RECOMBINANT MULTIVALENT SPV
Doubly defective rSPVs with deleted IL18bp and TK or ARP genes address inefficiencies in existing rSPVs by enabling stable and enhanced gene expression, suitable for producing vaccines against PCV2 in swine.
Patent Information
- Application Number
- BR112018075585
- Authority / Receiving Office
- BR · BR
- Patent Type
- Patents
- Current Assignee / Owner
- Priority Date
- 2016-06-10
- Filing Date
- 2017-06-09
- Publication Date
- 2026-07-14
- Estimated Expiration
- 2037-06-09
AI Technical Summary
Existing recombinant swinepox viruses (rSPVs) primarily rely on non-essential genetic regions for exogenous sequence cloning, leading to inefficiencies in expression and stability, and there is a need for improved viral vectors that can effectively express recombinant proteins or peptides in vivo.
Development of doubly defective rSPVs with deleted IL18bp and TK or ARP genes, allowing stable expression of exogenous genetic sequences, which are highly attenuated and can be propagated in culture.
The doubly defective rSPVs provide prolonged and effective gene expression, generating enhanced immune responses and are suitable for producing vaccines, particularly against PCV2 infection in swine.
Smart Images

Figure 00000056_0000 
Figure 00000057_0000 
Figure 00000058_0000
Abstract
Description
1 / 51 SPV Recombinant Multivalent
[0001] The present invention relates to innovative recombinant swinepox viruses and their use in vaccine compositions. The recombinant swinepox viruses of the invention are doubly defective and allow the effective expression of one or more exogenous genetic sequences in vivo. The invention is particularly suitable for producing vaccines for swine, particularly for vaccinating swine against PCV2 infection. Background
[0002] Different types of viruses have been proposed in the technique as vectors for gene delivery or peptide expression in vivo. In particular, veterinary vaccines expressing at least one relevant antigen have been prepared using recombinant viruses such as poxviruses (Ogawa R. et al., Vaccine, 8:486-490 (1990)), adenoviruses (HSU, KH et al., Vaccine, 12; 607-612 (1994)), baculoviruses, as well as herpesviruses (Shin, M.-F. et al., Proc. Natl. Acad. Sci. USA, 81:5867-5870 (1984)). Examples of specific viral vectors that allow the expression of a gene for an exogenous antigen include Aujeszky's disease virus (pseudorabies virus; PRV) (Van Zijl M. et al., J. Virol., 65:2761-2765 (1991)), Peruvian herpesvirus (HVT) (Morgan RW et al., Avian Dis. 36:858-870 (1992)), and Marek's disease virus (MDV). Recombinant vectors based on the herpesvirus genus are under intensive study.
[0003] There is therefore a need in the field for innovative viral vector products that can be used Petition 870180160870, dated 10 / 12 / 2018, page 10 / 77 2 / 51 to express recombinant proteins or peptides in vivo. In this sense, poxviruses have been manipulated to encode different polypeptides. Poxviruses, after being released into the bloodstream from infected cells, can infect other cells and thus potentially lead to high levels of expression. Recombinant poxviruses have been produced from different types of poxviruses, including cowpox virus, vaccinia virus, and swinepox virus (SPV). To date, however, SPV recombinants have been produced essentially by cloning exogenous genetic sequences in a genetic region that is considered non-essential for SPV survival, the TK region (Richard W. Moyer, Eladio Vinuela, EPJ Gibbs, US5,651,972 (1997)).
[0004] The applicant's document PCT / EP2015 / 080468 describes the genetic sequence of the IL18 binding protein (IL18bp) as a novel and highly advantageous cloning site in SPV.
[0005] Continuing the research, the inventors of the present invention have now found that doubly defective SPVs, in which both the IL18bp gene and at least the TK or ARP gene are defective, allow effective and stable expression of various exogenous genetic sequences in vivo, can be effectively propagated in culture, and are highly attenuated in vivo. These doubly defective SPVs therefore exhibit improved properties and can be used to produce therapeutic agents or vaccines for the treatment of any mammal, particularly swine. Petition 870180160870, dated 10 / 12 / 2018, p. 11 / 77 3 / 51 Summary of the invention
[0006] The present invention relates to innovative recombinant swinepox viruses and their use for gene delivery and in vivo expression, particularly in vaccine compositions. The recombinant swinepox viruses of the invention are doubly defective for both the IL18bp gene and the TK and / or ARP gene. Preferably, the SPVs of the invention contain one or more exogenous genetic sequences, preferably cloned into the defective TK, ARP, or IL18bp gene regions of the swinepox virus. The invention is particularly suitable for producing vaccines for swine, particularly for vaccinating swine against PCV2 infection.
[0007] A first object of the present invention relates, therefore, to a recombinant swinepox virus (rSPV) having at least one first and one second defective viral gene, wherein the first defective viral gene is the IL18bp gene and the second defective viral gene is the Thymidine Kinase (TK) or Ankyrin Repeat Protein (ARP) gene.
[0008] In a particular embodiment, the invention provides a recombinant swinepox virus (SPV) comprising a defective IL18bp gene and a defective TK gene.
[0009] In another particular embodiment, the invention provides a recombinant swinepox virus (SPV) comprising a defective IL18bp gene and a defective ARP gene.
[0010] Preferably, rSPV comprises a deletion of at least 50 bp, at least 100 bp, at least 200 bp, or at least 300 bp in each of the target sequences. Petition 870180160870, dated 10 / 12 / 2018, p. 12 / 77 4 / 51 defective viral genetics. Furthermore, in a preferred embodiment, the rSPV additionally comprises at least one first exogenous genetic sequence, which can be placed anywhere in the rSPV, preferably replacing all or part of the deleted viral genetic sequence. In a particular embodiment, the rSPV of the invention comprises two exogenous genetic sequences, a first one inserted in place of the deleted viral IL18bp gene sequence and a second one inserted in place of the deleted viral TK or ARP gene sequence.
[0011] A further objective of the invention lies in a nucleic acid molecule comprising the genome of an rSPV as defined above.
[0012] A further object of the invention is a host cell comprising an rSPV or a nucleic acid molecule of the invention.
[0013] The present invention further provides a method for producing an rSPV comprising infecting or introducing into a competent cell a nucleic acid molecule as defined above and collecting the rSPV.
[0014] The invention also relates to a method for propagating an rSPV comprising infecting a competent cell with an rSPV as defined above and collecting the SPV produced by said cells.
[0015] The invention also relates to a composition, preferably a veterinary composition, comprising an rSPV as defined above, or a cell as defined above, or a nucleic acid molecule as defined above, and an excipient.
[0016] An additional objective of the invention is a Petition 870180160870, dated 10 / 12 / 2018, page 13 / 77 5 / 51 vaccine composition comprising an rSPV as defined above, or a cell as defined above, or a nucleic acid molecule as defined above, a suitable excipient and, optionally, an adjuvant.
[0017] The invention also relates to an rSPV or nucleic acid cell or molecule as defined above for use in delivering a therapeutic agent or peptide or protein vaccination to a pig.
[0018] The invention also relates to an rSPV or nucleic acid cell or molecule as defined above for use in immunizing or vaccinating a mammal, preferably a pig, against a pathogen.
[0019] The invention also relates to a method for vaccinating a mammal, preferably a pig, against a pathogen, comprising administering to the mammal an rSPV or nucleic acid cell or molecule as defined above.
[0020] The invention also relates to a vaccination kit for immunizing a pig comprising the following components: a. an effective amount of an rSPV or vaccine as defined above, and b. a means for administering said rSPV or vaccine to said pig.
[0021] The invention can be used to deliver and express any exogenous genetic sequence to a mammal, particularly a pig. This is particularly suitable for the expression of exogenous antigens to immunize or vaccinate pigs (e.g., pigs, piglets, sows). Petition 870180160870, dated 10 / 12 / 2018, page 14 / 77 6 / 51 Caption for the figures
[0022] Fig.1. Construction scheme of the intermediate plasmid, pSP91
[0023] Fig. 2. Construction scheme of homologous plasmids, pSP91 l-Ess_ORF2cc and pSP911-ORF2cc
[0024] Fig. 3. Construction scheme of the homologous plasmid, pSP53-ORF2
[0025] Fig. 4. Construction scheme of the homologous plasmid, pSP72-ORF2
[0026] Fig. 5. Illustration of genome structures of Recombinant SPVs
[0027] Fig.6. In vitro PCR verification of SVR14 and SVR15 passage. (A) PCR Results. PCR was conducted using a primer set of SP7450F and SP8552R. Each template was an in vitro passage viral DNA +0 or +15p of SVR14 and SVR15. Each transfection-transfer plasmid to produce SVR12, SVR14, or SVR15 and pCR4SPV6030 / 9574 was used for a positive control (PC) or negative control (NC) template, respectively. Molecular weight markers were 10kb (Ml) and pHY. (B) Illustration of the IL-18bp gene franchisor region of origin and rSPVs, SVR14 and SVR15. The yellow box is the IL-18bp gene.
[0028] Fig. 7. Performing a western blot of purified rSPVs. ESK-4 cells were infected with wild-type SPV (wt), SVR14 (14) or SVR15 (15). After six days, cell lysates were subjected to 15% SDS-PAGE and western blot analysis using anti-mouse ORF2 (1:500), biotin-conjugated goat anti-mouse secondary IgG. Petition 870180160870, dated 10 / 12 / 2018, p. 15 / 77 7 / 51 (1:1000) and ABC-ALP (Vecterstain). M: Molecular weight marker.
[0029] Fig 8. In vitro PCR verification of SVR16 and 17 passage. (A) PCR Results. PCR was conducted using a primer set of P05-8 and P05-9. Each template was viral DNA from in vitro passages of SVR16 and 17 (+0p and +15p). The transfer plasmids, pSP53-ORF2 and pNZSP5 (described in Experiment 3 and Figure 3 of document JP2003-111591A) were used as positive control (PC) and negative control (NC) templates, respectively. Molecular weight markers were 10kb (M1) and λHindIII (M2). (B) Illustration of the franchising region of origin of ARP genes and rSPVs, SVR16 and SVR17. [00 30] Fig. 9. In vitro passage verification by PCR of SVR20. (A) PCR Results. PCR was conducted using two sets of primers: (a) SP7450F and SP8552R, and (b) SP55500F and SP56363R. Each template was each viral DNA of SVR20 +0p or +15p. Each plasmid, pCR4-SPV6030 / 9574 (N1) or pCR4-SPV54242 / 57617 (N2), and pSP91l-ORF2cc (P1) or pSP72ORF2 (P2), was used as a template for negative and positive controls. PCR products of (a) or (b) were set on 2% or 0.8% agarose gels, respectively. Molecular weight markers were 10kb (M1) and pHY (M2). (B) Illustration of gene franchising region TK from SPV and SVR20 wild type. The yellow box represents the TK gene.
