable heavy and variable light chain are connected by a linker. In some embodiments, the linker is set forth in SEQ ID NO:52. In some embodiments, the scFv comprises, in order, a Vy, a linker, and a Vi. In some embodiments, the scFv comprises, in order, a V1, a linker, and a Vu. In some embodiments, the scFv comprises the sequence of amino acids set forth in SEQ ID NO:53 or a sequence that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:53.

[0321] In some embodiments, the chimeric antigen receptor includes an extracellular portion containing an antibody or antibody fragment. In some aspects, the chimeric antigen receptor includes an extracellular portion containing the antibody or fragment and an intracellular signaling domain. In some embodiments, the antibody or fragment includes an scFv.

[0322] The term “antibody” herein is used in the broadest sense and includes polyclonal and monoclonal antibodies, including intact antibodies and functional (antigen-binding) antibody fragments, including fragment antigen binding (Fab) fragments, F(ab") fragments, Fab’ fragments, Fv fragments, recombinant IgG (rIgG) fragments, heavy chain variable (Vi) regions capable of specifically binding the antigen, single chain antibody fragments, including single chain variable fragments (scFv), and single domain antibodies (e.g., sdAb, sdFv, nanobody) fragments. The term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabodies, peptibodies, chimeric antibodies, fully human antibodies, humanized antibodies, and heteroconjugate antibodies, multispecific, e.g., bispecific or trispecific, antibodies, diabodies, triabodies, and tetrabodies, tandem di- scFv, tandem tri-scFv. Unless otherwise stated, the term “antibody” should be understood to encompass functional antibody fragments thereof also referred to herein as “antigen-binding fragments.” The term also encompasses intact or full-length antibodies, including antibodies of any class or sub-class, including IgG and sub-classes thereof, IgM, IgE, IgA, and IgD.

[0323] The terms “complementarity determining region,” and “CDR,” synonymous with “hypervariable region” or “HVR,” are known, in some cases, to refer to non-contiguous sequences of amino acids within antibody variable regions, which confer antigen specificity and / or binding affinity. In general, there are three CDRs in each heavy chain variable region (CDR-H1, CDR-H2, CDR-H3) and three CDRs in each light chain variable region (CDR-L1, CDR-L2, CDR-L3). “Framework regions” and “FR” are known, in some cases, to refer to the non-CDR portions of the variable regions of the heavy and light chains. In general, there are four FRs in each full-length heavy chain variable region (FR-H1, FR- H2, FR-H3, and FR-H4), and four FRs in each full-length light chain variable region (FR-L1, FR-L2, FR-L3, and FR-L4).

[0324] The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of a number of well-known schemes, including those described by Kabat et al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD (“Kabat numbering scheme); Al-Lazikani et al., (1997) IMB 273,927-948 (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262:732-745 (1996), “Antibody-antigen interactions: Contact analysis and binding site topography,” J. Mol. Biol. 262, 732- 745.” (“Contact” numbering scheme); Lefranc MP ez al, “IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains,” Dev Comp Immunol, 2003 Jan;27(1):55-77 (“IMGT” numbering scheme); Honegger A and Pliickthun A, “Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool,” J Mol Biol, 2001 Jun 8;309(3):657-70, (*“Aho” numbering scheme); and Martin ef al., “Modeling antibody hypervariable loops: a combined algorithm,” PNAS, 1989, 86(23):9268-9272, (“AbM” numbering scheme).

[0325] The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignments, while the Chothia scheme is based on structural information. Numbering for both the Kabat and Chothia schemes is based upon the most common antibody region sequence lengths, with insertions accommodated by insertion letters, for example, “30a,” and deletions appearing in some antibodies. The two schemes place certain insertions and deletions (“indels™) at different positions, resulting in differential numbering. The Contact scheme is based on analysis of complex crystal structures and is similar in many respects to the Chothia numbering scheme. The AbM scheme is a compromise between Kabat and Chothia definitions based on that used by Oxford Molecular’s AbM antibody modeling software.

[0326] Table 8, below, lists exemplary position boundaries of CDR-L1, CDR-L2, CDR-L3 and CDR-H1, CDR-H2, CDR-H3 as identified by Kabat, Chothia, AbM, and Contact schemes, respectively. For CDR-H1, residue numbering is listed using both the Kabat and Chothia numbering schemes. FRs are located between CDRs, for example, with FR-L1 located before CDR-L1, FR-L2 located between CDR- L1 and CDR-L2, FR-L3 located between CDR-L2 and CDR-L3 and so forth. It is noted that because the shown Kabat numbering scheme places insertions at H35A and H35B, the end of the Chothia CDR-H1 loop when numbered using the shown Kabat numbering convention varies between H32 and H34, depending on the length of the loop. Table 8. Boundaries of CDRs according to various numbering schemes. CDR Kabat Chothia AbM Contact CDR-L1 124--1.34 124-134 124-134 L30--L36 CDR-L2 L50--L56 L50--L56 L50--L56 L46--L55 CDR-L3 189--L97 L189--L97 L189--L97 L89--L96 CDR-H1 (Kabat Numbering") H31--H35B | H26--H32.34 H26--H35B H30--H35B CDR-H1 (Chothia Numbering?) H31--H35 H26--H32 H26--H35 H30--H35 CDR-H2 H52--H56 H50--H58 H47--H58 CDR-H3 H95--H102 H93--H101 1 - Kabat er al. (1991), “Sequences of Proteins of Immunological Interest,” 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD 2 - Al-Lazikani er al., (1997) IMB 273,927-948

[0327] Thus, unless otherwise specified, a “CDR” or “complementary determining region,” or individual specified CDRs (e.g., CDR-H1, CDR-H2, CDR-H3), of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) complementary determining region as defined by any of the aforementioned schemes, or other known schemes. For example, where it is stated that a particular CDR (e.g., a CDR-H3) contains the amino acid sequence of a corresponding CDR in a given Vg or Vi region amino acid sequence, it is understood that such a CDR has a sequence of the corresponding CDR (e.g., CDR-H3) within the variable region, as defined by any of the aforementioned schemes, or other known schemes. In some embodiments, specific CDR sequences are specified. Exemplary CDR sequences of provided antibodies are described using various numbering schemes, although it is understood that a provided antibody can include CDRs as described according to any of the other aforementioned numbering schemes or other numbering schemes known to a skilled artisan.

