Recombinant AAV vector, pharmaceutical composition and use thereof.

Abstract

This invention relates to polynucleotides encoding minidystrophin proteins, viral vectors comprising the same, and methods of using the same to deliver minidystrophin to a cell or an individual.

Description

“RECOMBINANT AAV VECTOR, PHARMACEUTICAL COMPOSITION AND ITS USE” Declaration Regarding Federally Sponsored Research or Development

[001] This invention was made with the support of the government under Nos. granted AR050595, AR056394 and AR056953 granted by National Institutes of Health. The government has certain rights to the invention. Field of Invention

[002] This invention relates to polynucleotides encoding mini-dystrophin proteins, viral vectors comprising the same and methods of using the same for delivering mini-dystrophin to a cell or to an individual. Background of the Invention

[003] Duchenne muscular dystrophy (DMD) is a severe, X-linked, progressive neuromuscular disease affecting approximately one in 3,600 to 9,200 live male births. The disorder is caused by frameshift mutations in the dystrophin gene, abolishing the expression of the dystrophin protein. Due to the lack of dystrophin protein, skeletal muscle and, ultimately, cardiac and respiratory muscles (e.g., intercostal muscles and diaphragm) degenerate, causing premature death. Progressive weakness and muscle atrophy begin in infancy, starting in the lower legs and pelvis before spreading to the arms. Other symptoms include loss of certain reflexes, waddling gait, frequent falls, difficulty rising from a sitting or lying position, difficulty climbing stairs, changes in overall posture, impaired breathing, and cardiomyopathy. Many children are unable to run quickly or jump.Atrophied muscles, especially the calf muscles (and, less commonly, the muscles of the buttocks, shoulders, and arms), can be enlarged by the accumulation of... Petition 870260051626, dated 05 / 29 / 2026, page 9 / 511 2 / 241 fat and connective tissue, making them appear larger and healthier than they actually are (called pseudohypertrophy). Bone thinning and scoliosis are common. Ultimately, independent ambulation is lost, and a wheelchair becomes necessary, in most cases between 12 and 15 years of age. As the disease progresses, the diaphragm muscles that assist in breathing and coughing become weaker. Affected individuals experience breathing difficulties, respiratory infections, and swallowing problems. Almost all patients with DMD develop cardiomyopathy. Pneumonia associated with cardiac involvement is the most frequent cause of death, often occurring before the third decade.

[004] Becker muscular dystrophy (BMD) has less severe symptoms than DMD, but still leads to premature death. Compared to DMD, BMD is characterized by late-onset skeletal muscle weakness. While patients with DMD are wheelchair-dependent before age 13, those with BMD lose ambulation and require a wheelchair after age 16. Patients with BMD also exhibit preserved neck flexor muscle strength, unlike their DMD counterparts. Despite milder skeletal muscle impairment, heart failure due to DMD-associated dilated cardiomyopathy (DCM) is a common cause of morbidity and the most common cause of death in BMD, occurring on average in the mid-40s.

[005] Dystrophin is a cytoplasmic protein encoded by the DMD gene and functions to link cytoskeletal actin filaments to membrane proteins. Normally, dystrophin protein, located primarily in skeletal and cardiac muscles, with smaller amounts expressed in the brain, acts as a shock absorber during muscle fiber contraction by binding to actin. Petition 870260051626, dated 05 / 29 / 2026, page 10 / 511 3 / 241 of the contractile apparatus is the connective tissue layer that surrounds each muscle fiber. In muscle, dystrophin is located on the cytoplasmic face of the sarcolemma membrane.

[006] First identified in 1987, the DMD gene is the largest known human gene at approximately 2.5 Mb. The gene is located on the X chromosome at position Xp21 and contains 79 exons. The most common mutations that cause DMD or BMD are large deletion mutations of one or more exons (60-70%), however duplication mutations (5-10%) and single nucleotide variants (including small deletions or insertions, single base alterations and binding site alterations, representing approximately 25%-35% of pathogenic variants in men with DMD and about 10%-20% of men with BMD, can also cause pathogenic dystrophin variants.

[007] In DMD, mutations frequently lead to a structural shift resulting in a premature stop codon and a truncated, non-functional, or unstable protein. Nonsense point mutations can also result in premature stop codons with the same outcome. While mutations that cause DMD can affect any exon, exons 2-20 and 45-55 are common hotspots for large deletion and duplication mutations. Structural deletions result in the less severe Becker muscular dystrophy (BMD), in which patients express a partially functional, truncated dystrophin.

[008] Natural-sized dystrophin is a large protein (427 kDa) comprising a number of subdomains that contribute to its function. These subdomains include, in order from amino-terminal to carboxy-terminal, the N-terminal actin-binding domain, a central “rod” domain, a cysteine-rich domain, and lastly, a carboxy-terminal domain or region. The domain of Petition 870260051626, dated 05 / 29 / 2026, page 11 / 511 4 / 241 rod consists of 4 proline-rich linkage domains (abbreviated H) and 24 spectrin-like repeats (abbreviated R) in the following order: a first linkage domain (H1), 3 spectrin-like repeats (R1, R2, R3), a second linkage domain (H2), plus 16 spectrin-like repeats (R4, R5, R6, R7, R8, R9, R10, R11, R12, R13, R14, R15, R16, R17, R18, R19), a third linkage domain (H3), plus 5 spectrin-like repeats (R20, R21, R22, R23, R24) and finally a fourth linkage domain (H4). The carboxy-terminal subdomains of the protein are involved in connecting to the dystrophin-associated glycoprotein (DGC) complex, a large protein complex that forms a critical link between the cytoskeleton and the extracellular matrix.

[009] No treatment definitively stops or reverses the progression of DMD. Corticosteroid treatment is the current standard of care, however, this only slows progression by a year or two. Several new drugs for DMD have recently been approved by regulators. These include ataluren, which causes the reading of premature stop codons, and eteplirsen, which causes exon 51 skipping, generating a partially functional dystrophin deleted internally. However, the mechanism of action of these drugs is not expected to help all patients with DMD, and more evidence is needed to definitively demonstrate their clinical efficacy in DMD.

[010] With advances in the last 10-15 years in the use of adeno-associated virus (AAV)-mediated gene therapy to potentially treat a variety of rare diseases, there has been renewed hope and interest that AAV could be used to treat DMD and less severe dystrophinopathies (i.e., other muscle diseases associated with mutations in the DMD gene). Due to limitations in the payload size of AAV vectors, attention has focused Petition 870260051626, dated 05 / 29 / 2026, p. 12 / 511 5 / 241 in the creation of micro or mini-dystrophins, smaller versions of dystrophin that eliminate non-essential subdomains while maintaining at least some function of the full-size protein. AAV-mediated mini-dystrophin gene therapy has shown promise in mdx mice, an animal model for DMD, with widespread muscle expression and evidence of improved muscle function (see, for example, Wang et al., J. Orthop. Res. 27: 421 (2009)). When related experiments using a microdystrophin vector were attempted in the GRMD dog DMD model, however, powerful immunosuppressive drugs were required to achieve significant muscle cell transduction (Yuasa et al., Gene Ther. 14: 1249 (2007)).Similarly, when human patients with DMD were treated with AAV vectors designed to express a mini-dystrophin, the mini-dystrophin protein was detected in only two of the six patients, while a T-cell response against the mini-dystrophin protein was stimulated in three (Bowles, et al., Mol Ther. 20(2): 443-455 (2012)).

[011] Thus, there is a need in the technique for AAV vectors that encode mini-dystrophins that can be expressed at high levels in transduced cells from individuals with DMD, while minimizing immune responses to the mini-dystrophin protein. Summary of the Invention

[012] Minidystrophin proteins, codon-optimized genes for expressing such minidystrophin proteins, AAV vectors for transducing cells with such genes, and methods of prevention and treatment using such AAV vectors are described and exemplified here, particularly for the prevention and treatment of dystrophinopathies in individuals in need thereof. In some of these embodiments, the AAV vectors described are capable of guiding the production of significant levels of minidystrophin in cells. Petition 870260051626, dated 05 / 29 / 2026, page 13 / 511 6 / 241 transduced proteins cause little or no immune response, or only a mutated response, against the mini-dystrophin protein.

[013] Certain non-limiting embodiments (E) of the inventions described are mentioned below. These and other related embodiments are described in more detail in the Detailed Description, including Examples and Drawings.

[014] E1. A mini-dystrophin protein comprising, consisting essentially of, or comprising the N-terminal, Actin-Binding Domain (ABD), H1 junction, R1 and R2 rods, H3 junction, R22, R23, and R24 rods, H4 junction, the Cysteine-Rich Domain (CR), and a portion of the carboxy-terminal (CT) domain of wild-type human muscle dystrophin protein (SEQ ID NO: 25), wherein the CT domain does not comprise the last three amino acid residues in the carboxy-terminal of wild-type dystrophin protein.

[015] E2.The E1 mini-dystrophin protein, in which the N-terminal and Actin-Binding Domain (ABD) together comprise, essentially consist of, or consist of amino acid numbers 1-240 of SEQ ID NO: 25; linkage H1 comprises, essentially consists of, or consists of amino acid numbers 253-327 of SEQ ID NO: 25; rod R1 comprises, essentially consists of, or consists of amino acid numbers 337-447 of SEQ ID NO: 25; rod R2 comprises, essentially consists of, or consists of amino acid numbers 448-556 of SEQ ID NO: 25; linkage H3 comprises, essentially consists of, or consists of amino acid numbers 2424-2470 of SEQ ID NO: 25; rod R22 comprises, essentially consists of, or consists of amino acid numbers 2687-2802 of SEQ ID NO: 25; R23 rod comprises, consists essentially of, or consists of amino acid numbers 2803-2931 of SEQ ID NO: 25; R24 rod comprises, consists of. Petition 870260051626, dated 05 / 29 / 2026, page 14 / 511 7 / 241 essentially comprises, or consists of amino acid numbers 2932-3040 of SEQ ID NO: 25; the H4 linkage comprises, consists essentially of, or consists of amino acid numbers 3041-3112 of SEQ ID NO: 25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 of SEQ ID NO: 25; and the CT domain portion comprises, consists essentially of, or consists of amino acid numbers 3300-3408 of SEQ ID NO: 25.

[016] E3. The mini-dystrophin protein of any of the E1 and E2, in which the mini-dystrophin protein comprises, consists essentially of, or consists of, the amino acid sequence of SEQ ID NO: 7.

[017] E4. The mini-dystrophin protein comprising, consisting essentially of, or comprising the N-terminal, Actin Binding Domain (ABD), H1 junction, rods R1, R2, R22, R23, and R24, H4 junction, the Cysteine-Rich Domain (CR), and a portion of the carboxy-terminal (CT) domain of the wild-type human muscle dystrophin protein (SEQ ID NO: 25), wherein the CT domain does not comprise the last three amino acid residues in the carboxy-terminal of the wild-type dystrophin protein.

[018] E5. The E4 mini-dystrophin protein in which the N-terminal and Actin-Binding Domain (ABD) together comprise, consist essentially of, or consist of amino acid numbers 1-240 of SEQ ID NO: 25; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 of SEQ ID NO: 25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 of SEQ ID NO: 25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 of SEQ ID NO: 25; R22 comprises, consists Petition 870260051626, dated 05 / 29 / 2026, page 15 / 511 8 / 241 essentially comprises, or consists of amino acid numbers 2687-2802 of SEQ ID NO: 25; rod R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 of SEQ ID NO: 25; rod R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 of SEQ ID NO: 25; linkage H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 of SEQ ID NO: 25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 of SEQ ID NO: 25; and the CT domain portion comprises, consists essentially of, or consists of amino acid numbers 3300-3408 of SEQ ID NO: 25.

[019] E6. The mini-dystrophin protein of any of the E4 and E5, in which the mini-dystrophin protein comprises, consists essentially of, or consists of, the amino acid sequence of SEQ ID NO: 8.

[020] E7. A polynucleotide encoding the E1-E3 minidystrophin protein.

[021] E8. A polynucleotide encoding the E4-E6 minidystrophin protein.

[022] E9. The polynucleotide of either E7 or E8, wherein the nucleobase sequence thereof is assembled from the coding sequence of the native wild-type gene encoding natural-size human muscle dystrophin, an example of which is provided by NCBI Reference Sequence NM_004006.2.

[023] E10. The E9 polynucleotide, wherein the nucleobase sequence thereof is given by SEQ ID NO: 26.

[024] E11. The polynucleotide of any one of E7-E10, in which the nucleobase sequence is optimized per codon.

[025] E12. The E11 polynucleotide, where optimization by Petition 870260051626, dated 05 / 29 / 2026, page 16 / 511 Codon 9 / 241 decreases or increases the GC content compared to the wild-type sequence.

[026] E13. The E11 polynucleotide, in which codon optimization decreases or increases the number of CpG dinucleotides compared to the wild-type sequence.

[027] E14. The E11 polynucleotide, in which codon optimization eliminates one or more hidden binding sites.

[028] E15. The E11 polynucleotide, in which codon optimization eliminates one or more ribosome entry sites other than that at the beginning of the coding sequence for the minidystrophin protein.

[029] E16. The E11 polynucleotide, in which codon optimization replaces one or more rare codons with codons that occur more frequently in the cell type and / or species in which the minidystrophin gene is intended to be expressed.

[030] E17. The E12 polynucleotide, in which codon optimization increases the GC content compared to the wild type and increases the gene expression level by at least 50%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 550%, 600%, 650%, 700%, 750%, 800%, 900%, 1000%, or more.

[031] E18. The E12 polynucleotide in which codon optimization increases the GC content compared to the wild type by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more.

[032] E19. The E12 polynucleotide wherein the GC content is about or at least 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, or more.

[033] E20. The E13 polynucleotide, in which codon optimization decreases or increases the number of CpG dinucleotides in Petition 870260051626, dated 05 / 29 / 2026, p. 17 / 511 10 / 241 comparison to the wild type by about or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or more.

[034] E21. The E20 polynucleotide, in which the number of CpG dinucleotides, if reduced, is reduced by a sufficient amount to suppress totally or partially the silencing of gene expression due to methylation of CpG motifs.

[035] E22. The E11 polynucleotide, in which codon optimization increases the codon adaptation index (CAI) of the mini-dystrophin gene in reference to highly expressed human genes to a value that is at least 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 or 0.99.

[036] E23. The polynucleotide of any one of E11-E22, in which the nucleobase sequence is optimized by human codon.

[037] E24. The polynucleotide of any of E11-E22, in which the nucleobase sequence is optimized by canine codon.

[038] E25. The E23 polynucleotide, wherein the human codon-optimized sequence is given by SEQ ID NO: 1, or a nucleobase sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the same.

[039] E26. The E23 polynucleotide, wherein the human codon-optimized sequence is given by SEQ ID NO: 2, or a nucleobase sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the same.

[040] E27. The E24 polynucleotide, wherein the canine codon optimized sequence provided by SEQ ID NO: 3, or a nucleobase sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identical to the same.

[041] E28. A vector comprising the polynucleotide of Petition 870260051626, dated 05 / 29 / 2026, p. 18 / 511 11 / 241 any one of E7-E27.

[042] E29. The E28 vector, in which the polynucleotide is operably linked to a genetic control region.

[043] E30. The E29 vector, in which the genetic control region is a promoter.

[044] E31. The E30 vector, in which the promoter is muscle-specific, is more active in muscle cells compared to other cell types, such as liver cells.

[045] E32. The vector of any of E30-E31, in which the genetic control region also includes an enhancer.

[046] E33. The vector of any of E30-E32, in which the promoter, and enhancer if present, is a muscle creatine kinase (CK) gene.

[047] E34. The E33 vector, in which the CK gene is from a mouse or human.

[048] E35. The E33 vector, in which the genetic control region is the mouse CK7 enhancer and promoter.

[049] E36. The vector of any one of E29-E36, wherein the genetic control region comprises the nucleobase sequence selected from the SEQ ID N4, SEQ ID N5 and SEQ ID N16 group.

[050] E37. The vector of any of E28-E36, in which the polynucleotide is operably linked to a transcription terminator region.

[051] E38. Vector of E37, wherein the transcription terminator region comprises the nucleobase sequence of SEQ ID NO: 6 or SEQ ID NO: 17.

[052] E39. The vector of any of E28-E38, wherein the vector is an AAV viral vector genome and comprises flanking AAV inverted terminal repeats (ITRs).

[053] E40. The vector of E39, where the ITRs are both ITRs of Petition 870260051626, dated 05 / 29 / 2026, page 19 / 511 12 / 241 AAV2.

[054] E41. The vector of any one of E39 and E40, wherein the vector nucleobase sequence is given by a nucleobase sequence selected from the group SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12 and SEQ ID NO: 18.

[055] E42. A recombinant AAV particle (rAAV) comprising an AAV capsid and the vector of any one of E39-E41.

[056] E43. The E42 rAAV particle, in which the E42 capsid AAV is the capsid of AAV9.

[057] E44. An rAAV particle, comprising an AAV capsid having tropism for striated muscle and a vector genome to express a human mini-dystrophin protein.

[058] E45. The rAAV particle of E44, in which the capsid of AAV is of the AAV9 serotype.

[059] E46. The rAAV particle of any one of E44 and E45, in which the vector genome comprises a human codon-optimized nucleic acid sequence encoding the human minidystrophin protein.

[060] E47. The rAAV particle of any one of E44E46, wherein the human mini-dystrophin protein comprises the following subdomains or portions thereof of the full-size human muscle dystrophin protein in order from N-terminal to C-terminal: N-terminal domain, Actin Binding Domain (ABD), H1 junction, R1 rod, R2 rod, H3 junction, R22 rod, R23 rod, R24 rod, H4 junction, the Cysteine-Rich Domain (CR) and a carboxy-terminal (CT) portion, wherein the CT domain portion does not include the last 3 amino acids of dystrophin.

[061] E48. The rAAV particle of any one of E44-E47, in which the human mini-dystrophin protein comprises the sequence Petition 870260051626, dated 05 / 29 / 2026, page 20 / 511 13 / 241 amino acid of SEQ ID NO: 7.

[062] E49. The rAAV particle of any one of E44-E46, wherein the human mini-dystrophin protein comprises the following subdomains or portions thereof of the full-size human muscle dystrophin protein in order from N-terminal to C-terminal: N-terminal domain, Actin Binding Domain (ABD), H1 junction, R1 rod, R2 rod, R22 rod, R23 rod, R24 rod, H4 junction, the Cysteine-Rich Domain (CR) and a portion of the carboxy-terminal domain (CT), wherein the CT domain portion does not include the last 3 amino acids of dystrophin.

[063] E50. The rAAV particle of any one of E44-E46 and E49, in which the human mini-dystrophin protein comprises the amino acid sequence of SEQ ID NO: 8.

[064] E51. The rAAV particle of any one of E44-E47, in which the human codon-optimized nucleic acid sequence encoding the human mini-dystrophin protein comprises the nucleic acid sequence of SEQ ID NO: 1.

[065] E52. The rAAV particle of any one of E44-E46, E49 and E50, wherein the human codon-optimized nucleic acid sequence encoding the human mini-dystrophin protein comprises the nucleic acid sequence SEQ ID NO: 3.

[066] E53. The rAAV particle of any one of E44-E52, wherein the vector genome further comprises inverted terminal repeats (ITRs) of AAV flanking the codon-optimized nucleic acid sequence.

[067] E54. The rAAV particle of E53, in which the ITRs of AAV are ITRs of AAV2.

[068] E55. The rAAV particle of any one of E44-E54, wherein the vector genome further comprises a muscle-specific transcriptional regulatory element operably linked with the Petition 870260051626, dated 05 / 29 / 2026, page 21 / 511 14 / 241 nucleic acid sequence optimized by human codon.

[069] E56. The E55 rAAV particle, in which the muscle-specific transcriptional regulatory element is positioned between the 5' AAV2 ITR and the human codon-optimized nucleic acid sequence.

[070] E57. The rAAV particle of any of E55 and E56, wherein the muscle-specific transcriptional regulatory element is derived from the human or mouse creatine kinase (CK) gene.

[071] E58. The rAAV particle of any one of E55-E57, wherein the muscle-specific transcriptional regulatory element comprises an enhancer and a promoter.

[072] E59. The rAAV particle of any one of E55-E58, in which the muscle-specific transcriptional regulatory element is the mouse CK7 enhancer and promoter.

[073] E60. The rAAV particle of any one of E55-E59, in which the muscle-specific transcriptional regulatory element comprises the nucleic acid sequence SEQ ID NO: 16.

[074] E61. The rAAV particle of any one of E44-E60, wherein the vector genome further comprises a transcription termination sequence positioned between the codon-optimized nucleic acid sequence and the 3' AAV2 ITR.

[075] E62. The rAAV particle of E61, in which the transcription termination sequence comprises a polyadenylation signal.

[076] E63. The rAAV particle of any one of E44-E62, in which the vector genome comprises in the order 5' to 3': a first AAV2 ITR, a muscle-specific transcriptional regulatory element operably linked to a human codon-optimized nucleic acid sequence encoding a human minidystrophin protein, a transcription termination sequence and a second AAV2 ITR. Petition 870260051626, dated 05 / 29 / 2026, p. 22 / 511 15 / 241

[077] E64. The rAAV particle of E63, in which the muscle-specific transcriptional regulatory element comprises the nucleic acid sequence SEQ ID NO: 16.

[078] E65. The rAAV particle of the E63 or E64 embodiments, in which the human codon-optimized nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO: 1.

[079] E66. The rAAV particle of the E63-E65 embodiments, in which the transcription termination sequence comprises the nucleic acid sequence of SEQ ID NO: 17.

[080] E67. The rAAV particle of any of E44-E48, E51 and E53-E66, wherein the vector genome comprises the nucleic acid sequence of SEQ ID NO: 18 or its reverse complement.

[081] E68. The rAAV particle of any one of E44-E48, E51 and E53-E66, where the vector genome consists essentially of the nucleic acid sequence SEQ ID NO: 18 or its reverse complement.

[082] E69. The rAAV particle of any one of E44-E48, E51 and E53-E66, wherein the vector genome consists of the nucleic acid sequence SEQ ID NO: 18 or its reverse complement.

[083] E70. A recombinant AAV particle comprising an AAV9 capsid and a vector genome comprising the nucleic acid sequence of SEQ ID NO: 18 or its reverse complement.

[084] E71. A recombinant AAV particle comprising an AAV9 capsid and a vector genome consisting essentially of the nucleic acid sequence of SEQ ID NO: 18 or its reverse complement.

[085] E72. A recombinant AAV particle comprising an AAV9 capsid and a vector genome consisting of the nucleic acid sequence of SEQ ID NO: 18 or its reverse complement. Petition 870260051626, dated 05 / 29 / 2026, page 23 / 511 16 / 241

[086] E73. A pharmaceutical composition comprising the rAAV particle of any one of E42-E72 and a pharmaceutically acceptable carrier.

[087] E74. A method for treating a dystrophinopathy comprising administering to an individual in need of treatment for a dystrophinopathy a therapeutically effective amount of the composition of E73.

[088] E75. Use of recombinant AAV particle (rAAV) of any of E42-E72 or use of the E73 composition in the preparation of a medicament for the treatment of an individual with a dystrophinopathy.

[089] E76. The rAAV particle of any one of E42-E72 or the E73 composition for use in the treatment of an individual having a dystrophinopathy.

[090] E77. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the dystrophinopathy is Duchenne Muscular Dystrophy (DMD), Becker Muscular Dystrophy (BMD), or DMD-associated dilated cardiomyopathy.

[091] E78. The method, use, particle of rAAV, or composition for use of any of E74-E77, wherein the individual is a human individual of the male or female sex.

[092] E79. The method, use, rAAV particle, or composition for use of any of E74-E78, wherein the individual is ambulatory when first treated or administered with the composition.

[093] E80. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the individual is about or at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 years of age when first treated or administered with the composition.

[094] E81. The method, use, particle of rAAV, or composition for use of any of E74-E79, wherein the method, use, particle Petition 870260051626, dated 05 / 29 / 2026, page 24 / 511 17 / 241 of rAAV, or composition for use, is effective in restoring the dystrophin-associated protein complex in the sarcolemma of muscle cells compared to untreated controls.

[095] E82. The method, use, rAAV particle or composition for use of any of E74-E79, wherein the method, use, rAAV particle or composition for use is effective in improving dystrophic histopathology in the heart compared to untreated controls.

[096] E83. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in inhibiting fibrosis in the muscle and diaphragm of the limbs compared to untreated controls.

[097] E84. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing the muscle injury score compared to untreated controls.

[098] E85. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing muscle fatigue compared to untreated controls.

[099] E86. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in increasing the maximum relative or absolute limb grip strength of Dmdmd1 rats compared to untreated controls.

[0100] E87. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in increasing the detectable level of mini-dystrophin mRNA or protein in muscle. Petition 870260051626, dated 05 / 29 / 2026, page 25 / 511 18 / 241 skeletal, cardiac muscle or diaphragm.

[0101] E88. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing mean MMP-9 levels in the blood of subjects to within about 15-, 14-, 13-, 12-, 11-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or twice as high as in healthy controls.

[0102] E89. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing the middle levels of ALT, AST, or LDH in the blood of individuals to within about 7-, 6-, 5-, 4-, 3-, or 2 times greater than in healthy controls.

[0103] E90. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing mean total CK levels in the blood of subjects to about 50-48, 46, 44, 42, 40, 38, 36, 34, 32, 30, 28, 26, 24, 22, 20, 18, 16-, 14-, 12-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or twice as high as in healthy controls.

[0104] E91. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in increasing the mean 6-minute walk distance (6MWD) of individuals by at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 meters compared to the mean 6MWD of untreated controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.

[0105] E92. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, Petition 870260051626, dated 05 / 29 / 2026, page 26 / 511 19 / 241 rAAV particle, or composition for use, is effective in reducing the average time required to perform the 4-step climb test by at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, or 4.0 seconds compared to the average time of untreated controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.

[0106] E93. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing the average proportion of individuals who lost ambulation by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65% compared to the average proportion of untreated controls who lost ambulation 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.

[0107] E94. The method, use, rAAV particle, or composition for use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in reducing the mean fat fraction in the lower extremities of subjects by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75% compared to the mean fat fraction in the lower extremities of untreated controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.

[0108] E95. The method, use, particle of rAAV, or composition for use of any of E88-E94, wherein the controls are age and sex matched to the subjects.

[0109] E96. The method, use, rAAV particle, or composition for use of any of E91-E94, wherein subjects and untreated controls are stratified according to age, prior corticosteroid treatment and / or baseline performance on the 6MWT.

[0110] E97. The method, use, particle of rAAV, or composition for Petition 870260051626, dated 05 / 29 / 2026, page 27 / 511 20 / 241 use of any of E74-E79, wherein the method, use, rAAV particle, or composition for use is effective in causing at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of an individual's skeletal muscle fibers to express the mini-dystrophin protein 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.

[0111] E98. The method, use, particle of rAAV, or composition for use of any of E97, in which skeletal muscle fibers are present in a biopsy of the individual's biceps, deltoid, or quadriceps muscle.

[0112] E99. The method, use, rAAV particle, or composition for use of any of E74-E98, wherein the method, use, rAAV particle, or composition for use causes a cellular immune response against mini-dystrophin protein or muscle inflammation in less than or equal to approximately 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% of individuals 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 months after vector administration.

[0113] E100. The method, use, rAAV particle, or composition for use of any of E74-E99, wherein the method, use, rAAV particle, or composition for use is effective without the need for concomitant immunosuppression in treated subjects.

[0114] E101. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the subject is a Dmdmd1 rat and the method, use, rAAV particle, or composition for use is effective in resulting in a reduction of serum AST, ALT, LDH, or total creatine kinase levels at 3 months or 6 months after injection compared to age-matched controls administered vehicle alone. Petition 870260051626, dated 05 / 29 / 2026, page 28 / 511 21 / 241

[0115] E102. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the individual is a Dmdmd1 rat and the method, use, rAAV particle, or composition for use is effective in resulting in a reduction of fibrosis in biceps femoris, diaphragm, or cardiac muscle at 3 months or 6 months after injection compared to age-matched controls administered vehicle alone.

[0116] E103. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the individual is a Dmdmd1 rat and the method, use, rAAV particle, or composition for use is effective in resulting in an increase in hind paw grip strength at 3 months or 6 months after injection, compared to age-matched controls administered with the vehicle alone.

[0117] E104. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the individual is a Dmdmd1 rat and the method, use, rAAV particle, or composition for use is effective in resulting in a reduction of muscle fatigue measured in 5 closely spaced tests, testing hind paw grip strength at 3 months or 6 months after injection, compared to age-matched controls administered vehicle only.

[0118] E105. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the subject is a Dmdmd1e rat, the method, use, rAAV particle, or composition for use is effective in resulting in an increase in left ventricular ejection fraction when measured using echocardiography at 6 months post-injection, compared to age-matched controls administered vehicle alone.

[0119] E106. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the individual is a Dmdmd1e rat and the method, use, rAAV particle, or composition for Petition 870260051626, dated 05 / 29 / 2026, page 29 / 511 22 / 241 use is effective in resulting in an increase in the early-to-late left ventricular velocity-to-load ratio (i.e., E / A ratio) measured by echocardiography at 3 months or 6 months post-injection, compared to age-matched controls administered vehicle alone.

[0120] E107. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the subject is a Dmdmd1 rat and the method, use, rAAV particle, or composition for use is effective in resulting in a decrease in isovolumetric relaxation time (IVRT) or in the time in milliseconds between the peak E velocity and its return to baseline, wherein the E-wave deceleration time (DT) is measured using echocardiography at 3 months or 6 months after injection compared to age-matched controls.

[0121] E108. The method, use, rAAV particle, or composition for use of E74-E76, wherein the individual is a Drndmdxe rat, the method, use, rAAV particle, or composition for use is effective in transducing biceps femoris, diaphragm, cardiac muscle, or other striated muscles and expressing the mini-dystrophin protein encoded by the opti-Dys3978 gene without inducing a cellular immune response against the mini-dystrophin protein at 3 months or 6 months after injection.

[0122] E109. The method, use, rAAV particle, or composition for use of any of E74-E76, wherein the subject is a Drndmdxe rat, the method, use, rAAV particle, or composition for use is effective in partially or completely reversing the increase in left ventricular end-diastolic diameter at 6 months after injection compared to age-matched controls administered vehicle alone.

[0123] E110. The method, use, particle of rAAV or composition for use of any of E74-E100, in which the individual is Petition 870260051626, dated 05 / 29 / 2026, page 30 / 511 23 / 241 also treated with, or the composition also comprises, at least one second agent effective for the treatment of dystrophinopathy, examples of which include an antisense oligonucleotide that causes exon skipping of the DMD gene, an antimyostatin antibody, an agent that promotes ribosomal reading of nonsense mutations, an agent that suppresses premature stop codons, an anabolic steroid, or a corticosteroid (such as, without limitation, prednisone, deflazacort, or prednisolone).

[0124] E111. The method, use, particle of rAAV, or composition for use of any of E74-E110, wherein the composition is administered systemically, such as by intravenous injection, or locally, such as directly into a muscle.

[0125] E112. The method, use, rAAV particle, or composition for use of any of E74-E111, wherein the dose of rAAV particles used in the method, use, rAAV particle, or composition for use is selected from the dose group consisting of: 1x1012vg / kg, 2x1012vg / kg, 3x1012vg / kg, 4x1012vg / kg, 5x1012vg / kg, 6x1012vg / kg, 7x1012vg / kg, 8x1012vg / kg, 9x1012vg / kg, 1x1013vg / kg, 2x1013vg / kg, 3x1013vg / kg, 4x1013vg / kg, 5x1013vg / kg, 6x1013vg / kg, 7x1013vg / kg, 8x1013vg / kg, 9x1013vg / kg, 1x1014vg / kg, 1.5x1014vg / kg, 2x1014vg / kg, 2.5x1014vg / kg, 3x1014vg / kg, 3.5x1014vg / kg, 4x1014vg / kg, 5x1014vg / kg, 6x1014vg / kg, 7x1014vg / kg, 8x1014vg / kg, and 9x1014vg / kg, where vg / kg represents vector genomes per kilogram of the individual's body weight.

[0126] E113. The composition of E73, also comprising empty capsids of the same AAV serotype as the rAAV particle, wherein the concentration ratio of empty capsids to rAAV particles is about, or at least, 0.5:1, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1 or more.

[0127] E114. The method of expressing a mini protein Petition 870260051626, dated 05 / 29 / 2026, page 31 / 511 24 / 241 dystrophin in a cell, comprising contacting the cell with the rAAV particle of any one of E42-E72.

[0128] E115. The E114 method, in which the cell is a muscle cell.

[0129] E116. The E115 method, in which the muscle cell is from skeletal muscle, diaphragm or heart.

[0130] E117. Method of producing rAAV particles from any of E42-E72, comprising introducing into a producer cell the vector from any of E39-E41, an AAV rep gene, an AAV cap gene and genes for auxiliary functions, incubating the cells and purifying the rAAV particles produced by the cells.

[0131] E118. adherents.

[0132] E119. non-adherent.