[0031] Fig. 10. Performing a western blot of purified rSPVs. Petition 870180160870, dated 10 / 12 / 2018, p. 16 / 77 8 / 51 ESK-4 cells were infected with wild-type SPV (wt), SVR14 (14), SVR15 (15), SVR16 (16), SVR17 (17) or SVR20 (20) at an MOI of 0.1. After six days, cell lysates were applied to 15% SDS-PAGE and western blot analysis using anti-mouse ORF2 (1:500), biotin-conjugated goat anti-mouse secondary IgG (1:1000) and ABC-ALP (Vecterstain). M: Molecular weight marker.
[0032] Fig. 11. Transition of redness sizes at injection sites in pigs. Detailed description of the invention
[0033] The present invention relates to innovative recombinant swinepox viruses and their uses. The recombinant swinepox viruses of the invention are doubly defective for the IL18bp gene and for a second gene selected from the TK and ARP genes of the swinepox virus, and preferentially contain one or more exogenous genetic sequences. As shown in the experimental section, such doubly defective SPV vectors allow for prolonged and effective gene expression. Furthermore, the rSPVs of the invention are stable and can produce enhanced immune responses in vivo. In addition, these SPV vectors of the invention are highly attenuated. This is the first report of a doubly defective SPV virus and the first demonstration that such SPVs can express exogenous genetic sequences, resulting in stable, immunogenic, and highly productive recombinant SPV vectors.The rSPV of the invention may contain more than one exogenous genetic sequence, and it may be used alone or in combination with other viruses or antigens. Petition 870180160870, dated 10 / 12 / 2018, page 17 / 77 9 / 51 recombinants to generate improved vaccines. The invention is particularly suitable for producing vaccines for swine, particularly for vaccinating swine against PCV2 infection. rSPVs
[0034] In the context of the invention, a recombinant swinepox virus generally means a swinepox virus that has an artificially (e.g., recombinantly) modified genome. rSPV includes, in particular, swinepox viruses containing exogenous genetic material or sequences in their genome. rSPV typically comprises an SPV genome containing an exogenous genetic sequence, enclosed within an SPV capsid or envelope, which may also contain an exogenous peptide or protein.
[0035] The rSPV of the present invention can be prepared starting with any SPV, such as any naturally occurring SPV or any available SPVs from collections such as ATCC, CNCM, etc. Preferably, the rSPVs of the invention are produced from the kasza strain of SPV (VR-363), isolate 17077-99 (GeneBank Ace: AF410153.1), or strain VTCC / AVA / 121 (GeneBank Ace: KJ725378.1). Such SPVs are available from collections or libraries or can be cloned from their publicly available genomic sequences. Additionally, SPV isolates can also be isolated from infected animals and used to prepare the rSPV of the invention.
[0036] SPV or rSPV can be grown, maintained, or propagated in any suitable cell. For example, SPVs can be grown, maintained, or propagated in cells Petition 870180160870, dated 10 / 12 / 2018, p. 18 / 77 10 / 51 porcine kidney embryonic cells, as ESK-4 (CL-184) cells, routinely cultured at 37 °C in 5% CO2 in Ham medium. F-12K (Gibco, Catalog No.: 21127-022) supplemented with 1% streptomycin-penicillin (Gibco, Catalog No.: 15140-122) and FBS at 5% (Gibco, Catalog No.: 10437-028).
[0037] In order to construct a recombinant virus of the present invention, initially, the SPV virus can be propagated in a suitable host cell and then the genomic DNA obtained. Subsequently, the IL18bp, TK and / or ARP regions of the genomic DNA are identified and made defective (e.g., deleted, totally or partially). Subsequently, or simultaneously, an exogenous genetic sequence (or a cloning site that allows the insertion of an exogenous genetic sequence) can be inserted into the genomic DNA, optionally in place of the deleted endogenous genetic sequence. The recombinant SPV genome obtained in this way can be used to produce rSPV by transformation of suitable competent cells according to conventional techniques. Alternatively, a transfer vector can be produced containing an exogenous genetic sequence (or a cloning site) flanked by sequences homologous to the IL18bp, TK and / or ARP regions of the gene and located in the coding region.Upon introduction into a competent cell in the presence of an SPV virus or genome, homologous recombination between the transfer vector and the genome generates the rSPV, which has defective genes and contains an exogenous genetic sequence. After an rSPV has been genetically modified as described above, it can be easily replicated and propagated by simple culture in any... Petition 870180160870, dated 10 / 12 / 2018, page 19 / 77 11 / 51 competent cells.
[0038] SPVs can be cultured, maintained or propagated in porcine kidney embryonic cells, such as ESK-4 cells (CL-184), routinely cultured at 37 °C in 5% CO2 in Ham F-12K medium (Gibco, Catalog No.: 21127-022) supplemented with 1% streptomycin-penicillin (Gibco, Catalog No.: 15140-122) and 5% FBS (Gibco, Catalog No.: 10437-028). DNA can be extracted from virus-infected cells using any conventional method. For example, cells grown in monolayers can be scraped and then rotated to collect the supernatant. After the protein has been denatured in a lysis buffer and removed, the DNA can be extracted with phenol and / or ethanol.
[0039] In the context of the invention, a defective gene means a gene that is partially or totally deleted. More particularly, an SPV containing a defective gene is an SPV containing a deletion of at least 20 bp in a coding sequence of said gene, preferably at least 50 bp, even more preferably at least 100 bp, further more preferably at least 150 bp, at least 200 bp, or even at least 300 bp.
[0040] The IL18bp gene of an SPV viral DNA contains approximately 402 bp and is generally located at residues nt 7745-8146 of an SPV genome. As a specific example, in the kasza strain of SPV (VR-363), the IL18bp gene is located at nt7745-8146. The exact position of the IL18bp gene in any SPV strain can be easily identified using common knowledge, routine sequence analysis, and / or sequence alignment. Petition 870180160870, dated 10 / 12 / 2018, page 20 / 77 12 / 51
[0041] The TK gene of an SPV viral DNA contains approximately 543 bp and is generally located at residues nt 55625-56167 of an SPV genome. As a specific example, in the kasza strain of SPV (VR-363), the TK gene is located at nt55625-56167. The exact position of the IL18bp gene in any SPV strains can be easily identified using common knowledge, routine sequence analysis, and / or sequence alignment.
[0042] The ARP gene of an SPV viral DNA contains approximately 1455 bp and is generally located at residues nt 137100-138554 of an SPV genome. As a specific example, in the kasza strain of SPV (VR-363), the ARP gene is located at ntl37100-138554. The exact position of the IL18bp gene in any SPV strains can be easily identified using common knowledge, routine sequence analysis, and / or sequence alignment.
[0043] The preferred rSPVs of the invention comprise a defective IL18bp gene, wherein the endogenous IL18bp gene is missing at least 50 nt, preferably at least 100 nt, even more preferably at least 150 nt, at least 200 nt, at least 250 nt, at least 300 nt, even more preferably between 320 nt and 380 nt. The specific and preferred rSPVs of the invention contain a deletion of at least 100-200 nt of the IL18bp gene, even more preferably at least 50-300 nt of the IL18bp gene, such as nt 31-382 or nt l9-369 of the IL18bp gene.
[0044] The preferred rSPVs of the invention further comprise a defective TK gene, wherein the endogenous TK gene lacks at least 50 nt, preferably at least 100 nt, even more preferably at least 150 nt, at least Petition 870180160870, dated 10 / 12 / 2018, p. 21 / 77 13 / 51 200 nt, at least 250 nt, at least 300 nt, even more preferably at least 400 nt, such as between 420 nt and 500 nt. The specific and preferred rSPVs of the invention contain a deletion of at least 100-300 nt of the TK gene, even more preferably at least 70-450 nt of the TK gene, even more preferably at least 60-500 nt of the TK gene, such as nt 59-536 of the TK gene.
[0045] Regarding the ARP gene, in rSPVs of the invention comprising a defective ARP gene, the endogenous ARP gene coding sequence preferably does not have at least 50 nt, preferably at least 100 nt, even more preferably at least 110 nt. The specific and preferred rSPVs of the invention contain a deletion of at least nt1 150-1200 of the ARP gene, even more preferably of at least nt1 130-1220 of the ARP gene, even more preferably of at least nt1 116-1228 of the ARP gene. Larger deletions may also be made, spanning between 800 and 1300 bp of the ARP gene.
[0046] In a particular embodiment, the rSPVs of the invention contain a deletion of at least nt 50-300 of the IL18bp gene and a deletion of at least nt 70-450 of the TK gene. In a specific embodiment, the rSPV contains a deletion of nt 31-382 or nt l9-369 of the IL18bp gene and a deletion of nt 59-536 of the TK gene.
[0047] In another particular embodiment, the rSPVs of the invention contain a deletion of at least nt 50-300 of the IL18bp gene and a deletion of at least nt1 1340-1220 of the ARP gene. In a specific embodiment, the rSPV contains a deletion of nt 31-382 or nt l9-369 of the IL18bp gene and a deletion of nt1 116-1228 of the TK gene. Petition 870180160870, dated 10 / 12 / 2018, p. 22 / 77 14 / 51
[0048] In one particular embodiment, the rSPV of the invention comprises an exogenous genetic sequence inserted in place of one of the deleted regions above. In another embodiment, the rSPV comprises at least 2 exogenous nucleic acids, each located at a distinct location selected from the deleted regions above.
[0049] The construction of an rSPV of the invention can be carried out using methods known per se in the art, following the guidance and information contained in this application. In particular, a person skilled in the art can insert an exogenous genetic sequence into the TK, ARP or IL18bp sequence, replacing all or part of the endogenous sequence, using known methods such as mutagenesis, PCR, homologous recombination, etc.
[0050] In a particular embodiment, a transfer vector is prepared by recombinant DNA technology in which an exogenous genetic sequence is cloned flanked by two homology regions of IL18bp or TK. The homology regions typically contain between 50 and 1000 nt of IL18bp or TK gene sequence, allowing specific homologous recombination. The transfer vector can be prepared from any known or conventional plasmids, cosmids, phages, and the like, such as pBS, pBR322, pUC18, pUC19, and pHC79 plasmids. The transfer plasmid can then be introduced into an SPV-infected cell using known techniques such as electroporation, calcium phosphate, a lipofectin-based method, or the like. Recombinant SPV viruses that have the exogenous genetic sequence integrated are then selected. Their sequence can be Petition 870180160870, dated 10 / 12 / 2018, page 23 / 77 15 / 51 verified. rSPV can then be maintained in any suitable competent cell. The virus can be maintained in culture, or purified and frozen or lyophilized.
