METHOD OF PRODUCING WHEAT FLOUR, WHEAT BRAN OR WHEAT STARCH GRANULES, AND PROCESS FOR PRODUCING A FOOD PRODUCT

Abstract

The present invention provides wheat grain of the species Triticum aestivum, the grain comprising: i) mutations in each of its ssiia genes such that the grain is homozygous for a mutation in its ssiia-a gene, homozygous for a mutation in its ssiia-b gene and homozygous for a mutation in its ssiia-d gene, wherein at least two of the mutations in said ssiia genes are null mutations, ii) a total starch content comprising an amylose content and an amylopectin content, iii) a fructan content which is increased relative to wild-type wheat grain on a weight basis, preferably between 3% and 12% of the grain weight, iv) a β-glucan content, v) an arabinoxylan content, vi) a cellulose content. The grain has a weight between 25 mg and 60 mg, and the amylose content is between 45% and 70% on a weight basis of the total starch content of the grain, as determined by the iodine binding test.The amylopectin content on a weight basis is reduced relative to wild wheat grain, and each of the β-glucan content, arabinoxylan content, and cellulose content are increased relative to wild wheat grain, on a weight basis, such that the sum of the fructan content, β-glucan content, arabinoxylan content, and cellulose content is between 15% and 30% of the grain weight.

Description

METHOD OF PRODUCING WHEAT FLOUR, WHEAT BRAN OR WHEAT STARCH GRANULES, AND PROCESS FOR PRODUCING A FOOD PRODUCT RELATED REQUEST

[001] This application claims priority to Australian provisional patent application 2016902643, filed on July 5, 2016, the description of which is included herein in its entirety by reference. FIELD

[002] The descriptive report describes methods of obtaining hexaploid wheat plants with high amylose starch content and the use of such plants, and particularly grain or starch thereof, in a variety of food and non-food products. FUNDAMENTALS

[003] Reference to any prior art in this descriptive report is not, and should not be considered as, an acknowledgment or any form of suggestion that such prior art is part of common general knowledge in any country. Throughout this application, various publications are referenced, including those referenced in parentheses. Full citations for the publications referenced in parentheses can be found listed in alphabetical order at the end of the descriptive report, immediately preceding the claims. Descriptions of all referenced publications in their entirety are incorporated herein by reference in this application in order to more fully describe the cutting-edge technology to which this invention pertains. Petition 870260060961, dated 06 / 22 / 2026, p. 11 / 26 / 187

[004] Food produced from wheat grain provides at least 20% of the kilojoules of food for the world's population, and provides a significant portion of protein and non-starch polysaccharides, as well as energy absorption for the human diet. Starch is the main component of wheat grain and is used in a wide range of food and non-food products. Starch characteristics vary and play a key role in determining the suitability of wheat starch for a particular end use. Despite this enormous global consumption, and despite a greater awareness of the importance of starch functionality in the quality of the final product, research into genetic variation in wheat and its exact impact on starch characteristics lags behind other commercially important vegetable crops.

[005] Carbohydrate represents approximately 65-75% of mature wheat grain (Stone and Morell, 2009). The main carbohydrate in wheat grain is starch, which consists of two glucose polymers, amylose and amylopectin. Amylose is an essentially linear polymer of α-1,4-linked glucose units with few branches, while amylopectin is relatively highly branched with α-1,6 glycosidic unit linkages that bind to linear chains of α-1,4-linked glucose units. The amylose to amylopectin ratio appears to be an important determinant in (i) the health benefit of wheat grain and wheat starch and (ii) the final quality of products comprising wheat starch.

[006] A second important determinant of wheat grain for health is the amount of non-starch polysaccharide in the grain, which forms part of the dietary fiber. Wild wheat grain contains about 1% by weight of oligosaccharides such as raffinose, about 1% of fructans, and about 10% of cell wall polysaccharides, mainly cellulose, arabinoxylan, and β-glucan (Stone and Morell, 2009). These form the main components of dietary fiber that is not digested and absorbed in the intestine. Petition 870190000436, dated 03 / 01 / 2019, page 10 / 233 / 187 small intestine, but passes into the colon, where it undergoes bacterial degradation. Dietary fiber is important for regulating blood glucose and insulin levels, as well as gut health.

[007] Cereal grains containing starch with relatively higher amounts of amylose are of particular interest for their health benefits. Foods containing more amylose have been observed to have higher levels of resistant starch (RS), a form of dietary fiber. RS is starch or starch products that are partially digested and not absorbed in the small intestine. Resistant starch is increasingly being observed to play an important role in promoting gut health and protecting against diseases such as colorectal cancer, type II diabetes, obesity, heart disease, and osteoporosis. High-amylose starches have been developed in certain cereals, such as maize and barley, for use in foods as a means of promoting gut health.The beneficial effects of resistant starch result from providing a nutrient to the large intestine, where it is supplied to the intestinal microflora as an energy source and fermented to form short-chain fatty acids. These short-chain fatty acids provide nutrients to the colonocytes, improve the absorption of certain nutrients by the large intestine, and promote physiological colon activity. In general, if resistant starches or other dietary fibers are not supplied to the colon, it will become relatively metabolically inactive. Thus, products with a high amylose content have the potential to provide a higher fiber intake. Additional potential health benefits of consuming wheat grains with a high amylose content or their products, such as starch, include improved regulation of blood sugar, insulin, and lipid levels.Additionally, such foods can promote satiety, improving laxation, promoting the growth of probiotic bacteria, and improving fecal bile acid excretion.

[008] Most processed starchy foods contain well Petition 870190000436, dated 03 / 01 / 2019, page 11 / 233 / 187. Little RS. Breads prepared using wild wheat flour and conventional baking processes contain <1% RS. In comparison, breads baked using the same process and stored under the same conditions, but containing wheat flour with a high amylose content, due to the reduced activity of the starch branching enzyme in the grain, showed RS levels as high as 10 times higher (WO2006 / 069422). Legumes, which represent one of the few rich sources of RS in the human diet, contain RS levels that are generally <5%. Therefore, consuming bread with wheat with a high amylose content in quantities normally consumed by adults (e.g., 200 g / d) can easily provide at least 5-12 g of RS. Thus, incorporating high-amylose wheat grain into food products has the potential to make a considerable contribution to dietary intake of sages for humans.

[009] Starch is initially synthesized in plants in the chloroplasts of photosynthetic tissues, such as leaves, in the form of transient starch. This is mobilized during subsequent dark periods to provide carbon for export to penetrate organs and energy metabolism, or for storage in organs such as seeds or tubers. Long-term synthesis and storage of starch occur in the amyloplasts of storage organs, such as the endosperm of cereals, where starch is deposited as semicrystalline granules up to 100 μm in diameter. The granules contain both amylose and amylopectin, the former typically as amorphous material in the natural starch granule, while the latter is semicrystalline through the stacking of linear glycosidic chains. The granules also contain some of the proteins involved in starch biosynthesis.

[0010] Starch synthesis in the endosperm involves at least four types of enzymes (Figure 1). First, ADP-glucose pyrophosphorylase (ADGP) Petition 870190000436, dated 03 / 01 / 2019, page 12 / 233 / 187 catalyzes the synthesis of ADP-glucose from glucose-1-phosphate and ATP. Secondly, a diverse set of starch synthases (SS; EC 2.4.1.21) catalyzes the transfer of glucose residues from ADP-glucose to the non-reducing end via α-1,4 linkages to elongate an α-glucan chain. Thirdly, starch branching enzymes (SBE) form new α-1,6 linkages in α-polyglucans. Finally, starch debranching enzymes (DBE) then remove some of the branched linkages, through a mechanism that has not been fully elucidated.