[0328] Likewise, unless otherwise specified, a FR or individual specified FR(s) (e.g., FR-H1, FR- H2, FR-H3, FR-H4), of a given antibody or region thereof, such as a variable region thereof, should be understood to encompass a (or the specific) framework region as defined by any of the known schemes. In some instances, the scheme for identification of a particular CDR, FR, or FRs or CDRs is specified, such as the CDR as defined by the Kabat, Chothia, AbM or Contact method, or other known schemes. In other cases, the particular amino acid sequence of a CDR or FR is given.

[0329] The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable regions of the heavy chain and light chain (Vy and V1, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007). A single Vy or Vi domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a Vy or Vi, domain from an antibody that binds the antigen to screen a library of complementary Vi or Vu domains, respectively. See, e.g., Portolano ef al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0330] Among the antibodies included in the provided CARs are antibody fragments. An “antibody fragment” or “antigen-binding fragment” refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab’, Fab’-SH, F(ab’); diabodies; linear antibodies; heavy chain variable (Vy) regions, single-chain antibody molecules such as scFvs and single-domain antibodies comprising only the Vg region; and multispecific antibodies formed from antibody fragments. In some embodiments, the antigen-binding domain in the provided CARs is or comprises an antibody fragment comprising a variable heavy chain (Vy) and a variable light chain (V1) region. In particular embodiments, the antibodies are single-chain antibody fragments comprising a heavy chain variable (Vy) region and / or a light chain variable (V1) region, such as scFvs.

[0331] The term “variable region” or “variable domain” refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (Vx and V1, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs. (See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91 (2007). A single Vg or V1 domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a Vy or V1, domain from an antibody that binds the antigen to screen a library of complementary Vi or Vu domains, respectively. See, e.g., Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0332] Single-domain antibodies are antibody fragments comprising all or a portion of the heavy chain variable domain or all or a portion of the light chain variable domain of an antibody. In certain embodiments, a single-domain antibody is a human single-domain antibody. In some embodiments, the CAR comprises an antibody heavy chain domain that specifically binds the antigen, such as a cancer marker or cell surface antigen of a cell or disease to be targeted, such as a tumor cell or a cancer cell, such as any of the target antigens described herein or known.

[0333] Antibody fragments can be made by various techniques, including but not limited to proteolytic digestion of an intact antibody as well as production by recombinant host cells. In some embodiments, the antibodies are recombinantly-produced fragments, such as fragments comprising arrangements that do not occur naturally, such as those with two or more antibody regions or chains joined by synthetic linkers, e.g., peptide linkers, and / or that are may not be produced by enzyme digestion of a naturally-occurring intact antibody. In some embodiments, the antibody fragments are scFvs.

[0334] A “humanized” antibody is an antibody in which all or substantially all CDR amino acid residues are derived from non-human CDRs and all or substantially all FR amino acid residues are derived from human FRs. A humanized antibody optionally may include at least a portion of an antibody constant region derived from a human antibody. A “humanized form” of a non-human antibody, refers to a variant of the non-human antibody that has undergone humanization, typically to reduce immunogenicity to humans, while retaining the specificity and affinity of the parental non-human antibody. In some embodiments, some FR residues in a humanized antibody are substituted with corresponding residues from a non-human antibody (e.., the antibody from which the CDR residues are derived), e.g., to restore or improve antibody specificity or affinity.

[0335] In some embodiments, the antibody portion of the recombinant receptor, e.g., CAR, further includes at least a portion of an immunoglobulin constant region, such as a hinge region, e.g., an IgG4 hinge region, and / or a Cxl / Cy. and / or Fc region. In some embodiments, the constant region or portion is of a human IgG, such as IgG4 or IgG1. In some aspects, the portion of the constant region serves as a spacer region between the antigen-recognition component, e.g., scFv, and transmembrane domain. The spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153, international patent application publication number W02014031687, U.S. Patent No. 8,822,647 or published app. No. US2014 / 0271635.

[0336] In some embodiments, the constant region or portion is of a human IgG, such as IgG4 or IgGl. In some embodiments, the spacer has the sequence ESKYGPPCPPCP (set forth in SEQ ID NO: 1), and is encoded by the sequence set forth in SEQ ID NO: 2. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 3. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 4. In some embodiments, the constant region or portion is of IgD. In some embodiments, the spacer has the sequence set forth in SEQ ID NO: 5. In some embodiments, the spacer has a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 1, 3, 4 or 5. In some embodiments, the spacer has the sequence set forth in SEQ ID NOS: 26-34. In some embodiments, the spacer has a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 26-34.

[0337] In some embodiments, the antigen receptor comprises an intracellular domain linked directly or indirectly to the extracellular domain. In some embodiments, the chimeric antigen receptor includes a transmembrane domain linking the extracellular domain and the intracellular signaling domain. In some embodiments, the intracellular signaling domain comprises an ITAM. For example, in some aspects, the antigen recognition domain (e.g. extracellular domain) generally is linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR complex, in the case of a CAR, and / or signal via another cell surface receptor. In some embodiments, the chimeric receptor comprises a transmembrane domain linked or fused between the extracellular domain (e.g. scFv) and intracellular signaling domain. Thus, in some embodiments, the antigen-binding component (e.g., antibody) is linked to one or more transmembrane and intracellular signaling domains.

[0338] In one embodiment, a transmembrane domain that naturally is associated with one of the domains in the receptor, e.g., CAR, is used. In some instances, the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.

[0339] The transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e. comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CDS, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. Alternatively the transmembrane domain in some embodiments is synthetic. In some aspects, the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain. In some embodiments, the linkage is by linkers, spacers, and / or transmembrane domain(s). In some aspects, the transmembrane domain contains a transmembrane portion of CD28.

[0340] In some embodiments, the extracellular domain and transmembrane domain can be linked directly or indirectly. In some embodiments, the extracellular domain and transmembrane are linked by a spacer, such as any described herein. In some embodiments, the receptor contains extracellular portion of the molecule from which the transmembrane domain is derived, such as a CD28 extracellular portion.

[0341] Among the intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulatory receptor, and / or a signal through a costimulatory receptor alone. In some embodiments, a short oligo- or polypeptide linker, for example, a linker of between 2 and 10 amino acids in length, such as one containing glycines and serines, e.g., glycine-serine doublet, is present and forms a linkage between the transmembrane domain and the cytoplasmic signaling domain of the CAR.

[0342] T cell activation is in some aspects described as being mediated by two classes of cytoplasmic signaling sequences: those that initiate antigen-dependent primary activation through the TCR (primary cytoplasmic signaling sequences), and those that act in an antigen-independent manner to provide a secondary or co-stimulatory signal (secondary cytoplasmic signaling sequences). In some aspects, the CAR includes one or both of such signaling components.