[0051] Particular examples of rSPVs of the invention comprise a deletion of at least 50 nt in the IL18bp gene, and at least 50 nt in the TK or ARP gene.
[0052] A preferred virus of the invention comprises a deletion of at least 100 nt in the IL18bp gene, and at least 100 nt in the TK or ARP gene.
[0053] A more preferred virus of the invention comprises a deletion of at least 200 nt in the IL18bp gene, and at least 200 nt in the TK gene.
[0054] Another particular virus of the invention is a recombinant swinepox virus (rSPV) that has a defective viral IL18bp gene and does not contain any exogenous genetic coding sequence. Such a virus is attenuated and can be used to produce rSPVs containing an exogenous genetic sequence, which can be inserted into a distinct region of the IL18bp gene sequence. Exogenous genetic sequence
[0055] An exogenous genetic sequence can be any nucleic acid sequence or molecule not naturally present in an SPV genome, or not naturally present at such a location in an SPV genome. An exogenous genetic sequence typically comprises a nucleic acid sequence encoding an mRNA, a peptide, or a polypeptide (or protein). The exogenous genetic sequence can encode, for example, various types of active molecules, such as an antigen, adjuvant, cytokine, lymphokine, growth factor, enzyme, tag, etc. Petition 870180160870, dated 10 / 12 / 2018, page 24 / 77 16 / 51
[0056] In a preferred embodiment, the exogenous genetic sequence encodes an antigen (peptide, polypeptide, or protein antigen) of a porcine infectious disease pathogen and, most preferably, an antigen of a virus, bacterium, fungus, or protozoan. In the context of the invention, a peptide typically designates a molecule comprising from 4 to 30 amino acids. A polypeptide is any amino acid polymer comprising more than 30 amino acids. The term polypeptide includes full-length proteins.
[0057] The exogenous genetic sequence preferentially encodes a peptide or polypeptide (e.g., glycoprotein, capsid protein, or fragment thereof) from a virus or pathogen selected from porcine circovirus (PCV1, PCV2, PCV2a, PCV2b, PCV2d, PCV3), Actinobacillus pleuropneunomia; Adenovirus; Alphaviruses such as Eastern equine encephalomyelitis virus; Balantidium coli; Bordetella bronchiseptica; Brachyspira spp., preferably B. hyodyentheriae, B. pilosicoli, B. innocens, Brucella suis, preferably biovars 1, 2, and 3; classical swine fever virus, African swine fever virus; Chlamydia and Chlamydophila sp., and preferably C. pecorum and C. abortus; Clostridium spp., preferably C1. difficile, C1. perfringens types A, B and C, C1.novyi, Cl.septicum, Cl.tetani; Digestive and respiratory coronaviruses; Cryptosporidium parvum; Eimeria spp; Eperythrozoonis suis currently called Mycoplasma haemosuis; Erysipelothrix rhusiopathiae; Escherichia coli; Haemophilus parasuis, preferably subtypes 1, 7 and 14; Hemagglutinating encephalomyelitis virus; Isospora suis. Petition 870180160870, dated 10 / 12 / 2018, page 25 / 77 17 / 51 Japanese encephalitis virus; Lawsonia intracellularis; Leptospira spp., preferably Leptospira australis, Leptospira canicola, Leptospira grippotyphosa, Leptospira icterohaemorrhagicae, Leptospira interrogans, Leptospira pomona and Leptospira tarassovi; Mannheimia haemolytica; Mycobacterium spp., preferably M. avium, M. intracellular and M. bovis; Mycoplasma hyponeumoniae; Parvovirus; Pasteurella multocida; Porcine cytomegalovirus; Porcine parovirus; Porcine reproductive and respiratory syndrome virus; Pseudorabies virus; Rotavirus; Sagiyama virus; Salmonella spp., preferably S. thymurium and S. choleraesuis; Staphylococcus spp., preferably S. hyicus; Streptococcus spp., preferably Strep. suis; Porcine cytomegalovirus; Swine herpesvirus; Swine influenza virus; Swine pox virus; Toxoplasma gondii; Swine vesicular stomatitis virus or swine exanthema virus.
[0058] In a particularly preferred embodiment, the exogenous genetic sequence encodes a PCV2 antigen, particularly a PCV2 protein or peptide, even more particularly a PCV2 capsid protein or peptide (e.g., ORF2).
[0059] The exogenous genetic sequence may contain a transcriptional promoter to enable or enhance the expression of the encoded mRNA or polypeptide. The promoter used may be a synthetic or natural promoter, including a swinepox promoter, a poxvirus promoter, or a promoter derived from different viruses or cells, such as promoters derived from eukaryotic or prokaryotic organisms. Specific examples of promoters Petition 870180160870, dated 10 / 12 / 2018, page 26 / 77 18 / 51 include the 7.5-kD variola virus promoter (P7.5k) (Davison AJ et al., J. Mol. Biol., 210(4):749-69 (1989)), 11-kD promoter (P11k) (Bertholet et al., Proc. Nat. Acad. Sci., 82:2096-2100 (1985)) or 28-kD (P28k) promoter (Weir JP & Moss B., J. Virol. 61:75-80 (1987)), or a synthetic artificial Poxvirus promoter (Ps), the herpesvirus thymidine kinase promoter (Ross LJ, Gen. Virol. 74:371-377 (1993)), HVT or MDV gB (supra) protein promoter, the human cytomegalovirus (HCMV) IE promoter (Alting-Mess MA, Nucleic Acids Res., 17:9494 (1989)), SV40 promoter (Gunning P., Proc. Natl. Acad. Sci., 84:4931-4835 (1987)), the beta-actin promoter (supra, and Kost AT, Nucleic Acids Res., 11:8287-8301 (1983)), the beta-globin promoter (Spitzner JR, Nucleic Acids Res., 18:1-11 (1990)), the Rous sarcoma virus LTR promoter (Fiek A. et al., Nucleic Acids Res., 20:1785 (1992)), and similar ones. In addition, promoters of structural proteins or essential SPV genes can also be used.
[0060] The rSPV of the invention may contain several exogenous genetic sequences, located in the same cloning region and / or in distinct cloning sites.
[0061] In a particular embodiment, the rSPV of the invention comprises at least 2 exogenous genetic sequences encoding two distinct antigens (from the same pathogen or from a distinct pathogen). In this sense, in a further particular embodiment, the rSPV of the invention comprises at least one exogenous genetic sequence encoding a PCV2 antigen and one exogenous genetic sequence encoding a distinct antigen. In another embodiment Petition 870180160870, dated 10 / 12 / 2018, page 27 / 77 19 / 51 In particular, the rSPV of the invention comprises an exogenous genetic sequence encoding an antigen and an exogenous genetic sequence encoding an adjuvant or a cytokine.
[0062] In a further particular embodiment, the rSPV of the invention comprises at least two exogenous genetic sequences, each encoding a PCV2 antigen, in particular each genetic sequence encoding an ORF2 protein or peptide, which may be the same or different.
[0063] In this sense, another embodiment of the invention relates to a recombinant virus comprising at least two exogenous genetic sequences, each encoding a PCV2 ORF2 protein or peptide, wherein each of said exogenous genetic sequences contains a different cell targeting signal that allows the expression of the PCV2 ORF2 protein or peptide in different cell compartments. In particular, in a preferred embodiment, one of said exogenous genetic sequences encodes a cytoplasmic PCV2 ORF2 protein or peptide and the other encodes a PCV2 ORF2 protein or peptide exposed on the cell surface (outside of cell membrane expression). The invention shows, in fact, that the co-expression of a PCV2 ORF2 protein or peptide antigen in two different cellular compartments generates a stronger immune response in vivo, allowing better protection of the animal.In one particular embodiment, cell membrane targeting of an ORF2 protein or peptide is achieved using a cell membrane targeting peptide derived from the Vaccinia virus B5R gene, as described in document WO2014 / 167060. Petition 870180160870, dated 10 / 12 / 2018, page 28 / 77 20 / 51 Alternatively, other cell addressing sequences may be considered.
[0064] In a particular embodiment, the invention relates to an rSPV comprising at least two exogenous genetic sequences, each encoding a PCV2 antigen, particularly an ORF2 protein or peptide, wherein one exogenous genetic sequence is located in the viral genome in place of the deleted viral IL18bp gene sequence, and one exogenous genetic sequence is located in the viral genome in place of the deleted viral TK or ARP gene sequence, and further wherein one of said exogenous genetic sequences allows cytoplasmic expression of the PCV2 antigen and the other of said exogenous genetic sequences allows cell membrane exposure of the PCV2 antigen.
[0065] In multivalent rSPVs of the invention, the at least two exogenous genetic sequences may be under the control of the same promoter or of different promoters, and in the same orientation or in opposite orientations. Nucleic acid molecules
[0066] The invention also relates to nucleic acid molecules comprising the genome of an rSPV of the invention. The nucleic acid molecules of the invention may be DNA or RNA, double-stranded or single-stranded. The single-stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also called the antisense strand. The invention also relates to variants or analogues of such nucleic acid molecules, for example, molecules that have at least 85%, 90%, 95%, 96%, 97%, 98% or more identity of Petition 870180160870, dated 10 / 12 / 2018, p. 29 / 77 21 / 51 sequence among themselves.
[0067] The degree of homology between two nucleic acid sequences can be determined using computer programs known in the art as GAP, provided in the GCG software package (Program Manual for the Wisconsin Package, Version 8, August 1996, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 1) (Needleman, SB and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453). Using GAP with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3. Nucleic acid molecules can be aligned with each other using the Pileup alignment software, available as part of the GCG software package, using, for example, the default settings of gap creation penalty of 5 and gap width penalty of 0.3.
[0068] Suitable experimental conditions for determining whether a given nucleic acid molecule hybridizes to a specified nucleic acid may involve pre-soaking a filter containing a relevant sample of the nucleic acid to be examined in 5x SSC for 10 minutes, and pre-hybridizing the filter in a solution of 5x SSC, 5x Denhardt solution, 0.5% SDS and 100 [µg]g / ml of denatured sonicated salmon sperm DNA, followed by hybridization in the same solution containing a concentration of 10 ng / ml of a P-dCTP-tagged probe for 12 hours at approximately 45 °C, according to the hybridization methods as described in Sambrook et al. (1989; Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Petition 870180160870, dated 10 / 12 / 2018, p. 30 / 77 22 / 51 Spring Harbor, New York). The filter is then washed twice for 30 minutes in 2 x SSC, 0.5% SDS at at least 55 °C (low stringency), at least 60 °C (medium stringency), at least 65 °C (medium / high stringency), at least 70 °C (high stringency), or at least 75 °C (very high stringency). Hybridization can be detected by exposing the filter to an X-ray film.