[0133] E120. The E117 method, in which the producing cells are The E117 method, in which the producing cells are The method uses any of E117-E119, where the vector is contained in one plasmid, the AAV rep and cap genes are contained in a second plasmid, and the helper function genes are contained in a third plasmid, where all three plasmids are introduced into the packaging cells.

[0134] E121. The method of any of E117-E120, in which the introduction step is performed by transfection.

[0135] E122. The method of any one of E117-E121, wherein the producing cells are HEK293 cells.

[0136] E123. The method of any one of E117-E122, in which the producing cells are cultured in serum-free medium.

[0137] E124. The method of any one of E117-E123, in which the AAV cap gene encodes the AAV9 proteins VP1, VP2 and VP3.

[0138] E125. The method of any one of E117-E124, in which rAAV particles are purified using ultracentrifugation Petition 870260051626, dated 05 / 29 / 2026, page 32 / 511 25 / 241 density gradient or column chromatography.

[0139] E126. A rAAV particle produced by the method of any one of E117-E125. Brief Description of the Drawings

[0140] Figure 1 shows the construction of highly truncated mini-dystrophin genes. Wild-type muscle dystrophin has four main domains: the N-terminal domain (N); the central rod domain, which contains 24 rod repeats (R) and four joints (H); a cysteine-rich domain (CR); and the carboxy-terminal domain (CT). The mini-dystrophin genes were constructed by eliminating a large portion of the central rods and joints and most of the CT domain. The mini-dystrophin genes were codon-optimized, fully synthesized, and subsequently cloned between a CMV promoter or a muscle-specific synthetic hybrid promoter at the 5' end of the gene, and a small poly(A) sequence at the 3' end of the gene.This gene segment, containing a promoter, codon-optimized mini-dystrophin gene, and polyA signal, was then cloned into a plasmid containing left and right terminal inverted AAV repeats (ITRs) so that the gene segment was flanked by the ITRs.

[0141] Figure 2 shows that codon optimization effectively increases mini-dystrophin gene expression. The upper panels show immunofluorescence (IF) staining of the mini-dystrophin protein in (A) untransfected 293 cells or after transfection of original unoptimized plasmids (B), or of optimized mini-dystrophin Dys3978 (C). The lower panels show Western blots of mini-dystrophin in transfected 293 cells. The stain on the left used an equal amount of cell lysates and shows overwhelming expression by the optimized cDNA. The stain on the right used Petition 870260051626, dated 05 / 29 / 2026, page 33 / 511 26 / 241 a 100X dilution of the cell lysate from 293 cells transfected with optimized mini-dystrophin cDNA, while the non-optimized sample was not diluted. Note that the signal from the optimized sample is still stronger after 100X dilution.

[0142] Figure 3 shows IF staining of human minidystrophin expression in dystrophin / utrophin double knockout (dKO) mice treated with AAV9 vector. Muscle and heart samples from wild-type control C57BL / 10 (C57) mice, untreated dKO mice, and AAV9-CMV-HoptiDys3978 (T-dKO) treated dKO mice were finely sectioned and stained with an antibody that also equally recognizes mouse wild-type dystrophin and human minidystrophin protein. Highly efficient expression was achieved in all samples examined.

[0143] Figure 4 shows the normalization of body weight in dKO mice as a result of treatment with AAV9-CMVHopti-Dys3978. Data were obtained at 4 months of age from wild-type control B10 mice (C57BL / 10), untreated mdx mice, untreated dKO mice, and vector-treated dKO mice.

[0144] Figure 5 shows the improvement in grip strength and treadmill running in dKO mice as a result of treatment with AAV9-CMV-Hopti-Dys3978. Data were obtained at 3 months of age from wild-type control B10 mice (C57BL / 10), untreated mdx mice, untreated dKO mice, and vector-treated dKO mice (T-dKO).

[0145] Figures 6A-6B show the dilution of dystrophic pathology in dKO mice as a result of treatment with AAV9-CMVHopti-Dys3978. (Figure 6A) Cryosections (8 µm) of anterior tibial muscles of wild-type control C57BL / 10 mice, Petition 870260051626, dated 05 / 29 / 2026, page 34 / 511 27 / 241 untreated dKO mice and vector-treated dKO (T-dKO) mice were subjected to hematoxylin and eosin (H&E) staining for histopathology (10X magnification). (Figure 6B) Quantitative analyses of muscle mass, heart mass, percentage of centrally located nuclei, and serum creatine kinase activities.

[0146] Figure 7 shows survival curves of dKO mice treated with the human codon-optimized mini-dystrophin vector Dys3978 (AAV9-CMV-Hopti-Dys3978) compared to untreated dKO mice and wild-type mice. More than 50% of the treated dKO mice survived for more than 80 weeks (duration of the experiment).

[0147] Figure 8 shows improved cardiac function in dKO mice as a result of treatment with AAV9-CMVHopti-Dys3978. Hemodynamic analysis was performed on wild-type control C57BL / 10 mice, untreated mdx mice, and dKO mice treated with the AAV9 vector. Untreated dKO mice were too ill to sustain the procedure. Data were collected from the three groups of mice with or without dobutamine challenge.

[0148] Figures 9A-9B show improvement in the electrocardiogram (ECG) of dKO mice as a result of treatment with AAV9-CMV-Hopti-Dys3978. (Figure 9A) The ECG PR interval was improved in vector-treated dKO mice. (Figure 9B) Quantitative data from the analysis. The experiment was conducted to carefully monitor the heart rate of the three groups so that the ECG was not affected by heart rate variation. *p<0.05.

[0149] Figure 10 shows a comparison of the tissue-nonspecific CMV promoter and the muscle-specific hCK promoter in the conduction of human codon-optimized mini-dystrophin Dys3978 in Petition 870260051626, dated 05 / 29 / 2026, page 35 / 511 28 / 241 mdx mice were injected into the caudal vein with AAV9Hopti-Dys3978 vectors containing either a CMV promoter or hCK. Using IF staining, the human mini-dystrophin Dys3978 showed strong expression in limb muscle and cardiac muscle. It appears that the hCK promoter was more effective than the CMV promoter.

[0150] Figure 11 shows magnetic resonance imaging (MRI) images of the hind paw of the dog GRMD “Jelly” after perfusion of the isolated paw vein with the AAV9-CMV-Hopti-Dys3978 vector.

[0151] The vector was pressure-infused into the right hind paw, which had a tight tourniquet placed in the groin area. Whitish spots indicated retention of vector solution in the perfused paw.

[0152] Figure 12 shows IF staining of human minidystrophin Dys3978 expression 2 months after vector injection in the dog with GRMD “Jelly”. Biopsy samples from 5 different muscle groups in both right and left hind legs were examined. The uninjected left leg also showed detectable dys3978, suggesting that the AAV9 vector had traveled from the injection site to the contralateral leg.

[0153] Figure 13 shows the IF staining of human minidystrophin Dys3978 expression 7 months after vector injection into the dog with GRMD “Jelly”. Biopsy samples from 4 different muscle groups in both the right and left hind legs were examined. The uninjected left leg also had detectable Dys3978, suggesting that the AAV9 vector had traveled from the injection site to the contralateral leg. Western blot analysis of Dys3978 was performed on the same samples.

[0154] Figure 14 shows IF staining of human Dys3978 minidystrophin expression 12 months after vector injection into the dog with GRMD “Jelly”. Biopsy samples from 4 muscle groups Petition 870260051626, dated 05 / 29 / 2026, page 36 / 511 29 / 241 different samples from the right and left hind paws and 1 sample from the foreleg were examined. The uninjected left paw also had detectable Dys3978, suggesting that the AAV9 vector had traveled from the injection site to the contralateral leg.

[0155] Figure 15 shows the IF staining of human minidystrophin Dys3978 expression 2 years after vector injection in the dog with GRMD “Jelly”. Biopsy samples from 2 different muscle groups in both right and left hind paws were examined. Note that the uninjected left paw appears to have more detectable Dys3978 than the injected paw.

[0156] Figure 16 shows the mini-dystrophin IF stain Dys3978 human. Biopsy samples of muscle groups (compared to Figure 15) in both the right and left hind paws and one sample in the forepaw were examined from the dog with GRMD “Jelly”. Samples were also collected 2 years after vector injection.

[0157] Figure 17 shows the mini-dystrophin IF stain Dys3978 human 4 years after vector injection into the uninjected left hind paw of the dog with GRMD “Jelly”.

[0158] Figure 18 shows the mini-dystrophin IF stain Dys3978 human more than 8 years after vector injection into the dog with GRMD “Jelly”. Necropsy muscle samples from 5 different muscle groups and the heart were examined.

[0159] Figure 19 shows the IF staining of mini-dystrophin Dys3978 human and endogenous reversed dystrophin over 8 years after vector injection in a dog with GRMD “Jelly”. Necropsy muscle samples from three different muscle groups were stained with an antibody that recognized both human and canine dystrophin (top panel) or an antibody that only recognized canine reversed dystrophin (bottom panel). Myofibers positive for Petition 870260051626, dated 05 / 29 / 2026, page 37 / 511 30 / 241 reversed dystrophin fibers were highlighted by arrows. Reversed fibers are rare muscle fibers that stain positively for the dystrophin protein that occurs in human DMD patients, as well as mdx mice and dogs with GRMD. The precise mechanism by which reversed fibers occur is not fully understood, however, it may involve exon skipping in rare muscle cells that produce a shortened dystrophin with epitopes recognized by antibody probes. See, for example, Lu, QL, et al., J Cell Biol 148: 985-96 (2000).

[0160] Figure 20 shows Western blot analyses of human mini-dystrophin Dys3978 present in muscle samples from a dog with GRMD “Jelly” at necropsy more than 8 years after injection of the AAV9 vector. Western blot showed that human mini-dystrophin Dys3978 was present in all skeletal muscles examined. Muscle from a normal age- and sex-matched dog named “Molly” was used as a positive control with 2-fold serial dilutions to indicate the quantification of the dystrophin protein. The molecular weight of wild-type natural-size dystrophin is approximately 400 kDa while the Dys3978 mini-dystrophin protein is approximately 150 kDa.

[0161] Figure 21 shows the improvement in muscle contractile strength in the GRMD dog “Jelly” after injection of the AAV9-CMV-HoptiDys3978 vector and whole-body gene expression. The upper curve represents the muscle strength of a normal dog, while the lower curve represents the muscle strength of the untreated GRMD dog. The two curves extended over more time points represent the muscle strength of the “Jelly” dog. Two more GRMD dogs treated with the canine mini-dystrophin vector Dys3849 from Ays9-CMV (Wang, et al., PNAS 97(25): 13714-9 (2000)) were also examined for muscle strength, and showed improvement (“Jasper” and “Peridot”). Petition 870260051626, dated 05 / 29 / 2026, page 38 / 511 31 / 241

[0162] Figure 22 shows IF staining of muscle biopsy for human mini-dystrophin expression 4 months after injection of the AAV9-hCK-Copti-Dys3978 vector into the GRMD dog “Dunkin”. The vector was delivered by intravenous injection to achieve gene expression throughout the body. Biopsy samples from 4 different muscle groups in the hind legs were examined. Note the almost uniform mini-dystrophin Dys3978 detected in all muscle groups.

[0163] Figure 23 shows IF staining of human minidystrophin expression at 14 months after injection of the AAV9-hCKCopti-Dys3978 vector into the GRMD dog “Dunkin.” Necropsy samples were collected and examined. Note the widespread and strong levels of mini-dystrophin Dys3978 detected in the heart and all muscle groups. 4X magnification.

[0164] Figure 24 shows IF staining of the diaphragm muscle with strong levels of human mini-dystrophin detected 14 months after injection of the AAV9-hCK-Copti-Dys3978 vector in the dog with GRMD “Dunkin.”

[0165] Figure 25 shows IF staining of the peroneus longus muscle with strong levels of human mini-dystrophin detected 14 months after injection of the AAV9-hCK-Copti-Dys3978 vector in the dog with GRMD “Dunkin.”

[0166] Figure 26 shows IF staining of the semimembranosus muscle with strong levels of human mini-dystrophin detected 14 months after injection of the AAV9-hCK-CoptiDys3978 vector in the dog with GRMD “Dunkin.”

[0167] Figure 27 shows IF staining of left ventricular (LV) heart muscle with strong levels of human mini-dystrophin detected 14 months after injection of the AAV9-hCK-CoptiDys3978 vector in the GRMD dog “Dunkin.”

[0168] Figure 28 shows the Western Blot detection of miniPetition 870260051626, dated 05 / 29 / 2026, page 39 / 511 32 / 241 human dystrophin Dys3978 was detected in muscle samples from a dog with GRMD “Dunkin” at 4 months and 14 months after vector injection. Muscle from a normal dog of the same age was used as a positive control with 2-fold serial dilutions to indicate the quantification of dystrophin protein. The molecular weight of wild-type natural-size dystrophin is approximately 400 kDa, while mini-dystrophin Dys3978 is approximately 150 kDa. Note that no mini-dystrophin Dys3978 was detected in the liver.

[0169] Figure 29 shows the Western blot detection of human mini-dystrophin Dys3978 expression in a heart sample (LV) from the GRMD dog “Dunkin” at 14 months after vector injection. A heart sample from a normal dog of the same age was used as a positive control with 2-fold serial dilutions to indicate the quantification of the dystrophin protein.

[0170] Figure 30 shows the restoration of the dystrophin-associated protein complex as shown by IF staining of human minidystrophin Dys 3978, as well as gamma-sarcoglycan (r-SG) from various muscle groups.

[0171] Figure 31 shows the analysis of the DNA copy of the vector of AAV9-CMV-Copti-Dys3978 was found in various muscles and tissues. Quantitative PCR (qPCR) was performed to determine the genome copy numbers of the AAV vector DNA, which were normalized on a diploid cell basis.

[0172] Figure 32 shows the improvement in dystrophic histopathology in the heart of the dog with GRMD “Dunkin” from the AAV9-CMV-CoptiDys3978 vector compared to the dog with normal and untreated GRMD of the same age. HE staining.

[0173] Figure 33 shows the improvement in dystrophic histopathology in the diaphragm muscle of the dog with GRMD “Dunkin” from the AAV9-CMVCopti-Dys3978 vector. Compared to the dog with normal GRMD and not Petition 870260051626, dated 05 / 29 / 2026, page 40 / 511 33 / 241 treated at the same age. HE staining.

[0174] Figure 34 shows the improvement in dystrophic histopathology in the paw muscles of the dog with GRMD “Dunkin” from the AAV9CMV-Copti-Dys3978 vector compared to the dog with untreated GRMD of the same age. HE staining.

[0175] Figure 35 shows the inhibition of fibrosis in the paw and diaphragm muscle of the dog with GRMD “Dunkin” compared to the dog with untreated GRMD of the same age. Mason Trichrome blue staining.

[0176] Figure 36A provides photomicrographs showing immunostaining with the antidystrophin antibody DYSB of the biceps femoris muscle obtained from a WT rat treated by sham with PBS (left panel), a rat with DMD treated by sham (center panel), and a rat with Dmdmd1 treated with AAV9.hCK.HoptiDys3978.spA vector (right panel). The dark outline around the fibers shows the subsarcolemmal location of dystrophin in WT rats and minidystrophin in Dmdmdx rats treated with the vector.

[0177] Figure 36B shows photomicrographs of the biceps femoris muscle stained with hematoxylin and eosin (HES) obtained from a sham-treated WT rat (left panel), a sham-treated DMD rat (center panel), and a DMD rat treated with AAV9.hCK.Hopti-Dys3978.spA vector (right panel). Cluster of necrotic fibers (*) and mild endomysial fibrosis (black arrowhead) are shown.

[0178] Figure 36C provides photomicrographs showing immunostaining with the antidystrophin antibody DYSB of cardiac muscle obtained from a WT mouse treated by sham (left panel), a Drndmdx mouse treated by sham (center panel), and a Dmdmdx mouse treated with AAV9.hCK.Hopti-Dys3978.spA vector (right panel). The dark outline around the fibers shows the Petition 870260051626, dated 05 / 29 / 2026, page 41 / 511 34 / 241 Subsarcolemmal location of dystrophin in WT rat and mini-dystrophin in Drndmdx rat treated with vector.

[0179] Figure 36D provides photomicrographs showing HES-stained cardiac muscle obtained from a sham-treated WT mouse (left panel), a sham-treated Drndmdx mouse (center panel), and a Drndmdx mouse treated with AAV9.hCK.Hopti-Dys3978.spA vector (right panel). A focus of fibrosis (open arrowhead) is shown in the center panel, and a focus of mononuclear cell infiltration is illustrated in the right panel.

[0180] Figure 37 shows the average body weight in grams of rats. WT-treated carrier (buffer) mice and Drndmdx-treated mice received vehicle and increasing doses of the AAV9.hCK.HoptiDys3978.spA vector over time up to 25 weeks post-dosing. “WT” refers to wild-type mice; “DMD” refers to Drndmdx-treated mice; “n” refers to sample size; “D” refers to the number of days since dosing; “W” refers to the number of weeks since dosing; “E” is the notation for the specified coefficient raised to the power of the specified exponent (thus, “1E13” means 1x1013, “3E13” means 3x1013, “1E14” means 1x1014 and “3E14” means 3x1014); “vg / kg” means vector genomes per kilogram of body weight; "e “w / o HAS” refers to a treatment subdivision where the vector was administered in PBS without human serum albumin.On the right side of the graph, at 25 weeks, the order of the mean body weight data from top to bottom is the same as the top-to-bottom order of the treatment subdivisions listed in the legend (except for the treatment of rats with Drndmdx with 1x1014vg / kg of vector administered in vehicle without HSA, for which data collection ended at 13 weeks from the start of the study). These same abbreviations are used in other figures here.

[0181] Figure 38A provides illustrative photomicrographs of Petition 870260051626, dated 05 / 29 / 2026, page 42 / 511 35 / 241 Skeletal muscle from rats with Dmdmdx stained for histological examination illustrating a semi-quantitative scoring scheme used to estimate the degree of severity of muscle lesions caused by the absence of dystrophin. In skeletal muscle, as illustrated, a score of 0 corresponded to the absence of lesions; 1 corresponded to the presence of some regenerative activity evidenced by centronucleated fibers and small foci of regeneration; 2 corresponded to the presence of degenerated fibers, isolated or in small clusters; and 3 corresponded to tissue remodeling and fiber replacement by fibrotic or adipose tissue. The scoring for the heart used different criteria, as explained in the text.

[0182] Figure 38B shows the total DMD lesion scores for rats (i.e., the average of lesion subscores for biceps femoris, pectoralis, diaphragm, and cardiac muscles) at 3 months post-injection are shown individually as well as the average among all rats in each treatment subdivision, and compared to show a dose-responsive reduction in lesion score. “WT simulation” refers to vehicle-treated WT rats, “KO simulation” refers to vehicle-treated Dmdmdx rats, “KO 1E13”, “3E13”, and “1E14” refer to Dmdmdx rats treated with the indicated doses of the AAV9.hCK.Hopti-Dys3978.spA vector in vg / kg. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. On the other hand, bars on which different letters appear are statistically different from each other. The statistics were calculated using the Kruskal-Wallis and Dunn tests.

[0183] Figure 39A provides representative sections of biceps femoris muscle samples from Dmdmdx rats treated with increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector and controls. Petition 870260051626, dated 05 / 29 / 2026, page 43 / 511 36 / 241 negative. Samples were doubly labeled with an antibody that binds specifically to full-size mouse dystrophin and human mini-dystrophin, and a wheat germ agglutinin conjugate that stains connective tissue. The top panel shows micrographs of animals sacrificed 3 months post-injection. The bottom panel shows micrographs of animals sacrificed 6 months post-injection.

[0184] Figure 39B provides the percentage of fibers in randomized sections of biceps femoris muscle samples from rats with Dmdmd1 treated with increasing doses of the AAV9.hCK.HoptiDys3978.spA vector and negative controls, which stained positively for the presence of dystrophin protein. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other. Statistics were calculated using ANOVA analysis and Fisher's two-tailed post-hoc test.

[0185] Figure 39C provides percentage area in randomized sections of biceps femoris muscle samples from rats with Dmdmd1 treated with increasing doses of the AAV9.hCK.HoptiDys3978.spA vector, and negative controls, which stained positively for the presence of connective tissue. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other. Statistics were calculated using ANOVA analysis and Fisher's two-tailed post-hoc test.

[0186] Figure 40A provides representative sections of diaphragm muscle samples from rats with Dmdmd1 treated with doses Petition 870260051626, dated 05 / 29 / 2026, page 44 / 511 37 / 241 increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector and negative controls, sacrificed 3 months after injection. Samples were double-labeled with an antibody that specifically binds to full-size mouse dystrophin and human mini-dystrophin, and a wheat germ agglutinin conjugate that stains connective tissue.

[0187] Figure 40B provides the percentage of fibers in randomized sections of diaphragm muscle samples from Dmdmd1 mice treated with increasing doses of the AAV9.hCK.HoptiDys3978.spA vector and negative controls, which stained positively for the presence of dystrophin. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other.The statistics were calculated using ANOVA analysis and Fisher's two-tailed post-hoc test.

[0188] Figure 40C provides percent area in randomized sections of diaphragm muscle samples from rats with Dmdmd1 treated with increasing doses of the AAV9.hCK.HoptiDys3978.spA vector and negative controls, which stained positively for the presence of connective tissue. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other. Statistics were calculated using ANOVA analysis and Fisher's two-tailed post-hoc test.

[0189] Figure 41A shows representative cross-sections of the heart at one-third of the apex taken from rats with Dmdmd1 treated with increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector. Petition 870260051626, dated 05 / 29 / 2026, page 45 / 511 38 / 241 (top panel) and negative controls (bottom panel) sacrificed at 3 and 6 months post-injection. Histological sections were stained with picrosirius red to allow visualization of connective tissue. The middle panel contains representative sections of cardiac muscle taken from Dmdmd1-infected mice treated with vector and vehicle doubly labeled with an antibody that specifically binds to full-size mouse dystrophin and human mini-dystrophin, and a wheat germ agglutinin conjugate that stains connective tissue.

[0190] Figure 41B provides the percentage of fibers in randomized sections of cardiac muscle samples from rats with Drndmdx treated with increasing doses of the AAV9.hCK.HoptiDys3978.spA vector and negative controls stained for the presence of dystrophin protein. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other. Statistics were calculated using ANOVA analysis and Fisher's two-tailed post-hoc test.

[0191] Figure 41C provides the percentage area in randomized sections of cardiac muscle samples from rats with Drndmdx treated with increasing doses of the AAV9.HCK.HoptiDys3978.spA vector and negative controls, stained for the presence of connective tissue. Data for 3 and 6 months post-injection are included. The letters above the bars indicate that the underlying data are not statistically different from other bars in which the same letters appear. Conversely, bars over which different letters appear are statistically different from each other. Statistics were calculated using ANOVA analysis and two-tailed test. Petition 870260051626, dated 05 / 29 / 2026, page 46 / 511 39 / 241 post-hoc Fisher.

[0192] Figure 42A provides data regarding muscle fatigue in rats with Dmdmd1 treated with increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector compared to rats with Drndmdxe WT treated with vehicle, measured by repeating five closely spaced grip strength tests. The tests were performed 3 months after injection in rats injected at 7-9 weeks of age, or when the rats were approximately 4.5 months old. The graph shows the decrease in forelimb grip strength measured between tests 1 and 5 (expressed as a percentage of the strength from test 1). Results are represented as mean ± SEM. The statistics compared rats with Dmdmdx treated with vector against WT rats receiving vehicle (*p <0.05; ***p <0.001), and rats with Dmdmdx receiving vehicle (nnp<0.01; nnp<0.001), both as negative controls.

[0193] Figure 42B provides data regarding muscle fatigue in Dmdmdx rats treated with increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector compared to vehicle-treated Dmdmdxe WT rats measured by repeating five closely spaced grip strength tests. The tests were conducted 6 months post-injection in rats injected at 7-9 weeks of age, or when the rats were approximately 7.5 months old. The graph shows the decrease in forelimb grip strength between tests 1 and 5 (expressed as a percentage of the strength from test 1). Results are represented as mean ± SEM.

[0194] Figure 43 provides the left ventricular end-diastolic diameter (LV) measured during diastole from long-axis images obtained by M-mode echocardiography 6 months after injection in WT rats and with Dmdmdxad administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. Descriptive statistics shown are Petition 870260051626, dated 05 / 29 / 2026, page 47 / 511 40 / 241 average ± SEM.

[0195] Figure 44 provides ejection fractions measured during diastole from long-axis images obtained by M-mode echocardiography 6 months after injection in WT and Dmdmd1 rats administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. The descriptive statistics shown are mean ± SEM, and the symbol “$” indicates a statistically significant difference between the data over which it is placed and the data for Dmdmdx rats treated with vehicle (buffer) (p <0.05).

[0196] Figure 45A provides measured E / A ratios using Pulsed Doppler with an apical four-chamber orientation 3 months after injection in WT rats and with Dmdmdxad administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. The descriptive statistics shown are mean ± SEM, and the symbol “*” indicates a statistically significant difference between the data over which it is placed and the data for vehicle-treated (buffer) WT rats (p <0.05).

[0197] Figure 45B provides measured E / A ratios using Pulsed Doppler with an apical four-chamber orientation 6 months after injection in rats with WT and Dmdmdxad administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. The descriptive statistics shown are mean ± SEM, and the symbol “**” indicates a statistically significant difference between the data over which it is placed and the data for WT rats treated with vehicle (buffer) (p <0.01).

[0198] Figure 46A provides the isovolumetric relaxation time measured using pulsed Doppler with an apical four-chamber orientation 3 months after injection in WT rats and with Dmdmdxad administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. Descriptive statistics shown are mean ± SEM.

[0199] Figure 46B provides the isovolumetric relaxation time measured using pulsed Doppler with a four-point apical orientation. Petition 870260051626, dated 05 / 29 / 2026, page 48 / 511 41 / 241 chambers 6 months after injection in WT rats and with Dmdmdx administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. The descriptive statistics shown are mean ± SEM, and the symbol “$” indicates a statistically significant difference between the data over which it is placed and the data for Dmdmdx rats treated with vehicle (buffer) (p <0.05).

[0200] Figure 47 provides the deceleration time measured using pulsed Doppler with an apical four-chamber orientation 6 months after injection in WT rats and with Dmdmdxad administered with vehicle or vector of AAV9.hCK.Hopti-Dys3978.spA. The descriptive statistics shown are mean ± SEM, and the symbol “*” indicates a statistically significant difference between the data over which it is placed and the data for the vehicle-treated (buffer) WT rats (p <0.05).

[0201] Figure 48A shows the effect in Dmdmdx rats of increasing doses of the AAV9.hCK.Hopti-Dys3978.spA vector on blood AST levels 3 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compare vector-treated Dmdmdx rats against WT rats that received buffer (vehicle) as a negative control (**p <0.01, *p <0.05).

[0202] Figure 48B shows the effect in Dmdmdx rats of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on blood AST levels 6 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a post-hoc Dunn multiple comparison test. Statistics compare vector-treated Dmdmdx rats against WT rats that received Petition 870260051626, dated 05 / 29 / 2026, page 49 / 511 42 / 241 buffer (vehicle) as a negative control (***p <0.001, **p <0.01).

[0203] Figure 49A shows the effect in Dmdmd1 rats of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on blood ALT levels 3 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compare Dmdmd' rats treated with vector against WT rats that received buffer (vehicle) (***p<0.001, *p<0.05), or against Dmdmd1 rats that received buffer (##p<0.01, #p<0.05), as negative controls.

[0204] Figure 49B shows the effect in Dmdmd1 rats of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on blood ALT levels 6 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compare Dmdmdx rats treated with the vector against WT rats that received buffer (vehicle) as a negative control (**p<0.01).

[0205] Figure 50A shows the effect in rats with Dmdmd1 of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on blood LDH levels 3 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compared rats with Drndmdx treated with vector against WT rats that received buffer (vehicle) (***p<0.001, **p<0.01), or against rats with Drndmdx that received buffer (#p<0.05), as negative controls.

[0206] Figure 50B shows the effect in rats with Drndmdx of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector at levels Petition 870260051626, dated 05 / 29 / 2026, page 50 / 511 43 / 241 of blood LDH 6 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a post-hoc Dunn multiple comparison test. Statistics compare Dmdmdx rats treated with vector against WT rats that received buffer (vehicle) as a negative control (**p<0.01).

[0207] Figure 51A shows the effect in rats with Dmdmd1 of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on total blood creatine kinase (CK) levels 3 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compare rats with Drndmdx treated with vector against WT rats that received buffer (vehicle) (**p<0.01), or rats with Dmdmdx with 3x1014vg / kg of vector against rats with Dmdmdx that received buffer or 1x1013vg / kg of vector (##p<0.01).

[0208] Figure 51B shows the effect in Dmdmdx rats of different doses of the AAV9.hCK.Hopti-Dys3978.spA vector on total blood creatine kinase (CK) levels 6 months after injection. Results are represented as mean ± SEM. Statistical analyses were performed using the non-parametric Kruskal-Wallis test and a Dunn post-hoc multiple comparison test. Statistics compare Dmdmdx rats treated with vector against WT rats that received buffer (vehicle) as a negative control (***p<0.001, **p<0.01, *p<0.05), or Dmdmdx rats with 3x1014vg / kg of vector against Dmdmdx rats that receive 1x1013vg / kg of vector ($p<0.05).

[0209] Figure 52A provides the evolution of total creatine kinase (CK) between the day of injection (D0) of the vector vehicle and sacrifice 3 months after injection. Solid bars indicate D0 data, while bars Petition 870260051626, dated 05 / 29 / 2026, pages 51 / 511 44 / 241 dashed lines indicate data over 3 months. Results are represented as mean ± SEM.

[0210] Figure 52B provides an evolution of total creatine kinase (CK) between the day of injection (D0) of the vector vehicle and sacrifice 6 months after injection. Solid bars indicate D0 data, while dashed bars indicate data at 6 months. Results are represented as mean ± SEM.

[0211] Figure 53A provides the mean absolute maximum forepaw grip strength of older Drndmdx rats treated with 1x1014vg / kg of the AAV9.hCK.Hopti-Dys3978.spA vector compared to vehicle-treated Drndmdx WT rats. Tests were conducted 3 months post-injection in rats injected at 4 months of age, or when rats were approximately 7 months old. Results are represented as mean ± SEM. Statistics compare vector-treated Drndmdx rats against vehicle-treated Drndmdx rats (*p<0.01).

[0212] Figure 53B provides a mean maximum forepaw grip strength relative to body weight of older Dmdmdx rats treated with 1x1014vg / kg of the AAV9.hCK.Hopti-Dys3978.spA vector compared to vehicle-treated Dmdmdx and WT rats. Tests were performed 3 months post-injection in rats injected at 4 months of age, or when rats were approximately 7 months old. Results are represented as mean ± SEM. Statistics compare vector-treated Dmdmdx rats against vehicle-treated Dmdmdx rats (*p<0.01).

[0213] Figure 53C shows the evolution of forward grip strength as a measure of muscle fatigue in older Dmdmdx rats treated with 1x1014vg / kg of the AAV9.hCK.HoptiDys3978.spA vector compared to Dmdmdx and WT rats treated with Petition 870260051626, dated 05 / 29 / 2026, page 52 / 511 45 / 241 vehicle. The test was conducted by measuring the mean maximum grip strength 5 times with short intervals between each test. Tests were performed 3 months after injection in rats injected at 4 months of age, or when the rats were approximately 7 months old. Results are given relative to body weight and as mean ± SEM. Statistics compared Dmdmd1-treated rats with vector against WT rats receiving vehicle (*p<0.05) and Dmdmd1-treated rats receiving vehicle (nnp<0.01), and compared subsequent tests against test 1 in Dmdmd1-treated rats with vehicle (§§p<0.01, §§§p<0.001).

[0214] Figure 54A provides the mean absolute maximum forepaw grip strength of older Drndmdx rats treated with 1x1014vg / kg of the AAV9.hCK.Hopti-Dys3978.spA vector compared to vehicle-treated Drndmdx and WT rats. Tests were performed 3 months post-injection in rats injected at 6 months of age, or when rats were approximately 9 months old. Results are represented as mean ± SEM. Statistics compare vehicle-treated Drndmdx rats against vehicle-treated WT rats (**p<0.01).

[0215] Figure 54B provides a mean maximum forepaw grip strength relative to body weight of older Dmdmdx rats treated with 1x1014vg / kg of the AAV9.hCK.Hopti-Dys3978.spA vector compared to vehicle-treated Drndmdx and WT rats. Tests were performed 3 months post-injection in rats injected at 6 months of age, or when rats were approximately 9 months old. Results are represented as mean ± SEM. Statistics compare vehicle-treated Dmdmd rats against vehicle-treated WT rats (*p<0.05) or vector-treated Drndmdx rats against vehicle-treated Dmdmdx rats (np<0.05). Petition 870260051626, dated 05 / 29 / 2026, page 53 / 511 46 / 241

[0216] Figure 54C shows the evolution of forelimb grip strength as a measure of muscle fatigue in older Dmdmd1 rats treated with 1x1014vg / kg of the AAV9.hCK.HoptiDys3978.spA vector compared to vehicle-treated Dmdmd1e WT rats. The test was conducted by measuring mean maximum grip strength 5 times with short intervals between each test. Tests were performed 3 months post-injection in rats injected at 6 months of age, or when rats were approximately 9 months old. Results are given relative to body weight and as mean ± SEM. The statistics compared Dmdmd1 rats treated with vector against Dmdmdx rats receiving vehicle (np <0.05), Dmdmd1 rats treated with vehicle against WT rats receiving vehicle (**p<0.01, ***p<0.001), and test 5 against test 1 in Drndmdx rats treated with vehicle (§§p<0.01).