[0011] Although it is evident that at least these four activities are required for the synthesis of normal starch granules in higher plants, multiple isoforms of each of the enzymes are found in the endosperm of higher plants. Specific roles for some isozymes have been proposed based on mutational analysis, or through the modification of gene expression levels using transgenic approaches (Abel et al., 1996; Jobling et al., 1999; Schwall et al., 2000). However, the contributions of each of the isozymes differ markedly between species, and the exact contribution of each isoform to starch biosynthesis is still unknown. This is especially true for hexaploid bread wheat (Triticum aestivum), which has three sets of homologous chromosomes that define the A, B, and D genomes. Hexaploidy has been considered a significant obstacle in the research and development of used wheat varieties.In fact, knowledge is limited regarding how homologous wheat genes interact, how their expression is regulated, and how the different proteins produced by homologous genes function separately or together.

[0012] In corn, rice, and wheat, the enzymes starch synthase I (SSI), starch synthase IIa (SSIIa), and starch synthase IIIa (SSIIIa) participate in the synthesis of amylopectin, perhaps along with another SS. In rice, for example, there are 10 different starch synthases, including two granule-bound forms. Petition 870190000436, dated 01 / 03 / 2019, p. 13 / 233 / 187 (GBSS). Wheat, barley, and rice mutants deficient in SSIIa have been isolated, but the three species showed different effects on phenotypes affected by SSIIa loss, especially in the extent of the effects. A mutant ssIIa wheat plant, which completely lacks the SGP-1 protein (SSIIa), was produced by crossing lines lacking the specific genome forms A, B, and D of the SGP-1 protein (Yamamori et al., 2000). The triple-null ssIIa grain exhibited deformed starch granules, and the starch showed altered amylopectin structure. The starch exhibited an amylose content of 30-37% w / w, which was an increase of approximately 8% compared to the wild-type level, and a substantial reduction in starch content (Yamamori et al., 2000). The starch from the triple-null ssIIa mutant exhibited a lower gelatinization temperature compared to the starch from the corresponding wild-type grain.The starch content of the triple-null ssIIa grain was reduced by less than 50% from at least 60% w / w in the wild grain. There is no suggestion in Yamamori et al. (2000) that wheat with more than 45% amylose content in its starch can be produced by combining mutations of the ssIIa gene; in fact, Yamamori et al. suggest the opposite. This was supported by KonikRose et al. (2007), who obtained a maximum of 43.98% amylose in the starch of a triple-null ssIIa mutant crossed into Sunco variety wheat.

[0013] In barley, a chemically induced null mutation in the SSIIa gene greatly reduced amylopectin synthesis and, thereby, increased the proportion of amylose in grain starch by 65-70% w / w (WO02 / 37955-A1; Morell et al., 2003). Japonica rice comprises an SSIIa mutation that reduces the SSIIa enzyme in the endosperm compared to Indica rice, but the amylose level in Japonica grain starch was not substantially elevated compared to Indica grain starch. In rice, a combination of mutations in the SBEIIb and SSIIIa genes showed a more substantial effect on the relative amount of amylose (Asai et al., 2014).

[0014] The different effects of ssIIa null mutations in wheat, barley Petition 870190000436, dated 01 / 03 / 2019, p. 14 / 233 / 187 and rice were attributed to the different extents of pleiotropic effects of SSIIa protein loss on the breakdown of starch synthase I (SSI) and starch branching enzyme IIb (SBEIIb) within and outside starch granules in the developing endosperms of these ssIIa mutants (Luo et al., 2015). Furthermore, differential effects at post-translational levels of SSI and SBEIIb proteins may have affected the remainder of the amylopectin structure. This was an example where observations in one cereal species cannot be simply extrapolated to another cereal species in the area of ​​starch synthesis.

[0015] In maize and rice, phenotypes with high amylose content have been generated by mutations in the SBEIIb gene, which encodes starch branching enzyme IIb, also known as the amylose extender gene (ae) (Boyer and Preiss, 1981; Mizuno et al., 1993; Nishi et al., 2001), without being an SSIIa gene. In these sbeIIb mutants, the amylose content was significantly elevated as a proportion of the starch content, the frequency of residual amylopectin branching was reduced, and the proportion of short chains ( <DP17, especialmente DP8-12) foi reduzida. Além do mais, a temperatura de gelatinização do amido foi aumentada. Para obter aumentos adicionais nos níveis de amilose no milho, variedades foram produzidas com atividade reduzida de enzima ramificadora de amido I (SBEI), junto com uma atividade de inativação quase completa de SBEII (Sidebottom et al., 1998).

[0016] Wheat with at least 50% amylose as a proportion of starch content was generated by reducing only the activity of SBEIIa (Regina et al., 2006), without reducing the activity of SBEIIb or SSIIa. Unlike maize and rice, wheat with reduced SBEIIb alone did not yield an increase in amylose content. International publication WO2005 / 001098 and International publication WO2006 / 069422 describe hexaploid transgenic wheat comprising exogenous duplex RNA, which reduced the expression of one or both SBEIIa and SBEIIb genes in the endosperm. Grain lines Petition 870190000436, dated 01 / 03 / 2019, p. 15 / 233 / 187: Transgenic plants reduced the levels of SBEIIa and / or SBEIIb proteins. The reduction of SBEIIa protein in the endosperm was associated with higher relative amylose levels by more than 50%, while the absence of SBEIIb protein alone did not appear to substantially alter the proportion of amylose in the starch grain. International publications WO2012 / 058730 and WO2013 / 063653 report the production of non-transgenic triple-null mutants sbelIa and / or sbelIb, which substantially do not express SBEIIa and SBEIIb proteins and exhibited higher amylose levels. The grain of triple-null sbeIIa genotypes was viable, provided that at least one of the sbeIIa gene mutations was a point mutation, not a deletion extending beyond the gene into adjacent regions. Therefore, if it is desired to produce wheat with a high amylose content of at least 50% amylose, the SBEIIa gene is the gene that can be targeted in bread wheat.Levels of non-starch polysaccharides, such as fructans, were not increased in wheat with reduced SBEII activity and increased (>50%) amylose in its starch (e.g., WO2010 / 006373).

[0017] There is a need in the field for more wheat plants with high amylose content and methods of producing them. SUMMARY

[0018] The inventors unexpectedly observed that hexaploid wheat grain with an amylose content of at least 45%, as a weight percentage of the total starch content of the grain, can be produced by combining mutations in the three SSIIa genes in the A, B, and D genomes of wheat through crossing and selection. Previous techniques indicated that 45% amylose was not achieved; in fact, the amylose level in mutant ssIIa wheat was generally 30-38% (Yamamori et al., 2000). At least two of the three mutations were null mutations, preferably all three. Since loss-of-function mutations in SSIIa are recessive, the phenotype was observed when the mutations were in the homozygous state. The inventors also observed that the Petition 870190000436, dated 03 / 01 / 2019, page 16 / 233 / 187: mutant wheat grain ssIIa showed significantly higher levels of non-starch polysaccharides, particularly β-glucan, fructan, arabinoxylan, and cellulose, each as a percentage of the grain weight. This resulted in a substantial increase in total fiber content, as well as an associated increase in protein content and other favorable phenotypes.

[0019] In a first aspect, the present invention therefore provides a wheat grain of the species Triticum aestivum, the grain comprising: i) mutations in each of its SSIIa genes, such that the grain is homozygous for a mutation in its SSIIa-A gene, homozygous for a mutation in its SSIIa-B gene, and homozygous for a mutation in its SSIIa-D gene, wherein at least two of the mutations in said SSIIa genes are null mutations, preferably all three are null mutations, ii) a total starch content comprising an amylose content and an amylopectin content, iii) a fructan content that is increased relative to wild-type wheat grain on a weight basis, preferably between 3% and 12% of the grain weight, iv) a β-glucan content, v) an arabinoxylan content, and vi) a cellulose content, the grain having a grain weight between 25 mg and 60 mg, wherein the amylose content is between 45% and 70% on a weight basis of the total starch content of the grain, as determined by the iodine binding assay, wherein the amylopectin content on a weight basis is reduced relative to wild wheat grain, wherein each of the β-glucan content, arabinoxylan content and cellulose content are increased relative to wild wheat grain on a weight basis, such that the sum of the fructan content, β-glucan content, arabinoxylan content and cellulose content is between Petition 870190000436, dated 03 / 01 / 2019, page 17 / 233 / 187 15% and 30% of the grain's weight.