[0069] The nucleic acid molecules according to the invention may be provided in the form of a nucleic acid molecule per se as unprotected nucleic acid molecules; a vector; virus or host cell etc. Vectors include expression vectors containing a nucleic acid molecule of the invention. Host cells
[0070] In a further embodiment of the invention, a host cell transformed with a nucleic acid or with an rSPV according to the invention is provided. Such cells can produce rSPVs of the invention. Suitable examples of host cells are known to those skilled in the art or can be readily selected by those skilled in the art. Host cells are preferably eukaryotic cells, such as mammalian cells (e.g., pig), fungal cells (e.g., Saccharomyces cerevisiae, Pichia, Aspergillus, Fusarium), insect cells, and plant cells. Specific examples of host cells are porcine kidney cells, such as ESK-4 (CL-184) cells. Vaccine compositions and methods
[0071] The term vaccine as used in this document includes any composition that can be used to cause, Petition 870180160870, dated 10 / 12 / 2018, page 31 / 77 23 / 51 stimulate or amplify an immune response in an animal (e.g., pigs) against a pathogen. Particular examples of vaccines of the invention are compositions capable of causing or stimulating or amplifying immunity against a PCV2 virus. In a vaccine of the invention, at least one exogenous genetic sequence must encode an antigen or an adjuvant.
[0072] The term immunization includes the process of delivering an immunogen to an individual. Immunization can, for example, enable a high, sustained level of cellular and / or antibody response where T lymphocytes can exterminate or suppress the pathogen in the immunized non-human animal, such as a pig, which is directed against a pathogen or antigen to which the animal has been previously exposed.
[0073] The vaccines of the invention comprise an immunologically effective amount of an rSPV or nucleic acid or cell as described above in a pharmaceutically acceptable vehicle.
[0074] The exact amount required for an immunologically effective dose may vary from individual to individual depending on factors such as the individual's age and general condition, the nature of the formulation, and the mode of administration. The appropriate effective amount can be determined by an element of common knowledge in the art using only routine experimentation. For example, methods are known in the art for determining or titrating appropriate dosages of a vaccine to find minimum effective dosages based on the weight of the non-human animal individual, vaccine concentration, and other typical factors. In a typical embodiment, the vaccine Petition 870180160870, dated 10 / 12 / 2018, page 32 / 77 24 / 51 comprises a unit dose of between 10 and 10,000,000 TCID50, preferably between 100 and 1,000,000 TCID50, even more preferably between 1,000 and 100,000 TCID50, of an rSPV of the invention. TCID50 designates the average tissue culture infectious dose, that is, the amount of virus that produces pathological changes in 50% of inoculated cell cultures.
[0075] The vaccine dosage, component concentration, and timing of vaccine administration, which elicit an adequate immune response, can be determined by methods such as serum antibody titers, for example, by ELISA and / or serum neutralization assay analysis and / or by vaccination challenge assessment.
[0076] Vaccines may comprise other ingredients, known to you by a person skilled in the art, such as vehicles, excipients, pharmaceutically acceptable diluents, adjuvants, freeze-drying stabilizers, wetting or emulsifying agents, pH buffering agents, gelling or viscosity-enhancing additives, or preservatives, depending on the route of administration.
[0077] Examples of pharmaceutically acceptable vehicles, excipients or diluents include, but are not limited to, demineralized or distilled water; saline solution; vegetable-based oils such as peanut oil, arachis oil, safflower oil, olive oil, cottonseed oil, corn oil, sesame oil or coconut oil; silicone oils, including polysiloxanes such as methyl polysiloxane, phenyl polysiloxane and methylphenyl Petition 870180160870, dated 10 / 12 / 2018, p. 33 / 77 25 / 51 polysiloxane; volatile silicones; mineral oils such as light liquid paraffin oil or heavy liquid paraffin oil; squalene; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, sodium salt of carboxymethylcellulose, or hydroxypropyl methylcellulose; lower alkanols, for example, ethanol or isopropanol; lower aralkanols; lower polyalkylene glycols or lower alkylene glycols, for example, polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3-butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyrrolidone; agar; carrageenan; tragacanth gum or acacia gum and petroleum gel.Typically, the vehicle or vehicles will form from 10% to 99.9% by weight of the vaccine composition and may be buffered by conventional methods using reagents known in the art, such as sodium hydrogen phosphate, sodium dihydrogen phosphate, potassium hydrogen phosphate, potassium dihydrogen phosphate, a mixture thereof, and the like.
[0078] Examples of adjuvants include, but are not limited to, oil-in-water emulsions, aluminum hydroxide (alum), immunostimulant complexes, nonionic block polymers or copolymers, cytokines (such as IL-1, IL-2, IL-7, IFN-α, IFN-β, IFN-γ, etc.), saponins, monophosphoryl lipid A (MFA), muramyl dipeptides (MDP), and the like. Other suitable adjuvants include, for example, aluminum potassium sulfate, heat-labile or heat-stable enterotoxin(s) isolated from Escherichia coli, cholera toxin, or the B subunit of Petition 870180160870, dated 10 / 12 / 2018, page 34 / 77 26 / 51 same, diphtheria toxin, tetanus toxin, pertussis toxin, incomplete or complete Freund's adjuvant, etc. Toxin-based adjuvants, such as diphtheria toxin, tetanus toxin and pertussis toxin, may be inactivated before use, for example, by treatment with formaldehyde.
[0079] Examples of freeze-drying stabilizers may include, for example, carbohydrates such as sorbitol, mannitol, starch, sucrose, dextran or glucose, proteins such as albumin or casein, and derivatives thereof.
[0080] Vaccines may comprise antigens of various pathogens, such as PCV2, Actinobacillus pleuropneumonia; Adenovirus; Alphaviruses such as Eastern equine encephalomyelitis virus; Balantidium coli; Bordetella bronchiseptica; Brachyspira spp., preferably B. hyodyentheriae, B.pilosicoli, B. innocens, Brucella suis, preferably biovars 1, 2 and 3; Classical swine fever virus, African swine fever virus; Chlamydia and Chlamydophila sp. and, preferably, C. pecorum and C. abortus; Clostridium spp., preferably C1. difficile, C1. perfringens types A, B and C, C1.novyi, Cl.septicum, Cl.tetani; Digestive and respiratory coronaviruses; Cryptosporidium parvum; Eimeria spp; Eperythrozoonis suis currently called Mycoplasma haemosuis; Erysipelothrix rhusiopathiae; Escherichia coli; Haemophilus parasuis, preferably subtypes 1, 7 and 14; Hemagglutinating encephalomyelitis virus; Isospora suis; Japanese encephalitis virus; Lawsonia intracellularis; Leptospira spp., preferably Leptospira australis, Leptospira canicola, Leptospira grippotyphosa, Leptospira. Petition 870180160870, dated 10 / 12 / 2018, page 35 / 77 27 / 51 icterohaemorrhagicae, Leptospira interrogans, Leptospira pomona and Leptospira tarassovi; Mannheimia haemolytica; Mycobacterium spp., preferably M. avium, M. intracellular and M. bovis; Mycoplasma hyponeumoniae; Parvovirus; Pasteurella multocida; Porcine cytomegalovirus; Porcine parovirus; Porcine reproductive and respiratory syndrome virus; Pseudorabies virus; Rotavirus; Sagiyama virus; Salmonella spp., preferably S. thymurium and S. choleraesuis; Staphylococcus spp., preferably S. hyicus; Streptococcus spp., preferably Strep. suis; Porcine cytomegalovirus; Swine herpesvirus; Swine influenza virus; Swine pox virus; Toxoplasma gondii; Vesicular stomatitis virus and / or swine exanthema virus.
[0081] The vaccine compositions of the invention may be liquid formulations, such as an aqueous solution, water-in-oil or oil-in-water emulsion, syrup, an elixir, a pigment, a preparation for parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration), such as sterile suspensions or emulsions. Such formulations are known in the art and are typically prepared by dissolving the antigen and other typical additives in appropriate carrier or solvent systems. Liquid formulations may also include suspensions and emulsions containing suspending or emulsifying agents.
[0082] The route of administration may be percutaneous, via mucosal administration, or via a parenteral route (intradermal, intramuscular, subcutaneous, intravenous, or intraperitoneal). The vaccine of the invention may Petition 870180160870, dated 10 / 12 / 2018, page 36 / 77 28 / 51 can be conveniently administered intranasally, transdermally (i.e., applied to or on the surface of the skin for systemic absorption), parenterally, ocularly, etc. The parenteral route of administration includes, but is not limited to, intramuscular, intravenous, intraperitoneal and similar routes.
[0083] The vaccines of the invention can be administered as single doses or in repeated doses. The vaccines of the invention can be administered alone or can be administered simultaneously or sequentially with one or more additional compositions, such as, for example, other porcine immunogenic or vaccine compositions. When the compositions are administered at different times, the administrations can be separated from each other or overlapped in time.
[0084] The present invention also relates to methods of immunization or induction of immune responses in a non-human mammal (e.g., pigs) comprising administering to said mammal an rSPV or a nucleic acid, or a cell or a vaccine as described above.
[0085] The vaccines of the invention are preferably administered to pigs, adult pigs, but also to young pigs, piglets or pregnant sows. Vaccination of pregnant sows is advantageous, as it can confer passive immunity to newborns through the transmission of maternal antibodies. Pigs may be less than 7, 6, 5, 4, 3, 2 or 1 week old; 1 to 6 weeks old; 2 to 5 weeks old; or 3 to 4 weeks old. Ideally, the vaccine is administered to an individual that has not yet been exposed to the pathogen. Petition 870180160870, dated 10 / 12 / 2018, p. 37 / 77 29 / 51
[0086] The present invention also provides a container comprising an immunologically effective quantity of an rSPV, nucleic acid, cell or vaccine as described above. The invention also provides vaccination kits comprising an optionally sterile container comprising an immunologically effective quantity of the vaccine, means for administering the vaccine to animals, and optionally an instruction manual including information for administering the immunologically effective quantity of the composition to treat and / or prevent the infectious disease. PCV2 vaccine
[0087] The invention is particularly suitable for the treatment (preventive curative) of PCV2 infection and associated diseases.
[0088] Currently developed PCV2 vaccines, such as Circovac® (Merial), Ingelvac®, CircoFLEX (Boehringer Ingelheim Vetmedica), or Suvaxyn®, are inactivated PCV2 vaccines or subunit vaccines. PCV2 subunit vaccines typically use a recombinant PCV2A capsid protein produced by recombinant expression of the PCV2A ORF2 gene. In this regard, the ORF2-encoded protein from PCV2 isolate Imp101 1 was reported in EP1741785. An ORF2-encoded protein from PCV2 isolate PCV2Rm was reported in document WO2010 / 061000. An ORF2-encoded protein from PCV2 isolate 412 was reported in document EP1816200. Another protein encoded by an ORF2 from an additional PCV2 isolate was reported in document EP1036180 or EP2225367. Enhanced synthetic ORF2-like proteins were described in document WO2013 / 030320 and in document Petition 870180160870, dated 10 / 12 / 2018, page 38 / 77 30 / 51 WO2014 / 167060.