[0217] Figures 55A-55C provide an alignment between the amino acid sequences of the mini-dystrophin protein Δ3990 (SEQ ID NO: 27) and the mini-dystrophin protein Dys3978 (SEQ ID NO: 7).

[0218] Figures 56A-56I provide an alignment between the nucleic acid sequence encoding mini-dystrophin Δ3990 (SEQ ID NO: 28), which is derived from the wild-type nucleic acid sequence encoding the human dystrophin protein, and the human codon-optimized nucleic acid sequence encoding mini-dystrophin Dys3978 (named Hopti-Dys3978; SEQ ID NO: 1). Detailed Description of the Invention

[0219] The present invention will now be described with reference to the accompanying drawings, in which preferred embodiments of the invention are shown. This invention can, however, be carried out in different forms and should not be interpreted as limited to the embodiments presented here. On the contrary, these embodiments are provided so that this description is thorough and complete, and Petition 870260051626, dated 05 / 29 / 2026, p. 54 / 511 47 / 241 will fully convey the scope of the invention to those skilled in the art.

[0220] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as that generally understood by one of ordinary experience in the art to which this invention pertains. The terminology used in the description of the invention herein is for the purpose of describing only particular embodiments and is not intended to be limiting of the invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety.

[0221] Nucleotide sequences are presented here as single-stranded, in the 5' to 3' direction, left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented here in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, either (for amino acids) by the one-letter code, or by the three-letter code, both in accordance with 37 CFR §1.822 and established usage. See, for example, PatentIn User Manual, 99-102 (Nov. 1990) (US Patent and Trademark Office).

[0222] Except where otherwise indicated, standard methods known to those skilled in the art may be used for the construction of recombinant parvovirus and AAV (rAAV) constructs, packaging vectors expressing the Rep and / or Cap parvovirus sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, for example, SAMBROOK et al., MOLECULAR CLONING: A LABORATORY MANUAL 2nd Ed. (Cold Spring Harbor, NY, 1989); AUSUBEL et al., CURRENT MOLECULAR BIOLOGY PROTOCOLSIN (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York). Petition 870260051626, dated 05 / 29 / 2026, p. 55 / 511 48 / 241

[0223] Furthermore, the present invention also contemplates that, in some embodiments of the invention, any aspect or combination of aspects set forth herein may be excluded or omitted.

[0224] To further illustrate, if, for example, the specification indicates that a particular amino acid may be selected from A, G, I, L and / or V, this language also indicates that the amino acid may be selected from any subset of these amino acids, for example A, G, I or L; A, G, I or V; A or G; only L; etc., as if each subcombination were expressly stated herein. Furthermore, such language also indicates that one or more of the specified amino acids may be omitted. For example, in particular embodiments, the amino acid is not A, G or I; is not A; is not G or V; as if each such possible omission were expressly stated in this document. Definitions

[0225] The following terms are used in the description herein and in the attached claims.

[0226] The singular forms “um” and “uma” are intended to include plural forms as well, unless the context clearly indicates otherwise.

[0227] Furthermore, the term “about”, when used herein when referring to a measurable value, such as an amount of the length of a polynucleotide or polypeptide sequence, dose, time, temperature and the like, is intended to cover variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified quantity.

[0228] Also when used here, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0229] When used here, the term “adeno-associated virus” (AAV) Petition 870260051626, dated 05 / 29 / 2026, p. 56 / 511 49 / 241 includes, but is not limited to, AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3, including types 3A and 3B), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), AAV type 9 (AAV9), AAV type 10 (AAV10), AAV type 11 (AAV11), AAV type 12 (AAV12), AAV type 13 (AAV13), Avian AAV ATCC VR-865, Avian AAV strain DA-1, Bb1, Bb2, Ch5, Cy2, Cy3, Cy4, Cy5, Cy6, Hu1, Hu10, Hu11, Hu13, Hu15, Hu16, Hu17, Hu18, Hu19, Hu2, Hu20, Hu21, Hu22, Hu23, Hu24, Hu25, Hu26, Hu27, Hu28, Hu29, Hu3, Hu31, Hu32, Hu34, Hu35, Hu37, Hu39, Hu4, Hu40, Hu41, Hu42, Hu43, Hu44, Hu45, Hu46, Hu47, Hu48, Hu49, Hu51, Hu52, Hu53, Hu54, Hu55, Hu56, Hu57, Hu58, Hu6, Hu60, Hu61, Hu63, Hu64, Hu66, Hu67, Hu7, Hu9, HuLG15, HuS17, HuT17, HuT32, HuT40, HuT41, HuT70, HuT71, HuT88, Pi1, Pi2, Pi3, Rh1, Rh10, Rh13, Rh2, Rh25, Rh32, Rh33, Rh34, Rh35, Rh36, Rh37, Rh38, Rh40, Rh43, Rh48, Rh49, Rh50, Rh51, Rh52, Rh53, Rh54, Rh55, Rh57, Rh58, Rh61, Rh62, Rh64, Rh74, Rh8,Snake AAV, Avian AAV, Bovine AAV, Canine AAV, Equine AAV, Ovine AAV, Caprine AAV, Shrimp AAV, AAV1. 1, AAV2. 5, AAV6. AAV6.3.1, AAV9.45, RHM4-1 (SEQ ID NO:5 of WO 2015 / 013313), AAV2-TT, AAV2-TT-S312N, AAV3B-S312N, AAV-LK03 and any other AAV now known or subsequently revealed. See, for example, Fields et al., VIROLOGY, volume 2, chapter 69 (4th ed., LippincottRaven Publishers). The capsids may be derived from a number of AAV serotypes described in US Patent No. 7,906,111; Gao et al., 2004, J. Virol. 78: 6381; Moris et al., 2004, Virol. 33: 375; WO 2013 / 063379; WO 2014 / 194132; and include true-type AAV variants (AAV-TT) described in WO 2015 / 121501, and RHM4-1, RHM15-1 to RHM15-6, and their variants, described in WO 2015 / 013313, and anyone skilled in the art would know that there are probably other, as yet unidentified, variants that perform the same or a similar function, or may include components of two or more Petition 870260051626, dated 05 / 29 / 2026, p. 57 / 511 50 / 241 AAV capsids. A full complement of AAV cap proteins includes VP1, VP2, and VP3. The open reading frame comprising nucleotide sequences encoding AAV cap proteins may comprise less than a full complement of AAV cap proteins, or the full complement of AAV cap proteins may be provided.

[0230] and any other AAV now known or subsequently revealed. See, for example, FIELDS et al., VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). A relatively new number of AAV clades and serotypes have been identified (See, for example, Gao et al., (2004) J. Virol. 78: 6381; Moris et al., (2004) Virol. 33-: 375).

[0231] AAV is a small, non-enveloped virus with an icosahedral capsid approximately 20–30 nm in diameter. AAV is unable to replicate without the contribution of so-called helper proteins from other viruses (e.g., adenovirus, herpes simplex virus, vaccinia virus, and human papillomavirus), and thus has been placed in a special genus called dependoviruses (because they depend on other viruses for replication) within the parvoviridae family. Although many different serotypes of AAV have been revealed, and many humans produce antibodies against one or more serotypes of AAV (suggesting a history of disseminated AAV infection), no disease is known to be caused by AAV, suggesting that AAV is not pathogenic in humans.

[0232] Although many different AAV serotypes have been revealed, one of the best characterized is AAV2, and the following discussion of AAV biology focuses on some of the lessons learned about AAV2. The life cycle of other AAV serotypes is believed to be similar, although the details may differ. The particular details by which AAV2 or any Petition 870260051626, dated 05 / 29 / 2026, pp. 58 / 511 The information provided by other AAV serotypes that infect and replicate within cells is provided merely to aid in understanding the inventions described herein and is not intended to limit their scope in any way. Even if some of this information is later found to be incorrect or incomplete, it should not be interpreted as diminishing the usefulness or capability of the inventions described and claimed herein. Further information on the AAV life cycle can be found in M. Goncalves, Virol J 2:43 (2005), MD Weitzman and RM Linden, Adeno-Associated Virus Biology, Ch. 1, pp. 1-23, Adeno-Associated Virus Methods and Protocols, Ed. RO Snyder and P Moullier, Humana Press (2011), GE Berry and A Asokan, Curr Opin Virol 21:54-60 (2016), and references cited herein.

[0233] The wild-type genome of AAV2 is linear DNA approximately 4.7 kilobases in length. Although mostly single-stranded, the 5' and 3' ends of the genome consist of so-called inverted terminal repeats (ITRs), each 145 base pairs long and containing palindromic sequences that self-reassemble via classic Watson-Crick base pairing to form T-shaped hairpin structures. One of these structures contains a free 3' hydroxyl group which, depending on cellular DNA polymerases, allows the initiation of viral DNA replication via a self-priming strand displacement mechanism. See, for example, M. Goncalves, Adeno-associated virus: from defective virus to effective vector, Virology J 2:43 (2005).Due to the mechanism by which single-stranded viral genomes are replicated and then packaged into capsids in infected cells, positive (sense or coding) and negative (antisense or non-coding) strands are packaged with equal efficiency into separate particles.

[0234] In addition to flanking ITRs, the AAV2 type genome Petition 870260051626, dated 05 / 29 / 2026, page 59 / 511 Wild-type 52 / 241 contains two genes, rep and cap, which respectively encode four replication proteins (Rep 78, Rep 68, Rep 52, and Rep 40) and three capsid proteins (VP1, VP2, and VP3) through efficient use of promoters and alternative binding. The large replication proteins, Rep 78 and 68, are multifunctional and play a role in AAV transcription, viral DNA replication, and site-specific integration of the viral genome into human chromosome 19. The smaller Rep proteins have been implicated in packaging the viral genome into viral capsids in the nuclei of infected cells. The three capsid proteins are produced through a combination of alternative linkage and the use of alternative translational initiation sites, such that all three proteins share sequences for their carboxy-terminals; however, VP2 includes the additional amino-terminal sequence absent from VP3, and VP1 includes the additional amino-terminal sequence absent from both VP2 and VP3.It is estimated that capsids contain a total of 60 capsid proteins in an approximate VP1:VP2:VP3 stoichiometry of 1:1:10, although these ratios may apparently vary.

[0235] Despite its relatively small size and therefore ability to carry heterologous genes, AAV has been identified as a leading viral vector for gene therapy. The advantages of using AAV compared to other viruses that have been proposed as gene therapy vectors include AAV's ability to support long-term gene expression in transduced cells, to transduce cells equally into dividing and non-dividing cells, to transduce a wide variety of different cell types depending on the serotype, the inability to replicate without a helper virus, and an apparent lack of pathogenicity associated with wild-type infections.

[0236] Because of their small size, AAV capsids Petition 870260051626, dated 05 / 29 / 2026, p. 60 / 511 53 / 241 can physically accommodate a single-stranded DNA genome that is at most about 4.7–5.0 kilobases in length. Without modifying the genome, there would not be enough space to include a heterologous gene, such as the coding sequence for a therapeutic protein, and gene regulatory elements, such as a promoter and, optionally, an enhancer. To create more space, the rep and cap genes can be removed and replaced with the desired heterologous sequences, provided the flanking ITRs are maintained. The functions of the rep and cap genes can be provided in trans in a different part of the DNA. Conversely, the ITRs are the only viral elements of AAV that must remain in cis with the heterologous sequence. Combining the ITRs with a heterologous gene and removing the rep and cap genes for a different plasmid without ITRs also prevents the production of infectious wild-type AAV while the AAV vector for gene therapy is being produced.The removal of rep and cap also means that AAV vectors for gene therapy cannot replicate in the cells they transduce.

[0237] In some modalities, the genome of the AAV vectors is. Linear single-stranded DNA flanked by AAV ITRs. Before it can support heterologous gene transcription and translation, the single-stranded DNA genome must be converted into double-stranded form by cellular DNA polymerases that utilize the free 3'-OH of one of the self-priming ITRs to initiate the synthesis of the second strand. In alternative embodiments, full-size single-stranded genomes of opposite polarity can pair up to generate a full-size double-stranded genome, and this can result when a plurality of AAV vectors carrying opposite-polarity genomes simultaneously transduce the same cell. After the double-stranded vector genomes are formed, by either mechanism, the cellular gene transcription machinery can act on the single-stranded DNA. Petition 870260051626, dated 05 / 29 / 2026, page 61 / 511 54 / 241 double to express the heterologous gene.

[0238] In other embodiments, the vector genome can be designed to be self-complementary (scAAV), having a wild-type ITR at each end and a mutated ITR in the middle. See, for example, McCarty, DM, et al., Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10:2112-18 (2003). It has been proposed that after entering a cell, self-complementary AAV genomes can self-pair starting with the ITR in the middle to form a double-stranded genome without the need for de novo DNA replication. This approach has been shown to result in more efficient transduction and faster expression of the heterologous gene, however, it reduces the size of the heterologous gene that can be used by about half.

[0239] Different strategies for producing AAV vectors for gene therapy have been developed, but one of the most common is the triple transfection technique, in which three different plasmids are transfected into producer cells. See, for example, N. Clement and J. Grieger, Mol Ther Methds Clin Dev, 3:16002 (2016), Grieger, JC, et al., Mol Ther 24(2):287-97 (2016), and references cited here. In this technique, a plasmid is created which includes the vector genome sequence including, for example, a heterologous promoter and optionally an enhancer, and a heterologous gene to express a desired RNA or protein, flanked by the left and right ITRs. The vector plasmid would be co-transfected into producer cells, such as HEK293 cells, with a second plasmid containing the rep and cap genes and a third plasmid containing adenovirus (or other virus) helper genes needed to replicate and package the vector genome into AAV capsids.In alternative modalities of the technique, the rep, cap, and adenovirus helper genes all reside in the... Petition 870260051626, dated 05 / 29 / 2026, page 62 / 511 55 / 241 same plasmid and two plasmids are cotransfected into producer cells. Examples of adenovirus helper genes include the E1a, E1b, E2a, E4orf6, and VA RNA genes. For many AAV serotypes, AAV2 ITRs can be replaced with native ITRs without significantly impairing the ability of the vector genome to be replicated and packaged into non-AAV2 capsids. This approach, known as pseudotyping, requires only the use of a rep / cap plasmid containing the rep and cap genes of the other serotype. Thus, for example, an AAV gene therapy vector could use an AAV9 capsid and a vector genome containing AAV2 ITRs flanking a heterologous gene (which can be designated “AAV2 / 9”), such as a mini-dystrophin.After the AAV particles are produced by the cell, they can be collected and purified using conventional techniques known in the art, such as ultracentrifugation in a CsCl gradient, or using chromatography columns of various types.

[0240] The parvoviral particles and genomes of the present invention may be, but are not limited to, AAV. Genomic sequences of various AAV serotypes and stand-alone parvoviruses, as well as sequences of native ITRs, Rep proteins, and capsid subunits are known in the art. Such sequences can be found in the literature or in public databases, such as GenBank. See, for example, GenBank Access Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, AY631966, AX753250, EU285562, NC_001358, NC_001540, AF513851, AF513852 and AY530579; the descriptions of which are incorporated herein by reference for teaching parvovirus. Petition 870260051626, dated 05 / 29 / 2026, p. 63 / 511 56 / 241 and AAV nucleic acid and amino acid sequences. See also, for example, Bantel-Schaal et al., (1999) J.Virol.73: 939; Chiorini et al., (1997) J.Virol. 71:6823; Chiorini etal., (1999) J.Virol.73:1309; Gao etal., (2002) Proc. Nat. Acad. Sci. USA 99:11854; Moris et al., (2004) Virol. 33-:375-383; Mori et al., (2004) Virol. 330:375; Muramatsu et al., (1996) Virol.221:208; Ruffing et al., (1994) J.Gen. Virol. 75:3385; Rutledge et al., (1998) J.Virol.72:309; Schmidt et al., (2008) J. Virol. 82:8911; Shade et al., (1986) J. Virol. 58:921; Srivastava et al., (1983) J. Virol.45:555; Xiao et al., (1999) J.Virol. 73:3994; international patent publications WO 00 / 28061, WO 99 / 61601, WO 98 / 11244; and US Patent No. 6,156,303; the descriptions of which are hereby incorporated by reference for the teaching of parvovirus and AAV nucleic acid and amino acid sequences. The ITR sequences for AAV1, AAV2, and AAV3 are provided by Xiao, X., (1996), “Characterization of Adeno-associated virus (AAV) DNA replication and integration,” Ph.D. Dissertation, University of Pittsburgh, Pittsburgh, PA (incorporated herein in its entirety).

[0241] When used here, “transduction” of a cell by AAV refers to AAV-mediated transfer of genetic material into the cell. See, for example, FIELDS et al., VIROLOGY, volume 2, chapter 69 (3rd ed., Lippincott-Raven Publishers).

[0242] The terms “5' portion” and “3' portion” are relative terms used to define a spatial relationship between two or more elements. Thus, for example, a “3' portion” of a polynucleotide indicates a segment of the polynucleotide that is downstream of another segment. The term “3' portion” does not intend to indicate that the segment is necessarily at the 3' end of the polynucleotide, or even that it is necessarily in the 3' half of the polynucleotide, although it may be. Similarly, a “5' portion” of a polynucleotide indicates a segment of the polynucleotide that is upstream of another Petition 870260051626, dated 05 / 29 / 2026, page 64 / 511 57 / 241 segment. The term “5' portion” is not intended to indicate that the segment is necessarily at the 5' end of the polynucleotide, or even that it is necessarily in the 5' half of the polynucleotide, although it may be.

[0243] When used herein, the term “polypeptide” includes both peptides and proteins, unless otherwise indicated.

[0244] A “polynucleotide” is a linear sequence of nucleotides in which the 3' position of each monomeric unit is linked to the 5' position of the neighboring monomeric unit by means of a phosphate group. Polynucleotides can be RNA (containing only RNA nucleotides), DNA (containing only DNA nucleotides), RNA-DNA hybrids (containing both RNA and DNA nucleotides), as well as other hybrids containing naturally occurring and / or unnaturally occurring nucleotides. The linear order of the nucleotide bases in a polynucleotide is called the “nucleotide sequence”, “nucleic acid sequence”, “nucleobase sequence”, or sometimes simply the “sequence” of the polynucleotide. Typically, the order of the bases is given starting from the 5' end of the polynucleotide and ending at the 3' end of the polynucleotide. As is known in the art, polynucleotides can adopt secondary structures, such as self-complementary regions.Polynucleotides can also hybridize with totally or partially complementary polynucleotides through classical Watson-Crick base pairing, or other mechanisms familiar to ordinary experience.

[0245] When used herein, a “gene” is a section of a polynucleotide, typically but not necessarily DNA, that codes for a polypeptide or protein. In some embodiments, genes may be interrupted by introns. In some embodiments, a polynucleotide may code for more than one polypeptide or protein due to mechanisms such as alternative linkage, use of. Petition 870260051626, dated 05 / 29 / 2026, page 65 / 511 58 / 241 alternative initiation codons or other biological mechanisms familiar to ordinary experience in the technique. The term "open reading frame," abbreviated as "ORF," refers to a portion of a polynucleotide that codes for a polypeptide or protein.

[0246] The term “codon-optimized,” as used herein, refers to a gene coding sequence that has been optimized to increase expression by replacing one or more codons normally present in a coding sequence (e.g., in a wild-type sequence, including, for example, a coding sequence for dystrophin or mini-dystrophin) with a codon for the same amino acid (synonym). In this way, the protein encoded by the gene is identical, but the underlying nucleobase sequence of the gene or the corresponding mRNA is different. In some embodiments, optimization replaces one or more rare codons (i.e., codons for tRNA that occur relatively infrequently in cells of a particular species) with synonymous codons that occur more frequently to improve translational efficiency.For example, in human codon optimization, one or more codons in a coding sequence are replaced with codons that occur more frequently in human cells for the same amino acid. Codon optimization can also increase gene expression through other mechanisms that can improve transcription / or translation efficiency. Strategies include, but are not limited to, increasing the total GC content (i.e., the percentage of guanines and cytosines in the entire coding sequence), decreasing the CGn content (i.e., the number of CG or GC dinucleotides in the coding sequence), removing cryptic acceptor or donor binding sites, and / or adding or removing ribosomal entry sites, such as Kozak sequences. Desirably, a codon-optimized gene exhibits enhanced protein expression, for example, a. Petition 870260051626, dated 05 / 29 / 2026, p. 66 / 511 59 / 241 The protein encoded in this way is expressed at a detectably higher level in a cell compared to the expression level of the protein provided by the wild-type gene in an otherwise similar cell.

[0247] The term “sequence identity,” as used herein, has its standard meaning in the art. As is known in the art, several different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity can be determined using conventional techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48: 443 (1970), and the search by the similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci.USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, WI), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:387 (1984), preferably using the default settings, or by inspection.

[0248] An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using forward alignments, in pairs. It can also plot a tree showing the grouping relationships used to create the alignment. PILEUP uses a simplification of the forward alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5: 151 (1989).

[0249] Another example of a useful algorithm is the BLAST algorithm, Petition 870260051626, dated 05 / 29 / 2026, page 67 / 511 60 / 241 described in Altschul et al., J. Mol. Biol. 215:403 (1990) and Karlin et al., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Meth. Enzymol., 266:460 (1996); blast.wustl / edu / blast / README.html. WU-BLAST-2 uses several search parameters, which are preferably set to default values. The parameters are dynamic values ​​and are set by the program itself, depending on the sequence composition and the particular composition of the particular database against which the sequence of interest is being searched; however, the values ​​can be adjusted to increase sensitivity.

[0250] An additional useful algorithm is the interval BLAST, as reported by Altschul et al., Nucleic Acids Res. 25:3389 (1997).

[0251] A percentage of the amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues in the “longest” sequence in the aligned region. The “longest” sequence is the one having the most actual residues in the aligned region (the gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).

[0252] Similarly, the nucleic acid sequence identity percentage is defined as the percentage of nucleotide residues in the candidate sequence that are identical to the nucleotides in the polynucleotide specifically described herein.

[0253] Alignment may include the introduction of gaps in the sequences to be aligned. Furthermore, for sequences containing more or fewer nucleotides than the polynucleotides specifically described herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides relative to the total number of Petition 870260051626, dated 05 / 29 / 2026, p. 68 / 511 61 / 241 nucleotides. Thus, for example, the sequence identity of sequences shorter than a sequence specifically described here will be determined using the number of nucleotides in the shortest sequence, in one embodiment. In the percentage identity calculations, relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc.

[0254] In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including intervals are assigned a value of “0”, which eliminates the need for a weighted scale or parameters as described below for sequence similarity calculations. The sequence identity percentage can be calculated, for example, by dividing the number of matching identical residues by the total number of residues in the “shortest” sequence in the aligned region and multiplying by 100. The “longest” sequence is the one with the most actual residues in the aligned region.

[0255] “Substantial homology” or “substantial similarity” means, when referring to a nucleic acid or fragment thereof, that when ideally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95 to 99% of the sequence.

[0256] When used herein, an “isolated” polynucleotide (e.g., an “isolated DNA” or an “isolated RNA”) means a polynucleotide that is separate from, or substantially free of, at least some of the other naturally occurring organism or virus components, for example, cellular or viral structural components or other polypeptides or nucleic acids usually found associated with the polynucleotide. Petition 870260051626, dated 05 / 29 / 2026, page 69 / 511 62 / 241

[0257] Similarly, an “isolated” polypeptide means a polypeptide that is separated from, or substantially lacking, at least some of the other naturally occurring organism or virus components, for example, cellular or viral structural components or other polypeptides or nucleic acids usually found associated with the polypeptide.

[0258] A “therapeutic polypeptide” is a polypeptide that can alleviate or reduce symptoms resulting from an absence or defect in a protein in a cell or an individual. Alternatively, a “therapeutic polypeptide” is one that otherwise confers a benefit to an individual, for example, anticancer effects or improved transplant survival capacity.

[0259] When used herein, the term “modified,” when applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type sequence due to one or more deletions, additions, substitutions, or any combination thereof.

[0260] When used herein, “isolating” or “purifying” (or grammatical equivalents) a viral vector means that the viral vector is at least partially separated from at least some of the other components in the starting material.

[0261] By the terms “treat”, “treat” or “treatment of” (and grammatical variations thereof) it is understood that the severity of the individual’s condition is reduced, at least partially improved or stabilized and / or that some relief, mitigation, reduction or stabilization in at least one clinical symptom is achieved and / or there is a delay in the progression of the disease or disorder.

[0262] The terms “prevent”, “preventing” and “prevention” (and grammatical variations thereof) refer to the prevention and / or delay of the onset of a disease, disorder and / or clinical symptom(s) in a Petition 870260051626, dated 05 / 29 / 2026, p. 70 / 511 63 / 241 individual and / or a reduction in the severity of the onset of the disease, disorder and / or clinical symptom(s) compared to what would occur in the absence of the methods of the invention. Prevention may be complete, for example, the total absence of the disease, disorder and / or clinical symptom(s). Prevention may also be partial, such that the occurrence of the disease, disorder and / or clinical symptom(s) in the individual and / or the severity of the onset is less than what would occur in the absence of the present invention.

[0263] An “effective treatment amount,” as used herein, is an amount that is sufficient to provide some improvement or benefit to the individual. Alternatively stated, an “effective treatment amount” is an amount that will provide some relief, mitigation, diminution, or stabilization in at least one symptom in the individual. Those skilled in the art will appreciate that therapeutic effects need not be complete or curative, provided some benefit is provided to the individual.

[0264] An “effective amount of prevention,” as used herein, is an amount that is sufficient to prevent and / or delay the onset of a disease, disorder, and / or clinical symptoms in an individual and / or reduce and / or delay the severity of the onset of a disease, disorder, and / or clinical symptoms in an individual relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, provided that some benefit is provided to the individual.

[0265] The terms “heterologous” or “exogenous” nucleotide or nucleic acid sequence are used interchangeably herein and refer to a nucleic acid sequence that does not occur naturally in a virus or cell. In some embodiments, the heterologous nucleic acid comprises an open reading frame encoding a non-translated polypeptide or RNA of interest (by Petition 870260051626, dated 05 / 29 / 2026, page 71 / 511 64 / 241 example, for release to a cell or individual).

[0266] When used herein, the terms “viral vector,” “viral vector,” “gene delivery vector,” or sometimes just “vector” refer to a virion or virus particle that functions as a nucleic acid delivery vehicle and that comprises a vector genome packaged within the virion or virus particle. Vectors may be infectious or non-infectious. Non-infectious vectors cannot replicate without exogenously added factors. Vectors may be AAV particles or virions comprising an AAV capsid within which an AAV vector genome is packaged. These vectors may also be referred to herein as “recombinant AAV” (abbreviated “rAAV”) vectors, particles, or virions.

[0267] A vector genome is a polynucleotide for packaging within a vector particle or virion for release into a cell (which may be referred to as a “target cell”). Typically, a vector genome is constructed to contain a heterologous nucleic acid sequence, such as a gene, for delivery into the target cell. A vector genome may also contain one or more nucleic acid sequences that function as regulatory elements to control the expression of the heterologous gene in the target cell. A vector genome may also contain wild-type or modified viral nucleic acid sequence(s) required for vector production and / or function, such as, but not limited to, vector genome replication in a host and packaging into vector particles. In some embodiments, the vector genome is an “AAV vector genome,” which is capable of being packaged into an AAV capsid.In some embodiments, an AAV vector genome includes one or two inverted terminal repeats (ITRs) in cis with the heterologous gene to support replication and packaging. All other sequences are structural and non-structural protein coding. Petition 870260051626, dated 05 / 29 / 2026, page 72 / 511 65 / 241 structural elements required for the production of AAV vectors can be provided trans (e.g., from a plasmid, or by stably integrating the sequences into a host cell). In certain embodiments, an AAV vector genome comprises at least one ITR (e.g., an AAV ITR), optionally two ITRs (e.g., two AAV ITRs), which will typically be at the 5' and 3' ends of the vector genome and flank the heterologous nucleic acid sequence, but need not be contiguous to it. The ITRs may be the same or different from each other and from the same or different AAV serotypes.

[0268] The terms “host cell,” “host cell line,” and “host cell culture” are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including progeny of such cells. Host cells include “transforming cells,” “transformed cells,” and “transduced cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. For the purpose of producing AAV vectors, certain host cells may be used as “producer” or “packaging” cells that contain all the genes necessary to assemble functional viral particles, including a capsid and a vector genome. As understood by those of ordinary experience in the art, different host cells may usefully serve as producer cells, such as HEK293 cells or the Pro10 cell line, but others are possible.The genes required for virion assembly include the vector genome as described elsewhere herein, the rep and cap genes of AAV, and certain helper genes from other viruses, including but not limited to adenovirus. As appreciated by those ordinarily versed, the genes required for AAV production can be introduced into producing cells in various ways. Petition 870260051626, dated 05 / 29 / 2026, page 73 / 511 66 / 241 including, without limitation, the transfection of one or more plasmids, however, some of the genes may already be present in the producing cells, either integrated into the genome or carried in an episome.

[0269] The term “inverted terminal repeat” or “ITR” includes any palindromic viral terminal repeat or synthetic sequence that forms a hairpin-shaped structure and functions as an inverted terminal repeat (i.e., mediates certain viral functions such as replication, virus packaging, provirus integration and / or rescue, and the like). The ITR can be an AAV ITR or a non-AAV ITR. For example, a non-AAV ITR sequence such as those of other parvoviruses (e.g., canine parvovirus, bovine parvovirus, mouse parvovirus, porcine parvovirus, human parvovirus B-19) or the hairpin-shaped SV40 that serves as the origin of SV40 replication can be used as an ITR, which can be modified by truncation, substitution, deletion, insertion, and / or addition. Furthermore, ITR can be partially or completely synthetic, such as the "double-D sequence," as described in U.S. Patent No. 5,478,745 by Samulski et al.See also FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0270] An “AAV terminal inverted repeat” or “AAV ITR” may be from any AAV, including, but not limited to, serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, caprine AAV, shrimp AAV, or any other AAV now known or later revealed. An AAV ITR need not have the native terminal repeat sequence (for example, a native AAV ITR sequence may be altered by insertion, deletion, truncation, and / or missense mutations), provided that the terminal repeat mediates Petition 870260051626, dated 05 / 29 / 2026, p. 74 / 511 67 / 241 the desired functions, for example, virus packaging replication, provirus persistence and / or saving, and the like. The AAV2 ITR sequences are 145 base pairs long, and are provided here as SEQ ID NO: 14 and SEQ ID NO: 15.

[0271] “Cis motifs” include conserved sequences, such as those found at or near the ends of the genomic sequence and recognized for the initiation of replication; cryptic promoters or sequences in internal positions likely used for transcription initiation, binding, or termination.

[0272] “Flanked”, in relation to a sequence that is flanked by other elements, indicates the presence of one or more flanking elements upstream and / or downstream, i.e., 5' and / or 3', relative to the sequence. The term “flanked” is not intended to indicate that the sequences are necessarily contiguous. For example, there may be intervening sequences between the nucleic acid encoding the transgene and a flanking element. A sequence (e.g., a transgene) that is “flanked” by two other elements (e.g., TRs) indicates that one element is located 5' from the sequence and the other is located 3' from the sequence; however, there may be intervening sequences between them.

[0273] “Transfection” of a cell means that genetic material is introduced into a cell for the purpose of genetically modifying the cell. Transfection can be performed by a variety of means known in the art, such as calcium phosphate, polyethyleneimine, electroporation, and the like.

[0274] “Gene transfer” or “gene release” refers to methods or systems for reliably inserting foreign DNA into host cells. Such methods may result in transient expression of unintegrated transferred DNA, extrachromosomal replication, and expression of transferred replicons (e.g., Petition 870260051626, dated 05 / 29 / 2026, page 75 / 511 68 / 241 episomes), or integration of transferred genetic material into the genomic DNA of host cells.

[0275] “Transgene” is used to designate any heterologous nucleotide sequence incorporated into a vector, including a viral vector, for release and including expression in a target cell (also referred to herein as a “host cell”) and associated expression control sequences, such as promoters. It is appreciated by those skilled in the art that expression control sequences will be selected based on their ability to promote transgene expression in the target cell. An example of a transgene is a nucleic acid encoding a therapeutic polypeptide.

[0276] The viral vectors of the invention may also be “targeted” viral vectors (e.g., having a targeted tropism) and / or a “hybrid” parvovirus (i.e., wherein the viral ITRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00 / 28004 and Chao et al., (2000) Mol. Therapy 2:619.

[0277] In addition, the viral capsid or genomic elements may contain other modifications, including insertions, deletions and / or substitutions.