[0020] The present invention further provides wheat plants that are capable of producing, or are obtained from, this grain and products such as flour, bran, wheat starch granules and wheat starch produced from this grain.

[0021] The present invention also provides food ingredients comprising the grain of the present invention or material produced from this grain. Food products including these ingredients and food compositions comprising the grain of the present invention, or material produced from this grain, are also provided. The food ingredient may be coarsely ground, broken, parboiled, rolled, pearled, crushed or milled grain or any combination thereof. A preferred ingredient is flour, above all preferably wholemeal flour or a mixture of wholemeal flour and white flour. These ingredients exhibit a higher level of total fiber compared to a corresponding wild wheat ingredient, by virtue of the incorporation of the wheat grain material of the invention.

[0022] In another aspect, the present invention provides a process for producing a wheat plant that is capable of producing the grain of the present invention, the process comprising the step of (i) crossing two parental wheat plants, each comprising a null mutation in each of one, two or three SSIIa genes selected from the group consisting of SSIIa-A, SSIIa-B and SSIIa-D, or mutagenizing a parental plant, preferably comprising one or two of said null mutations; and the step of (ii) screening plants or grain obtained from the crossing or mutagenesis, or progeny of plants or grain obtained therefrom, by analyzing DNA, RNA, protein, starch granules or starch from the plants or grain, and the step of (iii) selecting a fertile wheat plant that has reduced SSIIa activity relative to at least one of the parental wheat plants from step (i). Petition 870190000436, dated 03 / 01 / 2019, page 18 / 233 / 187

[0023] In another aspect, the present invention provides a process for improving one or more parameters of metabolic health, intestinal health or cardiovascular health in a subject who needs it, or for preventing or reducing the severity or incidence of a metabolic disease such as diabetes, intestinal disease or cardiovascular disease, the method comprising providing the subject with the grain or food product of the present invention.

[0024] In a further aspect, the present invention provides a process for producing wheat grain silos comprising: a) harvesting wheat stalks comprising the wheat grain of the present invention; b) threshing and / or winnowing the stalks to separate the grain from the chaff; and c) sift and / or classify the grain separated in step b), and place the sifted and / or classified grain in silos, thus producing wheat grain silos.

[0025] In the embodiments of each of the above aspects, the wheat grain is further distinguished by one or more, or all, of the following characteristics. The amylose content is increased relative to wild wheat grain, for example, between 48% and 70%, preferably between 50% and 65% of the total starch content of the grain as determined by the iodine binding test. In the embodiments, the amylose content is between 50% and 70%, or about 48%, about 50%, about 53%, about 55%, about 60% or about 65%. The starch content of the grain is reduced relative to wild wheat grain, for example, by at least 25%. In these embodiments, the starch content of the grain of the invention is between 30% and 70% of the grain weight, between 25% and 65%, between 25% and 60%, between 25% and 55%, between 25% and 50%, between 30% and 70%, between 30% and 65%, between 30% and 60%, between 30% and 55%, or between 30% and 50%. In further embodiments, the Petition 870190000436, dated 01 / 03 / 2019, p. 19 / 233 / 187. The starch content is approximately 35%, approximately 40%, approximately 45%, approximately 50%, approximately 55%, approximately 60%, or approximately 65% ​​as a percentage of the grain weight (w / w). In one embodiment, at least 50%, preferably at least 60% or at least 70%, more preferably at least 80% of the starch granules obtained from the grain of the invention show distorted shape and / or surface morphology. The starch of the grain comprises at least 2% resistant starch, preferably at least 3% resistant starch, more preferably between 3% and 15% resistant starch, or between 3% and 10% resistant starch. Starch is distinguished by a reduced gelatinization temperature, which is quickly assessed by differential scanning calorimetry (DSC); for example, the first peak in the DSC scan occurs at a temperature 28°C lower than for wild-type starch.In the embodiments, the BG content of the grain is the β-glucan content and is increased by 1% or 2% on an absolute basis relative to wild-type grain, and / or is increased between 2 times and 7 times relative to wild-type wheat grain on a weight basis. In the embodiments, the BG level is at least 1% or at least 2%, preferably between 1% and 4% or between 1% and 5% by weight of the grain, preferably about 2%, about 3%, about 4%, more preferably between 2% and 5%. In the embodiments, the arabinoxylan content is increased between 1% and 5% on an absolute basis, and / or the cellulose content is increased between 1% and 5% on an absolute basis. In a preferred embodiment, the grain (before any treatment that prevents its germination) exhibits a germination rate that is between approximately 70% and approximately 100% with respect to wild wheat grain, and the grain, when sown, gives rise to wheat plants that are both male and female fertile.Each of these phenotypes is associated with reduced SSIIa activity while the grain is developing in the wheat plant, a result of mutations in the SSIIa genes.

[0026] The preceding summary is not and should not be viewed in any way as an in-depth citation of all the modalities of the present Petition 870190000436, dated 01 / 03 / 2019, p. 20 / 233 / 187 invention. BRIEF DESCRIPTION OF THE FIGURES

[0027] Figure 1. Schematic representation of the enzymes involved in starch synthesis in cereal grain, for amylose and amylopectin.

[0028] Figure 2. Schematic genetic map of a mutation in the wheat SSIIa-A gene in the C57 wheat lineage A genome. The top row shows a map of the exons of the SSIIa-A gene. Following this are the nucleotide sequences of a region of the wild-type Chinese Spring SSIIa-A gene and the C57 mutant, showing a 289-nucleotide deletion in exon 1, including the early translation codon ATG and an 8-nucleotide insertion, net deletion size of 281 nucleotides. Positions of the JKSS2AP1F and JKSS2AP2R primer oligonucleotides are shown.

[0029] Figure 3. Schematic genetic map of a mutation in the wheat SSIIa-B gene in the K79 wheat lineage B genome. The top row shows a map of the exons of the SSIIa-B gene. Following this are the nucleotide sequences of a region of the wild-type (CS) Chinese Spring SSIIa-B gene and the K79 mutant, showing the insertion of 179 nucleotides into exon 8 of SSIIa-B. Positions of the JKSS2BP7F and JLTSS2BPR1 primer oligonucleotides are shown.

[0030] Figure 4. Schematic genetic map of a mutation in the wheat SSIIa-D gene in the D genome of the Turkey 116 wheat line. The top row shows a map of the exons of the SSIIa-D gene. Following are the nucleotide sequences of a region of the wild-type (CS) Chinese Spring and T116 mutant SSIIa-D gene, showing the 63-nucleotide deletion spanning the exon 5 and intron 5 junction (intron 5 junction site) of SSIIa-D. Positions of the JTSS2D3F and JTSS2D4R primer oligonucleotides are shown.

[0031] Figure 5. Schematic of the crossing and backcrossing program to produce triple null ssIIa mutants in the genetic origin. Petition 870190000436, dated 03 / 01 / 2019, page 21 / 233 / 187 Sunco.

[0032] Figure 6. Schematic of the crossbreeding and backcrossing program to produce triple null ssIIa mutants in the EGA Hume genetic line.

[0033] Figure 7. Schematic of the crossbreeding and backcrossing program to produce triple null ssIIa mutants in the Westonia genetic origin.