[0089] In a particular embodiment, the present invention relates to an rSPV as defined above, wherein the exogenous genetic sequence encodes a PCV2 antigen, more preferably a PCV2 protein, polypeptide or peptide. In a more preferred embodiment, the present invention relates to an rSPV as defined above wherein the exogenous genetic sequence encodes a PCV2 ORF2 polypeptide or a fragment thereof. In a particular embodiment, the ORF2 is selected from ORF2 of PCV2 Imp101 1, PCV2Rm or 412 isolates, or an ORF2 that has at least 80% sequence identity with such proteins, or an immunogenic fragment thereof comprising at least 10, 15, more preferably at least 20 contiguous amino acid residues thereof.
[0090] In a further particular embodiment, the invention relates to an rSPV comprising at least two exogenous genetic sequences, each encoding a PCV2 antigen, particularly an ORF2 protein or peptide, wherein one exogenous genetic sequence is located in the viral genome in place of the deleted viral IL18bp gene sequence, and one exogenous genetic sequence is located in the viral genome in place of the deleted viral TK or ARP gene sequence, and further wherein one of said exogenous genetic sequences allows cytoplasmic expression of the PCV2 antigen and the other of said exogenous genetic sequences allows cell membrane exposure of the PCV2 antigen.
[0091] In one embodiment, the rSPV comprises at least two exogenous genetic sequences, each encoding Petition 870180160870, dated 10 / 12 / 2018, page 39 / 77 31 / 51 an ORF2 protein or peptide from different genotypes, preferably from PCV2b and PCV2d.
[0092] A further aspect of the invention relates to methods for treating and / or preventing a disease associated with PCV2 in a non-human mammal, and to methods for immunizing or vaccinating a non-human animal individual, such as pigs, swine, sows, piglets, against PCV2 infection, comprising administering to said animal individual an rSPV, a nucleic acid, a cell or vaccine composition as defined above.
[0093] PCV2 infections or associated diseases include, among others, Post-weaning Multisystem Wasting Syndrome (PMWS), Porcine Dermatitis and Nephropathy Syndrome (PDNS), Porcine Respiratory Disease Complex (PRDC), reproductive disorders, granulomatous enteritis, exudative epidermitis, necrotizing lymphadenitis, and congenital tremors. Preferably, a non-human animal individual, such as a pig, is protected to an extent where one or all of the adverse physiological symptoms or effects of PCV2 infections are significantly reduced, improved, or completely prevented.
[0094] In one embodiment, the vaccine compositions of the invention are administered to a pig susceptible to, or otherwise at risk of, PCV2 infection in order to enhance the individual’s own immune response capabilities.
[0095] Preferably, the individual is a pig that is in need of vaccination against Post-Weaning Multisystem Wasting Syndrome (PMWS) and / or Porcine Dermatitis and Nephropathy Syndrome (PDNS).
[0096] Additional aspects and advantages of the invention should Petition 870180160870, dated 10 / 12 / 2018, page 40 / 77 32 / 51 will be revealed in the following experimental section, which illustrates the claimed invention. Examples Example 1 Construction of plasmids for recombinant SPV production (1) Construction of pSP91 (Figure 1)
[0097] The genomic DNA of SPV was prepared as follows:
[0098] The kasza strain of SPV (VR-363) and porcine kidney embryonic cells, and ESK-4 cells (CL-184) could be acquired from the American Collection of Cell Cultures (ATCC). ESK-4 cells were routinely cultured at 37 °C in 5% CO2 in Ham's F12K medium (Gibco, Catalog No.: 21127-022) supplemented with 1% streptomycin-penicillin (Gibco, Catalog No.: 15140-122) and FBS at 5% (Gibco, Catalog No.: 10437-028). For the preparation of SPV genomic DNA, confluent ESK-4 cells in a 225 cm² flask were infected with SPV and incubated for 6 days until the cells showed 100% cytopathic effect (CPE). The infected cells were then harvested by scraping cells from the medium and centrifuging at 1300 rpm for 5 minutes. The medium was decanted and the cell pellet was moderately resuspended in 2 ml of Phosphate Buffered Saline Solution (PBS: 1.5 g Na₂HPO₄, 0.2 g KH₂PO₄, 0.8 g NaCl and 0.2 g KCl per liter H₂O) and subjected to two successive freeze-thaw cycles. Cell residue was then removed by centrifugation at 3000 rpm for 5 min at 4 °C. SPV virions, present in the supernatant, were then pelletized by centrifugation at 20,000 x g for 20 min at 4 °C. Petition 870180160870, dated 10 / 12 / 2018, page 41 / 77 33 / 51 The resulting pellet was then suspended with 10 mM Tris pH 7.5. SPV genomic DNAs were then extracted from SPV virions by suspension with lysis buffer (20 mM Tris, pH 9, 0.1 M NaCl, 5 mM EDTA, 0.1% SDS, 0.2 mg / mL proteinase K) and incubation at 60 °C for 5 min. Phenol:chloroform (1:1) extraction was performed twice, and the sample was precipitated by adding two volumes of ethanol and centrifuging. The supernatant was decanted, and the pellet (SPV DNA) was air-dried and rehydrated in 10 mM Tris pH 7.5, 1 mM EDTA at 4 °C.
[0099] The flanking gene regions of interleukin-18 binding protein (IL-18bp) in the SPV genome were cloned by Polymerase Chain Reaction (PCR). Two primers (synthetic oligonucleotides), SP6030F and SP9574R, known from SEQ IDs 1 and 2, were acquired from Takara Bio. The PCR reaction was conducted using LA Taq polymerase (Takara Bio) and a set of SP6030F and SP9574R primers with SPV DNA as a template according to the manufacturer's protocol. SEQ ID NO: 1: CGAATTCATTCCTTTATCTTTA SEQ ID NO: 2: GGAACTACGTTATACGATCAT
[0100] The amplified DNA of approximately 3.5 kbp was confirmed by 0.8% agarose gel electrophoresis and purified from the gel using the QIAquick Gel Extraction Kit (Qiagen). The purified DNA fragment was cloned into the pCR4-TOPO vector (Invitrogen) according to the manufacturer's protocol. Twelve ampicillin-resistant white transformants were collected and grown in Petition 870180160870, dated 10 / 12 / 2018, page 42 / 77 34 / 51 LB broth containing 50 µg / ml ampicillin, and each plasmid was prepared with a QuickLyse Miniprep Kit (Qiagen). Each plasmid was digested with ScaI, and two candidate plasmid types (both directions of inserted DNA) were selected. The inserted DNAs were sequenced with a dye chemistry-based sequencing cycle (DTCS) reagent and a CEQ2000XL sequencer (Beckman Coulter). One of the candidate plasmids, pCR-SPV6030 / 9574 (no. 1), was confirmed to contain the 6,030nt to 9,574nt genomic DNA fragment of SPV (GeneBank Accession No.: NC 003389) and was used as a basic plasmid (Figure 1).
[0101] Next, PCR mutagenesis was conducted to delete a portion of the IL-18bp gene (nt31-382) and to introduce multiple restriction enzyme sites using pCR-SPV6030 / 9574 (n° 1) as a template and using two types of primer sets, (1) SEQ ID NOs: 3 and 4 or (2) SEQ ID NOs: 5 and 6. SEQ ID NO: 3: TTCGCCCTTACGGTACCATTCCTTTATCTTTATAAACG SEQ ID NO: 4: CTATAATATTAAATAAGCTTTATGGAGTTGTTTAAATAC SEQ ID NO: 5: CACACGATAACACTGCAGTCCACATATTACGGTTC SEQ ID NO: 6: GCCGCGAATTCGCCCTCGAGGAGCTCACTACG
[0102] Each of the PCR products was subjected to 0.8% agarose gel electrophoresis and purified using the QIAquick Gel Extraction Kit. The purified DNA fragment, which was amplified by PCR using a set of SEQ ID NOs: 3 and 4 primers, was digested. Petition 870180160870, dated 10 / 12 / 2018, p. 43 / 77 35 / 51 with two restriction enzymes, KpnI and HindIII, and ligated with the same restriction-cutting enzymes pBluescript KS(+) (Stratagene). The resulting plasmid pBS-9L(Kpn..Hin) (Figure 1) was digested with SacI and PstI, and the same restriction-cutting DNA fragment amplified by PCR using a primer set with SEQ ID NOS: 5 and 6 was inserted into it. The resulting plasmid was named pSP90 (Figure 1).
