Capture probe, familial chylomicronemia syndrome detection kit containing same, and use
Patent Information
- Application Number
- AU2024401919
- Authority / Receiving Office
- AU · AU
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-12-13
- Filing Date
- 2024-12-13
- Publication Date
- 2026-07-23
AI Technical Summary
Current diagnostic methods for familial chylomicronemia syndrome (FCS) are inaccurate and fail to precisely identify gene mutations associated with the disease, leading to missed diagnoses and delayed treatment.
A capture probe comprising multiple probe sets targeting specific gene fragments on chromosomes, designed to accurately detect FCS-related gene mutations through sequencing.
Enhances the precision of FCS diagnosis by stabilizing and accurately detecting gene mutations, providing a more convenient and timely diagnostic method.
Abstract
Description
At present, the diagnostic criteria for FCS are mainly derived from European clinical practice and are comprehensive diagnostic criteria, mainly relying on factors such as: triglyceride level, the patient’s response to drugs for lowering triglyceride levels, and a medical history of frequent attacks of abdominal pain or pancreatitis. Routine laboratory and clinical examinations cannot precisely identify the cause of the disease, and changes in triglyceride levels are also observed in other diseases and are not changes entirely specific to FCS, and therefore, in clinical practice FCS is often missed in diagnosis. Overall, the current diagnostic methods cannot provide accurate and timely FCS diagnostic results, which is not conducive to timely treatment of FCS, and precise identification and localization of FCS still remain challenging. Summary of the Invention In view of this, one objective of one or more embodiments of the present application is to provide a capture probe, and the probe can be used for accurate detection of FCS-related gene mutations. In one or more embodiments of the present application, a capture probe is provided, which comprises one or more probe set selected from probe set 1 to probe set 6; probe set 1 comprises one or more probes selected from probes 1 to 26; probe set 2 comprises one or more probes selected from probes 27 to 64; probe set 3 comprises one or more probes selected from probes 65 to 112; probe set 4 comprises one or more probes selected from probes 113 to 139; probe set 5 comprises one or more probes selected from probes 140 to 382; probe set 6 comprises one or more probes selected from probes 383 to 425; the probes 1 to 425 are constructed for target gene fragments located between different start positions and end positions on the following chromosomes and are complementary to and paired with said target gene fragments: Probe number Chromosome Start position End position Probe 1 chr11 116660063 116660183; Probe 2 chr11 116660168 116660288; Probe 3 chr11 116660273 116660393; Probe 4 chr11 116660378 116660498; Probe 5 chr11 116660483 116660603; Probe 6 chr11 116660588 116660708; Probe 7 chr11 116660693 116660813; Probe 8 chr11 116660798 116660918; Probe 9 chr11 116660903 116661023; Probe 10 chr11 116661008 116661128; Probe 11 chr11 116661113 116661233; Probe 12 chr11 116661218 116661338; Probe 13 chr11 116661323 116661443; Probe 14 chr11 116661428 116661548; Probe 15 chr11 116661533 116661653; Probe 16 chr11 116661638 116661758; Probe 17 chr11 116661743 116661863; Probe 18 chr11 116662282 116662402; Probe 19 chr11 116662387 116662507; Probe 20 chr11 116662508 116662628; Probe 21 chr11 116663076 116663196; Probe 22 chr11 116663181 116663301; Probe 23 chr11 116663286 116663406; Probe 24 chr11 116663391 116663511; Probe 25 chr11 116663496 116663616; Probe 26 chr11 116663601 116663721; Probe 27 chr12 50497271 50497391; Probe 28 chr12 50497376 50497496; Probe 29 chr12 50497481 50497601; Probe 30 chr12 50497586 50497706; Probe 31 chr12 50497691 50497811; Probe 32 chr12 50497796 50497916; Probe 33 chr12 50498337 50498457; Probe 34 chr12 50498442 50498562; Probe 35 chr12 50499311 50499431; Probe 36 chr12 50499416 50499536; Probe 37 chr12 50500051 50500171; Probe 38 chr12 50500156 50500276; Probe 39 chr12 50500568 50500688; Probe 40 chr12 50500673 50500793; Probe 41 chr12 50501330 50501450; Probe 42 chr12 50501435 50501555; Probe 43 chr12 50501540 50501660; Probe 44 chr12 50501787 50501907; Probe 45 chr12 50501892 50502012; Probe 46 chr12 50503186 50503306; Probe 47 chr12 50503291 50503411; Probe 48 chr12 50503396 50503516; Probe 49 chr12 50503501 50503621; Probe 50 chr12 50503606 50503726; Probe 51 chr12 50503711 50503831; Probe 52 chr12 50503816 50503936; Probe 53 chr12 50503921 50504041; Probe 54 chr12 50504026 50504146; Probe 55 chr12 50504131 50504251; Probe 56 chr12 50504236 50504356; Probe 57 chr12 50504341 50504461; Probe 58 chr12 50504446 50504566; Probe 59 chr12 50504551 50504671; Probe 60 chr12 50504656 50504776; Probe 61 chr12 50504761 50504881; Probe 62 chr12 50504866 50504986; Probe 63 chr12 50504971 50505091; Probe 64 chr12 50505076 50505196; Probe 65 chr16 903614 903734; Probe 66 chr16 903719 903839; Probe 67 chr16 903824 903944; Probe 68 chr16 903929 904049; Probe 69 chr16 904034 904154; Probe 70 chr16 904139 904259; Probe 71 chr16 904244 904364; Probe 72 chr16 904349 904469; Probe 73 chr16 904454 904574; Probe 74 chr16 904559 904679; Probe 75 chr16 904664 904784; Probe 76 chr16 905087 905207; Probe 77 chr16 905192 905312; Probe 78 chr16 918924 919044; Probe 79 chr16 919029 919149; Probe 80 chr16 919863 919983; Probe 81 chr16 919968 920088; Probe 82 chr16 920709 920829; Probe 83 chr16 920814 920934; Probe 84 chr16 921141 921261; Probe 85 chr16 921246 921366; Probe 86 chr16 929550 929670; Probe 87 chr16 929655 929775; Probe 88 chr16 942987 943107; Probe 89 chr16 960911 961031; Probe 90 chr16 961016 961136; Probe 91 chr16 981622 981742; Probe 92 chr16 981727 981847; Probe 93 chr16 983971 984091; Probe 94 chr16 984076 984196; Probe 95 chr16 984170 984290; Probe 96 chr16 1004337 1004457; Probe 97 chr16 1004442 1004562; Probe 98 chr16 1004547 1004667; Probe 99 chr16 1004652 1004772; Probe 100 chr16 1020768 1020888; Probe 101 chr16 1020873 1020993; Probe 102 chr16 1020978 1021098; Probe 103 chr16 1031125 1031245; Probe 104 chr16 1031230 1031350; Probe 105 chr16 1031335 1031455; Probe 106 chr16 1031440 1031560; Probe 107 chr16 1031545 1031665; Probe 108 chr16 1031650 1031770; Probe 109 chr16 1031755 1031875; Probe 110 chr16 1031860 1031980; Probe 111 chr16 1031965 1032085; Probe 112 chr16 1032070 1032190; Probe 113 chr19 45448788 45448908; Probe 114 chr19 45448893 45449013; Probe 115 chr19 45448998 45449118; Probe 116 chr19 45449103 45449223; Probe 117 chr19 45449208 45449328; Probe 118 chr19 45449313 45449433; Probe 119 chr19 45449418 45449538; Probe 120 chr19 45449628 45449748; Probe 121 chr19 45449733 45449853; Probe 122 chr19 45450048 45450168; Probe 123 chr19 45450363 45450483; Probe 124 chr19 45450468 45450588; Probe 125 chr19 45450573 45450693; Probe 126 chr19 45450678 45450798; Probe 127 chr19 45451518 45451638; Probe 128 chr19 45451623 45451743; Probe 129 chr19 45451728 45451848; Probe 130 chr19 45451833 45451953; Probe 131 chr19 45451938 45452058; Probe 132 chr19 45452043 45452163; Probe 133 chr19 45452148 45452268; Probe 134 chr19 45452253 45452373; Probe 135 chr19 45452358 45452478; Probe 136 chr19 45452463 45452583; Probe 137 chr19 45452568 45452688; Probe 138 chr19 45452673 45452793; Probe 139 chr19 45452778 45452898; Probe 140 chr8 19796244 19796364; Probe 141 chr8 19796349 19796469; Probe 142 chr8 19796454 19796574; Probe 143 chr8 19796559 19796679; Probe 144 chr8 19796664 19796784; Probe 145 chr8 19796769 19796889; Probe 146 chr8 19796874 19796994; Probe 147 chr8 19796979 19797099; Probe 148 chr8 19797084 19797204; Probe 149 chr8 19797189 19797309; Probe 150 chr8 19797294 19797414; Probe 151 chr8 19797399 19797519; Probe 152 chr8 19797504 19797624; Probe 153 chr8 19797609 19797729; Probe 154 chr8 19797714 19797834; Probe 155 chr8 19797819 19797939; Probe 156 chr8 19797924 19798044; Probe 157 chr8 19798029 19798149; Probe 158 chr8 19798134 19798254; Probe 159 chr8 19798239 19798359; Probe 160 chr8 19798344 19798464; Probe 161 chr8 19798449 19798569; Probe 162 chr8 19798554 19798674; Probe 163 chr8 19798659 19798779; Probe 164 chr8 19798764 19798884; Probe 165 chr8 19798869 19798989; Probe 166 chr8 19798974 19799094; Probe 167 chr8 19799079 19799199; Probe 168 chr8 19799184 19799304; Probe 169 chr8 19799289 19799409; Probe 170 chr8 19799394 19799514; Probe 171 chr8 19799499 19799619; Probe 172 chr8 19799604 19799724; Probe 173 chr8 19799709 19799829; Probe 174 chr8 19799814 19799934; Probe 175 chr8 19799919 19800039; Probe 176 chr8 19800024 19800144; Probe 177 chr8 19800129 19800249; Probe 178 chr8 19800234 19800354; Probe 179 chr8 19800339 19800459; Probe 180 chr8 19800444 19800564; Probe 181 chr8 19800549 19800669; Probe 182 chr8 19800654 19800774; Probe 183 chr8 19800759 19800879; Probe 184 chr8 19800864 19800984; Probe 185 chr8 19800969 19801089; Probe 186 chr8 19801074 19801194; Probe 187 chr8 19801179 19801299; Probe 188 chr8 19801284 19801404; Probe 189 chr8 19801704 19801824; Probe 190 chr8 19801809 19801929; Probe 191 chr8 19801914 19802034; Probe 192 chr8 19802019 19802139; Probe 193 chr8 19802124 19802244; Probe 194 chr8 19802229 19802349; Probe 195 chr8 19802334 19802454; Probe 196 chr8 19802439 19802559; Probe 197 chr8 19802544 19802664; Probe 198 chr8 19802649 19802769; Probe 199 chr8 19802754 19802874; Probe 200 chr8 19802859 19802979; Probe 201 chr8 19802964 19803084; Probe 202 chr8 19803069 19803189; Probe 203 chr8 19803174 19803294; Probe 204 chr8 19803279 19803399; Probe 205 chr8 19803384 19803504; Probe 206 chr8 19803489 19803609; Probe 207 chr8 19803594 19803714; Probe 208 chr8 19803699 19803819; Probe 209 chr8 19803804 19803924; Probe 210 chr8 19803909 19804029; Probe 211 chr8 19804014 19804134; Probe 212 chr8 19804119 19804239; Probe 213 chr8 19804224 19804344; Probe 214 chr8 19804329 19804449; Probe 215 chr8 19804434 19804554; Probe 216 chr8 19804539 19804659; Probe 217 chr8 19804644 19804764; Probe 218 chr8 19805064 19805184; Probe 219 chr8 19805169 19805289; Probe 220 chr8 19805274 19805394; Probe 221 chr8 19805379 19805499; Probe 222 chr8 19805484 19805604; Probe 223 chr8 19805589 19805709; Probe 224 chr8 19805694 19805814; Probe 225 chr8 19805799 19805919; Probe 226 chr8 19805904 19806024; Probe 227 chr8 19806009 19806129; Probe 228 chr8 19806114 19806234; Probe 229 chr8 19806219 19806339; Probe 230 chr8 19806324 19806444; Probe 231 chr8 19806429 19806549; Probe 232 chr8 19806534 19806654; Probe 233 chr8 19806639 19806759; Probe 234 chr8 19806744 19806864; Probe 235 chr8 19806849 19806969; Probe 236 chr8 19807269 19807389; Probe 237 chr8 19807374 19807494; Probe 238 chr8 19807479 19807599; Probe 239 chr8 19807584 19807704; Probe 240 chr8 19807689 19807809; Probe 241 chr8 19807794 19807914; Probe 242 chr8 19807899 19808019; Probe 243 chr8 19808319 19808439; Probe 244 chr8 19808424 19808544; Probe 245 chr8 19808529 19808649; Probe 246 chr8 19808634 19808754; Probe 247 chr8 19808739 19808859; Probe 248 chr8 19808844 19808964; Probe 249 chr8 19808949 19809069; Probe 250 chr8 19809054 19809174; Probe 251 chr8 19809159 19809279; Probe 252 chr8 19809264 19809384; Probe 253 chr8 19809369 19809489; Probe 254 chr8 19809474 19809594; Probe 255 chr8 19809579 19809699; Probe 256 chr8 19809684 19809804; Probe 257 chr8 19809789 19809909; Probe 258 chr8 19809894 19810014; Probe 259 chr8 19809999 19810119; Probe 260 chr8 19810104 19810224; Probe 261 chr8 19810209 19810329; Probe 262 chr8 19810314 19810434; Probe 263 chr8 19810419 19810539; Probe 264 chr8 19810524 19810644; Probe 265 chr8 19810629 19810749; Probe 266 chr8 19810734 19810854; Probe 267 chr8 19810839 19810959; Probe 268 chr8 19810944 19811064; Probe 269 chr8 19811049 19811169; Probe 270 chr8 19811154 19811274; Probe 271 chr8 19811259 19811379; Probe 272 chr8 19811364 19811484; Probe 273 chr8 19811469 19811589; Probe 274 chr8 19811574 19811694; Probe 275 chr8 19811679 19811799; Probe 276 chr8 19811784 19811904; Probe 277 chr8 19811889 19812009; Probe 278 chr8 19811994 19812114; Probe 279 chr8 19812099 19812219; Probe 280 chr8 19812204 19812324; Probe 281 chr8 19812309 19812429; Probe 282 chr8 19812519 19812639; Probe 283 chr8 19812624 19812744; Probe 284 chr8 19812729 19812849; Probe 285 chr8 19812834 19812954; Probe 286 chr8 19812939 19813059; Probe 287 chr8 19813044 19813164; Probe 288 chr8 19813149 19813269; Probe 289 chr8 19813254 19813374; Probe 290 chr8 19813359 19813479; Probe 291 chr8 19813464 19813584; Probe 292 chr8 19813569 19813689; Probe 293 chr8 19813674 19813794; Probe 294 chr8 19813779 19813899; Probe 295 chr8 19813884 19814004; Probe 296 chr8 19814094 19814214; Probe 297 chr8 19814199 19814319; Probe 