[0034] Figure 8. Top panel shows average grain weight (mg per grain), and bottom panel shows total lipid content (% grain weight) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0035] Figure 9. Means of the data in Figure 8 for the triple null mutant (abd) and WT genotypes in the genetic origins EGA Hume, Sunco, and Westonia, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0036] Figure 10. Top panel shows amylopectin content (% starch content on a weight basis), middle panel shows amylose content (% starch content on a weight basis, by the iodine binding method), and bottom panel shows total starch content (% grain weight) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0037] Figure 11. Means of the data in Figure 10 for the triple null mutant (abd) and WT genotypes in the EGA Hume, Sunco, and Westonia genetic origins, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0038] Figure 12. Top panel shows total fiber content (% of Petition 870190000436, dated 03 / 01 / 2019, page 22 / 233 / 187 grain on a weight basis), and the lower panel shows the total BG content (% of grain on a weight basis) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0039] Figure 13. Means of the data in Figure 12 for the triple null mutant (abd) and WT genotypes in the genetic origins EGA Hume, Sunco, and Westonia, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0040] Figure 14. Top panel shows fructan content (% of grain on a weight basis), middle panel shows arabinoxylan content (% of grain on a weight basis), and bottom panel shows cellulose content (% of grain on a weight basis) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0041] Figure 15. Top panel shows average grain weight (mg per grain) and bottom panel shows total lipid content (mg per grain) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0042] Figure 16. Means of the data in Figure 15 for the triple null mutant (abd) and WT genotypes in the EGA Hume, Sunco, and Westonia genetic origins, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0043] Figure 17. Top panel shows amylopectin content (mg per grain), middle panel shows amylose content (mg per grain), and bottom panel shows total starch content (mg per grain) in triple null ssIIa (abd) and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia. Petition 870190000436, dated 03 / 01 / 2019, page 23 / 233 / 187

[0044] Figure 18. Means of the data in Figure 17 for the triple null mutant (abd) and WT genotypes in the EGA Hume, Sunco, and Westonia genetic origins, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0045] Figure 19. Top panel shows total fiber content (mg per grain) and bottom panel shows total BG content (mg per grain) in triple null ssIIa (abd) grain and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0046] Figure 20. Means of the data in Figure 19 for the triple null mutant (abd) and WT genotypes in the EGA Hume, Sunco, and Westonia genetic origins, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0047] Figure 21. Top panel shows fructan content (mg per grain), middle panel shows arabinoxylan content (mg per grain), and bottom panel shows cellulose content (mg per grain) in triple null ssIIa (abd) and wild type SSIIa (WT) grain for individual wheat lines in the genetic origins EGA Hume, Sunco and Westonia.

[0048] Figure 22. Means of the data in Figure 21 for the triple null mutant (abd) and WT genotypes in the EGA Hume, Sunco, and Westonia genetic origins, showing the standard deviation. Bars indicated with the same letters (a, b, c) are not statistically significantly different, while bars with different letters are significantly different.

[0049] Figure 23. Resistant starch content as a percentage of starch in three selected mutant grains: triple null ssIIa (Sunco-abd) and wild type (WT) in the Sunco genetic origin. The three mutants were not significantly different from each other, but were significantly different in WT. Petition 870190000436, dated 03 / 01 / 2019, page 24 / 233 / 187

[0050] Figure 24. Percent differences in mean mole of chain length distribution (CLD) profiles of unbranched starch from 5 triple ssIIa mutant strains, compared to the corresponding wild-type starch. Short chains (SD 6-10) were increased in frequency, while intermediate chains (SD 11-24) were decreased in frequency for the ssIIa mutant starch, compared to that of the corresponding wild type.

[0051] Figure 25. Size exclusion chromatography (SEC) profiles of starch from the triple null mutant grain ssIIa and corresponding wild-type wheat starch, after debranching with isoamylase of the starches. The traces show the distribution of normalized refractometer index (RI) signals of eluted fractions, according to their degree of polymerization (X-axis). The first elution peak (I) is amylose, the second (II) is long-chain amylopectin, and peak III is amylopectin (debranched). The black trace was for the mutant starch ssIIa, the gray trace was for the wild-type starch.

[0052] Figure 26. Immunological characterization of starch-bound proteins from mature wheat grains, ssIIa mutant wheat (B22) and wild-type SSIIa wheat (B70). The top bands in the Western blots were identified as SSIIa, the second band from the top was identified as a mixture of SBEIIa and SBEIIb, and the 70 and 60 kDa bands were SSI and GBSSI, based on their binding to specific antisera. The identity of each band is marked and indicated by arrows. The identity of the antibodies used for the different blots is marked to the left or below each panel. M: protein molecular weight marker (kDa). LIST OF SEQUENCES

[0053] SEQ ID NO:1 SSIIa-A polypeptide amino acid sequence, encoded by the wheat A genome; Accession number: AAD53263, 799aa. Petition 870190000436, dated 03 / 01 / 2019, page 25 / 233 / 187

[0054] SEQ ID NO:2 Wheat SSIIa-B polypeptide amino acid sequence, encoded by the wheat B genome; Accession number: CAB96627, 798aa.

[0055] SEQ ID NO:3 SSIIa-D polypeptide amino acid sequence, encoded by the wheat D genome; Accession number: BAE48800, 799aa; Shimbata et al., (2005).

[0056] SEQ ID NO:4 Full-length cDNA nucleotide sequence of wheat SSIIa-A gene; 2821 nucleotides; Accession number: AF155217; Li et al., (1999); translation start codon nucleotides 89-91, stop codon 2486-2488.

[0057] SEQ ID NO:5 Full-length cDNA nucleotide sequence of wheat SSIIa-B gene; 2793 nucleotides; Accession number: AJ269504; Gao and Chibbar, (2000); translation start codon nucleotides 135-137, stop codon 2529-2531.

[0058] SEQ ID NO:6 Full-length cDNA nucleotide sequence of wheat SSIIa-D gene; 2846 nucleotides; Accession number: AJ269502; Gao and Chibbar, (2000); translation start codon nucleotides 210-212, stop codon 2607-2609. Transit peptide encoded by nucleotides 201-384, mature peptide 385-2606.

[0059] SEQ ID NO:7 The nucleotide sequence of the SSIIa-A gene of wheat; Accession number: AB201445; 6898nt (IWGSC: Chromosome 7AS, Traes_7AS_53CAFB43A, 52346437 bp to 52346905 bp, 52351676 to 52351931 bp reverse strand).

[0060] SEQ ID NO:8 The nucleotide sequence of the SSIIa-B gene from wheat (Accessory number: AB201446) (IWGSC: Chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp sense strand), 6811nt.

[0061] SEQ ID NO:9 The nucleotide sequence of the SSIIa-D gene of wheat (Accessory number: AB201447) (IWGSC: Chromosome 7DS, Petition 870190000436, dated 03 / 01 / 2019, page 26 / 233 / 187 Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp sense strand); 6950nt.

[0062] SEQ ID NO:10 Wheat amino acid sequence SSIIb-A encoded in genome A, 676aa, deduced from nucleotide sequence with accession number AK332724.

[0063] SEQ ID NO:11 Wheat amino acid sequence SSIIb-D encoded in the D genome, 674aa, Accession number ABY56824 (showing 100% identity with EU333947).

[0064] SEQ ID NO:12 Full-length cDNA nucleotide sequence of wheat SSIIb-A gene in genome A, Accession number: AK332724. 2727nt (IWGSC: Chromosome 6AL, Traes_6AL_AE01DC0EA, 187,500,495 bp to 187,505,249 bp sense strand).

[0065] SEQ ID NO:13 Wheat SSIIb-B partial-length cDNA nucleotide sequence in genome B, 1282nt, IWGSC: Chromosome 6DL, gene: Traes_6BL_61D83E262, 162,113.784 bp to 162,116.959 bp (reverse strand).

[0066] SEQ ID NO:14 The full-length cDNA nucleotide sequence of wheat SSIIb-D in genome V, 2025nt (Accessory number: EU333947) (IWGSC: Chromosome 6DL, gene: Traes_6DL_19F1042C7, 147,049,693 bp to 147,051,708 bp reverse strand).