[0103] Between EcoRI and HindIII, the sites in the multiple restriction enzyme sites of pSP90 were replaced by the oligonucleotide adapter prepared by annealing two synthetic DNA oligonucleotides from SEQ ID NOS: 7 and 8. The resulting plasmid was named pSP91 (Figure 1). SEQ ID NO: 7: AATTGCCCGGGTACCGTCGATCGACTTTTTATGGCCCCCCCGGCCA SEQ ID NO: 8: AGCTTGGCCGGGGGGGCCATAAAAAGTCGATCGACGGTACCCGGGC (2) Construction of pSP911-ORF2cc and pSP911-Ess_ORF2cc (Fig. 2)
[0104] The sequence between KpnI and PstI of pSP91 was replaced by the synthetic adapter shown in SEQ ID NO: 9 to insert the 11-kD vaccine virus promoter, which was reported as a strong late promoter (AJ Davison and B. Moss. J. Mol. Biol. 210, 771-784, 1989), even so. The resulting plasmid was designated as pSP911 (Fig. 2). SEQ ID NO:9: GGTACCGAGCTCGGTAGCCCGGGCCATGGTAGATCCTCTAGAGGATCCAAT TCATTTATAGCATAGAAAAAAACAAAATGAAATTCTACTATATTTTCTGCAG
[0105] Exogenous genetic sequences encoding PCV2 ORF2 were synthesized: The first sequence containing a PCV2 codon-altered ORF2 was prepared (designated Petition 870180160870, dated 10 / 12 / 2018, p. 44 / 77 36 / 51 0RF2cc). This sequence allows cytoplasmic expression. Another sequence was prepared containing the same 0RF2 codon-altered PCV2, but modified to additionally include a cell membrane targeting sequence (designated Ess_0RF2cc). This sequence allows cell membrane exposure of the encoded polypeptide. The synthesized 0RF2cc and Ess_0RF2cc sequences were SEQ ID NO: 10 and 11, respectively. SEQ [D NOJO: ATGACCTACXX TACjAAGAAGATATAGGAGGCGGACKjCATCGGCCACGCtAG TCACCTGGGACAAATTCTGCGGAGAAGGCCATGGTTGGTGCATCCAAGACA TAGATATAGGTGGAGGAGAAAGAACGGAATCTTAATACAAGACTGTCTAG AACTTTTGGGTACACCGTGAAAGAACAACCGTGAGGACCCCATCTTGGGC CGTTGATATGATGAGTTTAACACAACGATTTCTTCCCTCCTGGGGGAGGA TCTAATCCTAGATCCGTTCCATTCGAGTATTATAGGATCAGGAAAGTGAAAG TGGAGTTGTTGCCATTAGGAGGAGGAGGAGTT CTAGCGCCGTGATCCTGGACGACAATTTCGTGACCAAAGCAACCGCACTGA CTTACGATCCTTACGTGAATTATTCTAGCAGACACTATTACTCAACCATT TAGCTATCAGCAGATATTTCACCTAAGCCAGTGCTGGACAGCACCATC G ACTATTTTC AGCCTAATA ΑΤAG GΛGA AGA CTTTGGCTTAGGCTTCA GA CCGCCGGGAACGTGGATCACGTGGGATTGGGAACCGCATTTGAGAATTCTA TTTAI GATCAAGAGTATAACATTAGAGTGACTATGTAra G TTCAACC TGAAAGA TCCACC TCTGA AT CCATAA Petition 870180160870, of 10 / 12 / 2018, p. 45 / 77 37 / 51 SEQ ID: NO:11: ATGAAAACGATTI CCG'I TGTTACG 1TGTTATGCGTAC'I ACCTGCTGTTGTJTA TTCAACATGTAC'I GIACCCACTA TGAA TAACGC TA AA1 [ GACG TCTACCGAA ACATCGTGGAAAAAAGAGAAAGGAGTTGAACACCAGATTGTCTAGAACC TTCGG'nACACCATTAAGAACCACCGTCAAAACCCCATCTrGGGCTGT ATATGATGAGATTCAACATCAACGATTTCGTCCCACCTGGTGGTGGATCAAA CCCTAGATCCGTTCCATTC'GAGTACTACAGAATCAGAAAAGTCAAAGTCGA GTTCTGGCCATGTCCACTGACTGAGTTGACTGTTGATTGTT GCCGTCATCTTGGATGACAACTTCGTCAC?TAAGGCTA(?TGCCTTGACCTACG ATCCTTACGTCAATTACTCTAGTACACACCATCACCCAACCATTCATA CCATTCTAGATACTTCACTCCAAAACCTGTCTTGGACTCAAt?ATC:GATTAC GGTAACGTCGATCATGTCGGATTGGGAACCGCCTTCGAAAACTCCAAATAC GACCAGGAGTCAACATTAGAGTCACCATGTACGTCCAATTCAGAGAGTTC AACTTGAAGGACCCACCATTTGAACCCATAA
[0106] These synthetic genes - 0RF2cc and Ess_0RF2cc conjugated at the BamRl or Sall site at the 5' or 3' terminus were digested with BamHI and Sall, and inserted into the pSP911 cut with BamRl and Sall. The resulting plasmids were designated pSP91 l-ORF2cc or pSP91l-Ess_ORF2cc (Fig. 2), and used to produce each recombinant swinepox virus - SVR15 or SVR14 - respectively. (3) Construction of pSP53-ORF2 (Fig.3)
[0107] The gene for the Ankyrin Repeat Protein (ARP) of SPV was obtained from the pNZSP52L plasmid (JP2003-111591A). The synthetic adapter shown in SEQ ID NO: 12 was substituted in the region between HindIII and BcoRI of pNZSP52L, and the resulting plasmid was designated pSP53.
[0108] The PCV2-ORF2 qene used is shown in SEQ ID NO: 13. The qene was synthesized, acquired with BamRI and Sail, and inserted into the BamRI and Sail sites of pSP53. The resulting plasmid was designated as pSP53-ORF2 (Fig. 3), and used to produce two recombinant swinepox viruses. Petition 870180160870, dated 10 / 12 / 2018, p. 46 / 77 38 / 51 SVR16 and SVR17. SEQ ID NO: 12: AAGCTTGGCCGGGGGGGCCAGCTCGGTACATAAAAATGTCGACGGATCCGA GTGCAATAAATTAGAATAGTTTTTCAATTTTTACGCGTAATTAATTATTGTAT TTATTATTTATATGCCAAAAAAAAAAAAAAAAGCTTCATAAAAAGTC GATCGACGGTACCACCCGGGGATCGATCCAAAAAAATCTTTCGGCCTGCAT GAATGGCCTTGTTGATCGCTTATTATTATTTTTGACACCAGACCAACTGGTA ATGGTAGCGACCGGCGCTCAGCTGGAATTC SEQ ID NO: 13: GGATCCA JGACG'I ATCCAAGGAGGCGTTACCGCAGAAGAAGACACCGCCCC CGCAGCCA TCTTGGCCAGATCCl CCGCCGCCGCCCC TGGCl CGTCCACCCCC GCCACCGC TACCGTTGGAGAAGGAAAAA TGGCA'I C1TCAACACCCGCC TCT CCAGCACCTACCTACCTACCGACCGACCGCCG GGCGGTGGACATGA1 GAGA TTTAAACTTGACGACn TTCCCCCGGGAGG GGGGACCAACAAAATCTCTATACCCTrTGAATACJACAGAATAAGAAAGGT taaggttgaattctgcjCCCTGCTCCCC'catcaccca CTAACCTATGACCCATATGTAAACTACTCCTCCCGCCATACAATCCCCX-AAC CCTTCTCCTACCTCCCGTTACTTCACACCCAAACCTGTTCTTGACTCCACT ATTGATTACTTCCAACCAAATAACAAAGGAATCAGCTTTGGCTGAGGCTA CAAACTTCTAGAAATGGACCCGCCGAGCCGAGCCAA AGTAAATACGACCAAGACTACAATATCCGTGTAACCATGTATGTACAATTC AGAGAATTTAATCTTAAAGACCCCCCACTTAACCCCTAAGTCGAC (4) Construction of pSP72-ORF2 (Fig.4)
[0109] The flanking region of the thymidine kinase (TK) gene in the SPV genome was cloned by Polymerase Chain Reaction (PCR). Two primers (synthetic oligonucleotides), SP54242F and SP57617R known in SEQ ID NOs: 14 and 15, were acquired from Takara Bio. The PCR reaction was conducted using LA Taq polymerase (Takara Bio) and a set of SP54242F and SP57617R primers with SPV DNA as a template according to the manufacturer's protocol. Petition 870180160870, dated 10 / 12 / 2018, p. 47 / 77 39 / 51 SEQ ID NO: 14: AATATTACGGGTGCTGTTT SEQ ODNO: 15: AAAAACATCGTATTCCTG
[0110] The amplified DNA of approximately 3.4 kbp was confirmed by 0.8% agarose gel electrophoresis and purified from the gel using the QIAquick Gel Extraction Kit (Qiagen). The purified DNA fragment was cloned into the pCR4-TOPO vector (Invitrogen) according to the manufacturer's protocol. Fourteen ampicillin-resistant blank transformants were collected and grown in LB broth, and each plasmid was prepared using the QuickLyse Miniprep Kit (Qiagen). Each plasmid was digested with SpeI, and two candidate plasmid types (both directions of inserted DNA) were selected. The inserted DNAs were sequenced using dye chemistry-based sequencing cycle (DTCS) reagent and a CEQ2000XL sequencer (Beckman Coulter). One of the candidate plasmids, pCR-SPV54242 / 57617 (No. 2), was confirmed to contain the 54,242 nt to 57,617 nt genomic DNA fragment of SPV (GeneBank Accession No.: NC_003389) and was used as a basic plasmid (Fig.4).
[0111] Next, PCR mutagenesis was conducted to delete a portion of the TK gene (nt59-536) and to introduce multiple restriction enzyme sites using pCR-SPV54242 / 57617 (n° 2) as a template and using two types of primer sets, (1) SEQ ID NOs: 16 and 17 or (2) SEQ ID NOs: 18 and 19. Petition 870180160870, dated 10 / 12 / 2018, p. 48 / 77 40 / 51 SEQ ID NO: 16: CGTTCATGTTAAGCTTAACCTGAAATATTG SEQ ID NO: 17: GTTTAAACGAATTCGGTACCCTTAAAAAACATCG SEQ ID NO: 18: CGCCGAGCTCGAGAATATTACGGGTGCTGTTTTTAC SEQ ID NO: 19: CCAGACTGCAGAGAACATAGGTCCTAATATAAG
[0112] Each of the PCR products was subjected to 0.8% agarose gel electrophoresis and purified using the QIAquick Gel Extraction Kit. The purified DNA fragment, which was amplified by PCR using a set of SEQ ID NOs: 16 and 17 primers, was digested with two restriction enzymes, Kpn I and HindIII, and ligated with the same restriction-cutting enzymes pBluescript KS(+) (Stratagene). The resulting plasmid pBSTKR(Kpn..Hin) (Fig. 4) was digested with Sac I and Pst I, and the same restriction-cutting DNA fragment amplified by PCR using a set of SEQ ID NOs: 18 and 19 primers was inserted into it. The resulting plasmid was named pSP70 (Fig. 4).