298 chr8 19814304 19814424; Probe 299 chr8 19814619 19814739; Probe 300 chr8 19814724 19814844; Probe 301 chr8 19814829 19814949; Probe 302 chr8 19814934 19815054; Probe 303 chr8 19815039 19815159; Probe 304 chr8 19815144 19815264; Probe 305 chr8 19815249 19815369; Probe 306 chr8 19815354 19815474; Probe 307 chr8 19815459 19815579; Probe 308 chr8 19815774 19815894; Probe 309 chr8 19815879 19815999; Probe 310 chr8 19815984 19816104; Probe 311 chr8 19816194 19816314; Probe 312 chr8 19816299 19816419; Probe 313 chr8 19816404 19816524; Probe 314 chr8 19816509 19816629; Probe 315 chr8 19816614 19816734; Probe 316 chr8 19816719 19816839; Probe 317 chr8 19816824 19816944; Probe 318 chr8 19816929 19817049; Probe 319 chr8 19817034 19817154; Probe 320 chr8 19817139 19817259; Probe 321 chr8 19817559 19817679; Probe 322 chr8 19817664 19817784; Probe 323 chr8 19817769 19817889; Probe 324 chr8 19817874 19817994; Probe 325 chr8 19817979 19818099; Probe 326 chr8 19818084 19818204; Probe 327 chr8 19818189 19818309; Probe 328 chr8 19818294 19818414; Probe 329 chr8 19818399 19818519; Probe 330 chr8 19818504 19818624; Probe 331 chr8 19818609 19818729; Probe 332 chr8 19818714 19818834; Probe 333 chr8 19818819 19818939; Probe 334 chr8 19818924 19819044; Probe 335 chr8 19819029 19819149; Probe 336 chr8 19819134 19819254; Probe 337 chr8 19819239 19819359; Probe 338 chr8 19819344 19819464; Probe 339 chr8 19819449 19819569; Probe 340 chr8 19819554 19819674; Probe 341 chr8 19819659 19819779; Probe 342 chr8 19819764 19819884; Probe 343 chr8 19819869 19819989; Probe 344 chr8 19819974 19820094; Probe 345 chr8 19820079 19820199; Probe 346 chr8 19820184 19820304; Probe 347 chr8 19820289 19820409; Probe 348 chr8 19820394 19820514; Probe 349 chr8 19820499 19820619; Probe 350 chr8 19820604 19820724; Probe 351 chr8 19820919 19821039; Probe 352 chr8 19821024 19821144; Probe 353 chr8 19821129 19821249; Probe 354 chr8 19821234 19821354; Probe 355 chr8 19821339 19821459; Probe 356 chr8 19821759 19821879; Probe 357 chr8 19821864 19821984; Probe 358 chr8 19821969 19822089; Probe 359 chr8 19822284 19822404; Probe 360 chr8 19822389 19822509; Probe 361 chr8 19822494 19822614; Probe 362 chr8 19822599 19822719; Probe 363 chr8 19822704 19822824; Probe 364 chr8 19822809 19822929; Probe 365 chr8 19822914 19823034; Probe 366 chr8 19823019 19823139; Probe 367 chr8 19823124 19823244; Probe 368 chr8 19823229 19823349; Probe 369 chr8 19823334 19823454; Probe 370 chr8 19823439 19823559; Probe 371 chr8 19823544 19823664; Probe 372 chr8 19823649 19823769; Probe 373 chr8 19823754 19823874; Probe 374 chr8 19823859 19823979; Probe 375 chr8 19823964 19824084; Probe 376 chr8 19824069 19824189; Probe 377 chr8 19824174 19824294; Probe 378 chr8 19824279 19824399; Probe 379 chr8 19824384 19824504; Probe 380 chr8 19824489 19824609; Probe 381 chr8 19824594 19824714; Probe 382 chr8 19824699 19824819; Probe 383 chr8 144294573 144294693; Probe 384 chr8 144294678 144294798; Probe 385 chr8 144294783 144294903; Probe 386 chr8 144294888 144295008; Probe 387 chr8 144294993 144295113; Probe 388 chr8 144295098 144295218; Probe 389 chr8 144295203 144295323; Probe 390 chr8 144295308 144295428; Probe 391 chr8 144295413 144295533; Probe 392 chr8 144295518 144295638; Probe 393 chr8 144295623 144295743; Probe 394 chr8 144295728 144295848; Probe 395 chr8 144295833 144295953; Probe 396 chr8 144295938 144296058; Probe 397 chr8 144296043 144296163; Probe 398 chr8 144296148 144296268; Probe 399 chr8 144296253 144296373; Probe 400 chr8 144296358 144296478; Probe 401 chr8 144296463 144296583; Probe 402 chr8 144296568 144296688; Probe 403 chr8 144296673 144296793; Probe 404 chr8 144296778 144296898; Probe 405 chr8 144296883 144297003; Probe 406 chr8 144296988 144297108; Probe 407 chr8 144297093 144297213; Probe 408 chr8 144297198 144297318; Probe 409 chr8 144297303 144297423; Probe 410 chr8 144297408 144297528; Probe 411 chr8 144297513 144297633; Probe 412 chr8 144297618 144297738; Probe 413 chr8 144297723 144297843; Probe 414 chr8 144297828 144297948; Probe 415 chr8 144297933 144298053; Probe 416 chr8 144298038 144298158; Probe 417 chr8 144298143 144298263; Probe 418 chr8 144298248 144298368; Probe 419 chr8 144298353 144298473; Probe 420 chr8 144298458 144298578; Probe 421 chr8 144298563 144298683; Probe 422 chr8 144298668 144298788; Probe 423 chr8 144298773 144298893; Probe 424 chr8 144298878 144298998; Probe 425 chr8 144298983 144299103; The reference genome is Hg19. In some specific embodiments of the present sets selected from a probe set 1 to a probe set 6; application, the capture probes comprise a plurality of probe The probe set 1 comprises a plurality of probes selected from the probes 1 to 26; The probe set 2 comprises a plurality of probes selected from the probes 27 to 64; The probe set 3 comprises a plurality of probes selected from the probes 65 to 112; The probe set 4 comprises a plurality of probes selected from the probes 113 to 139; The probe set 5 comprises a plurality of probes selected from the probes 140 to 382; The probe set 6 comprises a plurality of probes selected from the probes 383 to 425. In some specific embodiments of the present application, the capture probes comprise the probe set 1 to the probe set 6; The probe set 1 comprises the probes 1 to 26; The probe set 2 comprises the probes 27 to 64; The probe set 3 comprises the probes 65 to 112; The probe set 4 comprises the probes 113 to 139; The probe set 5 comprises the probes 140 to 382; The probe set 6 comprises the probes 383 to 425. In another embodiment of the present application, the capture probes are used for preparing a familial chylomicronemia syndrome detection kit. In still another embodiment of the present application, a familial chylomicronemia syndrome detection kit comprising the capture probes is provided. In some specific embodiments of the present application, the familial chylomicronemia syndrome detection kit further includes one or more of a nucleic acid extraction reagent, a DNA library construction reagent, a sample and library quantification reagent, a fragment quality control reagent, a hybridization capture reagent, a nucleic acid purification reagent, a target gene fragment amplification reagent, and a sequencing reagent. In yet another one or more embodiments of the present application, use of the capture probes for constructing a detection library for familial chylomicronemia syndrome-related gene mutations is provided. In a further one or more embodiments of the present application, use of the detection kit for constructing a detection library for familial chylomicronemia syndrome-related gene mutations is provided. In a further one or more embodiments of the present application, a method for detecting familial chylomicronemia syndrome-related gene mutations is provided, comprising capturing target gene fragments containing the mutations by using the capture probes or the detection kit, and detecting the captured fragments. In some specific embodiments of the present application, sequencing is used to detect the captured fragments. Details of one or more embodiments of the present application are presented in the following description, and other features, objectives, and advantages of the present application will become apparent from the description and the claims. Specific Embodiments Below, the present invention is further described in detail in conjunction with embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present invention and are not used to limit the scope of the present invention, and the purpose of providing these embodiments and examples is to make the understanding of the disclosed content of the present invention more thorough and comprehensive. It should also be understood that the present invention can be realized in many different forms and is not limited to the embodiments and examples described herein, and those skilled in the art can make various changes or modifications without departing from the substance of the present invention, and any equivalent forms obtained in a similar way shall fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given in order to facilitate a more adequate understanding of the present invention, and it should be understood that the present invention may be implemented without one or more of these details. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as are commonly understood by those skilled in the technical field to which the present invention belongs. The terms used herein in the specification of the present invention are only for the purpose of describing the embodiments and examples, and are not intended to limit the present invention. Terms Unless otherwise stated or where there is a contradiction, the terms or phrases used herein have the following meanings: The scope of selection of the terms “and / or,” “or / and,” and “as well as / or” used herein includes any one item among two or more related listed items, and also includes any and all combinations of the related listed items, wherein the any and all combinations include a combination of any two related listed items, any more than two related listed items, or all related listed items. It should be noted that when at least three items are connected by a combination of at least two conjunctions selected from “and / or,” “or / and,” and “as well as / or,” it should be understood that, in the present application, the technical solution undoubtedly includes the technical solution in which all are connected by “logical AND,” and also undoubtedly includes the technical solution in which all are connected by “logical OR.” For example, “A and / or B” includes three alternatives: A, B, and A+B. For another example, the technical solution of “A, as well as / or, B, as well as / or, C, as well as / or, D” includes any one of A, B, C, and D (that is, the technical solution in which all are connected by “logical OR”), and also includes any and all combinations of A, B, C, and D, that is, includes a combination of any two items or any three items among A, B, C, and D, and further includes the four-item combination of A, B, C, and D (that is, the technical solution in which all are connected by “logical AND”). In the present invention, terms such as “a plurality of,” “multiple kinds,” “multiple times,” and “multiple elements,” unless otherwise specifically limited, mean greater than 2 or equal to 2 in quantity. For example, “one or more kinds” means one kind or two or more kinds. “Combination thereof,” “any combination thereof,” “any combination manner thereof,” and the like used herein include all suitable combination manners of any two items or any more than two items among the listed items. Herein, the term “suitable” as in “suitable combination manner,” “suitable manner,” “any suitable manner,” and the like is based on whether the technical solution of the present invention can be implemented, the technical problem of the present invention can be solved, and the intended technical effect of the present invention can be achieved. Herein, “preferably,” “better,” “more preferably,” and “as appropriate” are only used to describe embodiments or examples with better effects, and it should be understood that they do not constitute a limitation on the protection scope of the present invention. In the present invention, “further,” “still further,” “particularly,” and the like are used for descriptive purposes and indicate differences in content, but should not be understood as limitations on the protection scope of the present invention. In the present invention, “optionally,” “optional,” and “option” mean may or may not be present, that is, mean any one selected from the two parallel solutions of “present” or “absent.” If a technical solution contains multiple occurrences of “optional,” then, unless otherwise specifically stated and where there is no contradiction or mutually restrictive relationship, each “optional” is independent of the others. In the present invention, in “a first aspect,” “a second aspect,” “a third aspect,” “a fourth aspect,” and the like, the terms “first,” “second,” “third,” “fourth,” and the like are only used for descriptive purposes, and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, “first,” “second,” “third,” “fourth,” and the like only serve the purpose of non-exhaustive enumerative description, and should be understood as not constituting a closed-ended limitation on quantity. In the present invention, among technical features described in an open-ended manner, included are closed-ended technical solutions composed of the recited features, and also included are open-ended technical solutions comprising the recited features. In the present invention, where a numerical interval (that is, a numerical range) is involved, unless otherwise specifically