[0278] When used here, “Rep encoding sequences” of AAV or parvovirus genes indicate the nucleic acid sequences that encode the non-structural proteins of AAV or parvoviruses that mediate viral replication and the production of new viral particles. Parvoviral and AAV replication genes and proteins have been described in, for example, FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0279] “Rep coding sequences” do not need to encode all parvoviral or AAV Rep proteins. For example, with respect to AAV, Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep68, Rep52). Petition 870260051626, dated 05 / 29 / 2026, page 76 / 511 In fact, AAV5 is believed to only express the Rep68 and Rep40 proteins bound together (i.e., Rep68 / 241 and Rep40). In representative embodiments, the Rep coding sequences encode at least the replication proteins that are necessary for viral or vector genome replication and for packaging into new virions. The Rep coding sequences will generally encode at least one large Rep protein (i.e., Rep78 / 68) and one small Rep protein (i.e., Rep52 / 40). In particular embodiments, the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and / or Rep40 proteins. In other embodiments, the Rep coding sequences encode both the Rep68 and Rep52 and / or Rep40 proteins. In yet another modality, the Rep coding sequences encode the Rep68 and Rep52 proteins, the Rep68 and Rep40 proteins, the Rep78 and Rep52 proteins, or the Rep78 and Rep40 proteins.

[0280] When used here, the term “large Rep protein” refers to Rep68 and / or Rep78. Large Rep proteins of the claimed invention may be wild-type or synthetic. A wild-type large Rep protein may be from any parvovirus or AAV, including, but not limited to, serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11 or 13, or any other AAV now known or subsequently revealed. A synthetic large Rep protein may be altered by insertion, deletion, truncation and / or missense mutations.

[0281] In the native AAV genome, the different Rep proteins are encoded by a single gene through the use of two different promoters and alternative linkage. For AAV vector production purposes, however, Rep proteins can be expressed in cells producing a single gene, or distinct polynucleotides, one sequence for each Rep protein to be expressed. Thus, for example, a Rep-encoding gene can be constructed to inactivate the p5 or p19 promoter so that only small or only large Rep proteins are expressed. Petition 870260051626, dated 05 / 29 / 2026, page 77 / 511 70 / 241 are expressed in the respective modified genes. The expression of large and small Rep proteins from different genes can be advantageous when one of the viral promoters is inactive in a host cell, in which case a constitutively active promoter can be used instead, or where it is desired to express the Rep proteins at different levels under the control of separate transcriptional and / or translational control elements. For example, in some embodiments, it may be advantageous to downregulate the expression of the large Rep protein to the small Rep protein (e.g., Rep78 / 68) to avoid toxicity to host cells (see, for example, Urabe et al., (2002) Human Gene Therapy 13: 1935).

[0282] When used herein, AAV or parvoviral “cap coding sequences” encode the structural proteins that form a functional parvovirus or AAV capsid (i.e., they can package DNA and infect target cells). Typically, cap coding sequences will encode all subunits of the parvovirus or AAV capsid; however, fewer than all capsid subunits may be encoded as long as a functional capsid is produced. Typically, though not necessarily, cap coding sequences will be present on a single nucleic acid molecule.

[0283] The capsid structure of autonomous parvovirus and AAV is described in more detail in BERNARD N. FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

[0284] A “microdystrophin” or a “mini-dystrophin” is a protein constructed comprising certain subdomains or portions of subdomains present in full-sized muscle dystrophin or its isoforms that possess at least some of the functionality of dystrophin when expressed in a muscle cell. Microdystrophins and Petition 870260051626, dated 05 / 29 / 2026, page 78 / 511 71 / 241 mini-dystrophins are smaller than full-size muscle dystrophin (Dp427m). Compared to full-size muscle dystrophin, microdystrophins and mini-dystrophins may contain N-terminal, C-terminal deletions internally, or any combination thereof.

[0285] As used herein, a “dystrophinopathy” is a muscle disease caused by pathogenic variants in DMD, the gene that encodes the dystrophin protein. Dystrophinopathies manifest as a spectrum of phenotypes, depending on the nature of the underlying genetic lesion. The final end of the spectrum includes, without limitation, the phenotypes of asymptomatic elevation of serum creatine phosphokinase (CK) concentration and muscle cramps with myoglobinuria.The severe end of the spectrum includes, but is not limited to, progressive muscle diseases, Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD), in which skeletal muscle is primarily affected and the heart to a lesser degree, and DMD-associated dilated cardiomyopathy (DCM), in which the heart is primarily affected. Mini-dystrophin polynucleotide, expression cassettes, and vectors.

[0286] This description provides codon-optimized minidystrophin gene sequences and expression cassettes containing them. These genes and expression cassettes are useful for, among other applications, gene therapy to prevent or treat dystrophinopathies, such as DMD, in individuals with this need. The expression of minidystrophin proteins in transduced muscle cells is capable of replicating and replacing at least part of the function normally attributable to full-size dystrophin, such as supporting a mechanically strong link between the extracellular matrix and the cytoskeleton.

[0287] Codon-optimized sequences are designed to Petition 870260051626, dated 05 / 29 / 2026, page 79 / 511 72 / 241 fit within the size limitations of parvoviral vectors, for example, AAV vectors, as well as providing increased mini-dystrophin expression compared to non-optimized sequences. In some embodiments, optimized mini-dystrophin sequences provide increased mini-dystrophin protein expression in muscle cells or in animal muscle that is at least approximately 5% greater than the expression of non-optimized dystrophin sequences per codon, for example, at least approximately 5, 10, 20, 30, 40, 50, 75, 100, 200, 300, 400 or 500% or more, where the non-optimized sequence per codon is based on mRNA encoding wild-type human natural-size muscle dystrophin, as exemplified by NCBI Reference Sequence NM_004006.2, which is incorporated by reference.

[0288] Thus, one aspect of the invention relates to a polynucleotide encoding a mini-dystrophin protein, the polynucleotide comprising, consisting essentially of, or being composed of: (a) the nucleotide sequence of SEQ ID NO: 1 or a sequence at least about 90% identical thereto; (b) the nucleotide sequence of SEQ ID NO: 2 or a sequence at least about 90% identical thereto; or (c) the nucleotide sequence of SEQ ID NO: 3 or a sequence at least about 90% identical thereto. In some embodiments, the polynucleotide is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of one of the SEQ ID NOS: 1-3. In certain embodiments, the polynucleotide has a length that is within the capacity of a viral vector, for example, a parvoviral vector, for example, an AAV vector.In some forms, the polynucleotide has approximately 5000, 4900, 4800, 4700, 4600, 4500, 4400, 4300, 4200, 4100, or about 4000 nucleotides, or less.

[0289] In some forms, the mini-dystrophin protein Petition 870260051626, dated 05 / 29 / 2026, p. 80 / 511 The 73 / 241 encoded polynucleotide comprises, consists essentially of, or consists of the N-terminal H1 linkage, R1 and R2 rods, H3 linkage, R22, R23 and R24 rods, H4 linkage, the cysteine-rich domain (CR domain), and in some embodiments, all or a portion of the carboxy-terminal domain (CT domain) of the wild-type dystrophin protein. In other embodiments, the minidystrophin protein encoded by the polynucleotide comprises, consists essentially of, or consists of the N-terminal Actin-Binding Domain (ABD), H1 linkage, R1 and R2 rods, R22, R23 and R24 rods, H4 linkage, the CR domain and, in some embodiments, all or a portion of the CT domain of the wild-type dystrophin protein. In other embodiments, the mini-dystrophin protein does not comprise the last three amino acids at the C-terminal of the wild-type dystrophin protein (SEQ ID NO: 25).In certain embodiments, the polynucleotide encodes a mini-dystrophin protein comprising, consisting essentially of, or consisting of the amino acid sequence of SEQ ID NO: 7 or SEQ ID NO: 8 or a sequence at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 8.

[0290] The nucleotide sequence of dystrophin is well known in the art and can be found in sequence databases such as GenBank. For example, the mRNA sequence of human dystrophin can be found in GenBank Accession No. M18533 or NCBI Reference Sequence NM_004006.2, which are incorporated herein by reference in their entirety.

[0291] In some embodiments, the polynucleotide is part of an expression cassette for the production of dystrophin protein. The expression cassette may also comprise expression elements useful for increasing dystrophin expression.

[0292] In some embodiments, the polynucleotide of the invention Petition 870260051626, dated 05 / 29 / 2026, page 81 / 511 74 / 241 is operably linked to a promoter. The promoter may be a constitutive promoter or a tissue-specific or tissue-preferred promoter, such as a muscle-specific or muscle-preferred promoter. In some embodiments, the promoter is a creatine kinase promoter, for example, a promoter comprising, consisting essentially of, or consisting of the nucleotide sequence SEQ ID NO: 4 or SEQ ID NO: 5.

[0293] In some embodiments, the polynucleotide of the invention is operably linked to a polyadenylation element. In some embodiments, the polyadenylation element comprises the nucleotide sequence SEQ ID NO: 6.

[0294] In some embodiments, the polynucleotide forms part of an expression cassette comprising, essentially consisting of, or consisting of the polynucleotide operably linked to a promoter and a polyadenylation element. In certain embodiments, the gene expression cassette comprises, essentially consists of, or consists of the nucleotide sequence of any of the SEQ ID NOS: 9-12 or a sequence at least about 90% identical, for example, at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical.

[0295] Another aspect of the invention relates to a vector comprising the polynucleotides of the invention. Suitable vectors include, but are not limited to, a plasmid, phage, phagomid, viral vector (e.g., AAV vector, adenovirus vector, herpesvirus vector, alphavirus vector, or baculovirus vector), bacterial artificial chromosome (BAC), or yeast artificial chromosome (YAC). For example, the nucleic acid may comprise, consist of, or consist essentially of an AAV vector comprising a 5' and / or 3' terminal repeat (e.g., 5' and / or 3' terminal AAV repeat). In some embodiments, the vector is a viral vector, for Petition 870260051626, dated 05 / 29 / 2026, page 82 / 511 75 / 241 For example, a parvoviral vector, for example, an AAV vector, for example, an AAV9 vector. The viral vector may further comprise a nucleic acid comprising a recombinant viral pattern, wherein the nucleic acid is encapsulated by the parvoviral capsid. The invention further provides a recombinant parvovirus particle (for example, a recombinant AAV particle) comprising the polynucleotides of the invention. Viral vectors and viral particles are also discussed below.

[0296] In certain embodiments, the viral vector exhibits modified tissue tropism compared to the vectors from which the modified vector is derived. In one embodiment, the parvoviral vector exhibits systemic tropism for skeletal, cardiac, and / or diaphragmatic muscle. In other embodiments, the parvoviral vector has reduced tropism for the liver compared to a viral vector comprising a wild-type capsid protein. Tissue tropism can be modified by altering certain amino acids of the viral capsid, for example, those present in the VP1, VP2, and / or VP3 capsid proteins of AAV, according to the knowledge of those ordinarily skilled in the art.

[0297] In some embodiments, the vector genome is self-complementary or duplicated, and AAV virions containing such vector genomes are known as scAAV vectors. scAAV vectors are described in International Patent Publication WO 01 / 92551 (the description of which is incorporated herein by reference in its entirety). The use of scAAV to express a mini-dystrophin can provide an increase in the number of transduced cells, the number of copies per transduced cell, or both.

[0298] A further aspect of the invention relates to a transformed cell comprising the polynucleotide and / or vector of the invention. The cell may be an in vitro, ex vivo or in vivo cell. Petition 870260051626, dated 05 / 29 / 2026, page 83 / 511 76 / 241

[0299] Another aspect of the invention relates to a non-human transgenic animal comprising the polynucleotide and / or vector and / or transformed cell of the invention. In some embodiments, the transgenic animal is a laboratory animal, for example, an animal model of a disease, for example, an animal model of muscular dystrophy.

[0300] Another aspect of the invention relates to a minidystrophin protein encoded by the polynucleotides of the invention. The minidystrophin protein contains all the sequences necessary for a functional dystrophin protein. The dystrophin domains are well known in the art and the sequences can be found in sequence databases, such as GenBank. For example, the amino acid sequence of human dystrophin can be found in NCBI Reference Sequence: NP_003997.1 and GenBank Accession No. AAA53189, which are incorporated herein by reference in their entirety.

[0301] In some embodiments, the mini-dystrophin protein comprises, essentially consists of, or consists of the N-terminal, H1 linkage, R1 and R2 rods, H3 linkage, R22, R23 and R24 rods, H4 linkage, the CR domain and in some embodiments, all or a portion of the CT domain, wherein the mini-dystrophin protein does not comprise the last three amino acids at the C-terminal of the wild-type dystrophin protein (SEQ ID NO: 25). According to some of these embodiments, the N-terminal actin-binding domain comprises, essentially consists of, or consists of amino acid numbers 1-240 of SEQ ID NO: 25, the amino acid sequence of the natural-size human dystrophin protein; H1 comprises, essentially consists of, or consists of amino acid numbers 253-327 of SEQ ID NO: 25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 of SEQ ID NO: 25; R2 comprises, consists essentially of, or consists of. Petition 870260051626, dated 05 / 29 / 2026, p. 84 / 511 77 / 241 amino acid numbers 448-556 of SEQ ID NO: 25; H3 comprises, consists essentially of, or consists of amino acid numbers 2424-2470 of SEQ ID NO: 25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 of SEQ ID NO: 25; R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 of SEQ ID NO: 25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 of SEQ ID NO: 25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 of SEQ ID NO: 25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 of SEQ ID NO: 25; and the CT domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 of SEQ ID NO: 25. In certain embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 7.A further description of this and related constructions is included in Example 1 here.

[0302] In some embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the N-terminal, H1 linkage, R1 and R2 rods, R22, R23 and R24 rods, H4 linkage, the CR domain, and in some embodiments, all or part of the CT domain. In certain embodiments, the mini-dystrophin protein does not comprise the last three amino acids at the C-terminal of the wild-type dystrophin protein. According to some of these embodiments, the N-terminal actin-binding domain comprises, consists essentially of, or consists of amino acid numbers 1-240 of SEQ ID NO: 25, the amino acid sequence of the natural-size human dystrophin protein; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 of SEQ ID NO: 25; R1 comprises, consists essentially of, or Petition 870260051626, dated 05 / 29 / 2026, p. 85 / 511 78 / 241 consists of amino acid numbers 337-447 of SEQ ID NO: 25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 of SEQ ID NO: 25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 of SEQ ID NO: 25; R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 of SEQ ID NO: 25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 of SEQ ID NO: 25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 of SEQ ID NO: 25; cysteine-rich domain comprises, consists essentially of, or consists of amino acid numbers 31133299 of SEQ ID NO: 25; and terminal carboxy domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 of SEQ ID NO: 25.In certain embodiments, the mini-dystrophin protein comprises, consists essentially of, or consists of the amino acid sequence SEQ ID NO: 8.

[0303] Another aspect of the invention relates to a method of producing a mini-dystrophin protein in a cell, comprising contacting the cell with the polynucleotide or vector of the invention, thereby producing the mini-dystrophin in the cell. The cell can be an in vitro, ex vivo or in vivo cell, for example, a cell line or a primary cell. Methods for producing a protein in a cell by introducing a polynucleotide encoding the protein are well known in the art.

[0304] Another aspect of the invention relates to a method of producing a mini-dystrophin protein in an individual, comprising releasing to the individual the polynucleotide, vector and / or transformed cell of the invention, thereby producing the mini-dystrophin protein in the individual.

[0305] An additional aspect of the invention relates to a method of Petition 870260051626, dated 05 / 29 / 2026, page 86 / 511 79 / 241 treatment of muscular dystrophy in an individual in need thereof, comprising delivering to the individual a therapeutically effective amount of the polynucleotide, vector and / or transformed cell of the invention, thereby treating the muscular dystrophy in the individual. Muscular dystrophy may be any form of muscular dystrophy, for example, Duchenne muscular dystrophy or Becker muscular dystrophy. Recombinant Viral Vectors

[0306] The viral vectors of the present invention are useful for the delivery of mini-dystrophin-encoding polynucleotides to cells in vitro, ex vivo, and in vivo. In particular, the viral vectors can be advantageously employed to deliver or transfer mini-dystrophin-encoding polynucleotides to animal cells, including mammals.

[0307] The viral vector may also comprise a heterologous nucleic acid that shares homology with and recombines with a locus on a host chromosome. This approach can be used, for example, to correct a genetic defect in the host cell.

[0308] As an additional alternative, polynucleotides encoding mini-dystrophin can be used to produce mini-dystrophin in a cell in vitro, ex vivo or in vivo. For example, viral vectors can be introduced into cultured cells and the mini-dystrophin protein expressed isolated from there.

[0309] It will be understood by those skilled in the art that the polynucleotide encoding mini-dystrophin may be operably associated with appropriate control sequences. For example, the polynucleotide may be operably associated with expression control elements such as transcription / translation control signals, origins of replication, polyadenylation signals, internal ribosome entry sites (IRES), promoters and / or enhancers, and the like. Petition 870260051626, dated 05 / 29 / 2026, page 87 / 511 80 / 241

[0310] Those skilled in the art will appreciate that a variety of promoter and optionally enhancer elements can be used, depending on the level and specific tissue expression desired. The promoter / enhancer can be constitutive or inducible, depending on the desired expression pattern. The promoter / enhancer can be native or foreign and can be a natural or synthetic sequence. By foreign, it is intended that the transcriptional initiation region is not found in the wild-type host into which the transcriptional initiation region is introduced. An enhancer, if employed, can be chosen from the same gene and species as the promoter, from the orthologous gene in a different species as the promoter, from a different gene in the same species as the promoter, or from a different gene in a different species than the promoter.

[0311] In particular embodiments, the promoter / enhancer elements may be native to the target cell or individual to be treated. In representative embodiments, the promoter / enhancer element may be native to the heterologous nucleic acid sequence. The promoter / enhancer element is generally chosen to function in the target cell(s) of interest. Furthermore, in particular embodiments, the promoter / enhancer element is a mammalian promoter / enhancer element. The promoter / enhancer element may be constitutive or inducible.

[0312] Inducible expression control elements are typically advantageous in those applications where it is desirable to provide regulation over the expression of heterologous nucleic acid sequence(s). Inducible gene release enhancers can be tissue-specific or preferred enhancers, and include tissue-specific or preferred enhancers (including cardiac, skeletal and / or smooth muscle specific or Petition 870260051626, dated 05 / 29 / 2026, page 88 / 511 81 / 241 preferred). Other inducible promoting / potentiating elements include hormone-inducible and metal-inducible elements. Exemplary inducible promoting / potentiating elements include, but are not limited to, a Tet on / off element, a RU486-inducible promoter, an ecdysone-inducible promoter, a rapamycin-inducible promoter, and a metallothionein promoter.

[0313] In modalities where the polynucleotide encoding mini-dystrophin is transcribed and then translated into target cells, specific initiation signals are usually included for the efficient translation of inserted protein-coding sequences. These exogenous translational control sequences, which may include the ATG initiation codon and adjacent sequences, can be of a variety of origins, both natural and synthetic.

[0314] The viral vectors according to the present invention provide a means for the delivery of polynucleotide encoding mini-dystrophin into a wide range of cells, including dividing and undivided cells. The viral vectors can be employed to deliver the polynucleotide into a cell in vitro, for example, to produce mini-dystrophin in vitro or for ex vivo gene therapy. The viral vectors are additionally useful in a method of delivering the polynucleotide to an individual in need thereof, for example, to express mini-dystrophin. In this way, the protein can be produced in vivo in the individual. The individual may need mini-dystrophin because the individual has a functional dystrophin deficiency. Furthermore, the method can be practiced because the production of mini-dystrophin in the individual may confer some beneficial effect.

[0315] Viral vectors can also be used to produce mini-dystrophin in cultured cells or in an individual (e.g., using the individual as a bioreactor to produce the protein or to observe the effects of the protein in the individual, e.g., in connection Petition 870260051626, dated 05 / 29 / 2026, page 89 / 511 82 / 241 with tracking methods).

[0316] In general, the viral vectors of the present invention can be used to deliver the polynucleotide encoding mini-dystrophin to treat and / or prevent any disease state for which it is beneficial to release mini-dystrophin. Illustrative disease states include, but are not limited to, muscular dystrophies including Duchenne and Becker.

[0317] Viral vectors according to the present invention find use in diagnostic and screening methods, wherein a polynucleotide encoding mini-dystrophin is transiently or stably expressed in a cell culture system or, alternatively, in a transgenic animal model.

[0318] The viral vectors of the present invention can also be used for various non-therapeutic purposes, including but not limited to use in protocols to evaluate gene targeting, clearance, transcription, translation, etc., as would be apparent to someone skilled in the art. The viral vectors can also be used for the purpose of evaluating safety (dissemination, toxicity, immunogenicity, etc.). This data, for example, is considered by the United States Food and Drug Administration as part of the regulatory approval process prior to the evaluation of clinical efficacy.

[0319] According to certain embodiments of the description of AAV vectors or particles for the treatment of dystrophinopathy, such as DMD, the description provides AAV vectors or particles including AAV capsids of an AAV serotype that has tropism for striated muscle, including but not limited to, skeletal muscle, including the diaphragm and cardiac muscle. Non-limiting examples of naturally occurring AAV capsids having tropism for striated muscle are AAV1, AAV6, AAV7, AAV8, and AAV9. However, other Petition 870260051626, dated 05 / 29 / 2026, page 90 / 511 83 / 241 embodiments include AAV capsids that are not known to occur naturally, but have been constructed for the express purpose of creating novel AAV capsids that preferentially transduce striated muscle compared to other tissues. Such modified capsids are known in the art, however, the description encompasses novel muscle-specific AAV capsids yet to be developed. Non-limiting examples of muscle-specific constructed AAV capsids were reported in Yu, CY, et al., Gene Ther 16 (8): 953-62 (2009), Asokan, A, et al., Nat Biotech 28(1): 79-82 (2010 (describing AAV2i8), Bowles, DE, et al., Mol Therapy 20(2): 443-455 (2012) (describing AAV 2.5), and Asokan, A, et al., Mol Ther 20(4): 699-708 (2012).The amino acid sequences of the capsid proteins, including proteins VP1, VP2, and VP3, for many naturally occurring and unnaturally occurring AAV serotypes are known in the art. In a non-limiting example, the amino acid sequence for AAV9 serotype is given as the amino acid sequence SEQ ID NO: 13.

[0320] The AAV particles described for the treatment of dystrophinopathy, such as DMD, include a vector genome to express a dystrophin protein with dystrophin subdomains selected to restore, at least partially, in transduced muscle cells, the function provided by the missing natural-size dystrophin protein. According to some embodiments, the mini-dystrophin protein is constructed from natural-size wild-type human dystrophin protein subdomains. In some embodiments, the mini-dystrophin protein includes the following human dystrophin protein subdomains in the following order from N-terminal to C-terminal: N-terminal actin-binding domain (ABD); H1 linkage domain; spectrin-like repeat domains. Petition 870260051626, dated 05 / 29 / 2026, page 91 / 511 84 / 241 R1 and R2; H3 linking domain; spectrin-like repeat domains R22, R23, and R24; H4 linking domain; cysteine-rich domain (CR); and terminal carboxy domain (CT). According to some of these embodiments, the N-terminal actin-binding domain comprises, consists essentially of, or consists of amino acid numbers 1-240 of SEQ ID NO: 25, the natural-size human dystrophin protein amino acid sequence; H1 comprises, consists essentially of, or consists of amino acid numbers 253-327 of SEQ ID NO: 25; R1 comprises, consists essentially of, or consists of amino acid numbers 337-447 of SEQ ID NO: 25; R2 comprises, consists essentially of, or consists of amino acid numbers 448-556 of SEQ ID NO: 25; H3 comprises, consists essentially of, or consists of amino acid numbers 2424-2470 of SEQ ID NO: 25; R22 comprises, consists essentially of, or consists of amino acid numbers 2687-2802 of SEQ ID NO: 25;R23 comprises, consists essentially of, or consists of amino acid numbers 2803-2931 of SEQ ID NO: 25; R24 comprises, consists essentially of, or consists of amino acid numbers 2932-3040 of SEQ ID NO: 25; H4 comprises, consists essentially of, or consists of amino acid numbers 3041-3112 of SEQ ID NO: 25; the CR domain comprises, consists essentially of, or consists of amino acid numbers 3113-3299 of SEQ ID NO: 25; and the CT domain comprises, consists essentially of, or consists of amino acid numbers 3300-3408 of SEQ ID NO: 25. According to certain embodiments, the mini-dystrophin protein has the amino acid sequence of SEQ ID NO: 7.

[0321] The vector genome of the described AAV particles for the treatment of dystrophinopathy, such as DMD, includes a gene to express a mini-dystrophin. Typically, the vector genome will lack the rep and cap genes normally present in wild-type AAV for Petition 870260051626, dated 05 / 29 / 2026, p. 92 / 511 85 / 241 provide space for the gene that expresses mini-dystrophin. In some embodiments, the gene encodes a mini-dystrophin protein with the following natural-size human dystrophin protein subdomains: ABD-H1-R1-R2-H3-R22-R23-R24-H4-CRD-CTD. In some embodiments, CTD is only a portion of the CTD found in wild-type muscle dystrophin, and in some embodiments, it does not include the last three amino acids present in wild-type muscle dystrophin (SEQ ID NO: 25). In certain embodiments, the gene encodes for a human mini-dystrophin protein having the amino acid sequence of SEQ ID NO: 7.

[0322] According to some embodiments, the gene encoding the human mini-dystrophin protein is codon-optimized with respect to the species of the individual to whom the described AAV particles will be administered to effect gene therapy. Without wishing to be limited by theory, codon optimization is believed to improve the efficiency with which transduced cells are able to transcribe the gene into mRNA and / or translate the mRNA into protein, thus increasing the amount of mini-dystrophin protein produced compared to the expression of a mini-dystrophin-coding gene that is not codon-optimized. In some non-limiting embodiments, codon optimization is human codon optimization, however, codon optimization can be performed with respect to other species, including canines.

[0323] In some embodiments, codon optimization replaces one or more codons that pair with relatively rare tRNAs present in a species, such as humans, with synonymous codons that pair with more prevalent tRNAs for the same amino acid. This approach can increase translation efficiency. In other embodiments, codon optimization eliminates certain cis-action motifs that can influence transcription efficiency or Petition 870260051626, dated 05 / 29 / 2026, p. 93 / 511 86 / 241 translation. Non-limiting examples of codon optimization include the addition of a strong Kozak sequence at the intended start of the coding sequence, or the elimination of internal ribosome entry sites downstream of the intended initiation codon. Other cis-action motifs that can be eliminated through codon optimization include internal TATA boxes; chi sites; ARE, INS, and / or CRS sequence elements; r repeat sequences and / or RNA secondary structures; cryptic donor and / or acceptor binding sites, branch points; and SalI sites.

[0324] In certain embodiments, codon optimization increases the GC content (i.e., the number of G and C nucleobases present in a nucleic acid sequence, usually expressed as a percentage) relative to the wild-type sequence from which the mini-dystrophin gene was assembled. In some embodiments, the GC content is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or greater than the GC content of the corresponding wild-type gene. In related embodiments, the GC content of a codon-optimized gene is about or at least 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70% or more.

[0325] In some embodiments, codon optimization increases the codon adaptation index (CAI) of the gene encoding the mini-dystrophin protein. The CAI is a measure of synonymous codon usage bias in a particular species. The CAI value (ranging from 0 to 1) in a particular species is positively correlated with gene expression levels. See, for example, Sharp, PM and WH Lie, Nuc Acids Res. 15 (3): 1281-95 (1987). According to certain embodiments, codon optimization increases the CAI of the mini-dystrophin gene relative to highly expressed human genes for a Petition 870260051626, dated 05 / 29 / 2026, p. 94 / 511 87 / 241 value that is at least 0.70, 0.71, 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, 0.80, 0.81, 0.82, 0.83, 0.84, 0.85, 0.86, 0.87, 0.88, 0.89, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98 or 0.99.

[0326] In other embodiments, codon optimization reduces the number of CpG dinucleotides in the coding sequence of a mini-dystrophin. Without wishing to be bound to any particular theory of operation, it is believed that methylation in CpG dinucleotides can silence gene transcription, such that reducing the number of CpG dinucleotides in a gene sequence can reduce the level of methylation, resulting in enhanced transcriptional efficiency. Thus, in some embodiments of codon-optimized mini-dystrophin genes, the number of CpG dinucleotides is reduced by about or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more, compared to the wild-type sequence from which the mini-dystrophin gene was assembled.

[0327] A non-limiting example of a human codon-optimized mini-dystrophin gene is provided by the DNA sequence SEQ ID NO: 1. This DNA sequence, which is 3978 nucleobases long (including a stop codon), is referred to here as Hopti-Dys3978, although the particular terminology is merely used for convenience and is not intended to be limiting. The mini-dystrophin protein sequence encoded by SEQ ID NO: 1, which is termed Dys3978, is provided by SEQ ID NO: 7. An example of a canine codon-optimized human mini-dystrophin gene is provided by SEQ ID NO: 3, which also encodes Dys3978. As described in greater detail here, the coding sequence for mini-dystrophin of SEQ ID NO: 7 was assembled from wild-type natural-size human muscle dystrophin gene subsequences (as exemplified by NCBI Reference Sequence NM_004006.2, which is incorporated by reference). Petition 870260051626, dated 05 / 29 / 2026, page 95 / 511 88 / 241 corresponding to certain subdomains present in the dystrophin protein (SEQ ID NO: 25). The resulting gene sequence is provided here as SEQ ID NO: 26, which was then human codon optimized, resulting in the DNA sequence of SEQ ID NO: 1. Without limitation, codon optimization increased the GC content, decreased the use of infrequent codons (i.e., increased the codon adaptation index (CAI)), and included a strong translation initiation site (Kozak consensus sequence or similar), compared to the gene sequence before codon optimization.

[0328] The vector genome of the described AAV particles for the treatment of dystrophinopathy, such as DMD, also includes inverted terminal repeats of AAV (ITRs) flanking the codon-optimized gene encoding the mini-dystrophin protein. In some embodiments, the ITRs are of the same AAV serotype as the capsid (e.g., without limitation, AAV9 ITRs used with an AAV9 capsid), but in other embodiments, AAV ITRs of a different serotype may be used. For example, AAV2 serotype ITRs may be used in a vector genome in combination with an AAV capsid of a different serotype, not AAV2. Non-limiting examples include the use of AAV2 ITRs with a capsid of serotypes AAV1, AAV6, AAV7, AAV8, or AAV9, or a different AAV serotype, naturally occurring or unnatural. In one particular, non-limiting example, AAV2 ITRs can be used in combination with the capsid of the AAV9 serotype.From the perspective of the positive or sense DNA strand of the vector genome, the left, 5', or upstream ITR sequence of AAV2 is given as DNA sequence SEQ ID NO: 14, and the right, 3', or downstream ITR sequence of AAV2 is given as DNA sequence SEQ ID NO: 15.

[0329] The genome vector of AAV vectors from the description to the Petition 870260051626, dated 05 / 29 / 2026, page 96 / 511 89 / 241 Treatment of dystrophinopathy, such as DMD, also includes a transcriptional regulatory element operably linked to the gene encoding the mini-dystrophin protein so that the vector genome, once converted to its double-stranded form, can express the mini-dystrophin gene in transduced cells. Transcriptional regulatory elements typically include a promoter, but optionally one or more enhancer elements that can act to increase the rate of transcription initiation from the promoter.

[0330] Operable linkage of a transcriptional regulatory element to the mini-dystrophin coding sequence means that the transcriptional regulatory element can function to control gene transcription and expression, but does not necessarily require any particular structural or spatial relationship. Given that the vector genomes described are typically packaged in AAV capsids as single-stranded DNA molecules, it should be understood that operational linkage may not be functional until the vector genome is converted to double-stranded form. Usually, a promoter will be positioned 5' or upstream of a gene sequence encoding the mini-dystrophin protein, however, other transcriptional regulatory elements, such as enhancers, can be positioned 5' or elsewhere, such as 3' of the gene.

[0331] In some embodiments, the transcriptional regulatory element may be a strong constitutively active promoter, such as those found in certain viruses that infect eukaryotic cells. A well-known example of the technique includes the cytomegalovirus (CMV) promoter, however, others are also known in the Rous sarcoma virus (RSV) promoter. Strong viral promoters, such as CMV or RSV, are typically not tissue-specific, so if used, the mini-dystrophin protein would be expressed not only in muscle cells, but in any other Petition 870260051626, dated 05 / 29 / 2026, page 97 / 511 90 / 241 cell type, such as liver, transduced by the AAV particles described. Thus, in other embodiments, a muscle-specific transcriptional regulatory element can be used to reduce the amount of mini-dystrophin protein expressed in non-muscle cells, such as liver cells, which can also be transduced by the AAV particles described.

[0332] Muscle-specific transcriptional regulatory elements can be derived from muscle-specific genes of any species, including mammalian species, such as, without limitation, human or mouse muscle genes. Muscle-specific transcriptional regulatory elements will typically include at least one promoter from a muscle-specific gene, as well as one or more enhancers from the same or a different muscle-specific gene. Such enhancers may originate from many parts of the native gene, such as enhancers positioned 5' or 3' from the gene, or even reside in introns. Muscle-specific transcriptional regulatory elements may be removed en bloc from a muscle-specific gene and inserted into a plasmid to produce the AAV vector genomes of the description, or they may be designed to adapt their activity and reduce their size as much as possible.