[0343] The receptor, e.g., the CAR, generally includes at least one intracellular signaling component or components. In some aspects, the CAR includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex. Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAM containing primary cytoplasmic signaling sequences include those derived from CD3 zeta chain, FcR gamma, CD3 gamma, CD3 delta and CD3 epsilon. In some embodiments, cytoplasmic signaling molecule(s) in the CAR contain(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 zeta.

[0344] In some embodiments, the receptor includes an intracellular component of a TCR complex, such as a TCR CD3 chain that mediates T-cell activation and cytotoxicity, e.g., CD3 zeta chain. Thus, in some aspects, the antigen-binding portion is linked to one or more cell signaling modules. In some embodiments, cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and / or other CD transmembrane domains. In some embodiments, the receptor, e.g., CAR, further includes a portion of one or more additional molecules such as Fe receptor y, CD8, CD4, CD25, or CD16. For example, in some aspects, the CAR or other chimeric receptor includes a chimeric molecule between CD3-zeta (CD3-{) or Fc receptor v and CD8, CD4, CD25 or CD16.

[0345] In some embodiments, upon ligation of the CAR or other chimeric receptor, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of the immune cell, e.g., T cell engineered to express the CAR. For example, in some contexts, the CAR induces a function of a T cell such as cytolytic activity or T-helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of an intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, for example, if it transduces the effector function signal. In some embodiments, the intracellular signaling domain or domains include the cytoplasmic sequences of the T cell receptor (TCR), and in some aspects also those of co-receptors that in the natural context act in concert with such receptors to initiate signal transduction following antigen receptor engagement.

[0346] In the context of a natural TCR, full activation generally requires not only signaling through the TCR, but also a costimulatory signal. Thus, in some embodiments, to promote full activation, a component for generating secondary or co-stimulatory signal is also included in the CAR. In other embodiments, the CAR does not include a component for generating a costimulatory signal. In some aspects, an additional CAR is expressed in the same cell and provides the component for generating the secondary or costimulatory signal.

[0347] In some embodiments, the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule. In some embodiments, the CAR includes a signaling domain and / or transmembrane portion of a costimulatory receptor, such as CD28, 4-1BB, 0X40, DAP10, and ICOS. In some aspects, the same CAR includes both the activating and costimulatory components. In some embodiments, the chimeric antigen receptor contains an intracellular domain derived from a T cell costimulatory molecule or a functional variant thereof, such as between the transmembrane domain and intracellular signaling domain. In some aspects, the T cell costimulatory molecule is CD28 or 41BB.

[0348] In some embodiments, the activating domain is included within one CAR, whereas the costimulatory component is provided by another CAR recognizing another antigen. In some embodiments, the CARs include activating or stimulatory CARs, costimulatory CARs, both expressed on the same cell (see W0O2014 / 055668). In some aspects, the cells include one or more stimulatory or activating CAR and / or a costimulatory CAR. In some embodiments, the cells further include inhibitory CARs (iCARs, see Fedorov et al., Sci. Transl. Medicine, 5(215) (December, 2013), such as a CAR recognizing an antigen other than the one associated with and / or specific for the disease or condition whereby an activating signal delivered through the disease-targeting CAR is diminished or inhibited by binding of the inhibitory CAR to its ligand, e.g., to reduce off-target effects.

[0349] In certain embodiments, the intracellular signaling domain comprises a CD28 transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain. In some embodiments, the intracellular signaling domain comprises a chimeric CD28 and CD137 (4-1BB, TNFRSF9) co-stimulatory domains, linked to a CD3 zeta intracellular domain.

[0350] In some embodiments, the CAR encompasses one or more, €.g., two or more, costimulatory domains and an activation domain, e.g., primary activation domain, in the cytoplasmic portion. Exemplary CARs include intracellular components of CD3-zeta, CD28, and 4-1BB.

[0351] In some embodiments, the vector encoding the antigen receptor, and / or the cells expressing the CAR or other antigen receptor further includes a nucleic acid sequence encoding one or more marker(s). In some embodiments, the one or more marker(s) is a transduction marker, surrogate marker and / or a selection marker. In some embodiemnts, the marker is a surrogate marker, such as a cell surface marker, which may be used to confirm transduction or engineering of the cell to express the receptor

[0352] In some embodiments, the marker is a transduction marker or a surrogate marker. A transduction marker or a surrogate marker can be used to detect cells that have been introduced with the polynucleotide, e.g., a polynucleotide encoding a recombinant receptor. In some embodiments, the transduction marker can indicate or confirm modification of a cell. In some embodiments, the surrogate marker is a protein that is made to be co-expressed on the cell surface with the recombinant receptor, e.g. CAR. In particular embodiments, such a surrogate marker is a surface protein that has been modified to have little or no activity. In certain embodiments, the surrogate marker is encoded on the same polynucleotide that encodes the recombinant receptor. In some embodiments, the nucleic acid sequence encoding the recombinant receptor is operably linked to a nucleic acid sequence encoding a marker, optionally separated by an internal ribosome entry site (IRES), or a nucleic acid encoding a self-cleaving peptide or a peptide that causes ribosome skipping, such as a 2A sequence, such as a T2A, a P2A, an E2A or an F2A. Extrinsic marker genes may in some cases be utilized in connection with engineered cell to permit detection or selection of cells and, in some cases, also to promote cell suicide.

[0353] Exemplary surrogate markers can include truncated forms of cell surface polypeptides, such as truncated forms that are non-functional and to not transduce or are not capable of transducing a signal or a signal ordinarily transduced by the full-length form of the cell surface polypeptide, and / or do not or are not capable of internalizing. Exemplary truncated cell surface polypeptides including truncated forms of growth factors or other receptors such as a truncated human epidermal growth factor receptor 2 (tHER?2), a truncated epidermal growth factor receptor (tEGFR, exemplary tEGFR sequence set forth in SEQ ID NO:11 or 76) or a prostate-specific membrane antigen (PSMA) or modified form thereof. tEGFR may contain an epitope recognized by the antibody cetuximab (Erbitux®) or other therapeutic anti-EGFR antibody or binding molecule, which can be used to identify or select cells that have been engineered with the tEGFR construct and an encoded exogenous protein, and / or to eliminate or separate cells expressing the encoded exogenous protein. See U.S. Patent No. 8,802,374 and Liu et al., Nature Biotech. 2016 April; 34(4): 430-434). In some aspects, the marker, e.g. surrogate marker, includes all or part (e.g., truncated form) of CD34, a NGFR, a CD19 or a truncated CD19, e.g., a truncated non-human CD19, or epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the marker is or comprises a fluorescent protein, such as green fluorescent protein (GFP), enhanced green fluorescent protein (EGFP), such as super-fold GFP (sfGFP), red fluorescent protein (RFP), such as tdTomato, mCherry, mStrawberry, AsRed2, DsRed or DsRed2, cyan fluorescent protein (CFP), blue green fluorescent protein (BFP), enhanced blue fluorescent protein (EBFP), and yellow fluorescent protein (YFP), and variants thereof, including species variants, monomeric variants, and codon-optimized and / or enhanced variants of the fluorescent proteins. In some embodiments, the marker is or comprises an enzyme, such as a luciferase, the lacZ gene from E. coli, alkaline phosphatase, secreted embryonic alkaline phosphatase (SEAP), chloramphenicol acetyl transferase (CAT). Exemplary light-emitting reporter genes include luciferase (luc), B-galactosidase, chloramphenicol acetyltransferase (CAT), B-glucuronidase (GUS) or variants thereof.