stated, the optional numerical values distributed within the above numerical interval are regarded as continuous, and include the two numerical endpoints of the numerical range (that is, the minimum value and the maximum value), as well as each numerical value between the two numerical endpoints. Unless otherwise specifically stated, when a numerical interval refers only to integers within the numerical interval, including the two endpoint integers of the numerical range, as well as each integer between the two endpoints, this is equivalent herein to directly listing each integer, for example, t being an integer selected from 1 to 10 means that t is any one integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges describe features or characteristics, these ranges may be combined. In other words, unless otherwise indicated, the ranges disclosed herein should be understood as including any and all subranges subsumed therein. The temperature parameters in the present invention, unless otherwise specifically limited, are allowed to be constant-temperature treatment, and are also allowed to vary within a certain temperature interval. It should be understood that the constant-temperature treatment allows the temperature to fluctuate within the precision range controlled by the instrument. Fluctuation is allowed within a range such as ±5°C, ±4°C, ±3°C, ±2°C, or ±1°C. In the present invention, % (w / w) and wt% both denote weight percentage, % (v / v) denotes volume percentage, and % (w / v) denotes mass / volume percentage. All literature mentioned in the present invention is incorporated herein by reference, just as if each of the literature were individually incorporated by reference. Unless there is a conflict with the inventive purpose and / or technical solution of the present application, the cited literature involved in the present invention is cited for its entire content and all purposes. When cited literature is involved in the present invention, the definitions of related technical features, terms, nouns, phrases, and the like in the cited literature are also incorporated. When cited literature is involved in the present invention, examples and preferred modes of the cited related technical features may also be incorporated into the present application as reference, but only to the extent that the present invention can be implemented. It should be understood that, when the cited content conflicts with the description in the present application, the present application shall prevail or adaptive correction may be made according to the description of the present application. The embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention. For the experimental methods in the following examples for which specific conditions are not indicated, the guidance provided in the present invention shall be consulted first, and they may also be based on experimental manuals or conventional conditions in the art, may also follow the recommendation of the manufacturer, or may be based on experimental methods known in the art. FCS is caused by one or more gene mutations, and these gene mutations can cause loss of gene functions in lipoprotein lipase (LPL), apolipoprotein CII (APOC2), lipase maturation factor 1 (LMF1), glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1 (GPIHBP1), apolipoprotein AV (APOA5), and glycerol-3-phosphate dehydrogenase 1 (GPD1), thereby affecting the lipolysis and clearance of chylomicrons. In one example embodiment of the present application, 6 genes closely related to FCS were selected (LPL, APOC2, LMF1, GPIHBP1, APOA5, and GPD1), and a probe panel covering exon and hotspot intron regions of the 6 genes was designed for capture sequencing, aiming to stably and accurately detect gene mutations related to FCS, and to provide a more convenient and accurate FCS detection method for clinical practice. It has important significance for the clinical diagnosis and treatment of FCS. In a first aspect of the embodiments of the present application The present application provides a capture probe comprising one or more probe sets selected from a probe set 1 to a probe set 6; Probe set 1 comprises one or more probes selected from probes 1 to 26; Probe set 2 comprises one or more probes selected from probes 27 to 64; Probe set 3 comprises one or more probes selected from probes 65 to 112; Probe set 4 comprises one or more probes selected from probes 113 to 139; Probe set 5 comprises one or more probes selected from probes 140 to 382; Probe set 6 comprises one or more probes selected from probes 383 to 425; The probes 1 to 425 are constructed for target gene fragments located between different start positions and end positions on the following chromosomes and are complementary to and paired with said target gene fragments: Probe number Chromosome Start position End position Probe 1 chr11 116660063 116660183; Probe 2 chr11 116660168 116660288; Probe 3 chr11 116660273 116660393; Probe 4 chr11 116660378 116660498; Probe 5 chr11 116660483 116660603; Probe 6 chr11 116660588 116660708; Probe 7 chr11 116660693 116660813; Probe 8 chr11 116660798 116660918; Probe 9 chr11 116660903 116661023; Probe 10 chr11 116661008 116661128; Probe 11 chr11 116661113 116661233; Probe 12 chr11 116661218 116661338; Probe 13 chr11 116661323 116661443; Probe 14 chr11 116661428 116661548; Probe 15 chr11 116661533 116661653; Probe 16 chr11 116661638 116661758; Probe 17 chr11 116661743 116661863; Probe 18 chr11 116662282 116662402; Probe 19 chr11 116662387 116662507; Probe 20 chr11 116662508 116662628; Probe 21 chr11 116663076 116663196; Probe 22 chr11 116663181 116663301; Probe 23 chr11 116663286 116663406; Probe 24 chr11 116663391 116663511; Probe 25 chr11 116663496 116663616; Probe 26 chr11 116663601 116663721; Probe 27 chr12 50497271 50497391; Probe 28 chr12 50497376 50497496; Probe 29 chr12 50497481 50497601; Probe 30 chr12 50497586 50497706; Probe 31 chr12 50497691 50497811; Probe 32 chr12 50497796 50497916; Probe 33 chr12 50498337 50498457; Probe 34 chr12 50498442 50498562; Probe 35 chr12 50499311 50499431; Probe 36 chr12 50499416 50499536; Probe 37 chr12 50500051 50500171; Probe 38 chr12 50500156 50500276; Probe 39 chr12 50500568 50500688; Probe 40 chr12 50500673 50500793; Probe 41 chr12 50501330 50501450; Probe 42 chr12 50501435 50501555; Probe 43 chr12 50501540 50501660; Probe 44 chr12 50501787 50501907; Probe 45 chr12 50501892 50502012; Probe 46 chr12 50503186 50503306; Probe 47 chr12 50503291 50503411; Probe 48 chr12 50503396 50503516; Probe 49 chr12 50503501 50503621; Probe 50 chr12 50503606 50503726; Probe 51 chr12 50503711 50503831; Probe 52 chr12 50503816 50503936; Probe 53 chr12 50503921 50504041; Probe 54 chr12 50504026 50504146; Probe 55 chr12 50504131 50504251; Probe 56 chr12 50504236 50504356; Probe 57 chr12 50504341 50504461; Probe 58 chr12 50504446 50504566; Probe 59 chr12 50504551 50504671; Probe 60 chr12 50504656 50504776; Probe 61 chr12 50504761 50504881; Probe 62 chr12 50504866 50504986; Probe 63 chr12 50504971 50505091; Probe 64 chr12 50505076 50505196; Probe 65 chr16 903614 903734; Probe 66 chr16 903719 903839; Probe 67 chr16 903824 903944; Probe 68 chr16 903929 904049; Probe 69 chr16 904034 904154; Probe 70 chr16 904139 904259; Probe 71 chr16 904244 904364; Probe 72 chr16 904349 904469; Probe 73 chr16 904454 904574; Probe 74 chr16 904559 904679; Probe 75 chr16 904664 904784; Probe 76 chr16 905087 905207; Probe 77 chr16 905192 905312; Probe 78 chr16 918924 919044; Probe 79 chr16 919029 919149; Probe 80 chr16 919863 919983; Probe 81 chr16 919968 920088; Probe 82 chr16 920709 920829; Probe 83 chr16 920814 920934; Probe 84 chr16 921141 921261; Probe 85 chr16 921246 921366; Probe 86 chr16 929550 929670; Probe 87 chr16 929655 929775; Probe 88 chr16 942987 943107; Probe 89 chr16 960911 961031; Probe 90 chr16 961016 961136; Probe 91 chr16 981622 981742; Probe 92 chr16 981727 981847; Probe 93 chr16 983971 984091; Probe 94 chr16 984076 984196; Probe 95 chr16 984170 984290; Probe 96 chr16 1004337 1004457; Probe 97 chr16 1004442 1004562; Probe 98 chr16 1004547 1004667; Probe 99 chr16 1004652 1004772; Probe 100 chr16 1020768 1020888; Probe 101 chr16 1020873 1020993; Probe 102 chr16 1020978 1021098; Probe 103 chr16 1031125 1031245; Probe 104 chr16 1031230 1031350; Probe 105 chr16 1031335 1031455; Probe 106 chr16 1031440 1031560; Probe 107 chr16 1031545 1031665; Probe 108 chr16 1031650 1031770; Probe 109 chr16 1031755 1031875; Probe 110 chr16 1031860 1031980; Probe 111 chr16 1031965 1032085; Probe 112 chr16 1032070 1032190; Probe 113 chr19 45448788 45448908; Probe 114 chr19 45448893 45449013; Probe 115 chr19 45448998 45449118; Probe 116 chr19 45449103 45449223; Probe 117 chr19 45449208 45449328; Probe 118 chr19 45449313 45449433; Probe 119 chr19 45449418 45449538; Probe 120 chr19 45449628 45449748; Probe 121 chr19 45449733 45449853; Probe 122 chr19 45450048 45450168; Probe 123 chr19 45450363 45450483; Probe 124 chr19 45450468 45450588; Probe 125 chr19 45450573 45450693; Probe 126 chr19 45450678 45450798; Probe 127 chr19 45451518 45451638; Probe 128 chr19 45451623 45451743; Probe 129 chr19 45451728 45451848; Probe 130 chr19 45451833 45451953; Probe 131 chr19 45451938 45452058; Probe 132 chr19 45452043 45452163; Probe 133 chr19 45452148 45452268; Probe 134 chr19 45452253 45452373; Probe 135 chr19 45452358 45452478; Probe 136 chr19 45452463 45452583; Probe 137 chr19 45452568 45452688; Probe 138 chr19 45452673 45452793; Probe 139 chr19 45452778 45452898; Probe 140 chr8 19796244 19796364; Probe 141 chr8 19796349 19796469; Probe 142 chr8 19796454 19796574; Probe 143 chr8 19796559 19796679; Probe 144 chr8 19796664 19796784; Probe 145 chr8 19796769 19796889; Probe 146 chr8 19796874 19796994; Probe 147 chr8 19796979 19797099; Probe 148 chr8 19797084 19797204; Probe 149 chr8 19797189 19797309; Probe 150 chr8 19797294 19797414; Probe 151 chr8 19797399 19797519; Probe 152 chr8 19797504 19797624; Probe 153 chr8 19797609 19797729; Probe 154 chr8 19797714 19797834; Probe 155 chr8 19797819 19797939; Probe 156 chr8 19797924 19798044; Probe 157 chr8 19798029 19798149; Probe 158 chr8 19798134 19798254; Probe 159 chr8 19798239 19798359; Probe 160 chr8 19798344 19798464; Probe 161 chr8 19798449 19798569; Probe 162 chr8 19798554 19798674; Probe 163 chr8 19798659 19798779; Probe 164 chr8 19798764 19798884; Probe 165 chr8 19798869 19798989; Probe 166 chr8 19798974 19799094; Probe 167 chr8 19799079 19799199; Probe 168 chr8 19799184 19799304; Probe 169 chr8 19799289 19799409; Probe 170 chr8 19799394 19799514; Probe 171 chr8 19799499 19799619; Probe 172 chr8 19799604 19799724; Probe 173 chr8 19799709 19799829; Probe 174 chr8 19799814 19799934; Probe 175 chr8 19799919 19800039; Probe 176 chr8 19800024 19800144; Probe 177 chr8 19800129 19800249; Probe 178 chr8 19800234 19800354; Probe 179 chr8 19800339 19800459; Probe 180 chr8 19800444 19800564; Probe 181 chr8 19800549 19800669; Probe 182 chr8 19800654 19800774; Probe 183 chr8 19800759 19800879; Probe 184 chr8 19800864 19800984; Probe 185 chr8 19800969 19801089; Probe 186 chr8 19801074 19801194; Probe 187 chr8 19801179 19801299; Probe 188 chr8 19801284 19801404; Probe 189 chr8 19801704 19801824; Probe 190 chr8 19801809 19801929; Probe 191 chr8 19801914 19802034; Probe 192 chr8 19802019 19802139; Probe 193 chr8 19802124 19802244; Probe 194 chr8 19802229 19802349; Probe 195 chr8 19802334 19802454; Probe 196 chr8 19802439 19802559; Probe 197 chr8 19802544 19802664; Probe 198 chr8 19802649 19802769; Probe 199 chr8 19802754 19802874; Probe 200 chr8 19802859 19802979; Probe 201 chr8 19802964 19803084; Probe 202 chr8 19803069 19803189; Probe 203 chr8 19803174 19803294; Probe 204 chr8 19803279 19803399; Probe 205 chr8 19803384 19803504; Probe 206 chr8 19803489 19803609; Probe 207 chr8 19803594 19803714; Probe 208 chr8 19803699 19803819; Probe 209 chr8 19803804 19803924; Probe 210 chr8 19803909 19804029; Probe 211 chr8 19804014 19804134; Probe 212 chr8 19804119 19804239; Probe 213 chr8 19804224 19804344; Probe 214 chr8 19804329 19804449; Probe 215 chr8 19804434 19804554; Probe 216 chr8 19804539 19804659; Probe 217 chr8 19804644 19804764; Probe 218 chr8 19805064 19805184; Probe 219 chr8 19805169 19805289; Probe 220 chr8 19805274 19805394; Probe 221 chr8 19805379 19805499; Probe 222 chr8 19805484 19805604; Probe 223 chr8 19805589 19805709; Probe 224 chr8 19805694 19805814; Probe 225 chr8 19805799 19805919; Probe 226 chr8 19805904 19806024; Probe 227 chr8 19806009 19806129; Probe 228 chr8 19806114 19806234; Probe 229 chr8 19806219 19806339; Probe 230 chr8 19806324 19806444; Probe 231 chr8 19806429 19806549; Probe 232 chr8 19806534 19806654; Probe 233 chr8 19806639 19806759; Probe 234 chr8 19806744 19806864; Probe 235 chr8 19806849 19806969; Probe 236 chr8 19807269 19807389; Probe 237 chr8 19807374 