[0067] SEQ ID Nos:15-49 Oligonucleotide primers.

[0068] SEQ ID Nos: 50-51 Peptide amino acid sequences DETAILED DESCRIPTION

[0069] Throughout this descriptive report, unless the context requires otherwise, the word “comprise,” or variations such as “comprises” or “comprising,” shall be understood as suggesting the inclusion of a declared element or integer, or group of declared elements or integers, but not the exclusion of any other element or integer, or group of elements or integers. “Consisting Petition 870190000436, dated 03 / 01 / 2019, page 27 / 233 / 187. “Consisting of” means including, and limited to, whatever follows the term “consisting of”. Thus, the term “consisting of” indicates that the listed elements are required or mandatory, and that no other element may be present. “Essentially consisting of” means including any of the elements listed after the term, and limited to the other elements that do not interfere with or contribute to the activity or action specified in the description of the listed elements. Thus, the term “essentially consisting of” indicates that the listed elements are required or mandatory, but that none of the other elements are optional, and may or may not be present, depending on whether or not they affect the activity or action of the listed elements.

[0070] As used here, the singular forms “a”, “an”, “the”, and “the” include plural aspects, and vice versa, unless the context clearly dictates otherwise. Thus, for example, reference to “a mutation” includes a single mutation as well as two or more mutations; reference to “a plant” includes one plant as well as two or more plants; and so on.

[0071] As used herein, the term “about” in relation to a numerical value or range is intended to include numbers that are within ± 10% of the specified numerical value or range.

[0072] Each modality in this descriptive report shall be applied mutatis mutandis to all other modalities, unless expressly stated otherwise.

[0073] Genes and other genetic material (e.g., mRNA, constructs, etc.) are represented in italics, and their protein expression products are represented in non-italicized form. Thus, for example, SSIIa is an expression product of SSIIa.

[0074] Nucleotide and amino acid sequences are identified by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers. <400> 1 (SEQ Petition 870190000436, dated 03 / 01 / 2019, page 28 / 233 / 187 ID NO:1), <400> 2 (SEQ ID NO:2), etc. A sequence listing is provided after the claims. A list describing the SEQ ID NOs in the sequence listing is provided after the figure captions.

[0075] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to whom the invention pertains. Although any of the methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention, the preferred methods and materials are described.

[0076] The present invention is based in part on surprising observations made in the experiments described herein, in which hexaploid wheat grain comprising null mutations in each of its three SSIIa genes can be produced, which exhibits an amylose content of at least 45% (w / w). This was unexpected, based on observations made by others, in which the amylose level in triple null hexaploid wheat grain for ssIIa was less than 45% (Yamamori et al., 2000; Konik-Rose et al., 2007). Thus, amylose content is defined as a percentage of the total starch content of the grain on a weight / weight basis. Furthermore, wheat grain exhibits other desirable properties, including a higher total fiber content, based on increased levels of fructans, β-glucan, arabinoxylan, and cellulose, which provides health benefits when the grain or products derived from the grain are used as food or feed.

[0077] In this way, in a first aspect, the present invention provides a wheat grain of the species Triticum aestivum, the grain comprising: i) mutations in each of its SSIIa genes, such that the grain is homozygous for a mutation in its SSIIa-A gene, homozygous for a mutation in its SSIIa-B gene, and homozygous for a mutation in its SSIIa-D gene, wherein at least two of the mutations in said SSIIa genes are null mutations, Petition 870190000436, dated 03 / 01 / 2019, page 29 / 233 / 187 ii) a total starch content comprising an amylose content and an amylopectin content, iii) a fructan content that is increased relative to wild wheat grain on a weight basis, preferably between 3% and 12% of the grain weight, iv) a β-glucan content, (v) an arabinoxylan content, and (vi) a cellulose content, the grain having a grain weight between 25 mg and 60 mg, wherein the amylose content is between 45% and 70% on a weight basis of the total starch content of the grain, as determined by the iodine binding assay, wherein the amylopectin content on a weight basis is reduced relative to wild wheat grain, wherein each of the β-glucan content, arabinoxylan content and cellulose content are increased relative to wild wheat grain on a weight basis, such that the sum of the fructan content, β-glucan content, arabinoxylan content and cellulose content is between 15% and 30% of the grain weight.

[0078] The present invention further provides wheat plants which are produced or obtained from this grain, and wheat flour and / or starch granules produced from this grain.

[0079] The present invention also provides food ingredients comprising the grain of the present invention, or material produced from this grain. Food products including these ingredients and food compositions comprising the grain of the present invention, or material produced from this grain, are also provided. The food ingredient may be coarsely ground, broken, parboiled, rolled, pearled, crushed or milled grain or any combination thereof.

[0080] In another aspect, the present invention provides a process for producing a wheat plant that produces the grain of the present invention, the Petition 870190000436, dated 03 / 01 / 2019, page 30 / 233 / 187 process comprising step (i) crossing two parental wheat plants, each comprising a null mutation in each of one, two or three SSIIa genes selected from the group consisting of SSIIa-A, SSIIa-B and SSIIaD, or mutagenizing a parental plant comprising said null mutations; and step (ii) screening plants or grain obtained from the crossing or mutagenesis, or progeny of plants or grain obtained therefrom, analyzing DNA, RNA, protein, starch granules or starch from the plants or grain, and step (iii) selecting a fertile wheat plant that reduced SSIIa activity relative to at least one of the parental wheat plants from step (i).

[0081] In another aspect, the present invention provides a process for improving one or more parameters of metabolic health, intestinal health or cardiovascular health in a subject who needs it, or for preventing or reducing the severity or incidence of a metabolic disease such as diabetes, intestinal disease or cardiovascular disease, the method comprising providing the subject with the grain or food product of the present invention.

[0082] As used here, “improving one or more parameters of metabolic health” is a relative term and means an improvement compared to consuming an equivalent amount of food or drink produced with wild wheat.

[0083] In a further aspect, the present invention provides a process for producing wheat grain silos comprising: (a) harvesting wheat stalks comprising the wheat grain of the present invention; b) threshing and / or winnowing the stalks to separate the grain from the chaff; and c) sift and / or classify the grain separated in step b), and place the sifted and / or classified grain in silos, thus producing wheat grain silos. Petition 870190000436, dated 03 / 01 / 2019, page 31 / 233 / 187

[0084] In certain embodiments, the wheat grain of the present invention is further distinguished by one or more, or all of the following characteristics: i) a starch content between 30% and 70% of the grain weight, ii) amylose content between 45% and 65% of the total starch content of the grain, as determined by the iodine binding assay, iii) the starch content exhibits a chain length distribution determined by fluorescence-activated capillary electrophoresis (FACE), after debranching of the starch samples, which is greater in the proportion of chain lengths DP 7-10 and smaller in the proportion of chain lengths DP 11-24, compared to wild-type wheat starch, iv) the fructan content comprises fructans of DP 3-12, such that at least 50% of the fructan content is DP 3-12, v) the fructan content is increased between 2 and 10 times compared to wild wheat grain on a weight basis, vi) the β-glucan content is increased by 1% or 2% on an absolute basis, and / or is increased between 2 and 7 times compared to wild wheat grain on a weight basis, vii) the β-glucan content is between 1% and 4% of the grain weight, viii) the arabinoxylan content is increased between 1% and 5% on an absolute basis, ix) the cellulose content is increased between 1% and 5% on an absolute basis, x) the grain exhibits a germination rate that is between approximately 70% and approximately 100% in relation to wild wheat grain, and xi) when sown, the grain gives rise to wheat plants that are both male and female fertile.