[0113] The synthetic adapter shown in SEQ ID NO: 12 was substituted in the region between HindIII and EcoRI of pSP70, and the resulting plasmid was designated pSP711. The DNA fragment of the 'P7.5-LacZ promoter' gene cassette derived from pNZ76, which was cut with HindIII and SmaI of pNZ76 and followed by abrupt cleavage by DNA polymerase (described in USP5,387,519), was ligated into the SmaI site of pSP711. The resulting plasmid was named pSP721 (Fig. 4), and the P7.5-LacZ gene cassette was inserted into the TK gene. Petition 870180160870, dated 10 / 12 / 2018, p. 49 / 77 The synthetic 41 / 51 PCV2-ORF2 gene shown in SEQ ID NO: 13 was re-digested with BamHI and Sal I, and inserted into BamHI and Sal I sites of pSP721, and the resulting plasmid was named pSP72-ORF2 (Fig. 4). This plasmid was used as a homology plasmid to produce a recombinant SPV, SVR20. Example 2 Production of recombinant swinepox viruses (rSPVs) (1) Production of rSPVs, SVR14 and SVR15 (Fig.5)
[0114] Recombinant SPVs were generated in cells ESK-4 is produced by homologous recombination between wild-type SPV genomes and homology plasmid vectors. The cells ESK-4 subconfluent cells in a 6-well plate were infected with wild-type SPV (wtSPV) and, 17 h later, the wtSPV-infected cells were transfected with 2 g of pSP91l-Ess_ORF2cc or pSP911-ORF2cc using... Lipofectamine Plus reagent (Invitrogen) was used and incubated at 37°C for 5 days until the cytopathic effect (CPE) occurred. Cell lysates from infected transfected cells were transfection seed (TFS) for SVR14 and TFS for SVR15, respectively. They were diluted 1:20 with Ham's F-12K medium without FBS, and infected into ESK-4 cells in 96-well plates. Seven days later, each supernatant in 96-well plates was transferred to new, unprocessed 96-well plates, and infected cells were lysed with lysis buffer (20 mM Tris-Cl, 0.1 M NaCl, 5 mM EDTA, 0.1% SDS). 200 gg / ml of proteinase K) followed by heat treatment (60 °C 5 min, and 98 °C 2 min). These DNA samples lysed by infected cell were screened by qPCR using Petition 870180160870, dated 10 / 12 / 2018, page 50 / 77 42 / 51 SYBR-Green reagent (Bio-Rad Catalog #: 170-8882) with a set of primers SEQ ID NO: 20 and SEQ ID NO: 21. SEQ ID NO: 20 AAGTGGAGTTTTGGCCATGT SEQ ID NO: 21 TCCAGCACTGGCTTAGGAGT
[0115] Samples that showed DNA amplification signal by qPCR were positive, and the corresponding supernatants were forwarded to the next screening step. Screening was repeated until all plates shown were stained with immunofluorescence assay (IFA) using anti-PCV2 pig serum (PAB-PCV2, VMR) as the 1st antibody and FITC-conjugated anti-pig IgG (F1638-2ML, SIGMA) as the 2nd antibody.
[0116] Two recombinant viruses without wtSPV (clones of G2C2C4 and D10E5F5) were purified from TFS to SVR14 and SVR15 through three screening cycles and designated SVR14 and SVR15, respectively. (2) Production of rSPVs, SVR16 and SVR17 (Fig.5)
[0117] The recombinant SPV, SVR16, was generated by homologous recombination between recombinant SPV, the SVR15 genome, and the homology plasmid vector, pSP53-ORF2. SVR17 was generated by homologous recombination between the SVR14 genome and the homology vector, pSP53-ORF2. Subconfluent ESK-4 cells in a 6-well plate were infected with SVR15 or SVR14, and 17 h later the rSPV-infected cells were transfected with 2 g of pSP53-ORF2 using lipofectamine Plus reagent. After CPE had been Petition 870180160870, dated 10 / 12 / 2018, p. 51 / 77 Figure 43 / 51 shows that cell lysates (TFS for SVR16 and for SVR17) from infected and transfected cells were screened onto recombinant plates expressing β-galactosidase by adding 0.5 mg / ml of Bluo-gal (Invitrogen Catalog No.: 15,519 to 15,028) to the nutrient agarose overlay slide. The purified recombinant viruses underwent 3-4 screening cycles until all plates were β-galactosidase positive and designated SVR16 and SVR17, respectively. (3) Production of rSPV, SVR20 (Fig.5)
[0118] The recombinant SPV, SVR20, was generated by homologous recombination between recombinant SPV, the SVR14 genome, and the homology plasmid vector, pSP72-ORF2. Subconfluent ESK-4 cells in a 6-well plate were infected with SVR14, and 17 h later the SVR14-infected cells were transfected with 2 pg of pSP72ORF2 using lipofectamine Plus reagent. After CPE was shown, cell lysates (TFS for SVR20) from infected and transfected cells were screened onto recombinant β-galactosidase-expressing plates by adding 0.5 mg / ml of Bluo-gal (Invitrogen Catalog No.: 15,519 to 15,028) to the nutrient agarose overlay slide. The purified recombinant viruses underwent 3-4 screening cycles until all plates were positive for β-galactosidase and designated SVR20. Example 3 In vitro analysis of recombinant SPVs (1) Confirmation of structures and post-passage genome stability of SVR14 and SVR15 by PCR
[0119] To confirm SVR14 genome structures and Petition 870180160870, dated 10 / 12 / 2018, p. 52 / 77 44 / 51 SVR15 purified, their genomic DNAs were prepared as described in Example 1 (1) and used as non-passage (+0p) templates for PCR. To confirm the stability of the SVR14 and SVR15 genome, they were passed into ESK-4 cells 15 times (+15p) and prepared as +0p. These genomic DNAs were verified by PCR using a set of SP7450F and SP8552R primers shown in SEQ ID NOs: 22 and 23 (Fig. 6). SEQ IDNO: 22 CAATTGAAACATCTATATATCCTT SEQ ID NO: 23 CAATGTGAAGCGATAAAATACAG
[0120] PCR results (Fig. 6) showed that purified SVR14 and SVR15 had the expected genome structure and were free of wild-type SPV and that they were stable after 15-times in vitro passages. (2) Confirmation of PCV2-ORF2 protein expressed by SVR14 and SVR15
[0121] The molecular sizes of PCV2-ORF2 proteins expressed by SVR14 and SVR15 were analyzed by 15% SDS-PAGE and Western blot analysis using anti-PCV2 mouse sera. ESK-4 cells were infected with SVR14, SVR15, or wild-type SPV. Six days later, cell lysates were fractionated by 15% SDS-PAGE. Proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane, Immobilon-P (Merk Millipore, Catalog No.: IPVH08130), and blocked with 0.5% dry milk in PBS. PDVDF membrane blots were probed with anti-mouse PCV2 serum (1:1000) as the primary antibody, followed by a reaction with secondary anti-mouse IgG. Petition 870180160870, dated 10 / 12 / 2018, p. 53 / 77 45 / 51 goat biotin-conjugated (1:1000) and VECTASTAIN ABC-AP Standard Kit (Vector Labs, AK-5000). Membrane blots were developed with alkaline phosphatase substrate, Nitroblue Tetrazolium (NBT) / 5-Bromo-4-Chloro-3-Indole Phosphate (BCIP).
[0122] Western blotting results showed that SVR14 expressed two types of ORF2, molecular sizes of 27 kDa and 25 kDa (Fig. 7). It was presumed that the former 27 kDa protein was a precursor form and that the latter was a processed form after cleavage at the end of the signal peptide. On the other hand, SVR15 expressed only 27 kDa proteins that were located in infected cell nuclei (Fig. 7). (3) Confirmation of genome structures of double recombinant SVR16 and SVR17
[0123] To confirm SVR16 genome structures and SVR17 purified, their genomic DNAs were prepared as described in Example 1 (1) and used as non-passage (+0p) templates for PCR. To confirm the stability of the SVR16 and SVR17 genome, they were passed into ESK-4 cells 15 times (+15p) and prepared as well as +0p. These genome DNAs were verified by PCR using a set of P05-8 and P05-9 primers shown in SEQ ID NOs: 24 and 25 (Fig. 8). SEQ IDNO: 24 TATGTCTAAAGGTGCGTCTA SEQ ID NO: 25 AGTGGCTATATTATCATCCTG
[0124] PCR results (Fig. 8) showed that SVR16 Petition 870180160870, dated 10 / 12 / 2018, p. 54 / 77 The purified 46 / 51 and SVR17 strains had the expected genome structure and were stable after 15-fold in vitro passages. (4) Confirmation of double recombinant SVR20 genome structures. To confirm the genome structures of purified SVR20, its genomic DNA was prepared according to the procedures described in Example 1 (1), and used as non-passage (+0p) templates for PCR. To confirm the stability of the SVR20 genome, it was passed into ESK-4 cells 15 times (+15p) and prepared as for +0p. These genome DNAs were verified by PCR using primer sets of (a) SP7450F and SP8552R shown in SEQ ID Nos: 22 and 23 for the IL18bp site and (b) SP55500F and SP56363R shown in SEQ ID Nos: 26 and 27 for the TK site (Fig. 9). SEQ IDNO: 26 ATACGATTAAGCGATAGTGATA SEQ ID NO: 27 ATATTATTTTCATTTGTTTCCTA
[0125] PCR results (Fig. 9) showed that purified SVR20 had the expected genome structure and was stable after 15 in vitro passages. (5) Confirmation of PCV2-ORF2 protein expressed by SVR16, SVR17, and SVR20. PCV2-ORF2 proteins expressed by recombinant SPVs were analyzed by western blotting. ESK-4 cells in 6-well plates were infected with wild-type SPV, SVR14, SVR15, SVR16, SVR17, or SVR20 at a multiplicity of infection (MOI) of 0.1. Six days later, cell lysates were applied to 15% SDSPAGE and blotted onto a PVDF membrane. After blocking with 0.5% dry milk in PBS, blots of Petition 870180160870, dated 10 / 12 / 2018, pp. 55 / 77 47 / 51 PDVF membranes were probed with anti-PCV2 mouse serum (1:500) as the primary antibody, followed by reaction with biotin-conjugated secondary goat anti-mouse IgG (1:1000), and VECTASTAIN ABC-AP Standard Kit (Vector Labs, AK-5000). Membrane blots were developed with alkaline phosphatase substrate, Tetrazolium Nitroblue (NBT) / 5-Bromo-4-Chloro-3-Indolyl Phosphate (BCIP).