19807494; Probe 238 chr8 19807479 19807599; Probe 239 chr8 19807584 19807704; Probe 240 chr8 19807689 19807809; Probe 241 chr8 19807794 19807914; Probe 242 chr8 19807899 19808019; Probe 243 chr8 19808319 19808439; Probe 244 chr8 19808424 19808544; Probe 245 chr8 19808529 19808649; Probe 246 chr8 19808634 19808754; Probe 247 chr8 19808739 19808859; Probe 248 chr8 19808844 19808964; Probe 249 chr8 19808949 19809069; Probe 250 chr8 19809054 19809174; Probe 251 chr8 19809159 19809279; Probe 252 chr8 19809264 19809384; Probe 253 chr8 19809369 19809489; Probe 254 chr8 19809474 19809594; Probe 255 chr8 19809579 19809699; Probe 256 chr8 19809684 19809804; Probe 257 chr8 19809789 19809909; Probe 258 chr8 19809894 19810014; Probe 259 chr8 19809999 19810119; Probe 260 chr8 19810104 19810224; Probe 261 chr8 19810209 19810329; Probe 262 chr8 19810314 19810434; Probe 263 chr8 19810419 19810539; Probe 264 chr8 19810524 19810644; Probe 265 chr8 19810629 19810749; Probe 266 chr8 19810734 19810854; Probe 267 chr8 19810839 19810959; Probe 268 chr8 19810944 19811064; Probe 269 chr8 19811049 19811169; Probe 270 chr8 19811154 19811274; Probe 271 chr8 19811259 19811379; Probe 272 chr8 19811364 19811484; Probe 273 chr8 19811469 19811589; Probe 274 chr8 19811574 19811694; Probe 275 chr8 19811679 19811799; Probe 276 chr8 19811784 19811904; Probe 277 chr8 19811889 19812009; Probe 278 chr8 19811994 19812114; Probe 279 chr8 19812099 19812219; Probe 280 chr8 19812204 19812324; Probe 281 chr8 19812309 19812429; Probe 282 chr8 19812519 19812639; Probe 283 chr8 19812624 19812744; Probe 284 chr8 19812729 19812849; Probe 285 chr8 19812834 19812954; Probe 286 chr8 19812939 19813059; Probe 287 chr8 19813044 19813164; Probe 288 chr8 19813149 19813269; Probe 289 chr8 19813254 19813374; Probe 290 chr8 19813359 19813479; Probe 291 chr8 19813464 19813584; Probe 292 chr8 19813569 19813689; Probe 293 chr8 19813674 19813794; Probe 294 chr8 19813779 19813899; Probe 295 chr8 19813884 19814004; Probe 296 chr8 19814094 19814214; Probe 297 chr8 19814199 19814319; Probe 298 chr8 19814304 19814424; Probe 299 chr8 19814619 19814739; Probe 300 chr8 19814724 19814844; Probe 301 chr8 19814829 19814949; Probe 302 chr8 19814934 19815054; Probe 303 chr8 19815039 19815159; Probe 304 chr8 19815144 19815264; Probe 305 chr8 19815249 19815369; Probe 306 chr8 19815354 19815474; Probe 307 chr8 19815459 19815579; Probe 308 chr8 19815774 19815894; Probe 309 chr8 19815879 19815999; Probe 310 chr8 19815984 19816104; Probe 311 chr8 19816194 19816314; Probe 312 chr8 19816299 19816419; Probe 313 chr8 19816404 19816524; Probe 314 chr8 19816509 19816629; Probe 315 chr8 19816614 19816734; Probe 316 chr8 19816719 19816839; Probe 317 chr8 19816824 19816944; Probe 318 chr8 19816929 19817049; Probe 319 chr8 19817034 19817154; Probe 320 chr8 19817139 19817259; Probe 321 chr8 19817559 19817679; Probe 322 chr8 19817664 19817784; Probe 323 chr8 19817769 19817889; Probe 324 chr8 19817874 19817994; Probe 325 chr8 19817979 19818099; Probe 326 chr8 19818084 19818204; Probe 327 chr8 19818189 19818309; Probe 328 chr8 19818294 19818414; Probe 329 chr8 19818399 19818519; Probe 330 chr8 19818504 19818624; Probe 331 chr8 19818609 19818729; Probe 332 chr8 19818714 19818834; Probe 333 chr8 19818819 19818939; Probe 334 chr8 19818924 19819044; Probe 335 chr8 19819029 19819149; Probe 336 chr8 19819134 19819254; Probe 337 chr8 19819239 19819359; Probe 338 chr8 19819344 19819464; Probe 339 chr8 19819449 19819569; Probe 340 chr8 19819554 19819674; Probe 341 chr8 19819659 19819779; Probe 342 chr8 19819764 19819884; Probe 343 chr8 19819869 19819989; Probe 344 chr8 19819974 19820094; Probe 345 chr8 19820079 19820199; Probe 346 chr8 19820184 19820304; Probe 347 chr8 19820289 19820409; Probe 348 chr8 19820394 19820514; Probe 349 chr8 19820499 19820619; Probe 350 chr8 19820604 19820724; Probe 351 chr8 19820919 19821039; Probe 352 chr8 19821024 19821144; Probe 353 chr8 19821129 19821249; Probe 354 chr8 19821234 19821354; Probe 355 chr8 19821339 19821459; Probe 356 chr8 19821759 19821879; Probe 357 chr8 19821864 19821984; Probe 358 chr8 19821969 19822089; Probe 359 chr8 19822284 19822404; Probe 360 chr8 19822389 19822509; Probe 361 chr8 19822494 19822614; Probe 362 chr8 19822599 19822719; Probe 363 chr8 19822704 19822824; Probe 364 chr8 19822809 19822929; Probe 365 chr8 19822914 19823034; Probe 366 chr8 19823019 19823139; Probe 367 chr8 19823124 19823244; Probe 368 chr8 19823229 19823349; Probe 369 chr8 19823334 19823454; Probe 370 chr8 19823439 19823559; Probe 371 chr8 19823544 19823664; Probe 372 chr8 19823649 19823769; Probe 373 chr8 19823754 19823874; Probe 374 chr8 19823859 19823979; Probe 375 chr8 19823964 19824084; Probe 376 chr8 19824069 19824189; Probe 377 chr8 19824174 19824294; Probe 378 chr8 19824279 19824399; Probe 379 chr8 19824384 19824504; Probe 380 chr8 19824489 19824609; Probe 381 chr8 19824594 19824714; Probe 382 chr8 19824699 19824819; Probe 383 chr8 144294573 144294693; Probe 384 chr8 144294678 144294798; Probe 385 chr8 144294783 144294903; Probe 386 chr8 144294888 144295008; Probe 387 chr8 144294993 144295113; Probe 388 chr8 144295098 144295218; Probe 389 chr8 144295203 144295323; Probe 390 chr8 144295308 144295428; Probe 391 chr8 144295413 144295533; Probe 392 chr8 144295518 144295638; Probe 393 chr8 144295623 144295743; Probe 394 chr8 144295728 144295848; Probe 395 chr8 144295833 144295953; Probe 396 chr8 144295938 144296058; Probe 397 chr8 144296043 144296163; Probe 398 chr8 144296148 144296268; Probe 399 chr8 144296253 144296373; Probe 400 chr8 144296358 144296478; Probe 401 chr8 144296463 144296583; Probe 402 chr8 144296568 144296688; Probe 403 chr8 144296673 144296793; Probe 404 chr8 144296778 144296898; Probe 405 chr8 144296883 144297003; Probe 406 chr8 144296988 144297108; Probe 407 chr8 144297093 144297213; Probe 408 chr8 144297198 144297318; Probe 409 chr8 144297303 144297423; Probe 410 chr8 144297408 144297528; Probe 411 chr8 144297513 144297633; Probe 412 chr8 144297618 144297738; Probe 413 chr8 144297723 144297843; Probe 414 chr8 144297828 144297948; Probe 415 chr8 144297933 144298053; Probe 416 chr8 144298038 144298158; Probe 417 chr8 144298143 144298263; Probe 418 chr8 144298248 144298368; Probe 419 chr8 144298353 144298473; Probe 420 chr8 144298458 144298578; Probe 421 chr8 144298563 144298683; Probe 422 chr8 144298668 144298788; Probe 423 chr8 144298773 144298893; Probe 424 chr8 144298878 144298998; Probe 425 chr8 144298983 144299103; The reference genome is Hg19. The capture probes provided in the embodiments of the present application are designed to cover the exons and hotspot intron regions of 6 genes closely related to FCS (LPL, APOC2, LMF1, GPIHBP1, APOA5 and GPD1). It should be understood that, according to actual needs, some of the probe sets may be selected to detect some of the target genes, and they may be, for example, any one, two, three, four, or five probe sets selected from the probe sets 1 to 6. In order to meet the detection requirements of certain regions of the target gene, a corresponding number of probes may be selected from the corresponding probe set, for example, selecting 1 probe, 2 probes, 3 probes... 24 probes, 25 probes, and 26 probes from the probe set 1. Optionally, the capture probes comprise a plurality of probe sets selected from the probe set 1 to probe set 6; The probe set 1 comprises a plurality of probes selected from probes 1 to 26; The probe set 2 comprises a plurality of probes selected from the probe 27 to the probe 64; The probe set 3 comprises a plurality of probes selected from the probe 65 to the probe 112; The probe set 4 comprises a plurality of probes selected from the probe 113 to the probe 139; The probe set 5 comprises a plurality of probes selected from the probe 140 to the probe 382; The probe set 6 comprises a plurality of probes selected from the probe 383 to the probe 425. Further optionally, the capture probes comprise the probe set 1 to the probe set 6; The probe set 1 comprises probes 1 to 26; The probe set 2 comprises the probe 27 to the probe 64; The probe set 3 comprises the probe 65 to the probe 112; The probe set 4 comprises the probe 113 to the probe 139; The probe set 5 comprises the probe 140 to the probe 382; The probe set 6 comprises the probe 383 to the probe 425. A second aspect of the embodiments of the present application The embodiments of the present application provide use of the capture probes in preparing a familial chylomicronemia syndrome detection kit. A third aspect of the embodiments of the present application The embodiments of the present application provide a familial chylomicronemia syndrome detection kit comprising the capture probes. Optionally, the familial chylomicronemia syndrome detection kit further includes one or more of a nucleic acid extraction reagent, a DNA library construction reagent, a sample and library quantification reagent, a fragment quality control reagent, a hybridization capture reagent, a nucleic acid purification reagent, a target gene fragment amplification reagent, and a sequencing reagent. A fourth aspect of the embodiments of the present application The embodiments of the present application provide use of the capture probes in constructing a detection library for gene mutations related to familial chylomicronemia syndrome. A fifth aspect of the embodiments of the present application The embodiments of the present application provide use of the detection kit in constructing a detection library for gene mutations related to familial chylomicronemia syndrome. A sixth aspect of the embodiments of the present application The embodiments of the present application provide a method for detecting familial chylomicronemia syndrome-related gene mutations, comprising using the capture probes or the detection kit to capture target gene fragments containing gene mutations related to familial chylomicronemia syndrome, and detecting the captured fragments. Optionally, sequencing is used to detect the captured fragments. In the following specific embodiments, measurement parameters involving raw material components may, unless otherwise specifically stated, have slight deviations within the weighing accuracy range. For the temperature and time parameters involved, deviations caused by instrument testing accuracy or operational accuracy are allowable. The reagents used in the detection process of this embodiment is listed as follows: Table 1 No. Function Name of reagent consumable Brand Specification 1 Nucleic acid extraction QIAamp DNA Mini Kit(250) QIAGEN 51306 2 Nucleic acid quantification Qubit™dsDNA HS Assay Kit ThermoFisher Q32854 3 Specifically hydrolyzing cytosine (C) or uracil (U) residues of RNA RNase A (17,500 U) QIAGEN 19101 4 Constructing DNA libraries VAHTS Universal DNA Library Prep Kit for Illumina V3 Vazyme ND607-02 5 DNA amplification KAPA HiFi HotStart ReadyMix Kapa Biosystems KK2602 6 Library construction adapter NEXTflex®Dual-Indexed DNA Barcodes(1-96) Bioo Scientific NOVA-514160 7 Library construction adapter NEXTflex®Dual-Indexed DNA Barcodes (97-192) Bioo Scientific NOVA-514161 No. Function Name of reagent consumable Brand Specification 8 Purifying nucleic acid Agencourt AMPure XP 450mL Kit Beckman Coulter A63882 9 Blocking sample adapter sequences xGen®Universal Blockers-TS Mix,4x96rxn Integrated DNA Technologies 1075476 10 Binding and capturing nucleic acids complementary to the target sequence FCS_Probes (Table 4) Nanodigmbio customized 11 Targeted capture hybridization and washing xGen® Hybridization and Wash Kit Integrated DNA Technologies 1080584 12 Complementarity paired P5 sequence Illumina P5 Primer customized customized 13 Complementarity paired P7 sequence Illumina P7 Primer customized customized 14 DNA molecular weight determination and quantitative analysis DNA High Sensitivity Reagent Kit PerkinElmer CLS760672 15 Microfluidic chip DNA Extended Range Chip for use with GX Touch / GXII Touch HT PerkinElmer 760517 16 Buffer component TWEEN®20 SigmaAldrich P7949 17 Buffer component 1M Tris pH 7.0 ThermoFisher AM9851 18 Buffer component Sodium hydroxide solution Fluka Analytical 319511-500ML 19 Buffer component Sodium hypochlorite solution SigmaAldrich 239305 20 Calibration quality control PhiX Control v3 Illumina FC-110-3001 21 Cluster generation and sequencing NovaSeq 6000 v2 kit (300cycles) Illumina FC-404-2004 The equipment used in the detection process of this embodiment is listed as follows: Table 2 No. Function Equipment name Factory number Model 1 Vortex oscillation Vortex-Genie 2 Scientific Industries SI-0246 2 High-speed centrifugation Heraeus Pico 21 Centrifuge, Ventilated ThermoFisher 75002415 3 Dry constant temperature GL-150B Dry Thermostat Kylin-Bell GL-150B 4 Instant rapid centrifugation TGear Mini centrifuge (OSE-MC8) TIANGEN BIOTECH (BEIJING) OSE-MC8 5 Nucleic acid quantification Qubit 3 Fluorometer ThermoFisher Q33216 6 Nucleic acid quantitative analysis and purity assessment NanoDrop™ 2000 Spectrophotometer ThermoFisher ND-2000 7 PCR nucleic acid amplification GeneAmp® PCR System 9700, 96-Well Aluminum ThermoFisher 4314879 8 Electrophoresis power supply PowerPac™ Basic Power Supply Bio-Rad 1645050 9 Gel imaging analysis Tanon 2500 Gel Imaging System Tanon Science & Technology Tanon-2500 10 Ultrasonic fragmentation of samples M220 Focused-ultrasonicator™ Covaris 500295 11 PCR nucleic acid amplification Veriti™ 96-Well Thermal Cycler ThermoFisher 4375786 12 Vacuum concentration of nucleic acid Savant™ DNA SpeedVac™ Concentrator ThermoFisher DNA120-230 WO 2025 / 124559 PCT / CN2024 / 139229 24 13 Performing electrophoretic separation as well as qualitative and quantitative analysis of nucleic acid LabChip GX Touch HT Nucleic Acid Analyzer PerkinElmer CLS137031 14 Aspiration, discharge GL-802 Compact Desktop Vacuum Pump Kylin-Bell GL-802 15 Microplate centrifugation MPS 1000 Mini Plate Spinner Centrifuge Labnet C1000 16 Preparation of pure water and ultrapure water Direct-Q® 3 UV Water Purification System MerckMillipore ZRQSVP3CN 17 High-throughput sequencing NovaSeqTM 6000 Dx Illumina A00335 Example 1 In this example, the capture sequencing detection process for 6 genes related to FCS is divided into four steps: sample preparation, library construction, target region capture, and sequencing. 