[0333] Non-limiting examples of muscle-specific genes from which muscle-specific transcriptional regulatory elements can be derived include the muscle creatine kinase gene, myosin heavy chain gene, or myosin light chain gene, or the skeletal muscle alpha 1-actin gene, although others are possible as well. These genes can be from humans, mice, or other species.

[0334] Muscle-specific transcriptional regulatory elements that have been created for use in gene therapy applications. Petition 870260051626, dated 05 / 29 / 2026, page 98 / 511 91 / 241 are described in the technique, and can be used in the AAV vectors described for the treatment of muscular dystrophy. In non-limiting examples, Hauser described muscle-specific transcriptional regulatory elements known as CK4, CK5, and CK6 derived from the mouse creatine kinase (MCK) gene (Hauser, MA, et al., Mol Therapy 2 (1): 16-25 (2000)), Salva described muscle-specific transcriptional regulatory elements known as CK1 and CK7, derived from the MCK gene, and MHCK1 and MHCK7, which additionally include mouse α-MHC gene enhancers (Salva, MZ, et al., Mol Therapy 15 (2): 320-9 (2007)), and Wang described muscle-specific transcriptional regulatory elements known as enh358MCK, dMCK, and tMCK (Wang, B, et al., Gene Therapy 15: 1489-9 (2008)). The use of other muscle-specific transcriptional regulatory elements in the AAV vectors described for the treatment of muscular dystrophy is also possible.

[0335] Non-limiting examples of muscle-specific transcriptional regulatory elements that can be used in the AAV vectors described for the treatment of muscular dystrophy include CK4, CK5, CK6, CK1, CK7, MHCK1, MHCK7, enh358MCK, dMCK, and tMCK, each as described in the art, or those described herein as having the DNA sequences SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 16. Other muscle-specific transcriptional regulatory elements may also be used.

[0336] The genome vector of the described AAV vectors for the treatment of dystrophinopathy, such as DMD, also includes a transcription termination sequence positioned 3' from the coding sequence for the mini-dystrophin gene. The inclusion of the transcription termination sequence ensures that the mRNA transcript encoding the mini-dystrophin protein will be appropriately polyadenylated by the transduced cell, thus ensuring translation. Petition 870260051626, dated 05 / 29 / 2026, p. 99 / 511 92 / 241 efficient message in protein. Without intending to be limited by any particular theory of operation, research on transcription termination sequences in mammals has identified a consensus sequence in the 3' UTR of genes that serve to terminate transcription and signal polyadenylation of the growing transcription. Specifically, these sequences typically include the AATAAA motif, followed by 15-30 nucleotides and then CA. See, for example, N. Proudfoot, Genes Dev 25: 1770-82 (2011). Other motifs, such as an upstream element (USE) and downstream element (DSE), may contribute to transcription termination in some genes. Many transcription termination sequences are known in the art and can be used in the AAV vectors described.Non-limiting examples include the polyadenylation signal of early or late genes of the SV40 virus (SV40 early or late polyA) or the polyadenylation signal of the bovine growth hormone gene (bGH polyA). Transcription termination sequences from other genes of any species may be used in the AAV vectors described. Alternatively, synthetic transcription termination sequences may be designed and used to signal transcription termination and polyadenylation. Additional non-limiting examples of transcription termination sequences that may be used in the AAV vectors described include those described herein as having the DNA sequences SEQ ID NO: 6 and SEQ ID NO: 17.

[0337] According to certain non-limiting embodiments, the description provides an AAV viral particle or vector for the treatment of dystrophinopathy, such as DMD, comprising an AAV capsid and a vector genome encoding a mini-dystrophin protein. In some embodiments, the mini-dystrophin protein includes the following subdomains of the full-size human dystrophin protein: Petition 870260051626, dated 05 / 29 / 2026, page 100 / 511 93 / 241 ABD-H1-R1-R2-H3-R22-R23-R24-H4-CRD-CTD. In some embodiments, CTD is only a portion of the CTD found in wild-type muscle dystrophin, and in some embodiments, it does not include the last three amino acids present in wild-type muscle dystrophin (SEQ ID NO: 25). According to certain embodiments, the gene encoding the mini-dystrophin protein of SEQ ID NO: 7 is human codon-optimized and has the DNA sequence of SEQ ID NO: 1. In some embodiments, the AAV capsid is of the AAV9 serotype.

[0338] As noted elsewhere here, vector genomes of Single-stranded AAVs are packaged in capsids as either the positive strand or the negative strand in approximately equal proportions. Consequently, vector or particle modalities include AAV particles in which the vector genome is in the positive strand polarity (i.e., has the nucleobase sequence of the sense or coding DNA strand), as well as AAV particles in which the vector genome is in the negative strand polarity (i.e., has the nucleobase sequence of the antisense or pattern DNA strand). Given the positive strand nucleobase sequence in its regular 5' to 3' order, the negative strand nucleobase sequence in its 5' to 3' order can be determined as the reverse complement of the positive strand nucleobase sequence.

[0339] In some embodiments of the vector, the vector genome, when in positive polarity, comprises a muscle-specific transcriptional regulatory element derived from the creatine kinase gene having the DNA sequence SEQ ID NO: 16 positioned 5' from and operably linked to SEQ ID NO: 1, the DNA sequence of the human codon-optimized gene encoding the mini-dystrophin protein. Particles comprising the corresponding negative strand are also possible, where the nucleobase sequence of their Petition 870260051626, dated 05 / 29 / 2026, page 101 / 511 94 / 241 the 5' end would be the reverse complement of the aforementioned positive strand sequence. In other embodiments, the vector genome, when in positive polarity, comprises a first AAV2 ITR followed by the DNA sequence of SEQ ID NO. 16 positioned 5' and operably linked to the DNA sequence of SEQ ID NO: 1 and a transcription termination sequence comprising the DNA sequence of SEQ ID NO: 17 positioned 3' from the mini-dystrophin gene, followed by a second AAV2 ITR. Particles comprising the corresponding negative strand are also possible, where the nucleobase sequence of their 5' end would be the reverse complement of the aforementioned positive strand sequence.

[0340] In certain other embodiments of the vector, the vector genome, when in positive polarity, comprises in the 5' to 3' order, a first AAV2 ITR, a transcriptional regulatory element sequence defined by the DNA sequence of SEQ ID NO: 16, a human codon-optimized gene sequence to express a mini-dystrophin, the gene sequence defined by the DNA sequence of SEQ ID NO: 1 in operable linkage with the transcriptional regulatory element, a transcription termination sequence defined by the DNA sequence of SEQ ID NO: 17, and a second AAV2 ITR. Particles comprising the corresponding negative strand are also possible, where the nucleobase sequence of their 5' end would be the reverse complement of the aforementioned positive strand sequence.

[0341] According to a particular non-limiting embodiment, an AAV vector for the treatment of dystrophinopathy, such as DMD, which may be referred to herein as AAV9.hCK.Hopti-Dys3978.spA, comprises an AAV9 serotype capsid and a vector genome, which vector genome may be referred to herein as hCK.Hopti Petition 870260051626, dated 05 / 29 / 2026, p. 102 / 511 95 / 241 Dys3978.spA, comprising, consisting essentially of, or consisting of, when the genome is in positive polarity, the DNA sequence of SEQ ID NO: 18 or, when the genome is in negative polarity, the reverse complement of the DNA sequence of SEQ ID NO: 18 (that is, when the vector genome sequence is read 5' to 3'). Methods of Producing Viral Vectors

[0342] The present description also provides methods for producing AAV vectors. In a particular embodiment, the present description provides a method for producing a recombinant parvovirus particle, comprising providing a cell permissive to AAV replication and packaging a recombinant AAV vector genome, comprising a mini-dystrophin gene, associated gene control elements and flanking AAV ITRs, and AAV replication and packaging functions, such as those provided by the AAV rep and cap genes, under conditions sufficient for the replication and packaging of recombinant AAV particles, wherein the rAAV particles are produced by the cell. Conditions sufficient for the replication and packaging of rAAV particles include, without limitation, auxiliary functions, such as those of adenovirus and / or herpesvirus.Cells that are permissive for AAV replication and packaging are known here as packaging cells or producer cells, terms encompassed by the broader term, host cells. The rAAV particle vector genome, replication and packaging functions, and, where necessary, auxiliary functions can be provided via viral or non-viral vectors, such as plasmids, and can exist within packaging cells in a stable or transient form, either integrated into the cell's genome or in an episome.

[0343] Recombinant AAV vectors from the description may be Petition 870260051626, dated 05 / 29 / 2026, page 103 / 511 96 / 241 performed by various methods known to skilled technicians (see, for example, WO 2013 / 063379). An exemplary method is described in Grieger, et al. 2015, Molecular Therapy 24 (2): 287-297, the contents of which are incorporated by reference. Briefly, efficient transfection of HEK293 cells is used as a starting point, where an adherent HEK293 cell line from a qualified clinical master cell bank is used to grow under animal component-free suspension conditions in shaker flasks and WAVE bioreactors that allow for rapid and scalable rAAV particle production. Using the triple transfection method (e.g., WO 96 / 40240), the HEK293 suspension cell line is capable of generating, in some modalities, more than 1x10⁵ of vector genome (vg) containing particles per cell, or more than 1x10¹⁴ vg / L of cell culture when harvested 48 hours after transfection.Triple transfection refers to the packaging cell being transfected with three plasmids: one plasmid encodes the AAV rep and cap genes, another plasmid encodes various auxiliary functions (e.g., adenovirus or HSV proteins such as E1a, E1b, E2a, E4 and VA RNA), and another plasmid encodes the vector genome, i.e., the mini-dystrophin gene and its various control elements flanked by AAV ITRs. To achieve the desired yields, a number of variables can be optimized, such as the selection of compatible serum-free suspension media that equally support growth and transfection, selection of a transfection reagent, transfection conditions, and cell density. Vectors can be collected from the medium and / or by cell lysis, and then purified using the classic density gradient ultracentrifugation technique, or using column chromatographic or other techniques.

[0344] Packaging functions include genes for viral vector replication and packaging. Thus, for example, the Petition 870260051626, dated 05 / 29 / 2026, page 104 / 511 97 / 241 Packaging functions may include, when necessary, functions required for viral gene expression, viral vector replication, rescue of the viral vector from the integrated state, viral gene expression, and packaging of the viral vector into a viral particle. Packaging functions may be provided jointly or separately to the packaging cell using a gene construct, such as a plasmid or an amplicon, a Baculovirus, or an HSV helper construct. Packaging functions may exist extrachromosomally within the packaging cell, but may also be integrated into the cell's chromosomal DNA. Examples include genes encoding the Rep and Cap proteins of AAV. The Rep and Cap genes may be provided to package cells together as part of the same viral or non-viral vector.For example, rep and cap sequences can be provided by a hybrid adenovirus vector (e.g., inserted into the E1a or E3 regions of a deleted adenovirus vector) or a herpesvirus vector, such as an EBV vector. Alternatively, the AAV rep and cap genes can be provided separately. The rep and cap genes can also be stably integrated into the genome of a packaging cell, or exist in an episome. Typically, the rep and cap genes will not be flanked by ITRs to prevent packaging of these sequences into rAAV vector particles.

[0345] Helper functions include helper viral elements necessary to establish active infection of the packaging cell that is required to initiate viral vector packaging. Examples include adenovirus, baculovirus, and / or herpesvirus-derived functions sufficient to result in viral vector packaging. For example, adenovirus helper functions will typically include adenovirus components E1a, E1b, E2a, E4, and VA RNA. Packaging functions may be Petition 870260051626, dated 05 / 29 / 2026, page 105 / 511 98 / 241 provided by infecting the packaging cell with the required virus. Alternatively, the use of infectious virus can be avoided, whereby packaging functions can be provided jointly or separately to the packaging cell using a non-viral vector such as a plasmid or an amplicon. See, for example, pXR helper plasmids as described in Rabinowitz et al., 2002, J. Virol. 76: 791 and pDG plasmids described in Grimm et al., Human Gene Therapy 9: 2745-2760, 1998. Packaging functions can exist extrachromosomally within the packaging cell, however, they can also be integrated into the cell's chromosomal DNA (e.g., E1 or E3 in HEK 293 cells).

[0346] Any method of introducing the nucleotide sequence carrying the helper functions into a host cell for replication and packaging may be employed, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, and liposomes in combination with a nuclear localization signal. In embodiments where the helper functions are provided by transfection using a viral vector or infection using a helper virus; standard methods for producing viral infection may be used.

[0347] Any permissive or suitable packaging cell known in the art may be employed in the production of the packaged viral vector. Mammalian cells or insect cells are preferred. Examples of cells useful for the production of packaging cells in the practice of the invention include, for example, human cell lines such as VERO, WI38, MRC5, A549, HEK 293 cells (which express functional adenoviral E1 under the control of a constitutive promoter), B-50 cells, or any other HeLa, HepG2, Saos-2, HuH7, and HT1080 cell lines. In one aspect, the cell Petition 870260051626, dated 05 / 29 / 2026, page 106 / 511 The packaging cell 99 / 241 is capable of growing in suspension culture, especially in serum-free growth media. In one embodiment, the packaging cell is an HEK293 that grows in suspension in serum-free medium. In another embodiment, the packaging cell is the HEK293 cell described in U.S. Patent No. 9,441,206 and filed as ATCC No. PTA 13274. Numerous rAAV particle packaging cell lines are known in the art, including, but not limited to, those described in WO. 2002 / 46359.

[0348] Cell lines for use as packaging cells include insect cell lines, particularly when baculoviral vectors are used to introduce the genes required for rAAV particle production as described herein. Any insect cell that allows AAV replication and can be maintained in culture may be used in accordance with the present description. Examples include Spodoptera frugiperda, such as the Sf9 or Sf21 cell lines, Drosophila spp. cell lines, or mosquito cell lines, for example, cell lines derived from Aedes albopictus.

[0349] After the AAV vector particles described have been produced and purified, they can be titrated to prepare compositions for administration to individuals, such as human individuals with muscular dystrophy. AAV vector titration can be performed using methods known in the art. In certain embodiments, AAV vector particles can be titrated using quantitative PCR (qPCR) using primers against sequences in the vector genome, for example, AAV2 ITR sequences if present, or other sequences in the vector genome. Performing qPCR in parallel on dilutions of a known concentration standard, such as a plasmid containing the sequence Petition 870260051626, dated 05 / 29 / 2026, page 107 / 511 100 / 241 of the vector genome, a standard curve can be generated allowing the concentration of the AAV vector to be calculated as the number of vector genomes (vg) per unit volume, such as microliter or milliliter. Alternatively, the number of AAV vector particles containing genomes can be determined using spot staining with a suitable probe for the vector genome. These techniques are further described in Gray, SJ, et al., Production of recombinant adeno-associated viral vectors and use in vitro and in vivo administration, Curr Protoc Neurosci (2011) and Werling NJ, et al., Gene Ther Meth 26: 82-92 (2015). Once the concentration of AAV vector genomes in the raw material is determined, it can be diluted in or dialyzed against suitable buffers for use in preparing a composition for administration to individuals. Treatment methods

[0350] The description provides methods for treating a dystrophinopathy by administering to an individual in need of treatment for dystrophinopathy a therapeutically effective dose or amount of an AAV vector from the description, such as, without limitation, the vector known as AAV9.hCK.Hopti-Dys3978.spA. In some embodiments, the dystrophinopathy is a muscular dystrophy, including, without limitation, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), DMD-associated dilated cardiomyopathy (DCM), and symptomatic carrier states in women. Thus, in some embodiments, the description provides methods for treating muscular dystrophy by administering to an individual in need of treatment for muscular dystrophy a therapeutically effective dose or amount of an AAV vector from the description, such as, without limitation, the vector known as AAV9.hCK.Hopti-Dys3978.spA.In related modalities, the description provides methods for the treatment of Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), and cardiomyopathy. Petition 870260051626, dated 05 / 29 / 2026, page 108 / 511 101 / 241 dilated associated DMD (DCM) and symptomatic carrier states in women, in individuals requiring treatment for this purpose.

[0351] The use of an AAV vector or pharmaceutical composition of the description in the manufacture of a medicament for use in the treatment methods described herein is also provided. In addition, an AAV vector or pharmaceutical composition of the description is provided for use in a treatment method described herein.

[0352] Treatment of individuals with a dystrophinopathy, such as DMD, does not need to result in a cure to be considered effective, where cure is defined as the halting of disease progression or the partial or complete restoration of the individual's muscle function. Rather, a therapeutically effective dose or amount of an AAV vector of the description is one that serves to reduce or improve the symptoms of, slow the progression of, or improve the quality of life of an individual with a dystrophinopathy, such as DMD. According to certain non-limiting modalities, treatment of individuals with a dystrophinopathy may improve their mobility, delay the time to their loss of ambulation or other mobility, and in cases of severe dystrophinopathy, such as DMD, prolong the lives of individuals with the disorder.

[0353] The treatment methods described can be used to treat male or female individuals with a dystrophinopathy, such as DMD. In the case of women, treatment can be provided to symptomatic carriers, or to the rare female individual with the developed disease. The methods described can also be used to treat individuals of any age with a dystrophinopathy, including individuals under 1 year of age, or approximately or at least 1 year of age, or approximately or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 years or older. Individuals, when treated, Petition 870260051626, dated 05 / 29 / 2026, page 109 / 511 102 / 241 can be outpatient or non-outpatient.

[0354] The treatment methods described can be used to treat individuals with dystrophinopathy, regardless of the underlying genetic lesion (e.g., deletions, duplications, linkage site variants, or nonsense mutations in the dystrophin gene), provided that the lesion results in a reduction or loss of function of the native human dystrophin gene.

[0355] In certain embodiments of the description, treatment of an individual with a therapeutically effective dose or amount of an AAV mini-dystrophin vector will reduce tissue concentrations of one or more biomarkers that are associated with the presence or progression of muscular dystrophy.

[0356] According to certain modalities, biomarkers are certain enzymes released from damaged skeletal muscle or cardiac muscle cells into the blood (including serum or plasma). Non-limiting examples include creatine kinase (CK), the transaminases alanine aminotransferase (ALT) and aspartate aminotransferase (AST), and lactic acid dehydrogenase (LDH), whose average levels are all known to be elevated in individuals with DMD.

[0357] In some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the description is effective in reducing elevated blood ALT levels in DMD patients to approximately 7-, 6-, 5-, 4-, 3-, or twice as high as those typically found in healthy individuals of similar age and sex. In other embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the description is effective in reducing elevated blood AST levels in DMD patients to approximately 7-, 6-, 5-, 4-, 3-, or 2 times as high as those typically found in healthy individuals of similar age and sex. Petition 870260051626, dated 05 / 29 / 2026, p. 110 / 511 103 / 241 similar sex. In some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector from the description is effective in reducing elevated LDH levels in the blood of DMD patients to approximately 7-, 6-, 5-, 4-, 3-, or 2 times higher than those typically found in healthy individuals of similar age and sex. In other modalities, a therapeutically effective dose or amount of an AAV mini-dystrophin vector from the description is effective in reducing elevated total CK levels in the blood of DMD patients to within approximately 50-, 48-, 46-, 44-, 42-, 40-, 38-, 36-, 34-, 32-, 30-, 28-, 26-, 24-, 22-, 20-, 18-, 16-, 14-, 12-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or 2 times greater than that typically found in healthy individuals of similar age and sex. Matrix metalloproteinase-9 (MMP-9), an enzyme associated with the degradation or remodeling of the extracellular matrix, has also been found to be elevated in the blood of DMD patients.See, for example, Nadaraja, VD, et al., Neuromusc. Disorders 21: 569-578 (2011). Thus, in some embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the invention is effective in reducing elevated MMP-9 levels in the blood of DMD patients to within approximately 15-, 14-, 13-, 12-, 11-, 10-, 9-, 8-, 7-, 6-, 5-, 4-, 3-, or 2 times greater than that typically found in healthy individuals of similar age and sex.

[0358] In other embodiments, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the description is effective in altering ALT, AST, LDH, CK, and MMP9 levels as indicated above, alone or in combination with one or more of these same or other biomarkers. Thus, in a non-limiting exemplary embodiment, a therapeutically effective dose or amount of an AAV mini-dystrophin vector of the description is effective in reducing ALT and AST, ALT and LDH, AST and CK, or AST Petition 870260051626, dated 05 / 29 / 2026, p. 111 / 511 104 / 241 and MMP-9, etc.

[0359] In some treatment description methods, an effective dose or amount of an AAV vector is that which improves the individual’s average performance on the 6-minute walk test (6MWT). The 6MWT has been established as a reproducible and valid measure of muscle function and mobility in human individuals with muscular dystrophy, particularly DMD. See, for example, McDonald, CM, et al., Muscle Nerve 41 (4): 500-10 (2010); Henricson, E, et al., PLOS Currents Musc Dys, July 8, 2013; McDonald, CM, et al., Muscle Nerve 48: 343-56 (2013). In the test, the distance in meters that an individual can, from rest, walk continuously and unassisted for a period of 6 minutes is recorded. This distance is also known as the 6-minute walk distance (6MWD). In some applications of the test, an individual may be tested more than once over a period of days, and the results were averaged.Due to its advantages, the 6MWT has been adopted as a primary clinical outcome in clinical trials involving outpatient DMD patients. See, for example, Bushby, K, et al., Muscle Nerve 50: 477-87 (2014); Mendell, JR, et al. Ann Neurol 79: 257-71 (2016);. Campbell, C, et al, Muscle Nerve 55 (4): 458-64 (2017). Typically, in these studies, each individual in the treatment group has their ambulation tested using the 6MWT over a period of months or years to determine if there is a treatment effect.

[0360] According to some modalities of the treatment methods described, therapeutic efficacy is determined statistically by comparing the effect of the AAV vector treatment described on the average 6MWT performance of treated individuals, such as those with DMD, compared with the average 6MWT performance of untreated control individuals with the same type of dystrophinopathy, such as DMD. Such controls may have been included Petition 870260051626, dated 05 / 29 / 2026, p. 112 / 511 105 / 241 in the same studies used to evaluate the therapeutic efficacy of the AAV vectors described, or they may be similar individuals drawn from natural history studies of DMD progression or other dystrophinopathies. Controls may be matched by age (or stratified, for example and without limitation, into individuals younger or older than some thresholds, such as 6, 7, 8, 9, or 10 years), matched by prior corticosteroid treatment status (i.e., yes or no, or prior treatment time), matched for baseline performance on the 6MWT before any treatment (except perhaps with corticosteroids) (or stratified, for example and without limitation, into those individuals whose baseline performance is below and above some threshold, such as 200 m, 250 m, 300 m, 350 m, 400 m, 450 m, or 500 m), or some other attribute determined to be clinically relevant.

[0361] According to certain modalities of the treatment methods described, a therapeutically effective dose or amount of an AAV vector described is effective in increasing the mean 6MWD of individuals with dystrophinopathy, such as DMD, by approximately or at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 meters or more compared with similar or similarly stratified controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36 months after administration of the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0362] According to certain modalities of the treatment methods described, a therapeutically effective dose or quantity of an AAV vector described is effective in increasing the mean 6MWD of individuals with dystrophinopathy, such as DMD, by approximately or at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, Petition 870260051626, dated 05 / 29 / 2026, p. 113 / 511 106 / 241 75, 80, 85, 90, 95, or 100 meters or more compared with similar or similarly stratified controls 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, 360, 390, 420, 450, 480, 510, 540, 570, 600, 630, 660, 690, or 720 days after vector administration. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0363] As an alternative to the 6MWT, therapeutic efficacy can be expressed as a reduction in the time it takes an individual to climb 4 standard-sized stairs, a test known as the 4-step climbing test. This test has been used to evaluate the efficacy of corticosteroid treatment in patients with DMD. Griggs, RC, et al., Arch Neurol 48 (4): 383-8 (1991). Thus, according to certain modalities of the treatment methods described, a therapeutically effective dose or amount of an AAV vector described is effective in reducing the average time it takes for individuals with dystrophinopathy, such as DMD, to perform the 4-step climbing test by approximately, or at least, 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8, or 4.0 seconds or more compared with similar matched or stratified controls 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, or 36 months after vector administration.In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0364] In related modalities of the treatment methods described, a therapeutically effective dose or quantity of an AAV vector described is effective in reducing the average time it takes for individuals with dystrophinopathy, such as DMD, to perform the test. Petition 870260051626, dated 05 / 29 / 2026, page 114 / 511 107 / 241 of climbing 4 steps in approximately or at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.2, 2.4, 2.6, 2.8, 3.0, 3.2, 3.4, 3.6, 3.8 or 4.0 seconds or more compared with similar or similarly stratified controls 30, 60, 90, 120, 150, 180, 210, 240, 270, 300, 330, 360, 390, 420, 450, 480, 510, 540, 570, 600, 630, 660, 690 or 720 days after vector administration. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0365] Therapeutic efficacy can also be expressed as a reduction over time in the percentage of individuals who experience loss of ambulation at a specified time after treatment compared with controls. Loss of ambulation is defined as the onset of continued dependence on the use of wheelchairs. Thus, according to other modalities of the treatment methods described, a therapeutically effective dose or quantity of an AAV vector described reduces, 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36 months after administration to individuals with dystrophinopathy, such as DMD, the average number of individuals who lost ambulation by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or more compared with similar matched or stratified controls.In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a minidystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0366] In some modalities of the treatment methods described, a therapeutically effective dose or quantity of a Petition 870260051626, dated 05 / 29 / 2026, p. 115 / 511 The 108 / 241 AAV vector described is effective in delaying the onset of one or more symptoms in an individual having a dystrophinopathy, such as DMD. Diagnosis before the onset of symptoms can be made through prenatal, perinatal, or postnatal genetic testing for mutations in the DMD gene. According to certain modalities, treatment with an AAV vector described is effective in delaying the appearance of one or more DMD symptoms by at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 15, 16, 18, 20, 22, 24, 25, 26, 28, 30, 32, 34, 35, 36, 38, 40, 42, 44, 45, 46, 48, 50, 52, 54, 55, 56, 28, 60, 62, 64, 65, 66, 68, 70, 72, 74, 75, 76, 78, or 80 months, or more compared with similar or similarly stratified controls. According to experts, early symptoms of DMD include, but are not limited to, delayed walking ability (to an average age of about 18 months, compared to an average of 12-15 months in infants without DMD); difficulty jumping, running, or climbing stairs; proneness to falling; proximal muscle weakness, evidenced, for example, by exhibiting Gowers' maneuver when rising from the floor; enlarged calves, due to pseudohypertrophy; waddling gait due to walking on the toes and / or balls of the feet; tendency to maintain balance by stretching the belly and pulling the shoulders back; and cognitive impairments such as decreased receptive language, expressive language, visuospatial ability, fine motor skills, attention, and memory skills.In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a minidystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0367] Therapeutic efficacy can also be expressed as a reduction over time in the percentage of vector-treated individuals who experience an increase in the amount of adipose tissue. Petition 870260051626, dated 05 / 29 / 2026, page 116 / 511 109 / 241 which replaces lean muscle tissue compared to untreated controls. In some modalities, this progression towards increased adiposity can be determined using MRI analysis of the leg muscles of DMD patients and expressed as the fat fraction (FF), as explained in Willcocks, RJ, et al., Multicenter prospective longitudinal study of magnetic resonance biomarkers in a large Duchenne muscular dystrophy cohort, Ann Neurol 79:535-47 (2016). In related modalities, treatment of DMD individuals with an AAV vector as described is effective in reducing mean FF in their lower extremities as determined by MRI by approximately or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75% or more 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36 months after treatment compared with matched controls.In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0368] In some modalities, a therapeutically effective dose or amount of an AAV vector of the description is that which results in at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more of skeletal muscle fibers expressing minidystrophin protein 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33 or 36 months after treatment. The percentage of muscle fibers that are positive for mini-dystrophin protein expression can be determined by immunostaining biopsied muscle sections from individuals treated with an anti-dystrophin antibody capable of specifically binding to mini-dystrophin protein. Suitable immunostaining techniques are described in the Examples and are familiar to those from experiments. Petition 870260051626, dated 05 / 29 / 2026, page 117 / 511 110 / 241 ordinary technique. Exemplary muscles from treated individuals from which biopsies can be made include biceps, deltoids, and quadriceps, although other muscles can also be biopsied. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0369] In some embodiments, a dose or quantity of an AAV vector described for the treatment of dystrophinopathy, such as muscular dystrophy, such as DMD, is determined to be therapeutically effective while not causing a specific cellular (T cell) immune response to the mini-dystrophin protein in treated individuals, or only in a small percentage of these individuals. The existence or extent of a T cell response against the mini-dystrophin protein can be determined using the ELISPOT assay to detect peripheral blood mononuclear cells (PBMCs) isolated from the individual's blood that produce interferon gamma (IFNγ) in response to exposure to an overlapping peptide library covering the amino acid sequence of the mini-dystrophin protein. In certain embodiments, the threshold for a positive IFNγ response may be defined as greater than 50 spot-forming cells per million PBMCs tested.The use of other assays to detect a T-cell response against mini-dystrophin protein is also possible, including, without limitation, the detection of T-cell infiltrates in biopsies of muscle or other tissues expressing mini-dystrophin protein obtained from vector-treated individuals. The individuals may be human subjects or animal subjects, such as animal models of DMD, such as mdx mouse, mdx rat, or GRMD dog models. In other modalities, a dose or quantity of an AAV vector from the description is used for treatment of... Petition 870260051626, dated 05 / 29 / 2026, page 118 / 511 111 / 241 dystrophinopathy, such as muscular dystrophy, such as DMD, determined to be therapeutically effective and at the same time not cause an inflammatory response against the capsid, vector genome (or any of its components), or mini-dystrophin protein expressed by transduced cells, or in only a small percentage of such individuals. Without wishing to be bound to any particular theory of operation, inflammation in response to an AAV vector may be caused by an innate immune response. Inflammation, if present, in the muscles of vector-treated individuals can be detected using magnetic resonance imaging. See, for example, J Garcia, Skeletal Radiol 29: 425-38 (2000) and Schulze, M, et al., Am J Radiol 192: 1708-16 (2009). Individuals may be human individuals or animal individuals, such as animal models of DMD, such as mdx mouse, mdx rat, or dog models with GRMD.In some of the modalities described above, the presence or absence of a cellular immune response or inflammation is determined 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or 36 months after treatment, or at some other time after treatment. In related embodiments, a low percentage of individuals exhibiting a cellular immune response to the minidystrophin protein would be less than or equal to approximately 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% of individuals who received the vector. In some of these embodiments, the AAV vector comprises the AAV9 capsid and a genome including a human codon-optimized gene encoding a minidystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA.

[0370] In related modalities, a dose or quantity of an AAV vector from the description for treatment of dystrophinopathy, such as muscular dystrophy, such as DMD, is therapeutically effective without Petition 870260051626, dated 05 / 29 / 2026, page 119 / 511 112 / 241 need for concomitant immunosuppression in treated individuals. Thus, in certain modalities, treatment of an individual with dystrophinopathy, such as DMD, is effective without the need to administer to the individual before, during, or after treatment with AAV vector one or more immunosuppressive drugs (in addition to steroid treatment, which is the current standard of care). Exemplary immunosuppressive drugs include, but are not limited to, calcineurin inhibitors such as tacrolimus and cyclosporine, antiproliferative agents such as mycophenolate, leflunomide, and azathioprine, or mTOR inhibitors such as sirolimus and everolimus.

[0371] As explored in greater detail in the Examples, the efficacy of the AAV vectors described, including without limitation the vector designated AAV9.hCK.Hopti-Dys3978.spA, can be tested in animal models of Duchenne muscular dystrophy, and results used to predict effective doses of such vectors in human DMD patients. Several animal models are known in the art, including the mdx mouse model, the Golden Retriever muscular dystrophy model, and more recently, the Drndmdx rat model, which is described in greater detail in the Examples.

[0372] Based on the Drndmdx mouse model, effective doses of AAV vectors described, including the vector designated AAV9.hCK.Hopti-Dys3978.spA, can be established with respect to various biological parameters and aspects of the disease course in mice.

[0373] Thus, according to certain embodiments described, treatment of Drndmdx mice with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in reducing AST, ALT, LDH, or total creatine kinase levels at 3 months or 6 months after injection compared with controls.

[0374] In other modalities, the treatment of rats with Drndmdx Petition 870260051626, dated 05 / 29 / 2026, page 120 / 511 113 / 241 with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in reducing fibrosis in the biceps femoris, diaphragm, or cardiac muscle at 3 months or 6 months post-injection compared to controls.

[0375] In other modalities, the treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in increasing limb grip strength 3 months or 6 months post-injection compared to controls.

[0376] According to other modalities, treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in reducing muscle fatigue as measured in 5 near-test assays of forelimb grip strength at 3 months or 6 months post-injection compared to controls.

[0377] In some other modalities, the treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in increasing left ventricular ejection fraction measured by echocardiography at 6 months post-injection compared to controls.

[0378] In other embodiments, treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in increasing the ratio of early to late left ventricular load velocity (i.e., E / A ratio) measured by echocardiography at 3 months or 6 months post-injection compared to controls.