[0354] In some embodiments, the marker is a selection marker. In some embodiments, the selection marker is or comprises a polypeptide that confers resistance to exogenous agents or drugs. In some embodiments, the selection marker is an antibiotic resistance gene. In some embodiments, the selection marker is an antibiotic resistance gene confers antibiotic resistance to a mammalian cell. In some embodiments, the selection marker is or comprises a Puromycin resistance gene, a Hygromycin resistance gene, a Blasticidin resistance gene, a Neomycin resistance gene, a Geneticin resistance gene or a Zeocin resistance gene or a modified form thereof.

[0355] In some embodiments, the molecule is a non-self molecule, e.g., non-self protein, i.e., one that is not recognized as “self” by the immune system of the host into which the cells will be adoptively transferred.

[0356] In some embodiments, the marker serves no therapeutic function and / or produces no effect other than to be used as a marker for genetic engineering, e.g., for selecting cells successfully engineered. In other embodiments, the marker may be a therapeutic molecule or molecule otherwise exerting some desired effect, such as a ligand for a cell to be encountered in vivo, such as a costimulatory or immune checkpoint molecule to enhance and / or dampen responses of the cells upon adoptive transfer and encounter with ligand.

[0357] In some embodiments, the nucleic acid encoding the marker is operably linked to a polynucleotide encoding for a linker sequence, such as a cleavable linker sequence, e.g., a T2A. For example, a marker, and optionally a linker sequence, can be any as disclosed in PCT Pub. No. ‘W02014031687. For example, the marker can be a truncated EGFR (tEGFR) that is, optionally, linked to a linker sequence, such as a T2A cleavable linker sequence.

[0358] An exemplary polypeptide for a truncated EGFR (e.g. tEGFR) comprises the sequence of amino acids set forth in SEQ ID NO: 7 or 16 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 7 or 16. An exemplary T2A linker sequence comprises the sequence of amino acids set forth in SEQ ID NO: 6 or 17 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ IDNO: 6or 17.

[0359] In some embodiments, the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.

[0360] In some cases, CARs are referred to as first, second, and / or third generation CARs. In some aspects, a first generation CAR is one that solely provides a CD3-chain induced signal upon antigen binding; in some aspects, a second-generation CARs is one that provides such a signal and costimulatory signal, such as one including an intracellular signaling domain from a costimulatory receptor such as CD28 or CD137; in some aspects, a third generation CAR is one that includes multiple costimulatory domains of different costimulatory receptors.

[0361] For example, in some embodiments, the CAR contains an antibody, e.g., an antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of CD28 or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof. In some embodiments, the CAR contains an antibody, e.g., antibody fragment, a transmembrane domain that is or contains a transmembrane portion of CD28 or a functional variant thereof, and an intracellular signaling domain containing a signaling portion of a 4-1BB or functional variant thereof and a signaling portion of CD3 zeta or functional variant thereof. In some such embodiments, the receptor further includes a spacer containing a portion of an Ig molecule, such as a human Ig molecule, such as an Ig hinge, e.g. an IgG4 hinge, such as a hinge-only spacer.

[0362] In some embodiments, the transmembrane domain of the recombinant receptor, e.g., the CAR, is or includes a transmembrane domain of human CD28 (e.g. Accession No. P01747.1) or variant thereof, such as a transmembrane domain that comprises the sequence of amino acids set forth in SEQ ID NO: 8 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 8; in some embodiments, the transmembrane-domain containing portion of the recombinant receptor comprises the sequence of amino acids set forth in SEQ ID NO: 9 or a sequence of amino acids having at least at or about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

[0363] In some embodiments, the intracellular signaling component(s) of the recombinant receptor, e.g. the CAR, contains an intracellular costimulatory signaling domain of human CD28 or a functional variant or portion thereof, such as a domain with an LL to GG substitution at positions 186-187 of a native CD28 protein. For example, the intracellular signaling domain can comprise the sequence of amino acids set forth in SEQ ID NO: 10 or 11 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 10 or 11. In some embodiments, the intracellular domain comprises an intracellular costimulatory signaling domain of 4-1BB (e.g. (Accession No. Q07011.1) or functional variant or portion thereof, such as the sequence of amino acids set forth in SEQ ID NO: 12 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 12.

[0364] In some embodiments, the intracellular signaling domain of the recombinant receptor, e.g. the CAR, comprises a human CD3 zeta stimulatory signaling domain or functional variant thereof, such as an 112 AA cytoplasmic domain of isoform 3 of human CD3(, (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Patent No.: 7,446,190 or U.S. Patent No. 8,911,993. For example, in some embodiments, the intracellular signaling domain comprises the sequence of amino acids as set forth in SEQ ID NO: 13, 14 or 15 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to SEQ ID NO: 13, 14 or 15.

[0365] In some aspects, the spacer contains only a hinge region of an IgG, such as only a hinge of 1gG4 or IgGl, such as the hinge only spacer set forth in SEQ ID NO: 1. In other embodiments, the spacer is or contains an Ig hinge, e.g., an IgG4-derived hinge, optionally linked to a Cx2 and / or C3 domains. In some embodiments, the spacer is an Ig hinge, e.g., an IgG4 hinge, linked to Cn2 and Cu3 domains, such as set forth in SEQ ...