1. Panel design In this embodiment, the region covered by the target capture probe panel for detecting 6 genes related to FCS, namely LPL, APOC2, LMF1, GPIHBP1, APOA5 and GPD1, is 18.6 kb, covering all exons and hotspot intron regions of the 6 genes closely related to FCS (Table 3). The high-density probe design ensures that each target region will be covered by at least two probes (see Table 4). Table 3. Probe coverage ranges for 6 FCS-related genes Gene Coverage APOC2 Full exon+500bp upstream, 49.1% intron. LPL Full exon+500bp upstream, 89.3% intron. GPIHBP1 Full gene+500bp upstream. APOA5 Full exon+500bp upstream. GPD1 Full exon+500bp upstream. LMF1 Full exon+500bp upstream. Table 4. Capture probes Number Chr Start End Number Chr Start End 1 chr11 116660063 116660183 14 chr11 116661428 116661548 2 chr11 116660168 116660288 15 chr11 116661533 116661653 3 chr11 116660273 116660393 16 chr11 116661638 116661758 4 chr11 116660378 116660498 17 chr11 116661743 116661863 5 chr11 116660483 116660603 18 chr11 116662282 116662402 6 chr11 116660588 116660708 19 chr11 116662387 116662507 7 chr11 116660693 116660813 20 chr11 116662508 116662628 8 chr11 116660798 116660918 21 chr11 116663076 116663196 9 chr11 116660903 116661023 22 chr11 116663181 116663301 10 chr11 116661008 116661128 23 chr11 116663286 116663406 11 chr11 116661113 116661233 24 chr11 116663391 116663511 12 chr11 116661218 116661338 25 chr11 116663496 116663616 13 chr11 116661323 116661443 26 chr11 116663601 116663721 27 chr12 50497271 50497391 46 chr12 50503186 50503306 28 chr12 50497376 50497496 47 chr12 50503291 50503411 29 chr12 50497481 50497601 48 chr12 50503396 50503516 30 chr12 50497586 50497706 49 chr12 50503501 50503621 31 chr12 50497691 50497811 50 chr12 50503606 50503726 32 chr12 50497796 50497916 51 chr12 50503711 50503831 33 chr12 50498337 50498457 52 chr12 50503816 50503936 34 chr12 50498442 50498562 53 chr12 50503921 50504041 35 chr12 50499311 50499431 54 chr12 50504026 50504146 36 chr12 50499416 50499536 55 chr12 50504131 50504251 37 chr12 50500051 50500171 56 chr12 50504236 50504356 38 chr12 50500156 50500276 57 chr12 50504341 50504461 39 chr12 50500568 50500688 58 chr12 50504446 50504566 40 chr12 50500673 50500793 59 chr12 50504551 50504671 41 chr12 50501330 50501450 60 chr12 50504656 50504776 42 chr12 50501435 50501555 61 chr12 50504761 50504881 43 chr12 50501540 50501660 62 chr12 50504866 50504986 44 chr12 50501787 50501907 63 chr12 50504971 50505091 45 chr12 50501892 50502012 64 chr12 50505076 50505196 65 chr16 903614 903734 89 chr16 960911 961031 66 chr16 903719 903839 90 chr16 961016 961136 67 chr16 903824 903944 91 chr16 981622 981742 68 chr16 903929 904049 92 chr16 981727 981847 69 chr16 904034 904154 93 chr16 983971 984091 70 chr16 904139 904259 94 chr16 984076 984196 71 chr16 904244 904364 95 chr16 984170 984290 72 chr16 904349 904469 96 chr16 1004337 1004457 73 chr16 904454 904574 97 chr16 1004442 1004562 74 chr16 904559 904679 98 chr16 1004547 1004667 75 chr16 904664 904784 99 chr16 1004652 1004772 76 chr16 905087 905207 100 chr16 1020768 1020888 77 chr16 905192 905312 101 chr16 1020873 1020993 78 chr16 918924 919044 102 chr16 1020978 1021098 79 chr16 919029 919149 103 chr16 1031125 1031245 80 chr16 919863 919983 104 chr16 1031230 1031350 81 chr16 919968 920088 105 chr16 1031335 1031455 82 chr16 920709 920829 106 chr16 1031440 1031560 83 chr16 920814 920934 107 chr16 1031545 1031665 84 chr16 921141 921261 108 chr16 1031650 1031770 85 chr16 921246 921366 109 chr16 1031755 1031875 86 chr16 929550 929670 110 chr16 1031860 1031980 87 chr16 929655 929775 111 chr16 1031965 1032085 88 chr16 942987 943107 112 chr16 1032070 1032190 113 chr19 45448788 45448908 126 chr19 45450678 45450798 114 chr19 45448893 45449013 127 chr19 45451518 45451638 115 chr19 45448998 45449118 128 chr19 45451623 45451743 116 chr19 45449103 45449223 129 chr19 45451728 45451848 117 chr19 45449208 45449328 130 chr19 45451833 45451953 118 chr19 45449313 45449433 131 chr19 45451938 45452058 119 chr19 45449418 45449538 132 chr19 45452043 45452163 120 chr19 45449628 45449748 133 chr19 45452148 45452268 121 chr19 45449733 45449853 134 chr19 45452253 45452373 122 chr19 45450048 45450168 135 chr19 45452358 45452478 123 chr19 45450363 45450483 136 chr19 45452463 45452583 124 chr19 45450468 45450588 137 chr19 45452568 45452688 125 chr19 45450573 45450693 138 chr19 45452673 45452793 140 chr8 19796244 19796364 139 chr19 45452778 45452898 141 chr8 19796349 19796469 262 chr8 19810314 19810434 142 chr8 19796454 19796574 263 chr8 19810419 19810539 143 chr8 19796559 19796679 264 chr8 19810524 19810644 144 chr8 19796664 19796784 265 chr8 19810629 19810749 145 chr8 19796769 19796889 266 chr8 19810734 19810854 146 chr8 19796874 19796994 267 chr8 19810839 19810959 147 chr8 19796979 19797099 268 chr8 19810944 19811064 148 chr8 19797084 19797204 269 chr8 19811049 19811169 149 chr8 19797189 19797309 270 chr8 19811154 19811274 150 chr8 19797294 19797414 271 chr8 19811259 19811379 151 chr8 19797399 19797519 272 chr8 19811364 19811484 152 chr8 19797504 19797624 273 chr8 19811469 19811589 153 chr8 19797609 19797729 274 chr8 19811574 19811694 154 chr8 19797714 19797834 275 chr8 19811679 19811799 155 chr8 19797819 19797939 276 chr8 19811784 19811904 156 chr8 19797924 19798044 277 chr8 19811889 19812009 157 chr8 19798029 19798149 278 chr8 19811994 19812114 158 chr8 19798134 19798254 279 chr8 19812099 19812219 159 chr8 19798239 19798359 280 chr8 19812204 19812324 160 chr8 19798344 19798464 281 chr8 19812309 19812429 161 chr8 19798449 19798569 282 chr8 19812519 19812639 162 chr8 19798554 19798674 283 chr8 19812624 19812744 163 chr8 19798659 19798779 284 chr8 19812729 19812849 164 chr8 19798764 19798884 285 chr8 19812834 19812954 165 chr8 19798869 19798989 286 chr8 19812939 19813059 166 chr8 19798974 19799094 287 chr8 19813044 19813164 167 chr8 19799079 19799199 288 chr8 19813149 19813269 168 chr8 19799184 19799304 289 chr8 19813254 19813374 169 chr8 19799289 19799409 290 chr8 19813359 19813479 170 chr8 19799394 19799514 291 chr8 19813464 19813584 171 chr8 19799499 19799619 292 chr8 19813569 19813689 172 chr8 19799604 19799724 293 chr8 19813674 19813794 173 chr8 19799709 19799829 294 chr8 19813779 19813899 174 chr8 19799814 19799934 295 chr8 19813884 19814004 175 chr8 19799919 19800039 296 chr8 19814094 19814214 176 chr8 19800024 19800144 297 chr8 19814199 19814319 177 chr8 19800129 19800249 298 chr8 19814304 19814424 178 chr8 19800234 19800354 299 chr8 19814619 19814739 179 chr8 19800339 19800459 300 chr8 19814724 19814844 180 chr8 19800444 19800564 301 chr8 19814829 19814949 181 chr8 19800549 19800669 302 chr8 19814934 19815054 182 chr8 19800654 19800774 303 chr8 19815039 19815159 183 chr8 19800759 19800879 304 chr8 19815144 19815264 184 chr8 19800864 19800984 305 chr8 19815249 19815369 185 chr8 19800969 19801089 306 chr8 19815354 19815474 186 chr8 19801074 19801194 307 chr8 19815459 19815579 187 chr8 19801179 19801299 308 chr8 19815774 19815894 188 chr8 19801284 19801404 309 chr8 19815879 19815999 189 chr8 19801704 19801824 310 chr8 19815984 19816104 190 chr8 19801809 19801929 311 chr8 19816194 19816314 191 chr8 19801914 19802034 312 chr8 19816299 19816419 192 chr8 19802019 19802139 313 chr8 19816404 19816524 193 chr8 19802124 19802244 314 chr8 19816509 19816629 194 chr8 19802229 19802349 315 chr8 19816614 19816734 195 chr8 19802334 19802454 316 chr8 19816719 19816839 196 chr8 19802439 19802559 317 chr8 19816824 19816944 197 chr8 19802544 19802664 318 chr8 19816929 19817049 198 chr8 19802649 19802769 319 chr8 19817034 19817154 199 chr8 19802754 19802874 320 chr8 19817139 19817259 200 chr8 19802859 19802979 321 chr8 19817559 19817679 201 chr8 19802964 19803084 322 chr8 19817664 19817784 202 chr8 19803069 19803189 323 chr8 19817769 19817889 203 chr8 19803174 19803294 324 chr8 19817874 19817994 204 chr8 19803279 19803399 325 chr8 19817979 19818099 205 chr8 19803384 19803504 326 chr8 19818084 19818204 206 chr8 19803489 19803609 327 chr8 19818189 19818309 207 chr8 19803594 19803714 328 chr8 19818294 19818414 208 chr8 19803699 19803819 329 chr8 19818399 19818519 209 chr8 19803804 19803924 330 chr8 19818504 19818624 210 chr8 19803909 19804029 331 chr8 19818609 19818729 211 chr8 19804014 19804134 332 chr8 19818714 19818834 212 chr8 19804119 19804239 333 chr8 19818819 19818939 213 chr8 19804224 19804344 334 chr8 19818924 19819044 214 chr8 19804329 19804449 335 chr8 19819029 19819149 215 chr8 19804434 19804554 336 chr8 19819134 19819254 216 chr8 19804539 19804659 337 chr8 19819239 19819359 217 chr8 19804644 19804764 338 chr8 19819344 19819464 218 chr8 19805064 19805184 339 chr8 19819449 19819569 219 chr8 19805169 19805289 340 chr8 19819554 19819674 220 chr8 19805274 19805394 341 chr8 19819659 19819779 221 chr8 19805379 19805499 342 chr8 19819764 19819884 222 chr8 19805484 19805604 343 chr8 19819869 19819989 223 chr8 19805589 19805709 344 chr8 19819974 19820094 224 chr8 19805694 19805814 345 chr8 19820079 19820199 225 chr8 19805799 19805919 346 chr8 19820184 19820304 226 chr8 19805904 19806024 347 chr8 19820289 19820409 227 chr8 19806009 19806129 348 chr8 19820394 19820514 228 chr8 19806114 19806234 349 chr8 19820499 19820619 229 chr8 19806219 19806339 350 chr8 19820604 19820724 230 chr8 19806324 19806444 351 chr8 19820919 19821039 231 chr8 19806429 19806549 352 chr8 19821024 19821144 232 chr8 19806534 19806654 353 chr8 19821129 19821249 233 chr8 19806639 19806759 354 chr8 19821234 19821354 234 chr8 19806744 19806864 355 chr8 19821339 19821459 235 chr8 19806849 19806969 356 chr8 19821759 19821879 236 chr8 19807269 19807389 357 chr8 19821864 19821984 237 chr8 19807374 19807494 358 chr8 19821969 19822089 238 chr8 19807479 19807599 359 chr8 19822284 19822404 239 chr8 19807584 19807704 360 chr8 19822389 19822509 240 chr8 19807689 19807809 361 chr8 19822494 19822614 241 chr8 19807794 19807914 362 chr8 19822599 19822719 242 chr8 19807899 19808019 363 chr8 19822704 19822824 243 chr8 19808319 19808439 364 chr8 19822809 19822929 244 chr8 19808424 19808544 365 chr8 19822914 19823034 245 chr8 19808529 19808649 366 chr8 19823019 19823139 246 chr8 19808634 19808754 367 chr8 19823124 19823244 247 chr8 19808739 19808859 368 chr8 19823229 19823349 248 chr8 19808844 19808964 369 chr8 19823334 19823454 249 chr8 19808949 19809069 370 chr8 19823439 19823559 250 chr8 19809054 19809174 371 chr8 19823544 19823664 251 chr8 19809159 19809279 372 chr8 19823649 19823769 252 chr8 19809264 19809384 373 chr8 19823754 19823874 253 chr8 19809369 19809489 374 chr8 19823859 19823979 254 chr8 19809474 19809594 375 chr8 19823964 19824084 255 chr8 19809579 19809699 376 chr8 19824069 19824189 256 chr8 19809684 19809804 377 chr8 19824174 19824294 257 chr8 19809789 19809909 378 chr8 19824279 19824399 258 chr8 19809894 19810014 379 chr8 19824384 19824504 259 chr8 19809999 19810119 380 chr8 19824489 19824609 260 chr8 19810104 19810224 381 chr8 19824594 19824714 261 chr8 19810209 19810329 382 chr8 19824699 19824819 383 chr8 144294573 144294693 405 chr8 144296883 144297003 384 chr8 144294678 144294798 406 chr8 144296988 144297108 385 chr8 144294783 144294903 407 chr8 144297093 144297213 386 chr8 144294888 144295008 408 chr8 144297198 144297318 387 chr8 144294993 144295113 409 chr8 144297303 144297423 388 chr8 144295098 144295218 410 chr8 144297408 144297528 389 chr8 144295203 144295323 411 chr8 144297513 144297633 390 chr8 144295308 144295428 412 chr8 144297618 144297738 391 chr8 144295413 144295533 413 chr8 144297723 144297843 392 chr8 144295518 144295638 414 chr8 144297828 144297948 393 chr8 144295623 144295743 415 chr8 144297933 144298053 394 chr8 144295728 144295848 416 chr8 144298038 144298158 395 chr8 144295833 144295953 417 chr8 144298143 144298263 396 chr8 144295938 144296058 418 chr8 144298248 144298368 397 chr8 144296043 144296163 419 chr8 144298353 144298473 398 chr8 144296148 144296268 420 chr8 144298458 144298578 399 chr8 144296253 144296373 421 chr8 144298563 144298683 400 chr8 144296358 144296478 422 chr8 144298668 144298788 401 chr8 144296463 144296583 423 chr8 144298773 144298893 402 chr8 144296568 144296688 424 chr8 144298878 144298998 403 chr8 144296673 144296793 425 chr8 144298983 144299103 404 chr8 144296778 144296898 In this example, target capture probes covered all exons and hotspot intronic regions of the above six genes to ensure accurate and efficient detection of FCS-related gene mutations and to provide a basis for the clinical diagnosis and medication guidance of FCS. The nucleotide sequences of the probes 1 to 425 are shown in SEQ ID NOs. 1 to 425. 