[0085] The grain can also comprise a level and / or activity of Petition 870190000436, dated 03 / 01 / 2019, page 32 / 233 / 187 SSIIa protein that is less than 5% of the SSIIa protein level or activity in wild-type wheat grain, or that does not present one or more, or all of the SSIIa-A, SSIIa-B, and SSIIa-D proteins. The grain may also be homozygous for a null mutation in its SSIIa-A gene, homozygous for a null mutation in its SSIIa-B gene, and homozygous for a null mutation in its SSIIa-D gene. Each null mutation may be independently selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a junction site mutation, and a non-conservative amino acid substitution mutation, preferably where the grain comprises deletion mutations in each of two or three SSIIa genes, or deletions of the genes entirely.

[0086] In certain embodiments, the grain further comprises a loss-of-function mutation in an endogenous gene encoding a starch-synthesizing polypeptide, or a chimeric polynucleotide encoding an RNA that reduces the expression of the endogenous gene encoding the starch-synthesizing polypeptide, said starch-synthesizing polypeptide being selected from the group consisting of SSI, SSIIIa and SSIV, wherein said mutation is selected from the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a junction site mutation and a non-conservative amino acid substitution mutation. Preferably, at least one, more than one, or all of the mutations are i) introduced mutations, ii) were induced in a parent wheat plant or seed by mutagenesis with a mutagenic agent, such as a chemical agent, biological agent or irradiation, or iii) were introduced in order to modify the plant genome.

[0087] It is preferable that the grain has an amylose content of approximately 60% on a weight basis of the total starch content of the grain, and / or that the grain is non-GMO or free of any exogenous nucleic acid that Petition 870190000436, dated 03 / 01 / 2019, page 33 / 233 / 187 encodes an RNA that reduces the expression of an SSIIa gene and / or an SBEIIa gene.

[0088] The level and / or activity of SSIIa is determined by assaying the level and / or activity of SSIIa in developing endosperm, or by assaying the amount of SSIIa protein in grain harvested by immunological or other means. The endosperm may be from either the plant from which the grain was obtained or from a progeny plant.

[0089] The grain starch granules and / or grain starch of the present invention may also be distinguished by one or more of the properties selected from the group consisting of: i) contain at least 2% resistant starch; ii) starch distinguished by a reduced glycemic index (GI); iii) the starch granules have a distorted shape; iv) starch granules with reduced birefringence when viewed under polarized light; (v) starch distinguished by a reduced volume of swelling; vi) modified chain length distribution and / or branching frequency in starch; vii) starch distinguished by a reduced peak at the gelatinization temperature; viii) starch distinguished by a reduced peak in viscosity; ix) reduced starch paste temperature; x) molecular weight with a reduced amylose peak, as determined by size exclusion chromatography; xi) reduced starch crystallinity; and xii) reduced proportion of type A and / or type B starch, and / or increased proportion of type V crystalline starch; where each property is related to wild-type wheat starch granules or wild-type wheat starch. Petition 870190000436, dated 03 / 01 / 2019, page 34 / 233 / 187

[0090] In certain embodiments of the present invention, the grain is processed in such a way that it is no longer capable of germination. Examples of such processed grain include heat-treated grain, and coarsely ground, broken, parboiled, rolled, pearled, crushed or milled grain. Alternatively, the grain is capable of germinating at a rate between 70% and 100%, relative to the wild type.

[0091] The present invention clearly extends to the grain, as described above, when comprised within a wheat plant. The present invention also extends to wheat plants that produce, or are obtained from, the grain of the present invention. Such wheat plants can be distinguished by a level and / or activity of SSIIa protein in their endosperm that is less than 5% of the level or activity of SSIIa protein in wild-type wheat grain, or that does not exhibit one or more, or all, of SSIIa-A protein, SSIIa-B protein, and SSIIa-D protein. Preferably, the wheat plant is male or female fertile.

[0092] The flour produced from the grain of the present invention is also included. In one embodiment, the flour is white flour. The flour is preferably wholemeal flour, or a mixture of white flour and wholemeal flour, for example, in a ratio of 1:2 to 2:1. The invention also provides wheat bran from the grain of the invention. Each of these products comprises wheat cells with the genetic makeup of the wheat grain (i.e., the DNA of the wheat grain).

[0093] Wheat starch granules or wheat starch produced from the grain are also part of the present invention. The wheat starch granules or wheat starch will typically comprise 45%, preferably about 50%, about 55% or about 60% amylose, or between 45% and 70% amylose, each on a weight basis as a proportion of the total starch content of the starch granules or starch, the starch granules preferably comprising wheat GBSSI polypeptide. The granules of Petition 870190000436, dated 01 / 03 / 2019, p. 35 / 233 / 187 starch and / or starch will also be distinguished by one or more of: a) They do not present any detectable SSIIa polypeptide, as determined by an immunological method; b) comprise at least 2% resistant starch on a weight basis; c) starch distinguished by a reduced glycemic index (GI); d) the starch granules have a distorted shape; (e) starch granules with reduced birefringence when viewed under polarized light; f) starch distinguished by a reduced volume of swelling; g) modified chain length distribution and / or branching frequency in starch; h) starch distinguished by a reduced peak at the gelatinization temperature; i) starch distinguished by a reduced peak in viscosity; j) reduced starch paste temperature; k) molecular weight with a reduced amylose peak, as determined by size exclusion chromatography; l) reduced starch crystallinity; and m) reduced proportion of type A and / or type B starch, and / or increased proportion of type V crystalline starch; where each property is related to wild wheat starch granules or starch.

[0094] The present invention also provides a food ingredient comprising the grain, flour, preferably whole wheat flour, or wheat bran, or wheat starch granules or wheat starch of the present invention, preferably at a level of at least 10%, preferably from about 20% to about 80% on a dry weight basis. The food ingredient may be coarsely ground, broken, parboiled grain, Petition 870190000436, dated 03 / 01 / 2019, page 36 / 233 / 187 rolled, pearled, crushed or ground or any combination thereof. The food ingredient may also be incorporated into a food product, preferably at a level of at least 10% on a dry weight basis.

[0095] The present invention also provides a composition comprising wheat grain, flour, preferably wholemeal flour, or wheat bran, or wheat starch granules or wheat starch of the present invention, at a level of at least 10% by weight, or wheat grain with an amylose level of less than 45% (w / w) or flour, wholemeal flour, starch granules or starch obtained therefrom. The composition may comprise a mixture of flours.

[0096] The present invention also provides a process for producing a food comprising the steps of (i) adding a food ingredient of the present invention to another food ingredient, and (ii) mixing the food ingredients, thereby producing the food. The process may also involve processing the grain to produce the food ingredient prior to step (i), or a step of heating the mixed food ingredients of step (ii) at a temperature of at least 100°C for at least 10 minutes.

[0097] As used herein, the term “by weight” or “on a weight basis” refers to the weight of a substance as a percentage of the weight of the material or item comprising the substance. This is hereby abbreviated as “w / w”. For example, amylose content is defined as the weight of amylose as a percentage of the weight of the total starch content.

[0098] Starch synthesis in the endosperm of higher plants, including wheat, is carried out by a set of enzymes that catalyze four key steps, shown schematically in Figure 1. First, ADP-glucose pyrophosphorylase (EC 2.7.7.27) activates the starch precursor monomer via ADP-glucose synthesis from G-1-P and ATP. Second, the activated glycosyl donor, ADP-glucose, is transferred to the non-terminal Petition 870190000436, dated 01 / 03 / 2019, p. 37 / 233 / 187 reducing a pre-existing α-1,4 linkage by starch synthases (EC 2.4.1.24). Third, starch branching enzymes introduce branching points by cleaving a region of glucan linked to α-1,4, followed by the transfer of the cleaved chain to an acceptor chain, forming a new α-1,6 linkage. Starch branching enzymes are the only enzymes that can introduce α-1,6 linkages into α-polyglycans and therefore play an essential role in amylopectin formation. Fourth, starch debranching enzymes (EC 2.4.4.18) remove some of the branching linkages.