Claims

Claims 1 A method of treating a subject having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), wherein the method comprises administering to the subject a dose of engineered T cells comprising CD4* and CD8* T cells, the CD4* and the CD8* T cells comprising a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the dose of engineered T cells (i) is enriched for CD4+ and CD8+ primary human T cells; (ii) comprises a defined ratio of CD4+ cells expressing the CAR to CD8+ cells expressing the CAR, optionally wherein the ratio is between approximately 1:3 and approximately 3:1, and (iii) comprises at or about 2.5 x 10” total CAR-expressing cells to at or about 1.5 x 10° total CAR-expressing cells. 2 A method of treating a subject having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), wherein the method comprises administering to the subject a dose of engineered T cells comprising CD4* and CD8* T cells, the CD4* and the CD8* T cells comprising a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to a Bruton's Tyrosine Kinase inhibitor (BTKi) and venetoclax.

3. The method of claim 2, wherein the BTKi is ibrutinib.

4. A method of treating a subject having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), wherein the method comprises administering to the subject a dose of engineered T cells comprising CD4* and CD8* T cells, the CD4* and the CD8* T cells comprising a chimeric antigen receptor (CAR) that specifically binds to CD19, wherein the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to ibrutinib and venetoclax.

5. The method of any of claims 2-4, wherein the dose of engineered T cells is enriched for CD4+ and CD8+ primary human T cells.

6. The method of any of claims 2-5, wherein the dose of engineered T cells comprises a defined ratio of CD4+ cells expressing the CAR to CD8+ cells expressing the CAR, optionally wherein the ratio is between approximately 1:3 and approximately 3:

1.

7. The method of any of claims 1-6, wherein the administration comprises administering a plurality of separate compositions, wherein the plurality of separate compositions comprises a first composition comprising one of the CD4* T cells and the CD8* T cells and a second composition comprising the other of the CD4* T cells and the CD8* T cells.

8. A method of treating a subject having or suspected of having chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL), wherein the method comprises administering to the subject a dose of engineered T cells comprising CD4* and CD8* T cells, the CD4* and the CD8* T cells comprising a CAR that specifically binds CD19, wherein the administration comprises administering a plurality of separate compositions, wherein the plurality of separate compositions comprises a first composition comprising one of the CD4* T cells and the CD8* T cells and a second composition comprising the other of the CD4* T cells and the CD8* T cells.

9. The method of any of claims 1-8, wherein the dose of engineered T cells comprises a defined ratio of CD4* cells expressing the CAR to CD8* cells expressing the CAR is between approximately 1:3 and approximately 3:

1.

10. The method of any of claims 2-9, wherein the dose of engineered T cells comprises at or about 2.5 x 107 total CAR-expressing cells to at or about 1.5 x 108 total CAR-expressing cells.

11. The method of any of claims 8-10, wherein the dose of engineered T cells is enriched for CD4+ and CD8+ primary human T cells.

12. The method of any of claim 1-11, wherein the dose of engineered T cells enriched in primary human CD4+ and CD8+ T cells comprises greater than or greater than about 70%, greater than or greater than about 75%, greater than or greater than about 80%, greater than or greater than about 85%, greater than or greater than about 90%, greater than or greater than about 95% or greater than or greater than about 98% CD4+ and CD8+ primary human T cells.

13. The method of any of claim 1-12, wherein the dose of engineered T cells comprises a defined ratio of CD4* cells expressing the CAR to CD8* cells expressing the CAR that is or is approximately 1:

1.

14. The method of any of claims 1-13, wherein the dose of engineered T cells comprises at or about 2.5 x 107 total CAR-expressing cells to at or about 1.0 x 10° total CAR-expressing cells.

18. The method of any of claims 1-14, wherein the dose of engineered T cells comprises at or about 2.5 x 107 total CAR-expressing cells.

16. The method of any of claims 1-14, wherein the dose of engineered T cells comprises at or about 5 x 107 total cells or total CAR-expressing cells.

13. The method of any of claims 1-14, wherein the dose of engineered T cells comprises at or about 1 x 108 total cells or total CAR-expressing cells.

18. The method of any of claim 1-17, wherein the CAR comprised by the CD4* T cells and / or the CAR comprised by the CD8* T cells comprises a CAR that is the same and / or wherein the CD4* T cells and / or the CD8* T cells are genetically engineered to express a CAR that is the same.

19. The method of any of claims 7-18, wherein the first composition comprises the CD8* T cells and the second composition comprises the CD4+ T cells.

20. The method of claim 19, wherein the initiation of the administration of the first composition is carried out prior to the initiation of the administration of the second composition.

21. The method of any of claims 7-20, wherein the administration of the first composition and the administration of the second composition are carried out no more than 48 hours apart.

22. The method of any of claims 7-21, wherein the administration of the first composition and the administration of the second composition are carried out no more than 36 hours apart, no more than 24 hours apart, no more than 12 hours apart, no more than 6 hours apart, no more than 4 hours apart, no more than 2 hours apart, no more than 1 hour apart or no more than 30 minutes apart.

23. The method of any of claims 7-22, wherein: the administration of the first composition and the administration of the second composition are carried out on the same day, are carried out between about 0 and about 12 hours apart, between about 0 and about 6 hours apart or between about 0 and about 2 hours apart; or the initiation of administration of the first composition and the initiation of administration of the second composition are carried out between about 1 minute and about 1 hour apart or between about 5 minutes and about 30 minutes apart.

24. The method of any of claims 7-23, wherein the first composition and second composition are administered no more than 2 hours, no more than 1 hour, no more than 30 minutes, no more than 15 minutes, no more than 10 minutes or no more than 5 minutes apart.

25. The method of any of claims 1-24, wherein: the subject has CLL or is suspected of having CLL; or the subject is identified or selected as having CLL.

26. The method of any of claims 1-25, wherein the CLL is a relapsed or refractory CLL.

27. The method of any of claims 1-26, wherein: the subject has SLL or is suspected of having SLL; or the subject is identified or selected as having SLL.

28. The method of any of claims 1-24 and 27, wherein the SLL is a relapsed or refractory SLL.

29. The method of claims 1-28, wherein, prior to the administration of the dose of engineered T cells, the subject has been treated with one or more prior therapies for the CLL or SLL, other than another dose of cells expressing CAR or a lymphodepleting therapy.

30. The method of claim 29, wherein the one or more prior therapy comprises at least two prior therapies, optionally 3, 4, 5, 6, 7, 8, 9 or more prior therapies.

31. The method of any of claims 1-30, wherein, at or immediately prior to the time of the administration of the dose of engineered T cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with the one or more prior therapies for the CLL or SLL.

32. The method of any of claims 1-31, wherein, at or immediately prior to the time of the administration of the dose of engineered T cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies.

33. The method of any of claims 1-32, wherein, at or immediately prior to the time of the administration of the dose of engineered T cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with three or more prior therapies.