2. Detection experiment design The detection workflow includes four main steps: sample preparation, library construction, target region enrichment, and sequencing. First, about 300 ng of gDNA was taken and fragmented into DNA fragments of about 200 bp by using a Covaris ultrasonic fragmenter (see step 2.1), library preparation was carried out by using an Illumina V3 VAHTS Universal DNA Library Prep Kit (Vazyme ND607-02), and the library was quantified by using a Qubit® dsDNA HS Assay Kit (Thermo Fisher) (see step 2.2). An xGen hybridization and capture kit (Integrated DNA Technologies, 1080584) was used to perform FCS probe capture on the library, and after capture, library quality control (QC) was performed using a Qubit fluorometer (Invitrogen) and LabChip GX Touch HT (Perkin Elmer). Finally, sequencing was carried out on a NovaSeq6000 platform (Illumina) (2*150 bp) (see step 2.4). The following is a detailed description of each experimental step: 2.1 Sample preparation Ten mutant gDNA samples containing known variants in six genes (LPL, APOC2, LMF1, GPIHBP1, APOA5, and GPD1) (for specific gene variant types, see attached Table 5), and 10 wild-type gDNA samples not containing any variant type of the above 6 genes (Table 5) were selected. For each gDNA sample, about 300 ng was taken, IDTE buffer (10 mM Tris, 0.1 mM EDTA) was added to make up the volume to 50 uL, and the Covaris ultrasonic fragmenter was set according to the parameters in Table 6 below to fragment the gDNA samples for 180 s. Table 5. Sample information Sample number Gene Variant information Sample number Genotype PN1 LPL c.249 + 1G > A N1 Wild type PN2 LPL c.1160_1161insT (p.Lys387fs) N2 Wild type PN3 APOC2 c.189C > A (p.Tyr63Ter) N3 Wild type PN4 LMF1 c.895C > T (p.Gln299Ter) N4 Wild type PN5 GPIHBP1 c.422G > A (p.Trp141Ter) N5 Wild type PN6 GPIHBP1 c.417_433del (p.Pro140fs) N6 Wild type PN7 APOA5 c.289C > T (p.Gln97Ter) N7 Wild type PN8 APOA5 c.990_993del (p.Asp332fs) N8 Wild type PN9 GPD1 c.219 + 1_219 + 3del N9 Wild type Table 6. Parameter settings of the covaris ultrasonic fragmenter Peak incident power (W) Duty factor (%) Cycles per burst (#) Treatment time (s) Temperature (°C) Sample volume (UL) 450 30 200 180 7 50 2.2 Library construction 2.2.1 End repair and A-tailing 1) transferred the fragmented sample to a 0.2 mL sterilized centrifuge tube, transferred the centrifuge tube onto ice, and then added the following reagents according to the table below. Table 7 Component Single reaction system ( U L) Preparation of 11 Mixes (uL) Fragmented sample 50 550 End Prep Mix 4 15 165 Total volume 65 715 2) After microcentrifugation, collected the liquid to the bottom of the tube for the following reaction. 30 Table 8 Temperature Time Heated lid 105C On 20C 15 min 65C 15 min 4C w 2.2.2 Adapter ligation 1) Thawed the ligase buffer, inverted to mix well, and placed on ice for later use. 2) Prepared the reaction system according to the table below, and on ice, dispensed the reagents into the above reaction tubes. Table 9 Component Single reaction system ( U L) Preparation of 11 Mixes (uL) Rapid Ligation buffer 2 25 275 Rapid DNA ligase 5 55 Ultrapure water 3 33 Total volume 33 363 It is recommended that the IDT UDI Adapter Kit be used as the adapter. When the cDNA input amount was < 10 ng, the adapter was diluted 20-fold (diluted with Nuclease-Free Water) before use. 3) After carefully confirming the sample number, added 2 uL of Adapter to each sample, gently pipetted to mix well, and after microcentrifugation, collected the liquid to the bottom of the tube. Allowed to react according to the following amplification program. Table 10 Reaction temperature Time Heated lid 105C On 20°C 15 min 4C w 2.2.3 Purification of post-ligation products 1) Equilibrated the magnetic beads at room temperature for 30 min and vortexed thoroughly to mix well, and took 80 uL into a new 1.5 mL centrifuge tube. 2) transferred 100 uL of the ligation product to the 1.5 mL centrifuge tube in step 2.2.2, vortexed to mix well, and incubated at room temperature for 5 min. 3) Placed the 1.5 mL centrifuge tube on a magnetic rack, let stand until the solution was completely clear, and discarded the supernatant. 4) Added 200 uL of freshly prepared 80% (v / v) ethanol, incubated at room temperature for 30 s, and aspirated and discarded the supernatant. 5) Repeated the previous step. 6) Microcentrifuged the 1.5 mL centrifuge tube and placed it on the magnetic rack, let stand for 1 min, discarded the residual solution, and air-dried with the lid open at room temperature until the ethanol had completely evaporated. 7) Added 22 uL of Nuclease-Free Water, vortexed to mix well, incubated at room temperature for 2 min, microcentrifuged and placed on the magnetic rack, and after the solution was completely clear, transferred 20 uL of the supernatant to a newly labeled 0.2 mL centrifuge tube. 2.2.4 Library amplification 1) Thawed the library construction amplification primers and the library construction amplification buffer, and inverted to mix well. 2) Prepared the reaction system according to the table below, and dispensed it into the above ligation purification product tubes. Table 11 Component Single reaction system Preparation of 11 Mixes ( U L) (UL) Purification products 20 220 PCR Primer Mix 3 for Illumina 5 55 VAHTS HiFi Amplification Mix 25 275 Total volume 50 550 3) Gently pipetted to mix well, and after microcentrifugation, collected the liquid to the bottom of the tube. Amplification was carried out according to the following program: Table 12 Temperature Time Number of cycles Heated lid 105°C On NA 98C 3 min 1 98C 20 s 6 60C 15 s 72C 30 s 72C 5 min 1 4°C w 1 2.2.5 PCR product purification 1) Equilibrated the magnetic beads at room temperature for 30 min and vortexed thoroughly to mix well, and took 50 uL into a new 1.5 mL centrifuge tube. 2) transferred 50 uL of the PCR product to the 1.5 mL centrifuge tube in step 2.2.4, vortexed to mix well, and incubated at room temperature for 5 min. 3) Placed the 1.5 mL centrifuge tube on a magnetic rack, let stand until the solution was completely clear, and discarded the supernatant. 4) Added 200 uL of freshly prepared 80% ethanol, incubated at room temperature for 30 s, and discarded the supernatant. 5) Repeated the previous step. 6) Microcentrifuged the 1.5 mL centrifuge tube of step 5) and placed it on the magnetic rack, let stand for 1 min and then discarded the residual solution, and air-dried with the lid open at room temperature until the ethanol had completely volatilized. 7) Added 32 uL of Nuclease-Free Water, vortexed to mix well, incubated at room temperature for 2 min, microcentrifuged and place on the magnetic rack, and after the solution was completely clear, transferred 30 uL of the supernatant to a newly labeled 1.5 mL centrifuge tube, which was the library product. 2.2.6 Library quality control 1) Used the nucleic acid quantification kit Qubit™ dsDNA HS Assay Kit and its supporting instrument to determine the concentration of the DNA library, and the total amount of the DNA library should be > 500 ng. 2) Used the DNA High Sensitivity Reagent Kit and its supporting instrument to determine the fragment length of the DNA library. The main peak should be within the range of 200-800 bp, and there should be no obvious small-fragment or large-fragment miscellaneous peaks 2.3 Target region enrichment 2.3.1 Library mixing and drying down 1) According to the records in Table 3 or Table 4, after carefully confirming the sample numbers, pooled the DNA libraries into a single tube in a new 1.5 mL LoBind centrifuge tube. 2) In a new 1.5 mL LoBind centrifuge tube, prepared the Blocker Master Mix according to the table below, and when there were multiple samples, prepared an extra 10%. Table 13 Component Vol(uL) Preparation of 11 Mixes (UL) Human Cot DNA 5 55 xGen Universal Blocking Oligo - TS Mix 1 11 Total 6 66 3) After mixing well, added 6 uL of Blocker Master Mix to each pool. 4) After fully vortexing to mix well, centrifuged to collect the Mix to the bottom of the tube, sealed with sealing film, punctured 5 small holes in the film, and placed in a vacuum concentrator to dry down. 2.3.2 Library redissolution, denaturation, and hybridization 1) In a new 1.5 mL LoBind centrifuge tube, prepared the Hybridization Master Mix according to the table below, and when there were multiple samples, prepared an additional amount. Table 14 Component Volume (u L) Preparation of 11 Mixes (pL) xGen 2x Hybridization Buffer 8.5 93.5 xGen Hybridization Buffer Enhancer 2.7 29.7 Ultrapure water 3.8 41.8 Probe 2 22 Total volume 17 187 2) After vortexing to mix well and centrifuging, added 17 uL of Hybridization Master Mix to the dried centrifuge tube (step 2.3.1), fully vortexed to mix well and then microcentrifuged to collect the solution at the bottom of the tube, and let to stand at room temperature for 5-10 min for redissolution. Then transferred all 17 uL of Mix to the pre-prepared 0.2 uL centrifuge tube and placed it in the PCR instrument, and after brief centrifugation, placed it on the PCR instrument to start the HYB program, incubated at 65°C overnight and performed the capture. The reaction system is as follows: Table 15 HYB program (heated lid set to 100°C) 95C 30 s 65C Overnight 65C w 2.3.3 Preparation of wash buffers 1) Prepared the 1x working solutions according to the table below, and no extra was needed. Table 16 Component Buffer (uL) UPDW (uL) xGen 2x Bead Wash Buffer 160 160 xGen 10x Wash Buffer 1 16 144 xGen 10x Wash Buffer 1 (metal bath) 11 99 xGen 10x Wash Buffer 2 16 144 xGen 10x Wash Buffer 3 16 144 xGen 10x Stringent Wash Buffer (metal bath) 32 288 2) In a new 1.5 mL LoBind centrifuge tube, prepared the Bead Resuspension Mix according to the table below. Table 17 Component Vol (pL) xGen 2x Hybridization Buffer 8.5 xGen Hybridization Buffer Enhancer 2.7 Ultrapure water 5.8 Total 17 2.3.4 Washing streptavidin M270 magnetic beads 1) Took out the magnetic beads at least 30 min in advance and equilibrated to room temperature, and then vortexed thoroughly to mix well for about 15 s. 2) According to the number of samples, respectively took 50 uL / pool into a new 1.5 mL centrifuge tube. 3) For each centrifuge tube, added 100 uL / pool of well-mixed 1x Bead Wash Buffer according to the number of CAPs, gently pipetted 10 times to mix well and then let stand on the magnetic rack, and after the solution was completely clear, aspirated and discarded the supernatant (allowed the magnetic beads to separate on the magnetic rack for 1 min). 4) Repeated the previous step 2 times. 5) Added 17 uL / pool of Bead Resuspension Mix to resuspend the magnetic beads, mixed thoroughly. The resuspension solution may be collected to the bottom of the well by microcentrifugation. 6) Aliquoted the above magnetic bead Mix, and put 17 liL per tube into new 0.2 liL centrifuge tubes. 2.3.5 Magnetic bead hybridization 1) At least 15 min in advance, placed 1x Wash Buffer 1 and 1x Stringent Wash Buffer on a 65°C metal bath for heating. 2) After the hybridization reaction was carried out overnight, took the sample out of the PCR instrument, and microcentrifuged the sample. 3) Turned off the HYB program, and turned on the WASH program. 4) transferred all 17 liL of magnetic beads (preheated) into the centrifuge tube for the hybridization reaction, vortexed to mix well, lightly centrifuged, and then placed into the PCR instrument. 