[0099] In the cereal endosperm, two isoforms of ADP-glucose pyrophosphorylase (ADGP) are present, one form in the amyloplast, and one form in the cytoplasm. Each form is composed of two types of subunits. The shrunken (sh2) and brittle (bt2) mutants in maize represent lesions in large and small subunits, respectively.

[00100] As used herein, the term “starch synthase” (SS) refers to an enzyme that transfers a glycosyl residue from the activated glycosyl donor, ADP-glucose, to the non-reducing end of a pre-existing glucan chain via an α-1,4 linkage (EC 2.4.1.24). SS enzyme activity can be assayed in the manner described by Guan and Keeling (1998). At least five classes of starch synthase are found in the cereal endosperm, including in hexaploid wheat T. aestivum, namely, an isoform located exclusively in or bound to the starch granule, granule-bound starch synthase (GBSS), two forms that are split between the granule and the soluble fraction (SSI and SSII), a form that is entirely located in the soluble fraction (SSIII), and more recently a fifth form, SSIV (Figure 1). Each of these is included in the term “starch synthase”.They are active during endosperm development, during the growth of the wheat plant, when stored starch is being synthesized and deposited, but may be present in an inactive state in the... Petition 870190000436, dated 03 / 01 / 2019, page 38 / 233 / 187 mature wheat grain (latent). GBSS has been shown to be essential for amylose synthesis. Each of SSI-IV is primarily involved in amylopectin synthesis, based on biochemical and genetic evidence. For example, mutations in the SSII and SSIII genes have been shown to alter the structure of amylopectin (Schondelmaier et al., 1992; Yamamori et al., 2000). Starch synthases are classified according to their amino acid sequence, as they belong to one of five groups based on the extent of homology to known elements of these classes.

[00101] In cereals, at least two SSII subclasses have been identified, SSIIa and SSIIb, although a third subclass SSIIc has been identified in rice (Ohdan et al., 2005), and genes that appear to encode an enzyme corresponding to SSIIc in wheat are identified in the manner described in example 2. Starch synthase IIa (SSIIa) primarily catalyzes the polymerization of intermediate-length glucan chains (DP 1224) of amylopectin in the endosperm of cereals, transferring a glycosyl moiety from ADP-glucose to the non-reducing end of pre-existing α-1,4-linked glucan chains (Fontaine et al., 1993). SSIIa thus elongates short chains (DP<10) of amylopectin. In a wheat ssIIa mutant, DP 6-11 glucan chains were increased in frequency and DP 11-25 chains were decreased in frequency (Yamamori et al, 2000).The different classes of SSII enzymes are distinguished by their homology with the amino acid sequences of type elements of each class, that is, by phylogenetic analysis. Different SSII enzymes and in some cases different SSIIa isoenzymes of wheat can be distinguished by the number of amino acids in the polypeptides, as described below.

[00102] The expression level of genes encoding SSII, or specifically SSIIa, can be assessed by evaluating transcription levels, such as by Northern blot hybridization analysis or RT-PCR analysis. In a preferred method, the amount of SSIIa protein in Petition 870190000436, dated 03 / 01 / 2019, page 39 / 233 / 187 Developing grain or endosperm protein is measured by separating the proteins in grain / endosperm extracts in gels by electrophoresis, then transferring the proteins to a membrane by Western blotting, followed by quantitative detection of the protein on the membrane using specific antibodies (“Western blot analysis”). Exemplary methods for gel electrophoresis and immunoblotting are described in Example 1.

[00103] Starch synthase I (SSI) appears to exist as a single isoform in cereals. In rice, SSI accounts for about 70% of the total soluble SS activity in the endosperm (Fujita et al., 2006). SSI preferentially synthesizes short DP6-15 glucan chains, preferring shorter amylopectin chains as substrates. Despite its important role, the complete absence of SSI enzyme in the rice endosperm does not affect seed size and shape or starch granules, suggesting that other SS enzymes are able to compensate for the missing SSI function.

[00104] Conversely, SSIII produces the relatively longer amylopectin chains, particularly those with a DP>30, and extends intermediate-length glucan chains. SSIII mutants exhibit an increase in intermediate-length amylopectin chains. There are two forms, SSIIIa being the main form expressed in endosperm, and SSIIIb being a minor form. Little is known about the contribution of SSIV isoforms to glucan chain length in cereal grain, but it appears to function primarily in leaves (Leterrier et al., 2008). Two SSIV genes, SSIVa and SSIVb, are expressed in rice, throughout the plant, and at relatively constant levels during grain filling, thus they appear to have a plant-wide function. SSIV mutants in Arabidopsis decreased starch levels in the leaf.

[00105] Each of the amido synthases is expressed as polypeptides with N-terminal signal peptides that are cleaved during translocation in amyloplasts. Petition 870190000436, dated 01 / 03 / 2019, p. 40 / 233 / 187

[00106] As used herein, “starch branching enzyme” (SBE) means an enzyme that introduces α-1,6 glycosidic linkages between chains of glucose residues (EC 2.4.1.18), thereby introducing α-1,6 branching points into amylopectin. Two main classes of SBEs are known in plants, SBEI and SBEII. SBEII can be further categorized into two types in cereals, SBEIIa and SBEIIb (Hedman and Boyer, 1982; Boyer and Preiss, 1978; Mizuno et al., 1992, Sun et al., 1997). Additional forms of SBEs are also reported in some cereals, a probable 149 kDa SBEI from wheat, and a 50 / 51 kDa SBE from barley. Sequence alignment revealed a high degree of sequence similarity at both the nucleotide and amino acid levels, allowing for grouping into the SBEI, SBEIIa, and SBEIIb classes. The amino acid sequences of SBEIIa and SBEIIb generally exhibit around 80% identity with each other, concentrated mainly in the central regions of the polypeptides.

[00107] SBEI, SBEIIa, and SBEIIb can also be distinguished by their expression patterns, but this differs in different species. In wheat endosperm, SBEI (Morell et al., 1997) is found exclusively in the soluble fraction, while SBEIIa and SBEIIb are found in both soluble fractions and those associated with the starch granule (Rahman et al., 1995). In maize, SBEIIb is the predominant form in the endosperm, while SBEIIa is expressed relatively more strongly in the leaf and appears to be expressed throughout the plant (Gao et al., 1997). In rice, SBEIIa and SBEIIb are found in the endosperm in approximately equal amounts. However, there are also differences in the periodicity of gene expression.SBEIIa is expressed at an earlier stage of seed development, being detected 3 days after flowering and was expressed in leaves, while SBEIIb was not detected 3 days after flowering and was more abundant in developing seeds 7-10 days after flowering, and not. Petition 870190000436, dated 03 / 01 / 2019, page 41 / 233 / 187, was expressed in leaves. In wheat endosperm, SBEIIa is expressed approximately 3-4 times higher than SBEIIb. Different cereal species show significant differences in the expression of SBEIIa and SBEIIb, and conclusions drawn from one species cannot be readily applied to another species. Specific antibodies can also be used to distinguish the enzymes.

[00108] Genomic and cDNA sequences for each of the SBE genes were distinguished, including those from wheat. Sequence alignment reveals a high degree of sequence similarity at both the nucleotide and amino acid levels, but also sequence differences, and allows grouping into the SBEI, SBEIIa, and SBEIIb classes. In wheat, apparent gene duplication events have increased the number of SBEI genes in each genome (Rahman et al., 1999). Elimination of more than 97% of SBEI activity in wheat endosperm by combining mutations in the most expressive forms of SBEI genes, from genomes A, B, and D, showed no measurable impact on starch structure or functionality (Regina et al., 2004).Conversely, reducing SBEIIa expression through a gene silencing construct in hexaploid wheat resulted in elevated amylose levels (>70%), while a corresponding construct that reduced SBEIIb expression but not SBEIIa had a minimal effect (Regina et al., 2006). In barley, a gene silencing construct that reduced both SBEIIa and SBEIIb expression in the endosperm was used to generate barley grain with high amylose content (Regina et al., 2010). In maize, SBEIIb mutants known as amylose extender (ae) produced phenotypes with high amylose content.