34. The method of any of claims 1-33, wherein the one or more prior therapies are selected from a kinase inhibitor, optionally an inhibitor of Bruton’s tyrosine kinase (BTK), optionally ibrutinib; venetoclax; a combination therapy comprising fludarabine and rituximab; radiation therapy; and hematopoietic stem cell transplantation (HSCT).

35. The method of any of claims 1-35, wherein the one or more prior therapies comprise an inhibitor of Bruton's tyrosine kinase (BTK) and / or venetoclax.

36. The method of any of claims 1-35, wherein the one or more prior therapies comprise ibrutinib and / or venetoclax.

37. The method of any of claims 1-36, wherein the one or more prior therapies comprise ibrutinib and venetoclax.

38. The method of any of claims 1-37, wherein the subject has relapsed following remission after treatment with, become refractory to failed treatment with and / or is intolerant to an inhibitor of Bruton’s tyrosine kinase (BTK) and / or venetoclax.

39. The method of any of claims 1-38, wherein the subject has relapsed following remission after treatment with, become refractory to, failed treatment with and / or is intolerant to ibrutinib and venetoclax.

40. The method of any of claims 1-39, wherein at or prior to the administration of the dose of cells: the subject is or has been identified as having one or more cytogenetic abnormalities, optionally associated with high-risk CLL or SLL, optionally selected from among: complex karyotype or cytogenetic abnormalities, del 17p, unmutated IGVH gene, and TP53 mutation; and / or the subject is or has been identified as having high-risk CLL or SLL.

41. The method of any of claims 1-40, wherein at or prior to the administration of the dose of cells: the subject is or has been identified as having one or more cytogenetic abnormalities, optionally associated with high-risk CLL, optionally selected from among: complex karyotype or cytogenetic abnormalities, del 17p, unmutated IGVH gene, and TP53 mutation; and / or the subject is or has been identified as having high-risk CLL.

42. The method of claim 41, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies.

43. The method of any of claims 1-40, wherein at or prior to the administration of the dose of cells, the subject is or has been identified as having a standard-risk CLL or SLL.

44. The method of claim 43, at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with three or more prior therapies.

45. The method of any of claims 1-44, wherein at or prior to the administration of the dose of cells, the subject is or has been identified as being intolerant to an inhibitor of Bruton’s tyrosine kinase (BTK) and has received an inhibitor of BTK for a duration of less than at or about 6 months, and / or is ineligible for treatment with an inhibitor of BTK.

46. The method of claim 45, wherein: (i) the subject is or has been identified as having high-risk CLL or SLL, and at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with one or more prior therapies other than the inhibitor of BTK; or (ii) the subject is or has been identified as having a standard-risk CLL or SLL, and at or immediately prior to the time of the administration of the dose of cells, the subject has relapsed following remission after treatment with, or become refractory to, failed and / or was intolerant to treatment with two or more prior therapies other than the inhibitor of BTK.

47. The method of any of claims 1-46, wherein: the subject is or has been identified as having an ECOG status of 0 or 1; and / or the subject does not have an ECOG status of >1.

48. The method of any of claims 1-47, wherein at or immediately prior to the administration of the dose of engineered cells or the lymphodepleting therapy the subject does not have a Richter’s transformation of the CLL or SLL.

49. The method of any of claims 1-48, wherein the subject is an adult and / or is over at or about 50, 60, or 70 years of age.

50. The method of any of claims 1-49, wherein the engineered T cells are primary T cells obtained from a subject.

51. The method of any of claims 1-50, wherein the engineered T cells are autologous to the subject.

52. The method of any of claims 1-51, wherein the dose of engineered cells are viable cells.

53. The method of any of claims 1-52, further comprising, prior to the administration of the dose of engineered T cells, administering a lymphodepleting therapy to the subject.

54. The method of any of claims 1-53, wherein, wherein the method further comprises, the subject has been preconditioned with a lymphodepleting therapy.

55. The method of claim 53 or claim 54, wherein the lymphodepleting therapy comprises the administration of fludarabine and / or cyclophosphamide.

56. The method of any of claims 53-55, wherein the lymphodepleting therapy comprises administration of cyclophosphamide at about 200-400 mg / m?, optionally at or about 300 mg / m? inclusive, and / or fludarabine at about 20-40 mg / m?, optionally 30 mg / m?, daily for 2-4 days, optionally for 3 days.

57. The method of any of claims 53-56, wherein the lymphodepleting therapy comprises administration of cyclophosphamide at or about 300 mg / m? and fludarabine at about 30 mg / m?daily for 3 days, optionally wherein the dose of cells is administered at least at or about 2-7 days after the lymphodepleting therapy or at least at or about 2-7 days after the initiation of the lymphodepleting therapy.

58. The method of any of claims 1-57, wherein the administration of the dose of engineered T cells and / or the lymphodepleting therapy is carried out via outpatient delivery.

59. The method of any of claims 1-58, wherein the dose of engineered T cells is administered parenterally, optionally intravenously.

60. The method of any of claims 1-59, wherein, of a plurality of subjects treated according to the method, the response in at least 50%, at least 60%, at least 70%, at least 80%, at least 90% of the subjects treated is an objective response rate.

61. The method of any of claims 1-60, wherein, of a plurality of subjects treated according to the method, the response in at least 35%, at least 40 %, at least 50%, at least 60% or at least 70% of subjects treated is complete remission (CR).

62. The method of claim 60 or claim 61, wherein the duration of the response until progression is durable for greater than 3 months or greater than 6 months.

63. The method of any of claims 1-62, wherein, of a plurality of subjects treated according to the method, greater than 50%, greater than 60%, or greater than 70% had undetectable minimal residual disease (MRD) for at least one month, at least two months, at least three months or at least 6 months after administering the dose of engineered T cells.

64. The method of any of claims 1-63, wherein, of a plurality of subjects treated according to the method, no more than 10% of subjects exhibit a cytokine release syndrome (CRS) higher than grade 92.

65. The method of any of claims 1-64, wherein, of a plurality of subjects treated according to the method, no more than 10%, no more than 20%, no more than 30% or no more than 40% of the subjects exhibit neurotoxicity higher than grade 2.

66. The method of any of claims 60-64, wherein the plurality of subjects treated according to the method comprises a plurality of subjects that have relapsed following remission after treatment with, become refractory to, failed treatment with and / or is intolerant to ibrutinib and venetoclax.

67. A method of treatment, comprising: assaying a biological sample for the level, amount or concentration of TNF-alpha, wherein the biological sample is from a subject that is a candidate for treatment, optionally with a cell therapy, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells; and comparing the level, amount or concentration of TNF-alpha to a threshold level, wherein: (1) if the level, amount or concentration of TNF-alpha is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy; and (2) if the level, amount or concentration of TNF-alpha is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy.