[0379] According to some embodiments, treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 1 x 1014vg / kg or 3 x 1014vg / kg is effective in decreasing the isovolumetric relaxation time (IVRT) or the time in milliseconds. Petition 870260051626, dated 05 / 29 / 2026, page 121 / 511 114 / 241 between the velocity of the E peak and its return to baseline (i.e., the E-wave deceleration time (TD)) measured by echocardiography at 3 months or 6 months after injection compared to controls.

[0380] In each of the previous modalities, the increase or decrease in physiological measurement in vector-treated animals, compared to control animals, can, in some modalities, be tested for statistical significance. The choice of which statistical test to apply is within the knowledge of those of ordinary experience in the art. When a p-value is adopted as the way to assess statistical significance, these p-values, once calculated, can be compared to a predefined significance level, and if the p-value is less than the significance level, the treatment effect can be determined as statistically significant.In some embodiments, the significance level can be predefined as 0.25, 0.20, 0.15, 0.10, 0.05, 0.04, 0.03, 0.02, 0.01, 0.005, or some other significance level. Thus, in a non-limiting illustrative embodiment, where the significance level is predefined as 0.05, then the calculation of a p-value < 0.05 would be interpreted as representing a statistically significant difference between the vector-treated groups and the control groups.

[0381] In each of the above modalities, the controls can be animals of the same sex and genetic background of the same age that are not treated, or treated only with vehicle and not with vector. Other controls are also possible, however.

[0382] In some other modalities, the treatment of rats with Dmdmdx with a dose of AAV9.hCK.Hopti-Dys3978.spA of at least 3 x 1014vg / kg is effective in transducing the biceps femoris, diaphragm, cardiac muscle, or other striated muscles, and expressing the mini-dystrophin protein encoded by the opti-Dys3978 gene without Petition 870260051626, dated 05 / 29 / 2026, page 122 / 511 115 / 241 induce a cellular immune response against the mini-dystrophin protein at the end of 3 months or 6 months after injection. The cellular immune response against the mini-dystrophin protein can be evaluated by isolating splenocytes or blood lymphocytes, such as peripheral blood mononuclear cells (PBMCs), from test animals, incubating the cells with peptides from an overlapping peptide library covering the amino acid sequence of the mini-dystrophin protein (e.g., peptides 15 amino acids long by overlapping by 10 amino acids each) in sets (e.g., 5 sets) and determining whether the cells produce interferon gamma (IFNy) in response to exposure to the peptides. IFNy production can be determined using the ELISPOT assay according to the knowledge of those of ordinary experience in the art. See, for example, Smith, JG, et al., Clin Vaccine Immunol 8 (5): 871-9 (2001), Schmittel A, et al., J Immunol Methods 247: 17-24 (2001), and Marino, AT, et al., Measuring immune responses to recombinant AAV gene transfer, Ch. 11, pp. 259-72, Adeno-Associated Virus Methods and Protocols, Ed. RO Snyder and P Moullier, Humana Press (2011). In certain modalities, the threshold for a positive IFNγ response may be defined as greater than 50 spot-forming cells per million cells tested, or in other modalities, as at least 3 times the number of spot-forming cells detected using a negative control (e.g., medium only without peptide addition), so that a negative response would be considered below these limits.

[0383] In some embodiments of the treatment methods described herein, an AAV vector for the treatment of dystrophinopathy, such as DMD, is administered to a patient in need of treatment for dystrophinopathy, such as DMD, in conjunction with at least one second agent established or believed to be effective in the treatment of dystrophinopathy, such as DMD. The combined administration Petition 870260051626, dated 05 / 29 / 2026, page 123 / 511 116 / 241 of the AAV vector means treating an individual before, contemporaneously with, or after treatment with the second agent. According to certain embodiments, the AAV vector is administered in conjunction with an antisense oligonucleotide that causes exon skipping in the DMD gene, for example, exon 51 of the dystrophin gene, or some other exon of the dystrophin gene. Agents that cause exon 51 skipping in the dystrophin gene include drisapersene and eteplirsen, but others are possible. In other embodiments, the AAV vector is administered in conjunction with an agent that inhibits myostatin function in the individual, such as an antimyostatin antibody, examples of which are provided in Pat. 7,888,486, 8,992,913, and 8,415,459.In other embodiments, where the individual's dystrophinopathy can be attributed to a nonsense mutation in the dystrophin gene, the AAV vector is administered in conjunction with an agent that promotes ribosomal reading of nonsense mutations, such as ataluren, or with an agent that suppresses premature stop codons, such as an aminoglycoside like gentamicin. In other embodiments, the AAV vector is administered in conjunction with an anabolic steroid, such as oxandrolone. And in still other embodiments, the AAV vector is administered in conjunction with a corticosteroid, such as, without limitation, prednisone, deflazacort, or prednisolone. In some embodiments of these methods, the AAV vector is an AAV9 vector comprising a genome including a codon-optimized human gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.HoptiDys3978.spA. Pharmaceutical Formulations and Methods of Administration

[0384] The viral vectors and capsids according to the present invention find use in veterinary and human medical applications. Suitable subjects include both birds and mammals. The term avian when used herein includes, but is not limited to, chickens, Petition 870260051626, dated 05 / 29 / 2026, p. 124 / 511 117 / 241 ducks, geese, quails, turkeys, pheasants, parrots, parakeets and the like. The term “mammal” as used herein includes, but is not limited to, humans, non-human primates, cattle, sheep, goats, horses, cats, dogs, lagomorphs, etc. Human subjects include newborns, infants, juveniles and adults. Optionally, the subject is “in need” of the methods of the present invention, for example, because the subject has or is believed to be at risk for a disorder including those described herein or would benefit from the release of a polynucleotide including those described herein. As a further option, the subject may be a laboratory animal and / or an animal disease model.

[0385] In particular embodiments, the present invention provides a pharmaceutical composition comprising a viral vector (such as an rAAV particle) and / or capsid of the invention in a pharmaceutically acceptable vehicle and, optionally, other medicinal agents, pharmaceutical agents, stabilizing agents, buffers, vehicles, adjuvants, diluents, etc. For injection, the vehicle will typically be a liquid. For other methods of administration, the vehicle may be solid or liquid. For administration by inhalation, the vehicle will be respirable and, optionally, may be in the form of solid or liquid particles.

[0386] By “pharmaceutically acceptable” is meant a material that is not toxic or otherwise undesirable, that is, the material can be administered to an individual without causing any undesirable biological effects.

[0387] One aspect of the present invention is a method for transferring a polynucleotide encoding mini-dystrophin into a cell in vitro. The viral vector can be introduced into cells at the appropriate multiplicity of infection according to standard transduction methods suitable for the particular target cells. The Petition 870260051626, dated 05 / 29 / 2026, page 125 / 511 118 / 241 viral vector titers to be administered may vary depending on the type and number of target cells and the particular viral vector, and may be determined by those skilled in the art without undue experimentation. In representative embodiments, at least about 103 infectious units, more preferably at least about 105 infectious units, are introduced into the cell.

[0388] The cell(s) into which the viral vector is introduced may be of any type, including but not limited to muscle cells (e.g., skeletal muscle cells, cardiac muscle cells, smooth muscle cells and / or diaphragm muscle cells), stem cells, germ cells and the like. In representative embodiments, the cell may be any progenitor cell. As an additional possibility, the cell may be a stem cell (e.g., muscle stem cell).Furthermore, the cell can be of any species origin, as indicated above.

[0389] The viral vector can be introduced into cells in vitro for the purpose of administering the modified cell to an individual. In particular embodiments, cells have been removed from an individual, the viral vector is introduced therein, and the cells are then administered back to the individual. Methods of removing cells from the individual for ex vivo manipulation, followed by reintroduction into the individual, are known in the art (see, for example, U.S. Patent No. 5,399,346). Alternatively, the recombinant viral vector can be introduced into cells from a donor individual, into cultured cells, or into cells from any other suitable source, and the cells are administered to an individual in need (i.e., a “recipient” individual).

[0390] Suitable cells for ex vivo gene release are as described above. The dosages of cells to administer to an individual will vary depending on the age, condition, and species of the individual. Petition 870260051626, dated 05 / 29 / 2026, page 126 / 511 119 / 241 of the cell type, of the nucleic acid to be expressed by the cell, of the mode of administration and the like. Typically, at least about 102 to about 108 cells or at least about 103 to about 106 cells will be administered per dose in a pharmaceutically acceptable vehicle. In particular embodiments, cells transduced with the viral vector are administered to the individual in an effective or preventive treatment amount in combination with a pharmaceutical vehicle.

[0391] Another aspect of the invention is a method of administering the viral vector to individuals. The administration of the viral vectors and / or capsids according to the present invention to a human individual or to an animal in need thereof may be by any means known in the art. Optionally, the viral vector and / or capsid are administered in an effective or preventive dose effective to treatment in a pharmaceutically acceptable vehicle.

[0392] The dosages of viral vector and / or capsid to be administered to an individual depend on the mode of administration, the disease or condition to be treated and / or prevented, the individual's condition, the particular viral vector or capsid and nucleic acid to be released, and so forth, and can be determined in a routine manner. Exemplary doses to achieve therapeutic effects are titers of at least about 10⁵, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, 10¹⁵ transducer units, optionally about 10⁸-10¹³ transducer units.

[0393] In particular modalities, more than one administration (e.g., two, three, four or more administrations) may be used to achieve the desired level of gene expression during a period of varying intervals, e.g., daily, weekly, monthly, annually, etc.

[0394] In certain modalities, an AAV vector or particle of Petition 870260051626, dated 05 / 29 / 2026, p. 127 / 511 Description 120 / 241 can be administered to an individual in compositions comprising empty AAV capsids of the same or a different serotype. Empty capsids are AAV capsids comprising the typical arrangement and proportions of VP1, VP2, and VP3 capsid proteins, but do not contain a vector genome. Without wishing to be bound by any particular theory of operation, it is hypothesized that the presence of empty capsids may reduce the immune response against the AAV vector capsid, and thus increase transduction efficiency. Empty capsids may occur naturally in an AAV vector preparation, or be added in known quantities to achieve known ratios of empty capsids to AAV vector (i.e., capsids containing vector genomes). The preparation, purification, and quantification of empty capsids is within the knowledge of those of ordinary experience in the art.Compositions comprising AAV vectors of the description and empty capsids can be formulated with an excess of empty capsids relative to AAV vectors or an excess of vectors containing AAV genomes relative to empty capsids. Thus, in some embodiments, the compositions of the description comprise AAV vectors of the description and empty capsids of the same or a different serotype, wherein the ratio of empty capsids to AAV vectors is approximately 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8. 1,9, 2,0, 2,1, 2,2, 2,3, 2,4, 2,5, 2,6, 2,7, 2,8, 2,9, 3,0, 3,1, 3,2, 3,3,3,4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5,1, 5,2, 5,3, 5,4, 5,5, 5,6, 5,7, 5,8, 5,9, 6,0, 6,1, 6,2, 6,3, 6,4, 6,5,6,6, 6,7, 6,8, 6,9, 7,0, 7,1, 7,2, 7,3, 7,4, 7,5, 7,6, 7,7, 7,8, 7,9, 8,0, 8,1,8,2, 8,3, 8,4, 8,5, 8,6, 8,7, 8,8, 8,9, 9,0, 9,1, 9,2, 9,3, 9,4, 9,5, 9,6, 9,7,9,8, 9.9, 10 to 1, or some other ratio.

[0395] In other modalities, the description provides exemplary effective doses of AAV vector particles for the treatment of Petition 870260051626, dated 05 / 29 / 2026, page 128 / 511 121 / 241 dystrophinopathy, such as muscular dystrophy, such as DMD, quantified as vector genomes (vg) per kilogram of body weight (kg), abbreviated vg / kg. According to certain embodiments, an effective dose of an AAV vector of the description, including those comprising an AAV9 capsid and a genome including a codon-optimized human gene encoding a mini-dystrophin protein, such as, without limitation, the vector designated AAV9.hCK.Hopti-Dys3978.spA, is approximately 1 x 10¹²vg / kg, 2 x 10¹²vg / kg, 3 x 10¹²vg / kg, 4 x 10¹²vg / kg, 5 x 10¹²vg / kg, 6 x 10¹²vg / kg, 7 x 10¹²vg / kg, 8 x 10¹²vg / kg, 9 x 10¹²vg / kg, 1 x 10¹³vg / kg, 2 x 10¹³vg / kg, 3 x 10¹³vg / kg, 4 x 1013vg / kg, 5x1013vg / kg, 6x1013vg / kg, 7x1013vg / kg, 8x1013vg / kg, 9x1013vg / kg, 1 x 1014vg / kg, 1.5x1014vg / kg, 2 x 1014vg / kg, 2.5x1014vg / kg, 3 x 1014vg / kg, 3.5x1014vg / kg, 4 x 1014vg / kg, 5x1014vg / kg, 6x1014vg / kg, 7x1014vg / kg, 8x1014vg / kg, or 9x1014vg / kg, or some other dose.In any of these modalities, the AAV vector can be administered to an individual in a pharmaceutically acceptable composition alone, or with empty capsids of the same capsid serotype with an empty capsid to vector ratio of approximately 0.5:1, 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1 or some other ratio.

[0396] Exemplary modes of administration include oral, rectal, transmucosal, intranasal, inhalation (e.g., aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, in utero (or in ovo), parenteral (e.g., intravenous, subcutaneous, intradermal, intracranial, intramuscular (including administration to skeletal, diaphragmatic and / or cardiac muscle), intrapleural, intracerebral and intra-articular), topical (e.g., to cutaneous and mucous surfaces, including airway surfaces, and transdermal administration), intralymphatic and similar, as well as direct tissue or organ injection (e.g., Petition 870260051626, dated 05 / 29 / 2026, page 129 / 511 122 / 241 skeletal muscle, cardiac muscle or diaphragm muscle).

[0397] Administration may be to any site in an individual, including, without limitation, a site selected from the group consisting of skeletal muscle, smooth muscle, the heart and the diaphragm.

[0398] Administration to skeletal muscle according to the present invention includes, but is not limited to, administration to skeletal muscle in the limbs (e.g., upper arm, lower arm, upper leg and / or lower leg), back, neck, head (e.g., tongue), chest, abdomen, pelvis / perineum and / or fingers. The appropriate skeletal muscles include, but are not limited to, abductor digiti minimi (in the hand), abductor digiti minimi (in the foot), abductor hallucis, abductor ossis metatarsi quinti, abductor pollicis brevis, abductor pollicis longus, adductor brevis, adductor hallucis, adductor longus, adductor magnus, adductor pollicis, anconeus, scalene anterior, genu articularis, biceps brachii, biceps femoris, brachialis, brachioradialis, buccinator, coracobrachialis, corrugator supercilii, deltoid, depressor angulis oris, depressor labii inferioris, digastric, interosseous dorsalis (in the hand), interosseous dorsalis (in the foot), extensor carpi radialis brevis.extensor carpi radialis longus, extensor carpi ulnaris, extensor digiti minimi, extensor digitorum, extensor digitorum brevis, extensor digitorum longus, extensor hallucis brevis, extensor hallucis longus, extensor indicis, extensor pollicis brevis, extensor pollicis longus, flexor carpi radialis, flexor carpi ulnaris, flexor digiti minimi brevis (in the hand), flexor digiti minimi brevis (in the foot), flexor digitorium brevis, flexor digitorium longus, flexor digitorium profundus, flexor digitorium superficialis, flexor hallucis brevis, flexor hallucis longus, flexor pollicis bevis, flexor pollicis longus, frontal, gastrocnemius, geniohyoid, gluteus maximus, gluteus medius, gluteus minimus, gracilis, cervical iliocostal, lumbar iliocostal, thoracic iliocostal, iliac, inferior gluteus, inferior oblique, inferior rectus, infraspinous, interspinous, intertransverse, pterygoid, Petition 870260051626, dated 29 / 05 / 2026, p. 130 / 511 123 / 241 lateral, rectus lateralis, latissimus dorsi, levator anguli oris, levator labii superioris, levator labii superioris, alaeque nasi, levator palpebrae superioris, levator scapulae, long rotators, longissimus capitis, longissimus cervicis, longissimus thoracis, longus capitis, longus colli, lumbricals (in the hand), lumbricals (in the foot), masseter, medial pterygoid, medial rectus, middle scalene, multifidus, mylohyoid, obliquus capitis inferior, obliquus capitis superior, obturator externus, obturator internus, occipitalis, omohyoid, opponent digiti minimi, opponent pollicis, orbicularis oculi, orbicularis oris, palmar interossei, palmaris brevis, palmaris longus, pectineus, pectoralis major, pectoralis minor, peroneus brevis, peroneus longus, peroneus tertius, piriformis, plantar interossei, plantaris, platysma, popliteus, scalene posterior, pronador quadrado, pronador redondo, psoas major, quadrado femoris, quadrado plantar, rectus capitis anterior, rectus capitis lateralis,rectus capitis posterior major, rectus capitis posterior minor, rectus femoris, rhomboid major, rhomboid minor, risorius, sartorius, scalenus minimus, semimembranosus, semispinalis capitis, semispinalis cervicis, semispinatus thoracicus, semitendinosus, serratus anterior, rotators brevis, soleus, spinalis capitis, spinalis cervicis, spinalis thoracis, splenius capitis, splenius cervicis, sternocleidomastoid, sternohyoid, sternothyroid, stylohyoid, subclavius, subscapularis, superior gemellus, superior oblique, superior rectus, supinator, supraspinatus, temporalis, tensor fascia lata, teres major, teres minor, thoracicus, thyrohyoid, tibialis anterior, tibialis posterior, trapezius, triceps brachii, vastus intermedius, vasus lateralis vastus medialis, zygomaticus major and zygomaticus minor and any other suitable skeletal muscle as known in the art.,

[0399] The viral vector can be delivered to skeletal muscle by intravenous administration, intra-arterial administration, intraperitoneal administration, limb perfusion, (optionally, isolated perfusion) Petition 870260051626, dated 05 / 29 / 2026, page 131 / 511 124 / 241 of a limb (leg and / or arm; see, for example, Arruda et al. 2005) Blood 105: 3458-3464), and / or direct intramuscular injection. In particular embodiments, the viral vector and / or capsid is administered to a limb (arm and / or leg) of an individual (e.g., an individual with muscular dystrophy such as DMD) by limb perfusion, optionally isolated limb perfusion (e.g., intravenous or intra-articular administration). In embodiments of the invention, the viral vectors and / or capsids of the invention can advantageously be administered without employing hydrodynamic techniques. Tissue delivery (e.g., to muscle) of vectors of the prior art is often enhanced by hydrodynamic techniques (e.g., large-volume intravenous / intravenous administration), which increase pressure in the vasculature and facilitate the vector's ability to cross the endothelial cell barrier.In particular embodiments, the viral vectors and / or capsids of the invention can be administered in the absence of hydrodynamic techniques, such as high-volume infusions and / or elevated intravascular pressure (e.g., systolic pressure higher than normal, for example, less than or equal to 5%, 10%, 15%, 20%, 25% increase in intravascular pressure over normal systolic pressure). These methods can reduce or avoid side effects associated with hydrodynamic techniques, such as edema, nerve damage, and / or compartment syndrome.

[0400] Administration to the heart muscle includes administration to the left atrium, right atrium, left ventricle, right ventricle and / or septum. The viral vector and / or capsid may be administered to the heart muscle by intravenous administration, intra-arterial administration, such as intra-aortic administration, direct cardiac injection (e.g., into the left atrium, right atrium, left ventricle, right ventricle) and / or coronary artery perfusion. Petition 870260051626, dated 05 / 29 / 2026, page 132 / 511 125 / 241

[0401] Administration to the diaphragm muscle can be done by any suitable method, including intravenous administration, intra-arterial administration and / or intraperitoneal administration.

[0402] Administration to smooth muscle may be by any suitable method including intravenous administration, intra-arterial administration and / or intraperitoneal administration. In one embodiment, administration may be to endothelial cells present in, near, and / or within smooth muscle.

[0403] Release to a target tissue can also be achieved by distributing a depot comprising the viral vector and / or capsid. In representative embodiments, a depot comprising the viral vector and / or capsid is implanted into skeletal muscle, smooth muscle, cardiac muscle and / or diaphragm tissue, or the tissue can be placed in contact with a film or other matrix comprising the viral vector and / or capsid. Such implantable matrices or substrates are described in U.S. Patent No. 7,201,898.

[0404] In particular embodiments, a viral vector according to the present invention is administered to skeletal muscle, diaphragm muscle and / or cardiac muscle (for example, to treat and / or prevent muscular dystrophy).

[0405] In representative embodiments, the invention is used to treat and / or prevent disorders of skeletal, cardiac and / or diaphragmatic muscle.

[0406] In a representative embodiment, the invention provides a method of treating and / or preventing muscular dystrophy in an individual in need thereof, comprising the method: administering an effective amount of a viral vector of the invention as treatment or prevention to a mammal, wherein the viral vector comprises a heterologous nucleic acid encoding dystrophin, mini-dystrophin or microdystrophin. In particular embodiments, the viral vector may be Petition 870260051626, dated 05 / 29 / 2026, page 133 / 511 126 / 241 administered to skeletal muscle, diaphragm and / or heart, as described elsewhere herein.

[0407] Injectables may be prepared in conventional forms such as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, the viral vector and / or virus capsids of the invention may be administered in a local rather than systemically manner, for example, in a depot or sustained-release formulation. In addition, the viral vector and / or virus capsid may be administered adhered to a surgically implantable matrix (for example, as described in US patent publication 20040013645).

[0408] Having described the present invention, it will be explained in greater detail in the following examples, which are included here for illustrative purposes only and are not intended to be limiting to the invention. EXAMPLE 1 Synthesis of human mini-dystrophin genes optimized by codons

[0409] Previously, several miniature versions of the human dystrophin gene were generated by PCR cloning of human muscle dystrophin cDNA, generating mini-dystrophin genes that have large deletions in the central rod domain and near-complete deletion of the C-terminal region of the dystrophin coding sequence (Wang et al., Proc. Natl. Acad. Sci. USA 97: 13714 (2000); US Patents Nos. 7,001,761 and 7,510,867). These mini-dystrophin genes were tested to be highly functional in vivo in mdx DMD mouse models (Watchko et al., Human Gene Therapy 13: 1451 (2002)). One of these mini-dystrophin proteins, named Δ3990, was described in Pat. No. 7,510,867 in SEQ ID NO: 6. The protein sequence Petition 870260051626, dated 05 / 29 / 2026, page 134 / 511 127 / 241 of Δ3990 and the DNA that encodes it are provided here by SEQ ID NO: 27 and SEQ ID NO: 28, respectively.

[0410] A modification of the Δ3990 mini-dystrophin was also designed, codon-optimized, and tested for activity. This novel human mini-dystrophin, named Dys3978, is 1325 amino acids long and includes the following portions or subdomains of the wild-type full-length human muscle dystrophin (SEQ ID NO: 25): the N-terminus and actin-binding domain (ABD), H1 junction, R1 and R2 rods, H3 junction, R22, R23, and R24 rods, H4 junction, the cysteine-rich domain (CR domain), and part of the carboxy-terminal domain (CT domain). The amino acid sequence of this protein is provided by SEQ ID NO: 7 and is schematically illustrated in Figure 1. To reduce potential immunogenicity, the last four amino acids at the C-terminus of the 3990 protein were eliminated.In creating Δ3990, this sequence was formed by joining part of the amino-terminal end of the carboxy-terminal domain of dystrophin (ending at P3409) with the last three amino acids of dystrophin (3683-3685, or DTM). This four-amino-acid stretch has no known function and could function as a novel epitope, because the sequence does not occur in wild-type dystrophin. Furthermore, a valine at amino acid position 2 in Δ3990, not present in wild-type dystrophin but resulting from the creation of a consensus Kozak initiation sequence around the initiation codon of Δ3990, was changed to leucine normally present in dystrophin. Thus, there are 5 amino acid differences between Δ3990 and Dys3978. An amino acid sequence alignment between Δ3990 and Dys3978 is provided in Figures 55A-55C.

[0411] The gene encoding Dys3978 was constructed by combining subsequences of the wild-type dystrophin coding sequence corresponding to the protein subdomains described above. The gene Petition 870260051626, dated 05 / 29 / 2026, page 135 / 511 The resulting 128 / 241 is provided by SEQ ID NO: 26. To increase the expression of Dys3978, the gene sequence was codon-optimized using human codon algorithms. The resulting human codon-optimized gene, named Hopti-Dys3978, is provided as SEQ ID NO: 1. A canine codon-optimized gene encoding Dys3978, named Copti-Dys3978, was also generated, and its sequence is provided as SEQ ID NO: 3. An alignment comparing the DNA sequences of Hopti-Dys3978 and the non-codon-optimized gene encoding Δ3990 is provided in Figures 56A-56I.

[0412] Among other changes, codon optimization of the gene encoding Dys3978 increased the total GC content from about 46% in the non-codon-optimized gene to about 61% in the human codon-optimized gene (i.e., Hopti-Dys3978). The increased GC content may result in increased mRNA levels in mammalian cells. See, for example, Grzegorz, K, et al., PLoS Biol, 4 (6): e180 (2006); and Newman, ZR, et al., PNAS, E1362-71 (2016). Codon optimization also increased the codon adaptation index (CAI) and included the addition of a Kozak transcription initiation recognition site at the beginning of the coding sequence.

[0413] To examine whether human codon optimization could increase gene expression, the Hopti-Dys3978 gene was cloned into an AAV vector expression cassette containing the constitutively active CMV promoter and a small synthetic polyadenylation (polyA) signal sequence (SEQ ID NO: 6). After transfection into human HEK 293 cells, the vector plasmid containing HoptiDys3978 exhibited surprisingly higher protein expression than the non-optimized gene encoding Dys3978, as determined qualitatively using immunofluorescence staining and Western blot against dystrophin protein (Figure 2).

[0414] A gene that codes for a human mini-dystrophin Petition 870260051626, dated 05 / 29 / 2026, page 136 / 511 129 / 241, similar in structure to Dys3978, except that the H3 linkage is absent, was also generated and optimized by codons. This gene, named Hopti-Dys3837 (SEQ ID NO: 2), encodes a 1278-amino acid human mini-dystrophin protein called Dys3837 (SEQ ID NO: 8), which is also schematically illustrated in Figure 1.

[0415] For other experiments described herein, the Dys3978 genes optimized for human and canine codons were placed under the control of one of two different combinations of muscle-specific promoter and enhancer derived from the muscle creatine kinase gene identified below:

[0416] Synthetic hybrid muscle-specific promoter (hCK) (SEQ ID NO: 4); and

[0417] Synthetic hybrid muscle-specific promoter plus (hCKplus) (SEQ ID NO: 5);

[0418] For use in the experiments, the following vectors were constructed using standard molecular cloning techniques. The gene expression cassettes of the specified promoter, the mini-dystrophin gene, and the polyA sequence were arranged in an AAV vector plasmid structure containing AAV2 inverted terminal repeats (ITRs) flanking the expression cassette.

[0419] AAV-CMV-Hopti-Dys3978

[0420] AAV-hCK-Hopti-Dys3978 (SEQ ID NO:9)

[0421] AAV-hCK-Hopti-Dys3837 (SEQ ID NO:10)

[0422] AAV-hCKplus-Hopti-Dys3837 (SEQ ID NO: 11)

[0423] AAV-hCK-Copti-Dys3978 (SEQ ID NO:12) EXAMPLE 2 CMV-Hopti-Dys3978 in dystrophin / utrophin double knockout mice

[0424] The loss of dystrophin in patients with Duchenne muscular dystrophy (DMD) results in skeletal muscle degeneration and Petition 870260051626, dated 05 / 29 / 2026, page 137 / 511 130 / 241 devastating cardiomyopathies. mdx mice lacking only dystrophin have a much milder phenotype, whereas double knockout (dKO) mice lacking both dystrophin and its homologous utrophin exhibit severely similar dystrophic clinical signs observed in DMD patients. Intraperitoneal injection into neonatal homozygous dKO mice with 3 x 1011vg / mouse of AAV1-CMV^3990 (non-codon optimized) has previously been shown to partially restore growth, function, and extend lifespan by several months (50% survival rate at 22 weeks) (see Figure 6B from Wang et al., J. Orthop. Res, 27: 421 (2009)). Here, the therapeutic effects of systemic release of the human codon-optimized Hopti-Dys3978 gene were evaluated using AAV9 as the capsid.The results demonstrate that a single systemic administration (IP) of AAV9-CMV-Hopti-Dys3978 at approximately 2 x 1013vg / kg in 1-week-old neonatal dOKO mice led to widespread expression of the mini-dystrophin gene in skeletal muscles and throughout the cardiac muscle (Figure 3). AAV9-treated dKO mice exhibited near-normal growth curves and body weight (Figure 4) and significantly improved muscle function, as assessed by grip strength and treadmill running tests (Figure 5). Treated dKO mice also showed improvement in dystrophic pathology (Figures 6A-6B) and a large improvement in overall health. When compared with dKO mice treated with an AAV1 vector expressing the non-coding n3990, dKO mice treated with the Hopti-Dys3978 gene showed a much longer lifespan (50% survival: 22 weeks vs. 80 weeks) (Figure 7).Unexpectedly, the fertility of male and female dKO mice was restored (Table 1), suggesting overall improvement in function and possibly improvement in smooth muscle function as well. Petition 870260051626, dated 05 / 29 / 2026, p. 138 / 511 131 / 241 TABLE 1

[0425] Mini-dystrophin restores fertility in dKO mice

[0426] Pair #1: T-dKO male X T-dKO female 5 puppies

[0427] Pair #2: T-dKO male X T-dKO female 4 puppies

[0428] Pair #3: T-dKO male X T-dKO female 0 offspring

[0429] Pair #4: mdx male X T-dKO female 5 puppies

[0430] Pair #5: mdx male X T-dKO female 6 puppies

[0431] Untreated dKO mice are completely infertile. However, fertility was restored by AAV-CMV-HoptiDys3978 in male and female dKO-treated mice (TdKO).

[0432] The results described above demonstrate that systemic release of the codon-optimized Hopti-Dys3978 gene was more effective than the non-coding Δ3990 gene.

[0433] Importantly, significant improvement in cardiac function was also observed. The therapeutic effects on the heart were assessed at 4 months of age by hemodynamic analysis using the Millar Pressure Volume System. Untreated dKO mice survived for just over 4 months. The very small body size, kyphosis, and severe muscular and cardiac dysfunction made the dKO mice too ill to tolerate the hemodynamic analysis procedure. Therefore, dKO mice treated with AAV9 were compared with age-matched, untreated mdx mice, which exhibited much milder phenotypes due to an intact utrophin gene, known to compensate for the lack of dystrophin in this model.While echocardiography showed mdx mice with no apparent cardiac deficit at baseline when compared to wild-type C57 / B10 mice, they did show apparent deficits as measured by hemodynamics at the start of the study (Figure 8, bars). Petition 870260051626, dated 05 / 29 / 2026, page 139 / 511 132 / 241 open). The results show that dKO mice treated with AAV9 exhibited baseline cardiac hemodynamics similar to those of mdx mice, including end-systolic pressure, end-diastolic volume, maximum isovolumetric contraction rate (dp / dtmax), and maximum isovolumetric relaxation rate (dp / dtmin). However, after dobutamine challenge, dKO-treated mice exhibited baseline cardiac hemodynamics similar to those of mdx mice, including end-systolic pressure, end-diastolic volume, maximum isovolumetric contraction rate (dp / dtmax and dp / dtmin), while dKO mice treated with AAV9 performed significantly better than mdx mice in all parameters examined (Figure 8, solid bars). Furthermore, more than 50% of mdx mice died within the 30-minute dobutamine challenge window, consistent with our previous report (Wu et al., Proc. Natl. Acad. Sci. USA 105: 14814 (2008)).In striking contrast, due to cardiac expression of the mini-dystrophin transgene in AAV9-treated dKO mice, dobutamine-induced heart failure was largely avoided. Over 90% of AAV9-treated dKO mice survived the dobutamine stress test within the 30-minute window. Finally, the commonly observed PR interval deficit shown on the electrocardiogram (ECG) was also improved (Figures 9A-9B). The PR interval is the time from the onset of the P wave to the onset of the QRS complex. These results demonstrate the effectiveness of AAV9-CMV-Hopti-Dys3978 gene therapy for cardiomyopathy in a mouse model of severe DMD. EXAMPLE 3 hCK-Hopti-Dys3978 in mdx mice

[0434] To examine whether the synthetic muscle-specific hybrid promoter hCK was able to effectively target gene expression. Petition 870260051626, dated 05 / 29 / 2026, p. 140 / 511 133 / 241 Dys3978, it was compared with the same construct targeted by the strong non-specific CMV promoter. Immunofluorescence staining of mini-dystrophin expression in mdx mice after caudal vein injection of the respective vectors showed that the two promoters, i.e., hCK and CMV, distribute equivalent expression levels in muscle and heart (Figure 10). EXAMPLE 4 CMV-Hopti-Dys3978 in dogs with canine DMD modeling of Gold Retriever Muscular Dystrophy (GRMD)

[0435] Based on studies in mdx mice and double dystrophin / utrophin KO (dKO) mice, the same vector, AAV9-CMV-Hopti-Dys3978, was tested in the golden retriever muscular dystrophy (GRMD) dog, a large animal model of DMD. Specifically, the vector was administered to a 2.5-month-old GRMD dog, “Jelly”, and then followed for more than 8 years after injection.