5) Incubated for 45 min, and during the incubation process, vortexed to mix well every 12 min, avoiding splashing of the solution as much as possible. Table 18 WASH program (heated lid set to 70oC) 65°C | x 2.3.6 Heated washing 1) After the 45 min incubation was completed, took the sample out of the PCR instrument. 2) transferred 100 liL of preheated 1x Wash Buffer 1 into the sample, pipetted 10 times to mix well, and avoided generating too many bubbles. 3) transferred all of the above Mix to a new 1.5 mL centrifuge tube, let the sample stand on the magnetic rack for about 1 min, and after the solution was completely clear, aspirated and discarded the supernatant. 4) Removed the sample from the magnetic rack, transferred 150 liL of preheated 1x Stringent Wash Buffer into the sample, and pipetted 10 times to mix well. 5) After placing on the metal bath and incubating at 65°C for 5 min, let the sample stand on the magnetic rack, and after the solution was completely clear, aspirated and discarded the supernatant; 6) Repeated steps 4) to 5). 2.3.7 Room-temperature washing 1) Added 150 liL of well-mixed 1x Wash Buffer 1, vortexed to mix well and then incubated for 2 min, during which let stand for 30 s and shook for 30 s, and after brief centrifugation, let stand on the magnetic rack (about 1 min), and after the solution was completely clear, aspirated and discarded the supernatant. 2) Added 150 liL of well-mixed 1x Wash Buffer 2, vortexed to mix well and then incubated for 2 min, during which let stand for 30 s and shook for 30 s, and after brief centrifugation, let stand on the magnetic rack (about 1 min), and after the solution was completely clear, aspirated and discarded the supernatant. 3) Added 150 liL of well-mixed 1x Wash Buffer 3, vortexed to mix well and then incubated for 2 min, during which let stand for 30 s and shook for 30 s, and after brief centrifugation, let stand on the magnetic rack (about 1 min), and after the solution was completely clear, aspirated and discarded the supernatant. 4) After centrifuging again, used a 10 liL pipette tip to aspirate and discarded all residual 1x Wash Buffer 3 liquid. 5) Removed the sample from the magnetic rack, added 20 uL of ultrapure water into each centrifuge tube, pipetted 10 times to mix well and resuspended the magnetic beads, then carefully confirmed the sample number, and transferred all resuspension liquid to a newly labeled 0.2 mL centrifuge tube. 2.3.8 PCR amplification 1) In a new LoBind centrifuge tube, prepared the Amplification Reaction Mix, and when there were multiple samples prepared an extra 20%. Table 19 Component Vol(lL) KAPA HiFi HotStart ReadyMix 25 P7 Primer (SEQ ID NO.426: AATGATACGGCGACCACCGA) (10 qM) 2.5 P5 Primer (SEQ ID NO.427: CAAGCAGAAGACGGCATACGA) (10 qM) 2.5 Total 30 2) Transferred 30 uL of Amplification Reaction Mix to the 0.2 mL centrifuge tube (step 2.3.8), vortexed to mix well, microcentrifuged, and then placed into the PCR instrument and allowed to react according to the following program. Table 20 Reaction temperature Reaction time Number of cycles 98°C 45 s 1 98°C 15 s 10 60C 30 s 72°C 30 s 72°C 1 min 1 4C w 1 2.3.9 Post-PCR purification 1) Prepared 400 liL of fresh 80% ethanol for each sample, and when there were multiple samples, prepared an extra 10%. 2) Dispensed the AMpure XP Beads already equilibrated to room temperature into new 1.5 mL centrifuge tubes, 75 uL each. 3) After carefully checking the numbers, transferred all of the amplification product to the 1.5 mL centrifuge tube containing magnetic beads, vortexed to mix well and microcentrifuged, incubated at room temperature for 5-10 min and then let stand on the magnetic rack, and after the solution was completely clear, aspirated and discarded the supernatant. 4) Added 200 liL of freshly prepared 80% ethanol, let stand for 1 min, and then aspirated and discarded the supernatant. 5) Repeated step 4). 6) Kept the sample on the magnetic rack, and air-dried the magnetic beads for 1-3 min. 7) Added 27 uL of ultrapure water to the centrifuge tube, vortexed thoroughly to mix well and microcentrifuged, incubated at room temperature for 5 min, and placed the centrifuge tube on the magnetic rack. 8) After carefully confirming the sample number, transferred 25 liL of the supernatant to a labeled new 1.5 mL centrifuge tube. 2.4 Sequencing Sequencing of the above 10 samples was performed according to the manufacturer’s instructions for the NovaSeq 6000 (Illumina) sequencing system and NovaSeq 6000 v2 kit. The sequencing data were analyzed by bioinformatics methods, and the detection results are as shown in attached Table 21 and Table 22: Table 21. Detection results for 10 mutant gDNA samples clearly containing known variant types of the 6 genes Sample number Gene Variant information Detection result (negative / positive) Mutation frequency (%) PN1 LPL c.249 + 1G > A Positive 61.52 PN2 LPL c.1160_1161insT (p.Lys387fs) Positive 50.84 PN3 APOC2 c.189C > A (p.Tyr63Ter) Positive 33.04 PN4 LMF1 c.895C > T (p.Gln299Ter) Positive 45.99 PN5 GPIHBP1 c.422G > A (p.Trp141Ter) Positive 28.36 PN6 GPIHBP1 c.417_433del (p.Pro140fs) Positive 42.82 PN7 APOA5 c.289C > T (p.Gln97Ter) Positive 59.61 PN8 APOA5 c.990_993del (p.Asp332fs) Positive 56.64 PN9 GPD1 c.219 + 1_219 + 3del Positive 48.15 PN10 GPD1 c.751dup (p.Thr251fs) Positive 47.30 Table 22. Detection results for 10 wild-type gDNA samples not containing any variant type of the 6 genes Sample number Detection result (negative / positive) N1 Negative N2 Negative N3 Negative N4 Negative N5 Negative N6 Negative N7 Negative N8 Negative N9 Negative N10 Negative From the above data, it can be seen that the method of this example showed 100% sensitivity and 100% specificity for detecting variants in the 6 characteristic FCS genes (LPL, APOC2, LMF1, GPIHBP1, APOA5, and GPD1). It has extremely high detection accuracy. Overall, the embodiments of the present application, through a capture sequencing method, designed target capture probes covering all exons and hotspot intronic regions of 6 FCS-related genes (LPL, APOC2, LMF1, GPIHBP1, APOA5, and GPD1), and through detection of the variant types of the above 6 genes closely related to FCS, achieved precise detection of FCS, which is of great significance to the clinical diagnosis and treatment of FCS. The technical features of the above-described embodiments and examples may be combined in any suitable manner, and for simplicity of description, not all possible combinations of the technical features in the above embodiments and examples have been described; however, as long as the combinations of these technical features are not contradictory, they shall all be considered to fall within the scope described in this specification. The above-described examples merely illustrate several embodiments of the present invention, to facilitate concrete and detailed understanding of the technical solution of the present invention, but this shall not therefore be understood as a limitation on the scope of patent protection of the invention. It should be pointed out that, for a person of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements may also be made, and these all belong to the protection scope of the present invention. In addition, it should be understood that, after reading the above disclosure of the present invention, a person skilled in the art may make various changes or modifications to the present invention, and any equivalent forms obtained in a similar way fall within the protection scope of the present application. It should also be understood that technical solutions obtained by a person skilled in the art based on the technical solution provided by the present invention, through logical analysis, reasoning, or limited experiments, are all within the protection scope of the claims appended to the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the content of the appended claims, and the specification may be used to interpret the content of the claims.
Claims
1. A capture probe, which comprises one or more probe sets from a probe set 1 to a probe set 6;probe set 1 comprises one or more probes selected from probes 1 to 26;probe set 2 comprises one or more probes selected from probes 27 to 64;probe set 3 comprises one or more probes selected from probes 65 to 112;probe set 4 comprises one or more probes selected from probes 113 to 139;probe set 5 comprises one or more probes selected from probes 140 to 382;probe set 6 comprises one or more probes selected from probes 383 to 425;the probes 1 to 425 are constructed for target gene fragments located between different start positions and end positions on the following chromosomes and are complementary to and paired with said target gene fragments:Probe number Chromosome Start position End position Probe 1 chr11 116660063 116660183; Probe 2 chr11 116660168 116660288; Probe 3 chr11 116660273 116660393; Probe 4 chr11 116660378 116660498; Probe 5 chr11 116660483 116660603; Probe 6 chr11 116660588 116660708; Probe 7 chr11 116660693 116660813; Probe 8 chr11 116660798 116660918; Probe 9 chr11 116660903 116661023; Probe 10 chr11 116661008 116661128; Probe 11 chr11 116661113 116661233; Probe 12 chr11 116661218 116661338; Probe 13 chr11 116661323 116661443; Probe 14 chr11 116661428 116661548; Probe 15 chr11 116661533 116661653; Probe 16 chr11 116661638 116661758; Probe 17 chr11 116661743 116661863; Probe 18 chr11 116662282 116662402; Probe 19 chr11 116662387 116662507; Probe 20 chr11 116662508 116662628; Probe 21 chr11 116663076 116663196; Probe 22 chr11 116663181 116663301; Probe 23 chr11 116663286 116663406; Probe 24 chr11 116663391 116663511; Probe 25 chr11 116663496 116663616; Probe 26 chr11 116663601 116663721; Probe 27 chr12 50497271 50497391; Probe 28 chr12 50497376 50497496; Probe 29 chr12 50497481 50497601; Probe 30 chr12 50497586 50497706; Probe 31 chr12 50497691 50497811; Probe 32 chr12 50497796 50497916; Probe 33 chr12 50498337 50498457; Probe 34 chr12 50498442 50498562; Probe 35 chr12 50499311 50499431; Probe 36 chr12 50499416 50499536;Probe 37 chr12 50500051 50500171; Probe 38 chr12 50500156 50500276; Probe 39 chr12 50500568 50500688; Probe 40 chr12 50500673 50500793; Probe 41 chr12 50501330 50501450; Probe 42 chr12 50501435 50501555; Probe 43 chr12 50501540 50501660; Probe 44 chr12 50501787 50501907; Probe 45 chr12 50501892 50502012; Probe 46 chr12 50503186 50503306; Probe 47 chr12 50503291 50503411; Probe 48 chr12 50503396 50503516; Probe 49 chr12 50503501 50503621; Probe 50 chr12 50503606 50503726; Probe 51 chr12 50503711 50503831; Probe 52 chr12 50503816 50503936; Probe 53 chr12 50503921 50504041; Probe 54 chr12 50504026 50504146; Probe 55 chr12 50504131 50504251; Probe 56 chr12 50504236 50504356; Probe 57 chr12 50504341 50504461; Probe 58 chr12 50504446 50504566; Probe 59 chr12 50504551 50504671; Probe 60 chr12 50504656 50504776; Probe 61 chr12 50504761 50504881; Probe 62 chr12 50504866 50504986; Probe 63 chr12 50504971 50505091; Probe 64 chr12 50505076 50505196; Probe 65 chr16 903614 903734; Probe 66 chr16 903719 903839; Probe 67 chr16 903824 903944; Probe 68 chr16 903929 904049; Probe 69 chr16 904034 904154; Probe 70 chr16 904139 904259; Probe 71 chr16 904244 904364; Probe 72 chr16 904349 904469; Probe 73 chr16 904454 904574; Probe 74 chr16 904559 904679; Probe 75 chr16 904664 904784; Probe 76 chr16 905087 905207; Probe 77 chr16 905192 905312; Probe 78 chr16 918924 919044; Probe 79 chr16 919029 919149; Probe 80 chr16 919863 919983; Probe 81 chr16 919968 920088; Probe 82 chr16 920709 920829; Probe 83 chr16 920814 920934; Probe 84 chr16 921141 921261; Probe 85 chr16 921246 921366; Probe 86 chr16 929550 929670; Probe 87 chr16 929655 929775;Probe 88 chr16 942987 943107; Probe 89 chr16 960911 961031; Probe 90 chr16 961016 961136; Probe 91 chr16 981622 981742; Probe 92 chr16 981727 981847; Probe 93 chr16 983971 984091; Probe 94 chr16 984076 984196; Probe 95 chr16 984170 984290; Probe 96 chr16 1004337 1004457; Probe 97 chr16 1004442 1004562; Probe 98 chr16 1004547 1004667; Probe 99 chr16 1004652 1004772; Probe 100 chr16 1020768 1020888; Probe 101 chr16 1020873 1020993; Probe 102 chr16 1020978 1021098; Probe 103 chr16 1031125 1031245; Probe 104 chr16 1031230 1031350; Probe 105 chr16 1031335 1031455; Probe 106 chr16 1031440 1031560; Probe 107 chr16 1031545 1031665; Probe 108 chr16 1031650 1031770; Probe 109 chr16 1031755 1031875; Probe 110 chr16 1031860 1031980; Probe 111 chr16 1031965 1032085; Probe 112 chr16 1032070 1032190; Probe 113 chr19 45448788 45448908; Probe 114 chr19 45448893 45449013; Probe 115 chr19 45448998 45449118; Probe 116 chr19 45449103 45449223; Probe 117 chr19 45449208 45449328; Probe 118 chr19 45449313 45449433; Probe 119 chr19 45449418 45449538; Probe 120 chr19 45449628 45449748; Probe 121 chr19 45449733 45449853; Probe 122 chr19 45450048 45450168; Probe 123 chr19 45450363 45450483; Probe 124 chr19 45450468 45450588; Probe 125 chr19 45450573 45450693; Probe 