68. The method of claim 67, wherein if the subject is identified as at risk for developing a grade 3 or higher neurotoxicity, the method further comprises: (i) administering to the subject the cell therapy, optionally at a reduced dose, optionally wherein (a) the method further comprises administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of the neurotoxicity; and / or (b) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (ii) administering to the subject an alternative treatment other than the cell therapy for treating the disease or condition.

69. The method of claim 67, wherein if the subject is identified as not at risk for developing a grade 3 or higher neurotoxicity following administration of the cell therapy: (i) the subject is not administered an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administration and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.

70. The method of any of claims 67-69, wherein the assaying comprises: (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for TNF-alpha, optionally wherein the one or more reagent comprises an antibody that specifically recognizes TNF-alpha; and (b) detecting the presence or absence of a complex comprising the one or more reagent and TNF- alpha.

71. A method of treatment, wherein the method comprises administering to a subject a cell therapy for treating a disease or condition, said cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR, wherein: (1) if the subject has a level, amount or concentration of TNF-alpha in a biological sample from the subject that is at or above a threshold level, the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy: (i) administering to the subject the cell therapy at a reduced dose, (ii) further administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity; and / or (iii) the administering the cell therapy to the subject is carried out or is specified to be carried out in an in-patient setting and / or with admission to the hospital for one or more days; or (2) if the subject is selected or identified as having a level, amount or concentration of TNF- alpha in a biological sample from the subject that is below a threshold level, the subject is identified as not at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy: (i) not administering to the subject an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity unless or until the subjects exhibits a sign or symptom of a toxicity, optionally at or after the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic; and / or (ii) the administering and any follow-up is carried out on an outpatient basis and / or without admitting the subject to a hospital and / or without an overnight stay at a hospital and / or without requiring admission to or an overnight stay at a hospital, optionally unless or until the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic, wherein the subject is a candidate for treatment with the cell therapy, said biological sample obtained from the subject prior to administering the cell therapy and / or said biological sample does not comprise the CAR and / or said engineered cells.

22. The method of any of claims 68, 70 and 71, wherein if the subject is identified as at risk of developing grade 3 or higher neurotoxicity following administration of the cell therapy, administering the agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, wherein the agent is administered to the subject concurrently with the cell therapy or within three days of administering the cell therapy to the subject. 73, The method of any of claims 67-72, wherein: the threshold level is within 25%, within 20%, within 15%, within 10% or within 5% and / or is within a standard deviation above the median or mean level, amount or concentration, or is or is about the median or mean level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition; the threshold level is at or greater than 1.25-fold higher than the median or mean level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition; the threshold level is at or greater than 1.25-fold higher than the level, amount or concentration, of the TNF-alpha in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.

74. A method of treatment, wherein the method comprises: (a) assaying a biological sample from a subject for the level, amount or concentration of IL-16, said subject having received administration of a cell therapy comprising a dose of engineered cells comprising T cells expressing a CAR for treating a disease or condition, wherein the biological sample is obtained from the subject within one, two, or three days after the initiation of administration of the cell therapy; and (b) comparing the level, amount or concentration of IL-16 to a threshold level, wherein: (1) if the level, amount or concentration of IL-16 is at or above a threshold level, identifying the subject as at risk for developing a grade 3 or higher neurotoxicity; and (2) if the level, amount or concentration of IL-16 is below the threshold level, identifying the subject as not at risk for developing a grade 3 or higher neurotoxicity.

35. The method of claim 74, wherein if the subject is identified at risk of developing a grade 3 or higher neurotoxicity, administering an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity.

76. The method of claim 74 or claim 75, wherein the assaying comprises: (a) contacting a biological sample with one or more reagent capable of detecting or that is specific for IL-16, optionally wherein the one or more reagent comprises an antibody that specifically recognizes IL-16; and (b) detecting the presence or absence of a complex comprising the one or more reagent and IL- 16.

71. The method of any of claims 74-76, further comprising, prior to the assaying, administering to the subject the cell therapy.

78. A method of treatment, wherein the method comprises administering to a subject, identified as at risk of developing a grade 3 or higher neurotoxicity, an agent or other treatment capable of treating, preventing, delaying, reducing or attenuating the development or risk of development of a toxicity, said subject having previously received administration of a cell therapy for treating a disease or condition, wherein, at or immediately prior to administering the agent, the subject is selected or identified as being at risk of developing a grade 3 or higher neurotoxicity if the level or amount or concentration of IL-16 in a biological sample, obtained from the subject within one, two, or three days of the initiation of administration of the cell therapy, is above a threshold level.

79. The method of any of claims 75-78, wherein the administering the agent is carried out at a time when the subject exhibits a sustained fever or a fever that is or has not been reduced or not reduced by more than 1°C after treatment with an antipyretic.

80. The method of any of claims 75-79, wherein the administering to the subject the cell therapy was carried out on an outpatient basis and, if the level, amount or concentration of IL-16 is above a threshold level the method comprises admitting the patient to the hospital for one or more days.

81. The method of any of claims 74-80, wherein the threshold level is within 25%and / or is within a standard deviation above the median or mean level, amount or concentration, or is or is about the median or mean level, amount or concentration, of the IL-16 in a biological sample obtained, from a group of subjects, within one, two or three days after receiving a cell therapy comprising administration of a dose of engineered cells expressing the CAR for treating the same disease or condition, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of the cell therapy.

82. The method of any of claims 74-80, wherein the threshold level is at or greater than 1.3- fold higher than the median or mean level, amount or concentration, of the IL-16 in a biological sample obtained from a group of subjects prior to receiving a cell therapy, wherein each of the subjects of the group did not exhibit any grade of neurotoxicity, after administration of a dose of engineered cells expressing the CAR for treating the same disease or condition.

83. The method of any of claims 74-80, wherein the threshold level is at or greater than 1.3- fold higher than the level, amount or concentration, of the IL-16 in a biological sample obtained from a group of normal or healthy subjects that are not candidates for treatment with the cell therapy.

84. The method of any of claims 67-83, wherein the biological sample is or is obtained from a blood, plasma or serum sample.