[0436] Experimental procedures: The dog was injected with GRMD Jelly (female, 2.5 months old; 6.3 kg; serum CK: 20262 units / L before treatment) was injected with AAV9-CMV-HoptiDys3978 vector at a dose of 1 x 10¹³vg / kg via the right hind limb. Under general anesthesia, a rubber tourniquet was positioned at the proximal pelvic end (groin area) to cover most of the muscles of the right hind limb. The AAV9 vector was injected via the great saphenous vein using a Harvard pump regulated at an injection rate of 1 ml / sec. The vector volume was 20 ml / kg of body weight (130 ml total). The tourniquet was released 10 minutes after the start of the injection. The muscles of the injected limb became stiffer, as revealed by palpation. Magnetic resonance imaging of the hind limbs was collected approximately 1 hour after the injection. Petition 870260051626, dated 05 / 29 / 2026, page 141 / 511 134 / 241 injection and confirmed vector fluid in the injected limb (Figure 11). No immunosuppressants, such as steroids, were used at any time during the more than 8 years of observation. Muscle biopsy procedures were performed at 5 time points up to 4 years after vector injection. The final necropsy was performed at 8 years and 4 months, when “Jelly” was still ambulatory, but much less active than before.

[0437] Results: Immunofluorescence (IF) staining showed long-term mini-dystrophin expression in most muscle samples examined up to final necropsy. Interestingly, the initially injected limb (2 months after injection biopsy) had lower expression than the non-injected limb, suggesting procedure-related inflammation and partial CMV promoter inactivation (Figure 12). However, human mini-dystrophin expression persisted for 8 years in “Jelly,” despite initial inflammation in the injected limb. Muscle biopsies and immunofluorescence and Western blot staining of human mini-dystrophin at subsequent time points (7 months, 1 year, 2 years, and 4 years after vector injection) showed persistent gene expression (Figures 13-17). While the percentages of mini-dystrophin-positive myofibers varied among different muscles, certain muscles had more than 90% positive myofibers after necropsy (Figure 18).Co-staining of mini-dystrophin and revertant (anti-C-terminal antibody) myofibers showed the coexistence of both (Figure 19). Mini-dystrophin was also observed in approximately 20% of cardiomyocytes (Figure 18). Overall gene expression was largely stable. For example, positive myofibers in the sartorius muscle remained comparable across the 6 time points, from 2 and 7 months to 1.4 and 8 years (compare Figures 12, 13, 14, 17, and 18). Western blot confirmed the IF staining results (Figure 20). Petition 870260051626, dated 05 / 29 / 2026, page 142 / 511 135 / 241

[0438] Contractile force measurement showed partial improvement when compared to untreated dogs (Figure 21). Jelly remained ambulatory during the post-treatment observation period of more than 8 years and was euthanized due to cardiomyopathy in the last year. No tumors were found in any of the tissues after necropsy and examination by a pathologist. DNA sequencing showed that Jelly did not carry the disease-modifying Jagged 1 mutation found in two dogs with phenotypically moderate GRMD as recently reported (Vieira et al., Cell163: 1204 (2015)). EXAMPLE 5 hCK-Copti-Dys3978 in a dog with GRMD

[0439] In this study, the AAV9-hCK-Copti-Dys3978 vector (a modified creatine kinase promoter driving canine codon-optimized human mini-dystrophin 3978) was used in a dog with GRMD named “Dunkin.” The gene encodes the same human Dys3978 mini-dystrophin protein used in other studies, but was canine codon optimized. The DNA sequence is 94% identical to the human codon-optimized gene. Transfection experiments in human HEK 293 cells comparing CK-Copti-Dys3978 (canine codon optimized) and CK-Hopti-Dys3978 (human codon optimized) revealed essentially the same expression level. Multiple experiments comparing both constructs in mdx mice also showed essentially the same expression levels.

[0440] Experimental Procedure: The GRMD dog “Dunkin” (female, 2.5 m old, 6.5 kg) was intravenously injected with AAV9-hCK-Copti-Dys3978 vector at a dose of 4 x 1013vg / kg via the great saphenous vein. The dog was not sedated during the injection. There were no noticeable adverse reactions or behavioral changes. A muscle biopsy was performed 4 months after vector injection, and necropsy was performed. Petition 870260051626, dated 05 / 29 / 2026, page 143 / 511 136 / 241 performed 14 months after the injection.

[0441] Results: A very high and almost uniform level of dystrophin expression was observed by immunofluorescent staining with mini-dystrophin 3978 in skeletal muscle samples from 4 months post-injection biopsy (Figure 22) to 14 months post-injection (Figures 23-26 for necropsy).

[0442] Significantly high levels of mini-dystrophin in cardiac muscles were also observed by IF staining (Figure 27). The expression of the CK promoter appeared stronger and more uniform than that of the CMV promoter.

[0443] Western blot analysis confirmed the IF staining results. In skeletal muscles, minidystrophin levels were generally higher than the normal wild-type dystrophin level of the normal dog control (Figure 28). The Dys3978 level in the heart was approximately half the wild-type dystrophin level (Figure 29).

[0444] Expression of Dys3978 from the canine codon-optimized gene Copti-Dys3978 effectively restored the dystrophin-associated protein complex including gamma sarcoglycan (Figure 30).

[0445] Quantitative PCR of vector DNA copy numbers showed a consistent trend for mini-dystrophin protein expression levels (Figure 31).

[0446] No innate or cellular immune responses were found in all samples examined. This is very different from the results of AAV9-CMV-opH-dys3978, suggesting that the muscle-specific hCK promoter was not only strong but also safer than the CMV promoter.

[0447] The dystrophic pathology was largely improved, as shown by H&E staining for heart histology (Figure Petition 870260051626, dated 05 / 29 / 2026, page 144 / 511 137 / 241 32), diaphragm (Figure 33) and limb muscles (Figure 34). Staining with Trichrome Mason blue also showed a significant reduction in fibrosis in the limb muscle and diaphragm (Figure 35). EXAMPLE 6 Preparation of the AAV9.hCK.Hopti-Dys3978.spA vector for in vivo experiments.

[0448] The AAV9.hCK.Hopti-Dys3978.spA vector used in the Dmdmd1 rat studies described in Examples 7, 8 and 9 includes an AAV9 capsid and an expression cassette designed to express a miniaturized version of the human dystrophin protein including the N-terminal region, junction 1 (H1), rod 1 (R1), rod 2 (R2), junction 3 (H3), rod 22 (R22), rod 23 (R23), rod 24 (R24), junction 4 (H4), cysteine-rich domain (CR) and portion of the carboxy-terminal domain (CT) of the full-length human dystrophin protein Dp427m (SEQ ID NO: 25), which are minimally required domains for function. The protein sequence of the mini-dystrophin protein is provided as the amino acid sequence SEQ ID NO: 7, which is encoded by the human codon-optimized DNA sequence provided as the nucleic acid sequence SEQ ID NO: 1. The vector genome of the vector AAV9.hCK.Hopti-Dys3978.spA is provided as the nucleic acid sequence of SEQ ID NO: 18, or its reverse complement when the single-stranded genome is packaged in its negative polarity.

[0449] The vector genome comprises flanking 5' and 3' AAV2 inverted terminal repeats (ITRs) (having the DNA sequence SEQ ID NO: 14 or SEQ ID NO: 15, respectively), a synthetic hybrid enhancer and promoter derived from the creatine kinase (CK) gene to serve as a muscle-specific transcription regulator (hCK; possessing the DNA sequence SEQ ID NO: 16), a 3978-pair long human codon-optimized gene Petition 870260051626, dated 05 / 29 / 2026, page 145 / 511 138 / 241 bases encoding the human mini-dystrophin protein described above (i.e., Hopti-Dys3978 gene) and a small synthetic transcription termination sequence including a polyadenylation (polyA) signal (spA; possessing the DNA sequence SEQ ID NO: 17).

[0450] The vector was produced using the triple transfection technique and a non-adherent, serum-free cell line derived from HEK 293 cells. The plasmids used include a helper plasmid to express the adenovirus helper proteins required for efficient vector replication and packaging, a packaging plasmid expressing the AAV2 rep gene and AAV9 capsid proteins, and a third plasmid containing the expression cassette sequence described above.

[0451] Cells were cultured and expanded from a working cell bank sample and, once sufficient cell volume and density were achieved, the cells were transfected using a transfection reagent. After incubation to allow vector production from the transfected cells, the cells were lysed to release vector, the lysate was clarified and the vector purified using a nuclease treatment step to remove contaminating nucleic acids, followed by centrifugation in an iodixanol phase gradient, ion exchange chromatography, dialysis against formulation buffer, sterile filtration and then storage at 2-8 °C. EXAMPLE 7 Effects of a single dose of AAV9.hCK.Hopti-Dys3978.spA in a rat model of DMD.

[0452] This example describes the AAV9.hCK.Hopti Dys3978.spA test in a recently developed Dmdmd1 mouse model, which has certain advantages compared to classic mdx mouse and GRMD dog models. Larcher, T. et al., Characterization of dystrophy-deficient mice: a novel model for Duchenne Petition 870260051626, dated 05 / 29 / 2026, p. 146 / 511 139 / 241 muscular dystrophy. PLoS Um. 2014; 9(10):e110371. In particular, in the Dmdmd1 mouse model, skeletal and cardiac diseases are both present at an early stage and develop in a sequential manner similar to the disease progression observed in humans.

[0453] In these studies, 5-6 week old male Drndmdx mice were systemically administered via IV injection into tail veins with a single dose (1 x 1014 genome vectors per kilogram of body weight, or vg / kg) of Dys3978 vector suspended in PBS. As a control, wild-type (WT) mice of the same genetic background (Sprague Dawley) were also treated in this manner. All procedures were performed with concealment of mouse genotype or treatment cohort to avoid bias. Three Drndmdx mice and 4 WT mice were treated with vector, while 3 Drndmdx mice and 2 WT mice received PBS only as a negative control (sham treatment). Three months after injection, the animals were sacrificed and necropsied for tissue analysis by histology and immunocytochemistry for dystrophin protein expression.

[0454] For histopathological evaluation, tissue samples were fixed in 10% neutral buffered formalin, embedded in paraffin wax, and sectioned to 5 μm thickness before staining with hematoxylin eosin saffron (HES). For dystrophin immunostaining, additional samples (liver, heart, biceps femoris, pectoral muscles, and diaphragm) were frozen and sectioned to 8 μm thickness. Mouse monoclonal antibody NCL-DYSB to dystrophin (Novocastra Laboratories, Newcastle, Tyne, UK) was used for the detection of dystrophin and mini-dystrophin (1:50), as this antibody does not distinguish between full-length wild-type dystrophin and constructed mini-dystrophin. All necropsies and histological observations were performed blindly. Petition 870260051626, dated 05 / 29 / 2026, page 147 / 511 140 / 241

[0455] Histological examination revealed no lesions in the skeletal or cardiac muscle of PBS and WT vector-treated rats. In all Drndmdx rats, skeletal muscle fiber lesions exhibiting individual necrosis, clusters of small regenerative fibers, scattered giant hyaline fibers, anisocytosis, centronucleation, endomysial fibrosis, and sporadic adipose tissue were present and characteristic of DMD skeletal muscle. The incidence and intensity of these lesions were globally reduced in Drndmdx rats treated with the vector compared to those treated with PBS alone. In the heart, multifocal necrosis lesions, focal mononuclear cell infiltration, and mild extensive focal fibrosis were present in one of the Drndmdx rats (rat 49) treated with PBS, which is characteristic of DMD cardiac muscle.In all Drndmdx-treated rats, the cardiac muscle presentation was similar and showed focal infiltration of discrete mononuclear cells, as observed in the Drndmdx rat receiving PBS, but in contrast, no fibrotic foci were observed in the hearts of the Drndmdx-treated rats.

[0456] Using immunocytochemistry, WT mice showed subsarcolemmal dystrophin detected in skeletal, diaphragmatic, and cardiac muscle fibers, and the location of the detected dystrophin did not differ between vector-treated mice compared to PBS-treated mice. However, the detection of mini-dystrophin in vector-treated WT mice could not be confirmed using this assay because the anti-dystrophin antibody used failed to distinguish between wild-type dystrophin and mini-dystrophin protein. In contrast, one of the Drndmdx mice (mouse 49) exhibited rare skeletal muscle fibers (approximately 5% to 10%) with subsarcolemmal dystrophin detection, which is consistent with the previous description of the presence of dispersed reversed fibers in this model with a Petition 870260051626, dated 05 / 29 / 2026, page 148 / 511 141 / 241 frequency of approximately 5% (Larcher et al., PlosOne, 2014). However, dystrophin was not detected in the diaphragm or cardiac muscle fibers of this rat. In all Drndmdx rats treated with Dys3978, subsarcolemmal dystrophin was also detected in approximately 80% to 95% of skeletal muscle fibers, approximately 30% to 50% in diaphragmatic muscle fibers, and approximately 70% to 80% in cardiac muscle fibers, although no systematic counts were performed. In these rats, very rare skeletal muscle fibers (1 or 2 per muscle section) exhibited some interfibrillar cytoplasmic dystrophin. In both WT vector-treated and Drndmdx mice, there was no evidence of inflammatory cell infiltrates or increased necrosis that could indicate that a cellular immune response had been stimulated by vector transduction or minidystrophin production.

[0457] In summary, 3 months after systemic administration of 1 x 1014vg / kg of vector AAV9.hCK.opti-Dys3978.spA, no histological changes in muscle tissues were observed in vector-treated WT rats compared to PBS, suggesting that mini-dystrophin protein expression was well tolerated in healthy animals. Furthermore, vector treatment of rats with Drndmdx resulted in significant and widespread detection of mini-dystrophin in fibers of all muscles studied (biceps femoris, pectoralis, diaphragm, and heart) with a subsarcolemmal localization pattern similar to that of WT musculature. Vector mini-dystrophin Dys3978 expression was associated with reduced fibrosis and necrosis (Figures 36A-36D). EXAMPLE 8 Effects of increasing doses of AAV9.hCK.Hopti-Dys3978.spA in rats with DMDD determined at 3 months and 6 months after injection.

[0458] This example describes the results of treating rats. Petition 870260051626, dated 05 / 29 / 2026, page 149 / 511 142 / 241 with Dmdmdx, an animal model for Duchenne muscular dystrophy, with increasing doses of AAV9.hCK.Hopti-Dys3978.spA and measurement of effects 3 months and 6 months after administration.

[0459] Rats were dosed at 7-8 weeks of age by injection IV in the dorsal penile vein, which resulted in systemic administration of the test articles. Four different vector doses were tested in 1012 rats with DmdmdX: 1 x 1013vg / kg (5 rats at the 3-month time point and 6 rats at the 6-month time point), 3 x 1013vg / kg (6 rats at the 3-month time point and 5 rats at 6 months), 1 x 1014vg / kg (7 rats at 3 months and 6 rats at 6 months), and 3 x 1014vg / kg (5 rats at 3 months and 5 rats at the 6-month time point). In addition, DmdmdXe WT mice received only vehicle (PBS 1X, 215 mM NaCl, 1.25% human serum albumin, 5% (w / v) sorbitol) as a negative control (6 DmdmdXe mice at 3 months, 4 DmdmdXe mice at 6 months, 5 WT mice at 3 months, and 7 WT mice at 6 months). Five untreated (i.e., no vector and no vehicle) DmdmdXe mice were also included as other negative controls.Three and six months after injection, the rats from each test subdivision were euthanized and necropsied to collect tissue samples for further analysis. Before sacrifice, cardiac function and grip strength tests were performed on the test animals to assess the effect of vector treatment on DMD disease progression.

[0460] Note that vector doses can be represented in two different numerically equivalent ways in the text and figures. Thus, “1 x 10¹³” is equivalent to “1E¹³”, “3 x 10¹³” is equivalent to “3E¹³”, “1 x 10¹⁴” is equivalent to “1E¹⁴”, and “3 x 10¹⁴” is equivalent to “3E¹⁴.” Body weight

[0461] After treatment and before sacrifice, the rats in each treatment subdivision were weighed daily during the first Petition 870260051626, dated 05 / 29 / 2026, page 150 / 511 143 / 241 week and weekly thereafter until sacrifice. The average weight of all rats in each treatment subdivision is listed in Table 2 (pre-injection to 9 weeks post-injection) and Table 3 (weeks 10-25 post-injection) and is plotted as a function of time in Figure 37. In the graph, the error bars represent the standard error of the mean (SEM), which is also reported in the table. At all time points, the average weight of WT rats exceeded that of Dmdmd1 rats, including those treated with vector. Due to age differences and natural variability in body mass among Dmdmd1 rats, there was no consistent correlation between dose and body weight until 4 weeks post-injection, when the weights of all Dmdmdx-treated rats, except in the highest dose subdivision, were higher than untreated Dmdmd1 rats but lower than WT rats.Twelve weeks after injection, a dose effect was evident in all treatment subdivisions, with body weight proportional to the vector dose at all doses tested until the end of the study. Petition 870260051626, dated 05 / 29 / 2026, page 151 / 511 144 / 241 TABLE 2 MEaNj WElSHTS fcgj DC CH-1 D+2 Ch-3 D+8 D+5 CHi 0+7 W*2 À43 W+4 W+5 W+4 Vi+7 W+8 W+9 kVT+-BL>f«ln-12 unW 13, ihmi>-7} 2 31.9) 247.1 2511 242.1 246.7 276Λ 325 JO 361.8 336.8 4102 4268 HtÈ 4831 452.1 SEM 1Q? l(j,i 1Q1 1(1,1 1(11 9.3 IftÜ 1(19 1Q7 ?ae 11.7 Ί.? M6 14.6 iM 155 14.1 OMjtEA rn-10unMWt13,^n-dí 172402 203 221 / Z2W 235.4 244.3 2S6r3 3114 34U 356-7 374 / 4 389.1 4030 4100 ΪΘΜ 11.9 15.3 11.9 12.0 wüü 12.2.4 Ijá. 142 19(4 253 21,3 21,0 23,3 DM5+1E13\g4tg ln-11 LKifl W*13, íw, nM 173.1 2OÓ.4 205.5 2068 216 216,7 2215 325Λ 316.5 36S..6 3BE..1 4338 41Ϊ.5 439.1 5EM 103 2.9 7.5 7.9 7.2 7.4 7.0 017 9.5 J2.Í12 ?V 1.1010* 1 3E13rç0:? fn-11 L>.til W>13, n-Sl 1802 21QS 2063 206.1 217 / 224.1 237.2 245^ 297.7 329.5 357.904 348M 3.5. 11.9 ία* 10.3 1(V 11.3 lft5 IfO ia? 11.(1 134 13.5 153 1ft5 17.1 1ft(l 19.4 19).3 DMJ [n =13 untJ W*13, ihai n=ty 17«2 209J 204.3 21(15 211« 2211 225.3 232 / 5 244.5 w 329A 356A 371? 395.7 4138 3138^ SEM *404 7.9 7.5 7.7 7.5 7.4 7.0 7.5 9.9 9.4 iv 153 122 1^4 117 158 153 DMJ + 1E14vg / kgw / ortSA[ji=5 to 290.1 ​​234.9 243 2027 245 / 243,(1 252.7 251.9 300^ 331.7 352.7 370.3 3822 3923 4213 4203 5EM 1(J2 9.9 9.3 9.3 9.5 9.5 9.90 9.3 .10 143 ! 150 17.1 151 1*3 17.2 22? DMD+3E14^g4g fn-10 Lnbl W<-12,<hen n-51 U1J8 1*64 1912 197,1 2013 20M 2113 220 / 2217 272£ 3162 350,7 371t> 3913 414,? 429J *453 JEM I.1 7.5 6.O 9.9 9.3 *9 *7 0.7 a5 fi(2 iV 1A5 11.4 15* 150 144 14.7. Table Caption:- AVERAGE WEIGHT (g);- Buffer;- until;- next Petition 870260051626, of 29 / 05 / 2026, p. 152 / 511 145 / 241 TABLE 3 MEAN WEIGHTS tg) w+io W+11 W+1Z Wt-13 W+14 W+15 W+16 W+17 W+1B W+19 W+20 W+21 W-+22 W+23 W+24 W+25 WT + Buffer (η·12 until W+13, thenn*7) 490,7 505,2 509,1 516.8 514,0 527,3 545.0 553,S 562,2 572.0 577,2 581,9 586.9 597,3 613 J 596,4 SEM 1<0 124 1312 1^3 1S.8 w 19,2 1S,5 19,4 IfllS 21.6 2Ϊ9 24J 23.1 19.5 36,6 DMD 4 Buffer (η·10 until W+13. thenn-4) 423,0 435,2 42B.Z 430.3 430,2 440,6 452.7 461,0 464,0 463.5 464.9 463,0 465.S 467,1 467,4 444,9 SEM 22.8 21.8 17,4 21,6 30,5 32,3 37,7 39,4 39.2 42,7 43.6 465 466 462 46.6 34,9 DMD+ TEBvg / kg (n-11 until W+13, thenn-ÍJ 444,$ 452,5 453,5 4M,5 453,2 457,7 449,9 4313 484,8 491,7 490,1 496,3 491,6 501,3 513,3 447,2 SEM 14,6 17,5 154 17,7 17,4 17,2 18,7 17,4 18,3 21,2 23.7 24,2 27,0 27,7 35,8 3M DMD + 3Ê13vg / kg (η· 11 until W+13, then n*5j 458,2 4674 469,7 476,1 465,8 478,5 489.1 496,9 505,2 510.7 512,6 5174 519,7 526,6 525,7 507,0 SEM 2Üt2 19,4 20,7 211 23,9 31,4 34,2 34,2 35.3 39,4 3619 33.3 37,7 33,5 35.6 DMD 3- 1E14vg / kg [n· 13 until W+13, thenn-é) 459.3 472.7 478.0 483.2 482.1 492.5 504.5 513.6 525.0 532.7 530.6 541.9 545.9 554.9 430.2 464.5 469.1 470.3 N / AN / A 1V / AN / AN / AN / AN / AN / AN / AN / AN / AN / A SEM 475.3 483.9 502.1 515.9 519.1 532.8 547.1 552.4 558.0 558.1 565.9 566.4 577.0 577.6 564.9 SEM 143 ÜO 15.4 27.5 24.7 24.9 27.2 24.5 27.4 27.2 27.3 27.3 2«a 29.7 29.2 28.5. Table Legend: - AVERAGE WEIGHTS (g); - Buffer; - up to; - next Petition 870260051626, dated 05 / 29 / 2026, p. 153 / 511 146 / 241

[0462] Vector transduction quantification and expression of RNA and protein in mice with DMDD treated with the AAV9.hCK.Hopti-Dys3978.spA vector.

[0463] Materials and methods

[0464] Standard molecular biology techniques were used to quantify the number of transgene copies by quantitative PCR (qPCR), the relative expression levels of mini-dystrophin mRNA transcripts by reverse transcriptase qPCR (RT-qPCR), and the amount of mini-dystrophin protein expression qualitatively by Western blot analysis.

[0465] For qPCR, genomic DNA (gDNA) was purified from tissues using the Qiagen Gentra Puregene kit. Samples were then analyzed using a StepOne Plus™ real-time PCR system (Applied Biosystems®, Thermo Fisher Scientific) using 50 ng of gDNA in duplicate. All reactions were performed in duplex in a final volume of 20 pL containing standard DNA, Premix Ex taq (Ozyme), 0.3 pL of ROX reference dye (Ozyme), 0.2 pmol / L of each primer, and 0.1 pmol / L of Taqman® probe.

[0466] Vector copy numbers were determined using primers and a probe designed to amplify a region of the mini-dystrophin transgene:

[0467] Front: 5'-CCAACAAAGTGCCCTACTACATC-3' SEQ ID NO: 19

[0468] Reverse: 5'- GGTTGTGCTGGTCCAGGGCGT-3' SEQ ID NO: 20

[0469] Probe: 5'-FAM-CCGAGCTGTATCAGAGCCTGGCC-TAMRA3' SEQ ID NO: 21

[0470] Endogenous gDNA copy numbers were determined using primers and a probe designed to amplify the mouse HPRT1 gene:

[0471] Front: 5'- GCGAAAGTGGAAAAGCCAAGT -3' Petition 870260051626, dated 05 / 29 / 2026, p. 154 / 511 147 / 241 SEQ ID NO: 22

[0472] Reverse: 5'-GCCACATCAACAGGACTCTTGTAG-3' SEQ ID NO: 23

[0473] Probe: 5'-JOE-CAAAGCCTAAAAGACAGCGGCAAGTTGAATTAMRA-3' SEQ ID NO: 24

[0474] For each sample, the cycle limit (Ct) values ​​were compared with those obtained with different dilutions of linearized standard plasmids (containing the minidystrophin expression cassette or the mouse HPRT1 gene). The absence of qPCR inhibition in the presence of gDNA was verified by analyzing 50 ng of gDNA extracted from tissue samples of a control animal, mixed with different dilutions of conventional plasmid. Duplex qPCR (amplification of the 2 sequences in the same reaction) was used and the results were expressed in the vector genome per diploid genome (vg / dg). The sensitivity of the test was 0.003 vg / dg.

[0475] For RT-qPCR, total RNA was extracted from tissue samples with TRIzol® reagent (Thermo Fisher Scientific), and then treated with RNase-free DNase I from the TURBO DNA-free kit (Thermo Fisher Scientific). Total RNA (500 ng) was subjected to reverse transcription using random primers (Thermo Fisher Scientific) and M-MLV reverse transcriptase (Thermo Fisher Scientific) in a final volume of 25 pL. Duplex qPCR analysis was then performed with cDNA diluted to 1 / 15 using the same primers and mouse mini-dystrophin and HPRT1 specific probes for quantification of transgene copy numbers by qPCR. The absence of qPCR inhibition in the presence of cDNA was verified by analysis of cDNA obtained from tissue samples of a control animal contaminated with different dilutions of conventional plasmid. For each RNA sample, the Ct values ​​were compared with those obtained with different dilutions of standard plasmids (containing the Petition 870260051626, dated 05 / 29 / 2026, page 155 / 511 148 / 241 mini-dystrophin expression cassette or the mouse HPRT1 gene). Results were expressed as relative amounts (RQ):

[0476] RQ = 2-ΔΦ = 2-(Ct target - endogenous Ct control)

[0477] For each RNA sample, the absence of DNA contamination was also confirmed by analysis of “cDNA-like samples” obtained without the addition of reverse transcriptase to the reaction mixture.

[0478] For Western blot analysis of expressed protein levels, total proteins were extracted from tissue samples using RIPA buffer containing a protease inhibitor cocktail (Sigma-Aldrich). Protein extracts, 50 pg for biceps femoris, heart, and diaphragm, or 100 pg for liver, were loaded onto a Novex 3-8% Tris Acetate NuPAGE® gel and analyzed using the NuPAGE® large protein transfer kit (Thermo Fischer Scientific). A final DTT concentration of 200 mM was used to reduce proteins before loading. The membranes were then blocked in 5% skim milk, 1% NP40 (Sigma-Aldrich) in TBST (tris-buffered saline, 0.1% Tween 20) and hybridized with an antidystrophin antibody specific for exons 10 and 11 of the dystrophin protein (1:100, monoclonal antibody MANEX 1011C) and with an anti-IgG antibody conjugated with secondary HRP (1:2000, Dako).For protein load control, the same membrane was also hybridized with a rat anti-alpha-tubulin antibody (1:10000). Sigma) and with an anti-IgG antibody conjugated with secondary HRP (1:2000, Dako). Immune spots were visualized using the ECL Chemiluminescent analysis system (Thermo Fisher Scientific).

[0479] Number of copies of the human mini-dystrophin transgene at 3 and 6 months after injection

[0480] Test results for transgene copy numbers (as vector genomes per diploid genome (vg / dg)) in blood Petition 870260051626, dated 05 / 29 / 2026, p. 156 / 511 149 / 241 total, spleen, heart, biceps femoris, pectoral, diaphragm, and liver in rats treated with vector and vehicle, and in WT rats administered only with vehicle are described in the tables below. Data at 3 months post-injection are provided in Table 4 and at 6 months post-injection are provided in Table 5. The data are the average of the results of the individual test animals. TABLE 4 Months Post-Injection DMD + vehicle WT + vehicle DMD + 1x 1013 vg / kg DMD + 3x 1013 vg / kg DMD + 1x 1014 vg / kg DMD + 3x 1014 vg / kg Whole blood < 0.002 < 0.002 < 0.002 < 0.002 < 0.002 < 0.002 Spleen < 0.002 < 0.002 < 0.002 0.010 0.005 0.013 Heart (basal part) < 0.002 < 0.002 0.090 0.270 0.670 4.350 Biceps femoris < 0.002 < 0.002 < 0.002 0.070 0.260 1.700 Pectoral < 0.002 < 0.002 0.010 0.030 0.400 0.760 Diaphragm < 0.002 < 0.002 0.003 0.030 2.410 2.810 Liver (central lobe) < 0.002 < 0.002 0.830 5.460 30.780 112.880 TABLE 5 Months Post-Injection DMD + vehicle WT + vehicle DMD + 1x 1013 vg / kg DMD + 3x 1013 vg / kg DMD + 1x 1014 vg / kg DMD + 3x 1014 vg / kg Whole blood < 0.002 < 0.002 < 0.002 < 0.002 < 0.002 < 0.002 Spleen < 0.002 < 0.002 < 0.002 < 0.002 < 0.002 0.010 Heart (basal part) < 0.002 < 0.002 0.160 0.140 1.460 5.380 Biceps femoris < 0.002 < 0.002 0.009 0.020 0.390 1.400 Pectoral < 0.002 < 0.002 0.006 0.020 0.530 0.800 Diaphragm < 0.002 < 0.002 0.010 0.010 4.850 1.270 Liver (central lobe) < 0.002 < 0.002 1.080 8.130 30.490 82.230

[0481] No qPCR signal was detected in mice with Dmdmdxou WT injected with vehicle only, confirming that these animals did not receive any vector, and no qPCR signal was detected in whole blood at 3 and 6 months post-injection.

[0482] Mini-dystrophin DNA was detected in mice with Dmdmdx Petition 870260051626, dated 05 / 29 / 2026, p. 157 / 511 150 / 241 rats had been injected with the vector at both 3 and 6 months post-injection. The number of transgene copies in the tissues studied followed a prevalence pattern of liver > heart > biceps femoris > diaphragm > pectoral > spleen. Of the tissues analyzed, the liver was by far the most efficiently transduced, with vector copy numbers averaging 80-110 vg / dg in rats administered with 3 x 10¹⁴ vg / kg of vector. Vector copy numbers in the liver were 7-45 times higher than in the heart and 40-300 times higher than in the biceps femoris, diaphragm, or pectoral muscles. In the heart, vector copy numbers averaged about 1.0 vg / dg in rats with 1 x 10¹⁴ vg / kg of vector and about 5.0 vg / dg in rats treated with 3 x 10¹⁴ vg / kg of vector. At a dose of 1 x 1014vg / kg, the transgenic copy numbers in the biceps femoris and pectoralis major were similar and never exceeded the value of 0.5 vg / dg.When the vector dose increased to 3 x 10¹⁴ vg / kg, the average transgene copy number increased to approximately 1.2 vg / dg. The data were particularly variable for the diaphragm due to some unusually high results among 4 animals that received the two highest vector dose levels, in which the transgene copy number ranged from approximately 9-15 vg / dg. If these outlier data points are excluded, then the diaphragm transduction efficiency is relatively low at both the 3- and 6-month time points, with transgene copy numbers averaging 0.2-0.4 vg / dg at the 1 x 10¹⁴ vg / kg dose and approximately 1.05-1.3 vg / dg at the 3 x 10¹⁴ vg / kg dose.

[0483] Human mini-dystrophin mRNA expression at 3 and 1 months post-injection

[0484] Two to four animals per treatment subdivision were randomly selected for RT-qPCR analysis to quantify levels of human mini-dystrophin mRNA transcripts in Petition 870260051626, dated 05 / 29 / 2026, page 158 / 511 151 / 241 samples of biceps femoris, diaphragm, heart, spleen, and liver were obtained at sacrifice. The results obtained from test animals sacrificed at 3 months and 6 months after injection are provided in Table 6 and Table 7, respectively. Data are expressed as relative quantities (RQ) of mini-dystrophin mRNA relative to ratHPRTI gene mRNA.