126 chr19 45450678 45450798; Probe 127 chr19 45451518 45451638; Probe 128 chr19 45451623 45451743; Probe 129 chr19 45451728 45451848; Probe 130 chr19 45451833 45451953; Probe 131 chr19 45451938 45452058; Probe 132 chr19 45452043 45452163; Probe 133 chr19 45452148 45452268; Probe 134 chr19 45452253 45452373; Probe 135 chr19 45452358 45452478; Probe 136 chr19 45452463 45452583; Probe 137 chr19 45452568 45452688; Probe 138 chr19 45452673 45452793;Probe 139 chr19 45452778 45452898; Probe 140 chr8 19796244 19796364; Probe 141 chr8 19796349 19796469; Probe 142 chr8 19796454 19796574; Probe 143 chr8 19796559 19796679; Probe 144 chr8 19796664 19796784; Probe 145 chr8 19796769 19796889; Probe 146 chr8 19796874 19796994; Probe 147 chr8 19796979 19797099; Probe 148 chr8 19797084 19797204; Probe 149 chr8 19797189 19797309; Probe 150 chr8 19797294 19797414; Probe 151 chr8 19797399 19797519; Probe 152 chr8 19797504 19797624; Probe 153 chr8 19797609 19797729; Probe 154 chr8 19797714 19797834; Probe 155 chr8 19797819 19797939; Probe 156 chr8 19797924 19798044; Probe 157 chr8 19798029 19798149; Probe 158 chr8 19798134 19798254; Probe 159 chr8 19798239 19798359; Probe 160 chr8 19798344 19798464; Probe 161 chr8 19798449 19798569; Probe 162 chr8 19798554 19798674; Probe 163 chr8 19798659 19798779; Probe 164 chr8 19798764 19798884; Probe 165 chr8 19798869 19798989; Probe 166 chr8 19798974 19799094; Probe 167 chr8 19799079 19799199; Probe 168 chr8 19799184 19799304; Probe 169 chr8 19799289 19799409; Probe 170 chr8 19799394 19799514; Probe 171 chr8 19799499 19799619; Probe 172 chr8 19799604 19799724; Probe 173 chr8 19799709 19799829; Probe 174 chr8 19799814 19799934; Probe 175 chr8 19799919 19800039; Probe 176 chr8 19800024 19800144; Probe 177 chr8 19800129 19800249; Probe 178 chr8 19800234 19800354; Probe 179 chr8 19800339 19800459; Probe 180 chr8 19800444 19800564; Probe 181 chr8 19800549 19800669; Probe 182 chr8 19800654 19800774; Probe 183 chr8 19800759 19800879; Probe 184 chr8 19800864 19800984; Probe 185 chr8 19800969 19801089; Probe 186 chr8 19801074 19801194; Probe 187 chr8 19801179 19801299; Probe 188 chr8 19801284 19801404; Probe 189 chr8 19801704 19801824;Probe 190 chr8 19801809 19801929; Probe 191 chr8 19801914 19802034; Probe 192 chr8 19802019 19802139; Probe 193 chr8 19802124 19802244; Probe 194 chr8 19802229 19802349; Probe 195 chr8 19802334 19802454; Probe 196 chr8 19802439 19802559; Probe 197 chr8 19802544 19802664; Probe 198 chr8 19802649 19802769; Probe 199 chr8 19802754 19802874; Probe 200 chr8 19802859 19802979; Probe 201 chr8 19802964 19803084; Probe 202 chr8 19803069 19803189; Probe 203 chr8 19803174 19803294; Probe 204 chr8 19803279 19803399; Probe 205 chr8 19803384 19803504; Probe 206 chr8 19803489 19803609; Probe 207 chr8 19803594 19803714; Probe 208 chr8 19803699 19803819; Probe 209 chr8 19803804 19803924; Probe 210 chr8 19803909 19804029; Probe 211 chr8 19804014 19804134; Probe 212 chr8 19804119 19804239; Probe 213 chr8 19804224 19804344; Probe 214 chr8 19804329 19804449; Probe 215 chr8 19804434 19804554; Probe 216 chr8 19804539 19804659; Probe 217 chr8 19804644 19804764; Probe 218 chr8 19805064 19805184; Probe 219 chr8 19805169 19805289; Probe 220 chr8 19805274 19805394; Probe 221 chr8 19805379 19805499; Probe 222 chr8 19805484 19805604; Probe 223 chr8 19805589 19805709; Probe 224 chr8 19805694 19805814; Probe 225 chr8 19805799 19805919; Probe 226 chr8 19805904 19806024; Probe 227 chr8 19806009 19806129; Probe 228 chr8 19806114 19806234; Probe 229 chr8 19806219 19806339; Probe 230 chr8 19806324 19806444; Probe 231 chr8 19806429 19806549; Probe 232 chr8 19806534 19806654; Probe 233 chr8 19806639 19806759; Probe 234 chr8 19806744 19806864; Probe 235 chr8 19806849 19806969; Probe 236 chr8 19807269 19807389; Probe 237 chr8 19807374 19807494; Probe 238 chr8 19807479 19807599; Probe 239 chr8 19807584 19807704; Probe 240 chr8 19807689 19807809;Probe 241 chr8 19807794 19807914; Probe 242 chr8 19807899 19808019; Probe 243 chr8 19808319 19808439; Probe 244 chr8 19808424 19808544; Probe 245 chr8 19808529 19808649; Probe 246 chr8 19808634 19808754; Probe 247 chr8 19808739 19808859; Probe 248 chr8 19808844 19808964; Probe 249 chr8 19808949 19809069; Probe 250 chr8 19809054 19809174; Probe 251 chr8 19809159 19809279; Probe 252 chr8 19809264 19809384; Probe 253 chr8 19809369 19809489; Probe 254 chr8 19809474 19809594; Probe 255 chr8 19809579 19809699; Probe 256 chr8 19809684 19809804; Probe 257 chr8 19809789 19809909; Probe 258 chr8 19809894 19810014; Probe 259 chr8 19809999 19810119; Probe 260 chr8 19810104 19810224; Probe 261 chr8 19810209 19810329; Probe 262 chr8 19810314 19810434; Probe 263 chr8 19810419 19810539; Probe 264 chr8 19810524 19810644; Probe 265 chr8 19810629 19810749; Probe 266 chr8 19810734 19810854; Probe 267 chr8 19810839 19810959; Probe 268 chr8 19810944 19811064; Probe 269 chr8 19811049 19811169; Probe 270 chr8 19811154 19811274; Probe 271 chr8 19811259 19811379; Probe 272 chr8 19811364 19811484; Probe 273 chr8 19811469 19811589; Probe 274 chr8 19811574 19811694; Probe 275 chr8 19811679 19811799; Probe 276 chr8 19811784 19811904; Probe 277 chr8 19811889 19812009; Probe 278 chr8 19811994 19812114; Probe 279 chr8 19812099 19812219; Probe 280 chr8 19812204 19812324; Probe 281 chr8 19812309 19812429; Probe 282 chr8 19812519 19812639; Probe 283 chr8 19812624 19812744; Probe 284 chr8 19812729 19812849; Probe 285 chr8 19812834 19812954; Probe 286 chr8 19812939 19813059; Probe 287 chr8 19813044 19813164; Probe 288 chr8 19813149 19813269; Probe 289 chr8 19813254 19813374; Probe 290 chr8 19813359 19813479; Probe 291 chr8 19813464 19813584;Probe 292 chr8 19813569 19813689; Probe 293 chr8 19813674 19813794; Probe 294 chr8 19813779 19813899; Probe 295 chr8 19813884 19814004; Probe 296 chr8 19814094 19814214; Probe 297 chr8 19814199 19814319; Probe 298 chr8 19814304 19814424; Probe 299 chr8 19814619 19814739; Probe 300 chr8 19814724 19814844; Probe 301 chr8 19814829 19814949; Probe 302 chr8 19814934 19815054; Probe 303 chr8 19815039 19815159; Probe 304 chr8 19815144 19815264; Probe 305 chr8 19815249 19815369; Probe 306 chr8 19815354 19815474; Probe 307 chr8 19815459 19815579; Probe 308 chr8 19815774 19815894; Probe 309 chr8 19815879 19815999; Probe 310 chr8 19815984 19816104; Probe 311 chr8 19816194 19816314; Probe 312 chr8 19816299 19816419; Probe 313 chr8 19816404 19816524; Probe 314 chr8 19816509 19816629; Probe 315 chr8 19816614 19816734; Probe 316 chr8 19816719 19816839; Probe 317 chr8 19816824 19816944; Probe 318 chr8 19816929 19817049; Probe 319 chr8 19817034 19817154; Probe 320 chr8 19817139 19817259; Probe 321 chr8 19817559 19817679; Probe 322 chr8 19817664 19817784; Probe 323 chr8 19817769 19817889; Probe 324 chr8 19817874 19817994; Probe 325 chr8 19817979 19818099; Probe 326 chr8 19818084 19818204; Probe 327 chr8 19818189 19818309; Probe 328 chr8 19818294 19818414; Probe 329 chr8 19818399 19818519; Probe 330 chr8 19818504 19818624; Probe 331 chr8 19818609 19818729; Probe 332 chr8 19818714 19818834; Probe 333 chr8 19818819 19818939; Probe 334 chr8 19818924 19819044; Probe 335 chr8 19819029 19819149; Probe 336 chr8 19819134 19819254; Probe 337 chr8 19819239 19819359; Probe 338 chr8 19819344 19819464; Probe 339 chr8 19819449 19819569; Probe 340 chr8 19819554 19819674; Probe 341 chr8 19819659 19819779; Probe 342 chr8 19819764 19819884;Probe 343 chr8 19819869 19819989; Probe 344 chr8 19819974 19820094; Probe 345 chr8 19820079 19820199; Probe 346 chr8 19820184 19820304; Probe 347 chr8 19820289 19820409; Probe 348 chr8 19820394 19820514; Probe 349 chr8 19820499 19820619; Probe 350 chr8 19820604 19820724; Probe 351 chr8 19820919 19821039; Probe 352 chr8 19821024 19821144; Probe 353 chr8 19821129 19821249; Probe 354 chr8 19821234 19821354; Probe 355 chr8 19821339 19821459; Probe 356 chr8 19821759 19821879; Probe 357 chr8 19821864 19821984; Probe 358 chr8 19821969 19822089; Probe 359 chr8 19822284 19822404; Probe 360 chr8 19822389 19822509; Probe 361 chr8 19822494 19822614; Probe 362 chr8 19822599 19822719; Probe 363 chr8 19822704 19822824; Probe 364 chr8 19822809 19822929; Probe 365 chr8 19822914 19823034; Probe 366 chr8 19823019 19823139; Probe 367 chr8 19823124 19823244; Probe 368 chr8 19823229 19823349; Probe 369 chr8 19823334 19823454; Probe 370 chr8 19823439 19823559; Probe 371 chr8 19823544 19823664; Probe 372 chr8 19823649 19823769; Probe 373 chr8 19823754 19823874; Probe 374 chr8 19823859 19823979; Probe 375 chr8 19823964 19824084; Probe 376 chr8 19824069 19824189; Probe 377 chr8 19824174 19824294; Probe 378 chr8 19824279 19824399; Probe 379 chr8 19824384 19824504; Probe 380 chr8 19824489 19824609; Probe 381 chr8 19824594 19824714; Probe 382 chr8 19824699 19824819; Probe 383 chr8 144294573 144294693; Probe 384 chr8 144294678 144294798; Probe 385 chr8 144294783 144294903; Probe 386 chr8 144294888 144295008; Probe 387 chr8 144294993 144295113; Probe 388 chr8 144295098 144295218; Probe 389 chr8 144295203 144295323; Probe 390 chr8 144295308 144295428; Probe 391 chr8 144295413 144295533; Probe 392 chr8 144295518 144295638; Probe 393 chr8 144295623 144295743;Probe 394 chr8 144295728 144295848; Probe 395 chr8 144295833 144295953; Probe 396 chr8 144295938 144296058; Probe 397 chr8 144296043 144296163; Probe 398 chr8 144296148 144296268; Probe 399 chr8 144296253 144296373; Probe 400 chr8 144296358 144296478; Probe 401 chr8 144296463 144296583; Probe 402 chr8 144296568 144296688; Probe 403 chr8 144296673 144296793; Probe 404 chr8 144296778 144296898; Probe 405 chr8 144296883 144297003; Probe 406 chr8 144296988 144297108; Probe 407 chr8 144297093 144297213; Probe 408 chr8 144297198 144297318; Probe 409 chr8 144297303 144297423; Probe 410 chr8 144297408 144297528; Probe 411 chr8 144297513 144297633; Probe 412 chr8 144297618 144297738; Probe 413 chr8 144297723 144297843; Probe 414 chr8 144297828 144297948; Probe 415 chr8 144297933 144298053; Probe 416 chr8 144298038 144298158; Probe 417 chr8 144298143 144298263; Probe 418 chr8 144298248 144298368; Probe 419 chr8 144298353 144298473; Probe 420 chr8 144298458 144298578; Probe 421 chr8 144298563 144298683; Probe 422 chr8 144298668 144298788; Probe 423 chr8 144298773 144298893; Probe 424 chr8 144298878 144298998; Probe 425 chr8 144298983 144299103; the reference genome is Hg19.
2. The capture probe according to claim 1, which comprises a plurality of probe sets selected from a probe set 1 to a probe set 6;the probe set 1 comprises a plurality of probes selected from the probes 1 to 26;the probe set 2 comprises a plurality of probes selected from the probes 27 to 64;the probe set 3 comprises a plurality of probes selected from the probes 65 to 112;the probe set 4 comprises a plurality of probes selected from the probes 113 to 139;the probe set 5 comprises a plurality of probes selected from the probes 140 to 382;the probe set 6 comprises a plurality of probes selected from the probes 383 to 425.
3. The capture probe according to claim 2, which comprises the probe set 1 to the probe set 6;the probe set 1 comprises the probes 1 to 26;the probe set 2 comprises the probes 27 to 64;the probe set 3 comprises the probes 65 to 112;the probe set 4 comprises the probes 113 to 139;the probe set 5 comprises the probes 140 to 382;the probe set 6 comprises the probes 383 to 425.
4. Use of the capture probe according to any one of claims 1 to 3 in preparing a familial chylomicronemia syndrome detection kit.
5. A familial chylomicronemia syndrome detection kit, which comprises the capture probe according to any one of claims 1 to 3.
6. The familial chylomicronemia syndrome detection kit according to claim 5, which further comprises one or more of a nucleic acid extraction reagent, a DNA library construction reagent, a sample and library quantification reagent, a fragment quality control reagent, a hybridization capture reagent, a nucleic acid purification reagent, a target gene fragment amplification reagent, and a sequencing reagent.
7. Use of the capture probe according to any one of claims 1 to 3 in constructing a familial chylomicronemia syndrome-related gene mutation detection library.
8. Use of the detection kit according to claim 5 or 6 in constructing a familial chylomicronemia syndrome-related gene mutation detection library.
9. A method for detecting a familial chylomicronemia syndrome-related gene mutation, which comprises a step of using the capture probe according to any one of claims 1 to 3 or the detection kit according to claim 5 or 6 to capture a target gene fragment containing a familial chylomicronemia syndrome-related gene mutation, and a step of detecting the captured fragment.
10. The method for detecting a familial chylomicronemia syndrome-related gene mutation according to claim 9, wherein the captured fragment is detected by using a sequencing method.