85. The method of any of claims 67-84, wherein the assaying comprises an immunoassay.

86. The method of any of claims 67-85, wherein the disease or condition is a cancer.

87. The method of any of claims 67-86, wherein the disease or condition is a myeloma, leukemia or lymphoma.

88. The method of any of claims 67-87, wherein the biological sample comprises an antigen that is ROR1, B cell maturation antigen (BCMA), carbonic anhydrase 9 (CAIX), tEGFR, Her2 / neu (receptor tyrosine kinase erbB2), L1-CAM, CD19, CD20, CD22, mesothelin, CEA, and hepatitis B surface antigen, anti-folate receptor, CD23, CD24, CD30, CD33, CD38, CD44, EGFR, epithelial glycoprotein 2 (EPG-2), epithelial glycoprotein 40 (EPG-40), EPHa2, erb-B2, erb-B3, erb-B4, erbB dimers, EGFR VIII, folate binding protein (FBP), FCRLS, FCRHS, fetal acetylcholine receptor, GD2, GD3, HMW-MAA, IL-22R-alpha, IL-13R-alpha2, kinase insert domain receptor (kdr), kappa light chain, Lewis Y, L1-cell adhesion molecule, (L1-CAM), Melanoma-associated antigen (MAGE)-Al, MAGE- A3, MAGE-AG, Preferentially expressed antigen of melanoma (PRAME), survivin, TAG72, B7-H6, IL- 13 receptor alpha 2 (IL-13Ra2), CA9, GD3, HMW-MAA, CD171, G250 / CAIX, HLA-AI MAGE Al, HLA-A2 NY-ESO-1, PSCA, folate receptor-a, CD44v6, CD44v7 / 8, avb6 integrin, 8H9, NCAM, VEGF receptors, 5T4, Foetal AchR, NKG2D ligands, CD44v6, dual antigen, a cancer-testes antigen, mesothelin, murine CMV, mucin 1 (MUC1), MUC16, PSCA, NKG2D, NY-ESO-1, MART-1, gp100, oncofetal antigen, ROR1, TAG72, VEGF-R2, carcinoembryonic antigen (CEA), Her2 / neu, estrogen receptor, progesterone receptor, ephrinB2, CD123, c-Met, GD-2, O-acetylated GD2 (OGD2), CE7, Wilms Tumor 1 (WT-1), a cyclin, cyclin A2, CCL-1, CD138, G Protein Coupled Receptor 5D (GPCRS5D), or a pathogen-specific antigen.

89. The method of any of claims 67-88, wherein the biological sample comprises an antigen that is CD19.

90. The method of any of claims 67-89, wherein the disease or condition is a B cell malignancy and / or is acute lymphoblastic leukemia (ALL), adult ALL, chronic lymphoblastic leukemia (CLL), small lymphocytic lymphoma (SLL), non-Hodgkin lymphoma (NHL), and Diffuse Large B-Cell Lymphoma (DLBCL).

91. The method of any of claims 67-90, wherein the disease or condition is CLL or SLL.

922. The method of any of claims 68-73 and 75-91, wherein the agent or other treatment is or comprises an anti-IL-6 antibody, anti-IL-6R antibody or a steroid.

93. The method of any of claims 68-73 and 75-92, wherein the agent is or comprises tocilizumab, siltuximab or dexamethasone.

94. The method of any of claims 1-93, wherein: the CAR comprises an extracellular antigen-binding domain specific for CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, which optionally is a 4- 1 BB, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule, which optionally is a CD3zeta; the CAR comprises, in order, an extracellular antigen-binding domain specific for CD19, a transmembrane domain, a cytoplasmic signaling domain derived from a costimulatory molecule, and a cytoplasmic signaling domain derived from a primary signaling ITAM-containing molecule.

95. The method of claim 94, wherein the antigen-binding domain is an scFv.

96. The method of claim 95, wherein: the scFv comprises a CDRL1 sequence of RASQDISKYLN (SEQ ID NO: 35), a CDRL2 sequence of SRLHSGV (SEQ ID NO: 36), and / or a CDRL3 sequence of GNTLPYTFG (SEQ ID NO: 37) and / or a CDRH1 sequence of DYGVS (SEQ ID NO: 38), a CDRH2 sequence of VIWGSETTYYNSALKS (SEQ ID NO: 39), and / or a CDRH3 sequence of YAMDYWG (SEQ ID NO: 40); the scFv comprises a variable heavy chain region of FMC63 and a variable light chain region of FMC63 and / or a CDRLI sequence of FMC63, a CDRL2 sequence of FMC63, a CDRL3 sequence of FMC63, a CDRHI sequence of FMC63, a CDRH2 sequence of FMC63, and a CDRH3 sequence of FMC63 or binds to the same epitope as or competes for binding with any of the foregoing; the scFv comprises a VH set forth in SEQ ID NO:41 and a VL set forth in SEQ ID NO: 42, optionally wherein the VH and VL are separated by a flexible linker, optionally wherein the flexible linker is or comprises the sequence set forth in SEQ ID NO:24; and / or the scFv is or comprises the sequence set forth in SEQ ID NO:

43.

97. The method of any of claims 94-96, wherein the costimulatory signaling region is a signaling domain of CD28 or 4-1BB.

98. The method of any of claims 94-97, wherein the costimulatory signaling region is a signaling domain of 4-1BB.

99. The method of any of claims 94-98, wherein the costimulatory domain comprises SEQ ID NO: 12 or a variant thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

100. The method of any of claims 94-99, wherein the primary signaling domain is a CD3zeta signaling domain.

101. The method of any of claims 94-100, wherein the primary signaling domain comprises SEQ ID NO: 13 or 14 or 15 having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto.

102. The method of any of claims 94-101, wherein the CAR further comprises a spacer between the transmembrane domain and the scFv.

103. The method of claim 102, wherein the spacer is a polypeptide spacer that comprises or consists of all or a portion of an immunoglobulin hinge or a modified version thereof, optionally an IgG4 hinge, or a modified version thereof.

104. The method of claim 102 or claim 103, wherein the spacer is about 15 amino acids or less, and does not comprise a CD28 extracellular region or a CD8 extracellular region.

105. The method of any of claims 102-104, wherein the spacer is at or about 12 amino acids in length.

106. The method of any of claims 102-105, wherein: the spacer has or consists of the sequence of SEQ ID NO: 1, a sequence encoded by SEQ ID NO: 2, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, or a variant of any of the foregoing having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity thereto; and / or comprises or consists of the formula XPPX,P, where X is glycine, cysteine or arginine and X is cysteine or threonine.

107. The method of any of claims 1-106, wherein the subject is a human subject.

108. An article of manufacture comprising a composition of a cell therapy, or one of a plurality of compositions of a cell therapy, comprising T cells expressing an anti-CD19 chimeric antigen receptor (CAR), and instructions for administering the cell therapy, wherein the instructions specify administering the T cell composition according to the methods of any of claims 1-106.

Images