[0126] Western blotting results (Fig. 10) surprisingly showed that the doubly defective viruses of the invention express the exogenous gene more effectively than the monodefective viruses: SVR16 expressed 25 kDa protein more than SVR15, and SVR17 and SVR20 expressed two types of ORF2 (27 kDa precursor and 25 kDa processed protein) more than SVR14. Example 4 Pig experiment for safety testing of rSPVs (1) Pig immunization
[0127] 12 SPF pigs (ZEN-NOH premium pigs) were acquired from the National Federation of Agricultural Cooperative Associations (Chiba, Japan) and divided into 4 groups (N=3 per group). Each pig in groups 1 to 4 was immunized on the right side of the neck using a 23G 38.1 mm (1.5 inch) needle with 1 ml of 104TCID50 / ml of SVR16, SVR17, SVR20, or wild SPV (wtSPV), respectively, at 4 weeks of age. (2) Observation of immunized pigs
[0128] Vaccination sites were observed from day 1 post-vaccination (1-DPV) to 18-DPV. During the experiment, all pigs were healthy and did not show any clinical signs such as diarrhea or other symptoms. Petition 870180160870, dated 10 / 12 / 2018, pp. 56 / 77 48 / 51 respiratory infections, except for skin reactions at the injection site, were reported in animals vaccinated with SVR16, SVR17, or wtSPV. Redness sizes due to inflammatory skin reactions were quantitatively determined as cubic content [Width (mm) x Depth (mm) = mm2]. Width (W) is the X-axis as the longest geometric axis direction of redness. Depth (D) is the Y-axis as the shortest geometric axis direction of redness. Redness sizes of immunized pigs were summarized in Table 1 and plotted in Fig. 11. Table 1. Redness sizes (mm2) in pigs from groups 1 to 4. Group (Vaccine) Pig Label Size of redness (mm2) on Day Post-Vaccination (DPV) 1DPV 2DPV 3DPV 4DPV 5DPV 6DPV 7DPV 8DPV 9DPV 10DPV 11DPV 12DPV 13DPV 14DPV 15DPV 16DPV 17DPV 18DPV Group 1 (SVR16) No. 4 No. 5 No. 6 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 9.1 7.0 0 15.5 23.1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Group 2 (SVR17) n°7 n°8 n°9 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 33.2 10.3 16.5 38.3 26.0 24.7 23.7 14.7 12.8 8.2 6.3 9.6 6.7 4.4 5.7 4.1 2.4 4.2 7.8 3.3 5.6 9.8 4.5 5.7 0 0 0 0 0 0 0 0 0 0 0 0 Group 3 (SVR20) n°10 n°11 n°12 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Group 4 (wtSPV) n°13 n°14 n°15 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 17.5 28.7 26.0 23.3 40.4 0 0 0 0 0 10.4 13.8 14.6 8.5 15.2 17.5 9.1 18.0 12.7 10.5 13.6 8.7 1.3 9.9 7.4 1.8 4.7 5.4 2.0 4.3
[0129] The areas of redness were larger in pigs vaccinated with wild-type SPV. No redness was observed at the injection site of pigs immunized with SVR20. These results show that the doubly deleted recombinant IL18-bp and TK genes are much safer than wild-type SPV. SVR20 appeared particularly Petition 870180160870, dated 10 / 12 / 2018, pp. 57 / 77 49 / 51 attenuated. Example 5 Second pig experiment for immunogenicity and safety testing of rSPVs (1) Immunization
[0130] 30 SPF pigs (ZEN-NOH premium pigs) were acquired from the National Federation of Agricultural Cooperative Associations (Chiba, Japan) and divided into 6 groups (N=5 per group).
[0131] Pigs in group 3 were immunized intramuscularly on the right side of the neck with 1 ml of 105TCID5o / ml of SVR20 at 4 weeks of age. Pigs in group 4 were immunized intramuscularly on the right side of the neck with 1 ml of the commercial PCV2 vaccine, Ingelvac CircoFLEX (Boehringer Ingelheim Vetmedica). Pigs in groups 5 and 6 were not immunized. All pigs vaccinated with SVR20 appeared healthy. (2) PCV2 challenge in pigs
[0132] Three weeks post-vaccination, pigs from groups 1 to 5 were challenged by spraying 6 x 105TCID50 of Rm40 strain of PCV2b (imported from Ceva-Phylaxia, Hungary) into the right nostril. Pigs in group 6 were non-immune and unchallenged controls. (3) PCY2 load in lymphoid organs
[0133] Three weeks post-challenge (10 weeks of age), all pigs were euthanized and anatomized. Sections of four lymph nodes—inguinal lymph nodes (ILN), hilar lymph nodes (HEN), mesenteric lymph nodes, and tonsillar lymph nodes (MEN)—were removed using scissors and clean, separate forceps. Sections of these were placed in Petition 870180160870, dated 10 / 12 / 2018, pp. 58 / 77 50 / 51 sterile 50 ml Eppendorf tubes, kept at -80 °C until further processing.
[0134] DNAs from organ samples were extracted by Mini Kit QIAamp DNA (QIAGEN) according to the manufacturer's instructions. PCV2 DNAs were quantified using a TaqMan-based real-time PCR described in J. Virol. Methods, December 15, 2004; 122 (2): 171-178 (PMID: 15542141).
[0135] The ratios of PCV2-positive pigs (> 1x 103 copies / mg-organ) are summarized in Table 2. Table 2. PCV2-positive pigs in 4 lymphoid organs after 3 weeks post-challenge. Group No. of PCV2 positive / Total (%) Vac No. / Challenge HLN ILN Amygdala MLN G3 SVR20 / Ch 1 / 5 (20) 0 / 5 (0) 1 / 5 (20) 0 / 5 (0) G4 CircoFlex / Ch 4 / 5 (80) 1 / 5 (20) 3 / 5 (60) 1 / 5 (20) G5 Nl / Ch 5 / 5 (100) 5 / 5(100) 5 / 5(100) 4 / 5 (80) G6 Nl / N-Ch 0 / 5 (0) 0 / 5 (0) 0 / 5 (0) 0 / 5 (0)
[0136] Vaccination with the doubly defective virus of the invention was very effective in inhibiting PCV2 load in lymph nodes. In particular, regarding PCV2 load in HLN, all G5 (unvaccinated) pigs were PCV2 positive (100%), while only one G3 pig (vaccinated with SVR20) was positive (20%). Surprisingly, the viral load in G4 pigs, vaccinated with commercial anti-PCV2 vaccine, was much higher (80% of pigs were positive). Regarding the PCV2 load in ILN, all G5 pigs (unvaccinated) were PCV2 positive (100%), while all G3 pigs (vaccinated with SVR20) were negative (0%). Petition 870180160870, dated 10 / 12 / 2018, pp. 59 / 77 51 / 51 Surprisingly, the viral load in G4 pigs vaccinated with a commercial anti-PCV2 vaccine was higher (20% of pigs were positive). Regarding the PCV2 load in tonsils, all G5 pigs (unvaccinated) were PCV2 positive (100%), while only one G3 pig (vaccinated with SVR20) was positive (20%). Again, the viral load in G4 pigs vaccinated with a commercial anti-PCV2 vaccine was much higher (60% of pigs were positive). Regarding the viral load... In MLN, most of the G5 pigs (unvaccinated) were PCV2 positive (80%), while all the G3 pigs (vaccinated with SVR20) were negative (0%). The viral load in G4 pigs, vaccinated with a commercial anti-PCV2 vaccine, was higher (20% of pigs were positive).
[0137] These results show that vaccination with SVR20 produced much stronger protection than the commercial vaccine. Petition 870180160870, dated 10 / 12 / 2018, pp. 60 / 77
Claims
1 / 4 CLAIMS 1. Recombinant swinepox virus (rSPV) characterized by having at least one first and one second defective viral genes, wherein the first defective viral gene is the IL18bp gene and the second defective viral gene is the Thymidine Kinase (TK) or Ankyrin Repeat Protein (ARP) gene, and wherein said rSPV is selected from rSPV16, rSPV17 or rSPV20, with the proviso that said rSPV does not comprise at least one first exogenous genetic sequence inserted into the IL18-binding protein (IL18bp) gene of the rSPV genome in substitution for all or a portion of the IL18bp viral genetic sequence.
2. rSPV, according to claim 1, characterized in that said rSPV comprises a deletion of at least 50 bp in the TK gene sequence and a deletion of at least 50 bp in the IL18bp gene sequence.
3. rSPV, according to claim 1, characterized by comprising a deletion of at least 100 bp in the TK gene sequence and a deletion of at least 100 bp in the IL18bp gene sequence, preferably a deletion of at least 200 bp in the TK gene sequence and a deletion of at least 200 bp in the IL18bp gene sequence, even more preferably a deletion of at least 300 bp in the TK gene sequence and a deletion of at least 300 bp in the IL18bp gene sequence.
4. rSPV, according to claim 1, characterized in that said rSPV comprises a deletion of at least 50 bp in the ARP gene sequence and a deletion of at least 50 bp in the IL18bp gene sequence.
5. rSPV, according to any one of claims 1 to 4, characterized by additionally comprising a first exogenous genetic sequence, located in place of the viral defective TK, ARP or IL18bp gene sequence.
6. rSPV, according to any one of claims 1 to 5, characterized in that the rSPV genome comprises a deletion of at least 100 bp in the TK gene sequence and in that the first exogenous genetic sequence is located in said deletion.
7. rSPV, according to any one of claims 1 to 6, wherein the rSPV is characterized by comprising a first exogenous genetic sequence located in place of the deleted viral TK gene sequence, and a second exogenous genetic sequence located in place of the deleted viral IL18bp gene sequence.
8. rSPV, according to any one of claims 1 to 5, wherein the rSPV is characterized by comprising a first exogenous genetic sequence located in place of the deleted viral ARP gene sequence, and a second exogenous genetic sequence located in place of the deleted viral IL18bp gene sequence.
9. rSPV, according to any of the preceding claims, characterized in that the first and / or second exogenous genetic sequences encode an antigen, preferably a PCV2 antigen.
10. rSPV, according to any of the preceding claims, characterized in that the first and / or second exogenous genetic sequences encode a PCV2 capsid antigen, preferably a PCV2 ORF2 protein or peptide.
11. rSPV, according to any of the preceding claims, characterized in that each of the first and / or second exogenous genetic sequences contains a transcriptional promoter.
12. rSPV, according to claim 11, characterized in that each promoter is selected from the 7.5-kD vaccinia virus promoter (P7.5k), 11-kD promoter (P11k) or 28-kD promoter (P28k), an artificial synthetic Poxvirus promoter (Ps), the chicken beta-actin promoter (Bac) or a derivative thereof, the Pec promoter, the early immediate Murine Cytomegalovirus (Mcmv) promoter (ie) 1, the Human Cytomegalovirus (Hcmv) promoter, the Simian virus (SV)40 promoter, and the Raus Sarcoma virus (RSV) promoter, or any fragments thereof that retain promoter activity.
13. rSPV, according to any of the preceding claims, characterized by comprising a first nucleic acid sequence encoding a PCV2 antigen inserted in place of the deleted TK gene sequence from the rSPV genome, and a second nucleic acid sequence encoding a PCV2 antigen inserted in place of the deleted IL18bp gene sequence from the rSPV genome.
14. Recombinant swinepox virus (rSPV) characterized by having a defective viral IL18bp gene.
15. Nucleic acid molecule characterized by comprising the rSPV genome, as defined in any of the preceding claims.
16. Host cell characterized by comprising an rSPV, as defined in any one of claims 1 to 14, or a nucleic acid molecule, as defined in claim 15, wherein said host cell is a transgenic microorganism, preferably a fungus.
17. In vitro method for producing an rSVP, as defined in any one of claims 1 to 13, characterized by comprising infecting a competent cell with a nucleic acid molecule, as defined in claim 14, and collecting the rSVP.
18. Composition characterized by comprising an rSVP, as defined in any one of claims 1 to 10, and an excipient.
19. Composition, according to claim 14, characterized in that it is a vaccine.
20. rSPV, according to any one of claims 1 to 10, characterized in that it is for use in immunizing a pig against a pathogen.
21. Vaccination kit for immunizing a pig, characterized by comprising the following components: c. an effective quantity of a vaccine, as defined in claim 15, and d. a means for administering said vaccine to said pig. Petition 870260044126, dated 11 / 05 / 2026, pp. 21 / 22