[0485] No transcripts were detected in any animal tissue in the negative control subdivisions (WT rats and vehicle-treated Dmdmd1 rats), or in the spleen of vector-treated animals, regardless of dose. In all other tissues examined, vector-derived transcripts were detected, with levels tending to increase in a dose-responsive manner, although with some variability in the data. Transcription levels in tissues followed the pattern biceps femoris > heart ~ diaphragm > liver. As discussed above, the liver was the most transduced tissue among those sampled, with vector copy numbers ranging approximately 60-130 times higher than in the biceps femoris muscle. Despite this, the mini-dystrophin mRNA level in the liver was approximately 5-15 times lower than in the biceps femoris, evidence of the highly muscle-specific activity of the promoter used in the vectors. Petition 870260051626, dated 05 / 29 / 2026, page 159 / 511 152 / 241 TABLE 6 Months Post-Injection Mouse 1 RQ DMD + vehicle Mouse 2 RQ DMD + vehicle Mouse 3 RQ WT + vehicle Mouse 4 RQ WT + vehicle Mouse 5 RQ DMD + 1 x 1013 vg / kg Mouse 6 RQ DMD + 1 x 1013 vg / kg Mouse 7 RQ DMD + 3 x 1013 vg / kg Mouse 8 RQ DMD + 3 x 1013 vg / kg Mouse 9 RQ DMD + 1 x 1014 vg / kg Mouse 10 RQ DMD + 1 x 1014 vg / kg Mouse 11 RQ DMD + 1 x 1014 vg / kg Mouse 12 RQ DMD + 1 x 1014 vg / kg Mouse 13 RQ DMD + 3 x 1014 vg / kg Mouse 14 RQ DMD + 3 x 1014 vg / kg Spleen < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 Biceps femoris < 0.03 < 0.03 < 0.03 < 0.03 2.6 0.9 7.8 7.2 23.8 18.4 40.9 79.6 33.1 33.3 Heart (basal part) < 0.03 < 0.03 < 0.03 < 0.03 1.7 1.8 3.3 1.4 4.5 4.5 3.2 6.5 9.6 12.4 Diaphragm < 0.03 < 0.03 < 0.03 < 0.03 0.2 0.3 1.6 2.7 13.6 5.1 4.2 23.2 9.7 18.8 Liver (central lobe) < 0.03 < 0.03 < 0.03 < 0.03 0.1 0.2 0.7 0.8 2.2 4.7 3.8 0.8 7.4 3.3 TABLE 7 Months Post-Injection Mouse 15 RQ DMD + vehicle Mouse 16 RQ DMD + vehicle Mouse 17 RQ WT + vehicle Mouse 18 RQ WT + vehicle Mouse 19 RQ DMD + 1 x 1013 vg / kg Mouse 20 RQ DMD + 1 x 1013 vg / kg Mouse 21 RQ DMD + 3 x 1013 vg / kg Mouse 22 RQ DMD + 3 x 1013 vg / kg Rat 23 RQ DMD + 1 x 1014 vg / kg Rat 24 RQ DMD + 1 x 1014 vg / kg Rat 25 RQ DMD + 3 x 1014 vg / kg Rat 26 RQ DMD + 3 x 1014 vg / kg Spleen < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 < 0.03 Biceps femoris < 0.03 < 0.03 < 0.03 < 0.03 0.6 0.3 3.0 8.9 15.8 24.2 64.0 19.7 Heart (basal part) < 0.03 < 0.03 < 0.03 < 0.03 1.2 1.6 1.3 1.4 3.7 4.3 9.2 6.1 Diaphragm < 0.03 < 0.03 < 0.03 < 0.03 0.5 0.1 1.4 1.1 4.5 8.0 19.7 17.1 Liver (central lobe) < 0.03 < 0.03 < 0.03 < 0.03 0.1 0.1 0.2 0.5 0.7 0.6 4.6 2.1 Petition 870260051626, dated 05 / 29 / 2026, p. 160 / 511 153 / 241

[0486] Expression of human mini-dystrophin protein at 3 and 6 months post-injection

[0487] The same animals randomly selected for analysis to determine human mini-dystrophin mRNA levels were also analyzed to determine mini-dystrophin protein levels using Western blot. No mini-dystrophin protein was detected in any animal tissue in the negative control subdivisions (WT mice and Dmdmd' mice treated with vehicle). At both 3- and 6-month time points, mini-dystrophin protein was detected in the biceps femoris, heart, and diaphragm of vector-treated Dmdmd' mice. At the lowest dose tested (1 x 1013vg / kg), mini-dystrophin protein was detected less frequently in tissue samples compared to vector-treated mice at higher levels. These results are qualitatively summarized in Table 8. TABLE 8 Rat Time Dose Biceps femoris Heart (basal part) Diaphragm 5 3 me 1 x 10¹³ vg / kg + + + 6 3 me 1 x 10¹³ vg / kg - + - 7 3 me 3 x 10¹³ vg / kg + + + 8 3 me 3 x 10¹³ vg / kg + + + 9 3 me 1 x 10¹⁴ vg / kg + + + 10 3 me 1 x 10¹⁴ vg / kg + + + 11 3 me 1 x 10¹⁴ vg / kg + + + 12 3 me 1 x 10¹⁴ vg / kg + - + 13 3 me 3 x 10¹⁴ vg / kg + + + 14 3 me 3 x 10¹⁴ vg / kg + + + 19 6 me 1 x 10¹³ vg / kg + + - 20 6 me 1 x 1013 vg / kg - + - 21 6 me 3 x 1013 vg / kg + + + 22 6 me 3 x 1013 vg / kg + + - 23 6 me 1 x 1014 vg / kg + + + 24 6 me 1 x 1014 vg / kg + + + 25 6 me 3 x 1014 vg / kg + + + 26 6 m and 3 x 1014 vg / kg + + +

[0488] There was a positive correlation between the amount of protein detected by Western blot and the vector dose, as well as the amount of mini-dystrophin mRNA in the same samples. Petition 870260051626, dated 05 / 29 / 2026, p. 161 / 511 154 / 241 tissue. A mini-dystrophin mRNA RQ of approximately 1.5 was required to allow protein detection. Consistent with the low levels of mini-dystrophin transcripts measured in the liver, no mini-dystrophin protein was detected in this tissue, even with the highest vector dose used.

[0489] Histopathological evaluation

[0490] Immediately after the sacrifice of WT and Drndmdx rats, tissue samples were obtained for histopathological and immunocytochemical analysis.

[0491] Materials and methods

[0492] Vehicle-treated WT mice, vehicle-treated and vector-treated Drndmdx mice were obtained during complete necropsy evaluation at 3 and 6 months post-injection. Samples were also obtained from untreated Drndmdx mice sacrificed at 7-9 weeks of age to serve as a baseline comparison. Tissues were immediately fixed in formalin for histopathology or frozen for immunohistochemistry (immunolabeling) and stored until processing. For histopathology, tissue samples were fixed in 10% neutral buffered formalin, embedded in paraffin wax, and sectioned (5 µm) before staining with hematoxylin eosin saffron (HES) stain. An additional section of paraffin-embedded cardiac tissue was stained to visualize collagen with picrosirius red F3B (Sigma-Aldrich Chimie SARL, Lyon, FR). To identify dystrophin and connective tissue by immunostaining, samples were frozen and sectioned (8 μm).A mouse monoclonal antibody, NCL-DYSB (1:50, Novocastra Laboratories, Newcastle on Tyne, UK), which specifically binds to mouse dystrophin as well as human mini-dystrophin opti-Dys3978, was used in immunolabeling studies to visualize the protein. Petition 870260051626, dated 05 / 29 / 2026, p. 162 / 511 155 / 241 dystrophin. The Alexa Fluor 555 conjugate of wheat agglutinin germ (WGA) (1:500, Molecular Probes, Eugene, OR) was used to visualize connective tissue. Nuclei were stained with DRAQ5 (1:1000, BioStatus Ltd, Shepshed, UK). Necropsies and histological examination were performed blindly.

[0493] Quantification of picrosirius-positive areas in cardiac sections was performed using Nikon Imaging software (Nikon, Champigny sur Marne, France). Quantification of DYSB-positive fibers and WGA-positive areas was performed using the open-source image processing software ImageJ (v 2.0.0-rc-49 / 1.51a). Results

[0494] Histopathological analysis of DMD lesions in muscle at 3 and 6 months post-injection

[0495] Histologically stained tissue samples were examined microscopically, and lesions related to the DMD phenotype were systematically recorded. Lesions in skeletal and cardiac muscle were semi-quantitatively classified as illustrated in Figure 38A. In skeletal muscle (biceps femoris, pectoralis major, and diaphragm), a score of 0 corresponded to the absence of significant lesions; a score of 1 corresponded to the presence of some regenerative activity, evidenced by centronucleated fibers and foci of regeneration; a score of 2 corresponded to degenerative fibers, isolated or in small clusters; and a score of 3 corresponded to tissue remodeling and replacement of fibers by fibrotic or adipose tissue. In the heart, the score was based on the intensity of fibrosis (score 1 for least and 2 for greatest) and the presence of degenerative fibers (score 3).A total injury score for each rat was calculated as the average of the animals' scores for the muscles. Petition 870260051626, dated 05 / 29 / 2026, page 163 / 511 156 / 241 biceps femoris, pectoralis major, diaphragm, and cardiac muscles. Injury scores for individual rats within each treatment subdivision were also calculated.

[0496] Total lesion scores for individual rats and pooled averages by treatment subdivision 3 months after injection are shown in Figure 38B, where WT sham refers to vehicle-treated WT rats, for which lesion scores were 0. KO sham refers to vehicle-treated Dmdmd1 rats, while KO 1E13, 3E13, and 1E14 refer to Dmdmd1 rats treated with the indicated doses (i.e., 1x1013, 3x1013, and 1x1014, respectively) of vector in vg / kg. As can be seen, the prevalence of muscle lesions associated with the dystrophic phenotype in Dmdmd1 rats was reduced by vector treatment in a dose-responsive manner.

[0497] Statistical analysis of injury scores (by multiple pairwise comparisons using Dunn's test) revealed the following differences between treatment subdivisions. In biceps femoris muscle samples at 3 months post-injection, there were no significant differences in injury scores between vehicle-treated WT rats and vector-treated Dmdmdx rats at the two highest doses (1x1014 and 3x1014vg / kg), and at 6 months post-injection, there were no significant differences between vehicle-treated WT and vector-treated Dmdmdx rats at any of the four doses tested.In pectoral muscle and diaphragm samples at 3 months post-injection, there were no significant differences in injury scores between vehicle-treated WT rats and DmdmdX rats treated with the three highest vector doses tested (3x1013, 1x1014, and 3x1014vg / kg), and 6 months post-injection, there were no significant differences in scores between vehicle-treated WT rats and DmdmdX rats treated with all four vector doses. Petition 870260051626, dated 05 / 29 / 2026, page 164 / 511 157 / 241 Finally, in cardiac muscle, at both time points, there were no significant differences in injury scores between vehicle-treated WT rats and Drndmdx rats treated with all four vector doses.

[0498] Histomorphometry at 3 and 6 months after injection

[0499] After marking the tissue samples with the antibody Using DYSB, which specifically binds to mouse dystrophin and human mini-dystrophin expressed from the vector, the percentage of positively stained muscle fibers in three randomly selected microscopic fields from each mouse biceps femoris, diaphragm, and cardiac muscles was calculated. Additionally, the area in three randomly selected microscopic fields that stained positively with the WGA conjugate was calculated to determine the extent of connective tissue fibrosis in frozen tissue samples from the biceps femoris and diaphragm. In a related analysis, the amount of connective tissue (collagen) in cross-sections of the heart was determined by quantifying the area stained positively with picrosirius red in histological preparations. The results of these studies are presented in Figures 39A-39C, Figures 40A-40C, and Figures 41A-41C.

[0500] Figure 39A shows representative photomicrographs of stained tissue sections from biceps femoris muscle samples of vehicle-treated WT rats (WT + buffer), vehicle-treated Drndmdx rats (DMD + buffer), and vector-treated Drndmdx rats at increasing doses of 1x10¹³, 3x10¹³, 1x10¹⁴, and 3x10¹⁴vg / kg (DMD + 1E13, 3E13, 1E14, and 3E14, respectively). The top panel of photos is of samples harvested 3 months after injection, and the bottom panel is of samples harvested 6 months after injection. Figure 39B is a graph showing the percentage of dystrophin-positive fibers in biceps femoris muscle samples from WT rats and Drndmdx rats. Petition 870260051626, dated 05 / 29 / 2026, page 165 / 511 158 / 241 Dmdmdx rats, each treated with vehicle, and Dmdmdx rats treated with increasing doses of vector, at the 3- and 6-month time points. Also included are the results from untreated Dmdmdx rats at 7-9 weeks of age (“DMD pathol status”). Figure 39C is a graph showing the percentage area occupied by connective tissue (as a measure of fibrosis) in biceps femoris muscle samples from similarly treated WT and Dmdmdx rats at 3 and 6 months, and untreated Dmdmdx rats at 7-9 weeks of age. In the graphs, the same letter above the error bars indicates that there is no statistically significant difference between the data, while no common letter indicates that there is a significant difference (e.g., two bars with an “a” above them would not be significantly different from each other).

[0501] Figure 40A shows representative photomicrographs of stained tissue sections from diaphragm samples of WT rats treated with vehicle (WT + buffer), Dmdmdx rats treated with vehicle (DMD + buffer), and Dmdmdx rats treated with vector at increasing doses of 1x10¹³, 3x10¹³, 1x10¹⁴, and 3x10¹⁴vg / kg (DMD + 1E13, 3E13, 1E14, and 3E14, respectively), all taken at 3 months post-injection. Figure 40B is a graph showing the percentage of dystrophin-positive fibers in diaphragm samples from WT rats and Dmdmdx rats, each treated with vehicle, and Dmdmdx rats treated with increasing doses of vector, at time points of 3 and 6 months. Also included are results from untreated DMDx rats aged 7-9 weeks (“DMD pathol status”).Figure 40C is a graph showing the percentage of area occupied by connective tissue (as a measure of fibrosis) in diaphragm samples from WT rats and Dmdmdx rats treated similarly at 3 and 6 months, and untreated Dmdmdx rats at 7-9 weeks of age. The same lettering as above is used in the graphs. Petition 870260051626, dated 05 / 29 / 2026, p. 166 / 511 159 / 241 of the error bars indicates that there is no statistically significant difference between the data, while no common letter indicates that there is a significant difference (for example, two bars with an “a” above them would not be significantly different from each other).

[0502] Figure 41A shows representative photomicrographs of stained tissue sections of cardiac muscle samples from vehicle-treated WT rats (WT + buffer), vehicle-treated Dmdmdx rats (DMD + buffer), and vector-treated Dmdmdx rats at increasing doses of 1x10¹³, 3x10¹³, 1x10¹⁴, and 3x10¹⁴vg / kg (DMD + 1E13, 3E13, 1E14, and 3E14, respectively). The upper and lower panels show histologically prepared and picrosirius red stained cross-sections of apex thirds of hearts taken from test animals sacrificed 3 and 6 months post-injection, respectively. Black bars indicate 2 mm length. The middle panel shows immunostaining with antidystrophin antibody and WGA conjugate in cardiac muscle samples taken at 3 months.Figure 41B is a graph showing the percentage of dystrophin-positive fibers in cardiac muscle samples from WT rats and DmdmdX rats, each treated with vehicle, and DmdmdX rats treated with increasing doses of vector, at 3- and 6-month time intervals. Results from untreated DmdmdX rats aged 7-9 weeks (“DMD pathol status”) are also included. Figure 41C is a graph showing the percentage area occupied by connective tissue (as a measure of fibrosis) in cardiac muscle samples from similarly treated WT and DmdmdX rats at 3 and 6 months, and untreated DmdmdX rats aged 7-9 weeks. In the graphs, the same letter above the error bars indicates no statistically significant difference between the data, while no common letter indicates a significant difference (e.g., two bars with an “a” above them do not). Petition 870260051626, dated 05 / 29 / 2026, p. 167 / 511 160 / 241 would be significantly different from each other).

[0503] Statistical analysis (ANOVA and two-tailed Fisher post-hoc test) of the data demonstrated that at 3 and 6 months post-injection, there was a significant difference in dystrophin staining in the biceps femoris and heart between vehicle-treated Drndmdx rats and DrndmdX rats treated at all vector doses. In the diaphragm, the differences at 3 months post-injection were significant at the two highest doses tested, while at 6 months post-injection, the differences were significant at the three highest doses tested. Comparison between vehicle-treated WT rats and Dmdmdx rats treated with 3 x 1014vg / kg revealed no significant difference in the biceps femoris muscle at 3 months post-injection or in the heart muscle at 6 months post-injection.

[0504] In vehicle-treated WT rat muscles, all muscle fibers exhibited intense homogeneous subsarcolemmal staining with the DYSB antibody. In vehicle-treated DmdmdX rat muscles, a small percentage of scattered reversed fibers showed similar staining (at 3 and 6 months post-injection, respectively: biceps femoris, 3.7 ± 2.4% and 7.3 ± 2.3%; diaphragm, 0.7 ± 1.5% and 5.8 ± 1.3%; cardiac, 0.0 ± 0.0% and 0.1 ± 0.1%). In the vector administered from DmdmdX rats, the percentage of dystrophin-positive fiber staining was increased in all muscles observed, with fibers exhibiting weak to intense subsarcolemmal staining. Labeling of two-thirds of the fiber was required to be considered positive. At both the 3- and 6-month time points, the percentage of dystrophin-positive fibers was similar between the biceps femoris and cardiac muscle, and higher than in the diaphragm.In rats with DMDmdX treated with vector, the number and size of fibrotic foci measured by the area occupied by connective tissue were reduced in skeletal muscle, and the intensity of... Petition 870260051626, dated 05 / 29 / 2026, page 168 / 511 161 / 241 Fibrosis decreased in the heart muscle.

[0505] In untreated Dmdmdx rats sacrificed at 7-9 weeks of age, no fibrosis was evident in the biceps femoris or cardiac muscle, but there was already significant expansion of connective tissue in the diaphragm. Compared to WT rats, Dmdmdx vehicle-treated rats exhibited focal or generalized thickening of the endomysial and perimysial space in skeletal muscle, which is indicative of fibrosis. In the heart, these rats exhibited scattered and extensive fibrotic foci in the ventricular subepicardial and septal regions. In severe cases, transmural fibrosis altering the shape of the heart was observed. Compared to vehicle-treated rats with Drndmdx, there was a significant reduction in the number and size of fibrotic foci at 3 months post-injection in the biceps femoris of rats treated with Dmdmdx with 3 x 1013vg / kg of vector and higher doses, and at 6 months post-injection in the diaphragm of rats treated with Dmdmdx with 3 x 1014vg / kg of vector.In the heart, significant differences in fibrosis were found between vehicle-treated Dmdmdx rats and Dmdmdx-treated rats at all vector doses at both time points. At 3 months post-injection, no significant difference in fibrosis was observed between vehicle-treated WT rats and vector-treated Dmdmdx rats at a dose of 3 x 1013vg / kg and higher. The amount of fibrosis observed and the vector dose were negatively correlated (p = 0.019 for the biceps femoris; p = 0.004 for the diaphragm; ep = 0.003 for the cardiac muscle, all by linear regression).

[0506] In rats with Dmdmdx, treatment with vector-induced minidystrophin expression in all muscles analyzed (biceps femoris, diaphragm, and heart) and the percentage of fibers expressing minidystrophin correlated positively with the vector dose (p < 0.001 by linear regression). The number of fibers Petition 870260051626, dated 05 / 29 / 2026, page 169 / 511 162 / 241 positive mini-dystrophin levels in rats with Dmdmdx treated with vector were higher in the biceps femoris and heart than in the diaphragm, suggesting some heterogeneity in biodistribution or expression efficacy. Mini-dystrophin expression was similar in terms of subsarcolemmal localization, independent of dose, and no abnormal localization was detected even at the highest dose analyzed, 3 x 1014vg / kg. In some fibers, discontinuous dystrophin staining was detected along the sarcolemma, although the frequency of this observation decreased with increasing vector dose.

[0507] Comparison of the number of minidystrophin-positive muscle fibers between 3 and 6 months after injection revealed no significant differences between treatment subdivisions for the biceps femoris. In the diaphragm, there was a significant increase between 3 and 6 months post-injection at the dose of 1 x 1014vg / kg, while in the cardiac muscle there was a significant increase between the two time points at doses of 1 x 1013, 3 x 1013 and 1 x 1014vg / kg.

[0508] The incidence and degree of certain classic muscle lesions associated with DMD varied between treatment groups. For example, there were fewer Dmdmdx rats treated with necrotic or degenerative fibers compared to those that received only vehicle, and newly regenerated fibers were observed in all DmdmdX rats, but their number tended to decrease with increasing dose.

[0509] Measures of grip strength and muscle fatigue

[0510] The grip strength of the forelimb of rats with Dmdmdx injected with vehicle or increasing doses of vector was tested 3 and 6 months after injection. Vehicle-injected WT rats were included as negative controls. Rats were injected when they were 7-9 weeks old, so the grip strength test was performed when they were approximately 4.5 and 7.5 months old. The strength Petition 870260051626, dated 05 / 29 / 2026, page 170 / 511 Maximum grip strength (163 / 241) and grip strength after repeated tests as an indication of fatigue were measured.

[0511] Materials and methods

[0512] A grip strength gauge (Bio-GT3, BIOSEB, France) coupled to a force transducer was used to measure the peak force generated when rats were placed with their forepaws on the T-bar and gently pulled back until they released the cable. Five tests were performed sequentially with a short latency (20-40 seconds) between each test, and the reduction in force between the first and last determination was taken as an index of fatigue. Results are expressed in grams (g) and are normalized to body weight (g / g body weight). Grip strength test measurements were performed by an experimenter blinded to genotype and treatment subdivision. Data are presented as mean ± SEM, and statistically evaluated using the non-parametric Kruskal-Wallis test for analysis of differences between groups. When significant overall effects were detected, differences between groups were assessed using Dunn's post-hoc test.The evolution of grip strength was analyzed using the Friedman test, followed by Dunn's post-hoc test. All data analyses were performed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, CA). Numerically, significant differences at the 95%, 99%, and 99.9% confidence levels are represented by one, two, and three symbols, respectively. Results

[0513] The results of grip strength tests for rats sacrificed 3 months after injection are provided in Table 9 and Table 10. As shown in Table 9, vehicle-treated Dmdmdx rats exhibited a reduction in absolute grip strength (i.e., not corrected for differences in body mass) compared Petition 870260051626, dated 05 / 29 / 2026, page 171 / 511 164 / 241 with vehicle-treated WT rats (decrease of 24 ± 2%). Conversely, rats with Drndmdx treated with vector exhibited a dose-dependent increase in absolute grip strength compared to vehicle-treated Drndmdx control rats. At the two lowest doses, 1 x 1013 and 3 x 1013vg / kg, grip strength increased by 13 ± 7% and 24 ± 8%, respectively, but did not reach statistical significance, while at the two highest doses, 1 x 1014 and 3 x 1014vg / kg, grip strength increased by 40 ± 9% and 55 ± 6%, respectively, which reached statistical significance (p < 0.01 and p < 0.001, respectively). Also, as shown in Table 9, when grip strength was corrected for differences in body mass, there was no statistically significant difference between the grip strength of the WT rats and those with Drndmdx when both were treated with vehicle.However, there was an increased dose response in grip strength in animals treated with Drndmdxem compared to vehicle-treated rats, which reached statistical significance at the two highest doses tested, 1 x 1014 and 3 x 1014vg / kg (27 ± 8% increase, p < 0.05 and 39 ± 6% increase, p < 0.001, respectively).

[0514] Forelimb grip strength was also measured during five repeated and spaced trials to determine the extent to which vector treatment could affect known muscle fatigue in the rat model with Drndmdx. As shown in Figure 42A, vehicle-treated Drndmdx rats exhibited a marked decrease in forelimb strength between the first and fifth trials (63 ± 5% reduction), while vehicle-treated WT rats were equally strong after the fifth and first trials, an effect seen before in this model (Larcher, et al., 2014).

[0515] Conversely, a dose-dependent improvement was observed in rats with Drndmdx treated with vector, compared with Petition 870260051626, dated 05 / 29 / 2026, page 172 / 511 165 / 241 similar rats treated with vehicle only. As indicated in Table 10, at the two lowest doses tested (1 x 10¹³ and 3 x 10¹³vg / kg) there was a delay before a decrease in grip strength manifested, suggesting a reduction in fatigue, at least at the beginning of the trials. However, at the lowest doses, in the fifth test, there was still no statistically significant difference between the grip strength of rats with Dmdmdx treated with the vector and rats with Dmdmdx treated with vehicle only. However, a strong tendency towards a decrease in grip strength was apparent even at these lower doses. At the two highest doses, 1 x 10¹⁴ and 3 x 10¹⁴vg / kg, rats with Dmdmdx showed no statistically significant difference in the extent of fatigue compared to WT rats treated with vehicle. In other words, after five tests, these Dmdmdx-treated rats were indistinguishable from the wild type.In fact, in all trials, the mean grip strength of rats with Dmdmdx treated with the highest vector dose was greater than that of WT controls, although the difference was not statistically significant.

[0516] The results of grip strength tests for rats sacrificed 6 months after injection are provided in Table 11 and Table 12. As shown in Table 11, vehicle-treated Dmdmdx rats exhibited a reduction in grip strength (i.e., not corrected for differences in body mass) compared to vehicle-treated WT rats (38 ± 3% decrease in absolute grip strength). This difference was statistically significant when measured in absolute terms, but not when measured in relative terms. Conversely, vector-treated Dmdmdx rats exhibited a dose-dependent increase in absolute grip strength compared to vehicle-treated Dmdmdx control rats. At the two lowest doses, 1 x 10¹³ and 3 x 10¹³vg / kg, the Petition 870260051626, dated 05 / 29 / 2026, page 173 / 511 166 / 241 grip strength increased by 20 ± 5% and 21 ± 6%, respectively, but did not reach statistical significance, while at the two higher doses, 1 x 1014 and 3 x 1014vg / kg, grip strength increased by 39 ± 9% and 41 ± 5%, respectively, which reached statistical significance (p < 0.05 and p < 0.01, respectively).

[0517] Similar to Dmdmdx rats sacrificed 3 months after injection, vehicle-treated Dmdmdx rats sacrificed 6 months after injection also exhibited a substantial decrease in forelimb strength between the first and fifth trials (57 ± 3% reduction) (Figure 42B), although this difference was not statistically significant compared to the slight reduction in grip strength over five trials observed with vehicle-treated WT rats, probably due to the small sample size involved in these studies.

[0518] In contrast, a dose-dependent improvement was observed in vector-treated Dmdmdx rats compared to similar rats treated with vehicle alone. As indicated in Table 12, while the two lowest doses (1 x 1013 and 3 x 1013vg / kg) had no significant impact on the decline in grip strength during multiple trials, at the two highest doses (1 x 1014 and 3 x 1014vg / kg), Dmdmdx rats showed no statistically significant difference in the extent of fatigue compared to vehicle-treated WT rats. Furthermore, at the highest dose, the grip strength of vector-treated Dmdmdx rats was statistically significantly greater than vehicle-treated Dmdmdx rats in each trial. In other words, after five trials, these vector-treated Dmdmdx rats were indistinguishable from the wild type.In fact, in all trials, the average grip strength of rats treated with the highest dose of vector was greater than that of WT controls, although the difference was not significant. Petition 870260051626, dated 05 / 29 / 2026, page 174 / 511 167 / 241 statistically significant.

[0519] Based on these studies, it is evident that at 3 and 6 months post-injection, a vector dose of 1 x 1014vg / kg was sufficient to reverse the reduction in grip strength exhibited by rats with Drndmdxe to muscle fatigue caused by multiple closely spaced grip strength tests. Furthermore, a vector dose of 3 x 1014vg / kg actually improved grip strength and fatigue resistance in rats with Drndmdxa to a level that exceeded WT rats of the same genetic background. Petition 870260051626, dated 05 / 29 / 2026, page 175 / 511 168 / 241 TABLE 9 Grip Strength at 4.5 Months of Age (3 Months Post-Injection) Genotype WT DMD™* DMD'™*' DMD™* DMD™* DMD™* Treatment dose {vg / kg) - - AAV8optidys3978 1E+13 AAV9optidys3979 3E+13 AAV9optidys3978 1E+14 AAV9optidys3979 3E+14 Body weight (g) 510.0 ± 12 2 438.1 ± 22.0* 462 7 ± 16.2 469.1 ± 21.0 477.2 ±11.3 482.9 ± 15.8 Maximum forelimb grip force gg / gBW 1743.1 ± 3.43 ± 77.2 0.15 1318.8 3.06 ± ± 41.8* 0.14 1493.6 ± 87.3 3.25 ± 0.19 1640.1 3.50 ± ± 102.7 0.19 1848.5 ± 124.8““ 3.87 ± 0.24“ 2044.2 ± 83.13□ 4.24 ± 0.13*^ n 12 10 11 11 11 10 Table Legend: - Genotype; Treatment; - Dose; - Body weight; - Maximum hind paw grip strength Animal body weight (g); maximum absolute hind paw grip strength (g); and relative hind paw grip strength (g / g of body weight) Values ​​are mean ± SEM n: number of animals tested *: p< 0.05 vs WT n: p< 0.05, nn: p< 0.01 vs Dmdmdx treated with vehicle Petition 870260051626, dated 05 / 29 / 2026, p. 176 / 511 169 / 241 TABELA 10 Fadiga da Força de Preensão aos 4,5 Meses de Idade (3 Meses Pós-lnjeção) Genotype WT DMD^ DMDratf' DMD™ DMD111 DMDmd* Treatment - - AAV9-optidys3978 AAV9-optidys3978 AAV9optidys 3978 AAV9optidys397B Dose (vg / kg) - - 1E+13 3E+13 1E + 14 3E+14 Relative forelimb grip force {g / g BW) Trial 1 2.98 ± 0.23 2.97 + 0.14 3.14 ± 0.16 3.16 ± 0.18 3.35 ± 0.31 3.65 ± 0.113» Trial 2 2.92 ± 0.21 2.44 + 0.31s 2.86 ± 0.23 2.98 ± ...

Claims

CLAIMS 1. Recombinant AAV vector (rAAV), characterized in that it comprises an AAV9 capsid and a genome comprising two inverted terminal repeats (ITRs) of AAV, a nucleic acid sequence encoding a human minidystrophin protein, which consists of the amino acid sequence of SEQ ID NO: 7, and a muscle-specific transcriptional regulatory element operationally linked thereto.

2. rAAV vector, according to claim 1, characterized in that the muscle-specific transcriptional regulatory element is a muscle-specific promoter or enhancer.

3. rAAV vector, according to claim 2, characterized in that said specific muscle promoter or enhancer is derived from a muscle creatine kinase gene.

4. rAAV vector, according to claim 3, characterized in that the muscle-specific promoter or enhancer comprises the nucleotide sequence SEQ ID NO:

16.

5. rAAV vector, according to any one of claims 1 to 4, characterized in that it further comprises a transcription termination sequence positioned 3' from the nucleic acid sequence encoding the human mini-dystrophin protein.

6. rAAV vector, according to claim 5, characterized in that said transcription termination sequence comprises the nucleotide sequence of SEQ ID NO:

17.

7. Vector of rAAV, according to any one of claims 1 to 6, characterized in that it further comprises an intron. Petition 870260051626, dated 05 / 29 / 2026, page 262 / 511 2 / 3 8. rAAV vector, according to any one of claims 1 to 7, characterized in that said nucleic acid sequence encoding said human mini-dystrophin is human codon optimized.

9. rAAV vector, according to claim 8, characterized in that said nucleic acid sequence comprises the nucleic acid sequence of SEQ ID NO:

1.

10. rAAV vector, according to any one of claims 1 to 9, characterized in that said first and second AAV ITRs are positioned at opposite ends of said vector genome.

11. Vector of rAAV, according to claim 10, characterized in that each of the first and at least the second ITRs of AAV are of AAV2.

12. rAAV vector, according to claim 1, characterized in that said vector genome comprises a first AAV2 ITR, a muscle-specific promoter or enhancer operationally linked to a human codon-optimized nucleic acid sequence encoding the human mini-dystrophin protein consisting of the amino acid sequence of SEQ ID NO: 7, a polyadenylation signal transcription termination sequence, and a second AAV2 ITR.

13. rAAV vector, according to claim 12, characterized in that said nucleic acid sequence encoding said human mini-dystrophin protein comprises a nucleotide sequence with SEQ ID NO:

1.

14. rAAV vector, according to claim 12 or 13, characterized in that said specific muscle promoter or enhancer is derived from a muscle creatine kinase gene. Petition 870260051626, dated 05 / 29 / 2026, p. 263 / 511 3 / 3 15. rAAV vector, according to any one of claims 12 to 14, characterized in that said muscle-specific promoter or enhancer comprises the nucleotide sequence of SEQ ID NO:

16.

16. rAAV vector, according to any one of claims 12 to 15, characterized in that said polyadenylation signal transcription termination sequence comprises the nucleotide sequence of SEQ ID NO:

17.

17. rAAV vector, according to any one of claims 1 to 16, characterized in that said genome is a linear single-stranded DNA genome.

18. rAAV vector, according to any one of claims 1 to 17, characterized in that said genome comprises the nucleotide sequence of SEQ ID NO: 18 or the reverse complement thereof.

19. Pharmaceutical composition, characterized in that it comprises the rAAV vector, as defined in any one of claims 1 to 18, and a pharmaceutically acceptable vehicle.

20. Use of the pharmaceutical composition, as defined in claim 19, characterized in that it is for the manufacture of a medicament for the treatment of Duchenne muscular dystrophy (DMD) in a human being.

Images