[00109] The enzyme activity assays of branching enzymes to detect the activity of all three isoforms, SBEI, SBEIIa, and SBEIIb, are based on the method of Nishi et al., 2001 with minor modification, as follows. After electrophoresis, the gel is washed twice in HEPES 50 Petition 870190000436, dated 03 / 01 / 2019, page 42 / 233 / 187 mM, pH 7.0, containing 10% glycerol and incubated at room temperature, in a reaction mixture consisting of HEPES 50 mM, pH 7.4, glucose-1-phosphate 50 mM, AMP 2.5 mM, 10% glycerol, phosphorylase at 50 U, DTT 1 mM and 0.08% maltotriose for 16 hours. The bands are visualized with a solution of 0.2% (w / v) I2 and 2% KI. The specific activities of the SBEI, SBEIIa and SBEIIb isoforms are separated under these electrophoresis conditions. This is confirmed by immunoblotting using anti-SBEI, anti-SBEIIa and anti-SBEIIb antibodies. Densitometric analysis of immunoblots, which assesses the intensity of each band, is conducted to determine the level of enzymatic activity of each isoform.

[00110] Starch branching enzyme (SBE) activity can be evaluated by enzymatic assay, for example, by the phosphorylase stimulation assay (Boyer and Preiss, 1978). This assay evaluates the SBE stimulation of glucose 1-phosphate incorporation into methanol-insoluble polymer (α-D-glucan) by phosphorylase A. SBE isoforms show different substrate specificities, for example, SBEI exhibits higher activity on branched amylose, while SBEIIa and SBEIIb show higher branching rates with an amylopectin substrate. SBEI preferentially produces longer chains with DP>16 branching less branched polyglycans, whereas SBEII isoenzymes generate shorter chains with DP<12. The isoforms can also be distinguished on the basis of the length of the glucan chain that is transferred.

[00111] Two classes of debranching enzymes (DBEs) are known in cereals, especially isoamylase (ISA) and pullulanase (PUL). ISA primarily debranches phytoglycogen and amylopectin, while PUL acts on pullulan and amylopectin, but not on phytoglycogen (Nakamura et al., 1996). Mutants for ISA have been termed sugary and produce shorter amylopectin chains, and therefore ISA appears to act in the assembly of excessively branched chains or improper branching in Petition 870190000436, dated 03 / 01 / 2019, page 43 / 233 / 187 amylopectin. Conversely, it is believed that PUL functions in starch degradation during grain germination, as well as in starch synthesis.

[00112] The development of hexaploid wheat endosperm expresses SSIIa from the SSIIa genes in each of the A, B, and D genomes. As used herein, “SSIIa expressed from genome A” or “SSIIa-A” means a polypeptide whose amino acid sequence is presented in SEQ ID NO:1, or that is at least 99% identical to the amino acid sequence presented in SEQ ID NO:1 or comprising a sequence like this. The amino acid sequence provided as SEQ ID NO:1 (Li et al., 1999; Genbank accession number AAD53263) is used herein as the reference sequence for a wild-type SSIIa-A polypeptide. The polypeptide of SEQ ID NO:1 has 799 amino acid residues in length, as do the amino acid substitution mutants of SEQ ID NO:1. Enzymatically active variations of this enzyme exist in wheat, for example, in the cultivar Fielder, see accession number CAB96626. 1 (Gao and Chibbar, 2000), whose amino acid sequence is 99.5% (795 / 799) identical to SEQ ID NO.1, and in diploid parents of Triticum aestivum, such as Triticum urartu, provided as accession numbers CUS28065.1 and CDI68213.1. These variations are included in “SSIIa-A”. SSIIa-A does not include the homologous polypeptides, SSIIa-B and SSIIa-D, because these polypeptides are approximately 96% identical to SEQ ID NO:1.

[00113] As used herein, “SSIIa expressed from genome B” or “SSIIa-B” means a polypeptide whose amino acid sequence is presented in SEQ ID NO:2, or which is at least 99% identical to the amino acid sequence presented in SEQ ID NO:2 or comprising a sequence like this. The amino acid sequence provided as SEQ ID NO:2 (GenBank accession number CAB99627.1) corresponds to amide synthase IIa, expressed from genome B of the Fielder wheat variety, which is used herein as the reference sequence for a type B polypeptide. Petition 870190000436, dated 01 / 03 / 2019, p. 44 / 233 / 187 wild SSIIa-B. The polypeptide of SEQ ID NO:2 has 798 amino acids in length, as do amino acid substitution mutants of SEQ ID NO:2. Enzymatically active variations of this enzyme exist in wheat; these variations are included in “SSIIa-B”. SSIIa-B does not include the homologous polypeptides, SSIIa-A and SSIIa-D, as a result of these polypeptides being approximately 96% identical to SEQ ID NO:2 (Li et al., 1999).

[00114] As used herein, “SSIIa expressed from genome D” or “SSIIa-D” means a polypeptide whose amino acid sequence is presented in SEQ ID NO:3, or that is at least 99% identical to the amino acid sequence presented in SEQ ID NO:3, or comprising a sequence like this. The amino acid sequence of SEQ ID NO:3 (GenBank accession number BAE48800; Shimbata et al.The SSIIa (2005) corresponds to SSIIa expressed from the D genome in the wheat cultivar Chinese Spring, which is used here as the reference sequence for wild-type SSIIa-D. The protein with SEQ ID NO:3 is 799 amino acids long. Enzymatically active variations of this enzyme exist in wheat, for example, in the cultivar Fielder, see accession number CAB86618 (Gao and Chibbar, 2000), whose amino acid sequence is 99.9% (798 / 799) identical to SEQ ID NO. 3, and in diploid Triticum aestivum parents such as Aegilops tauschii, a likely progenitor of the hexaploid wheat D genome, provided as accession number CAB86618. Such variations are included in “SSIIa-D”. SSIIa-D does not include the homologous polypeptides, SSIIa-A and SSIIa-B, because these polypeptides are approximately 96% identical to SEQ ID NO:3. The amino acid sequence provided as SEQ ID NO:3 is 95.9% identical to each of SEQ ID NO:1 and SEQ ID NO:2.The alignment of the three amino acid sequences shows amino acid differences that can be used to distinguish proteins or to classify variations such as SSIIaA, SSIIa-B, or SSIIa-D.

[00115] During the comparison of amino acid sequences for Petition 870190000436, dated 03 / 01 / 2019, page 45 / 233 / 187 to determine percent identity in this context, for example, by Blastp, full-length sequences can be compared, and intervals in a sequence are counted as amino acid differences.

[00116] As used herein, an “SSIIa polypeptide” means an SSIIa-A polypeptide, an SSIIa-B polypeptide, or an SSIIa-D polypeptide.

[00117] As used herein, each of the SSIIa-A, SSIIa-B, and SSIIa-D polypeptides includes polypeptide variations that have reduced or absent amide synthase enzyme activity, as well as polypeptides with wild-type or essentially wild-type enzymatic activity. Comparison of the amino acid sequence of a mutant form of an SSIIa polypeptide with SEQ ID NOs:1, 2, and 3 is used to determine from which of the SSIIa-A, B, or D polypeptides it is derived and thus classify the mutant form. For example, a mutant SSIIa polypeptide is considered a mutant SSIIa-A polypeptide if its amino acid sequence is more closely related, i.e., with a higher degree of sequence identity, to SEQ ID NO:1 than to SEQ ID NOs:2 and 3.Similarly, a mutant SSIIa polypeptide is a mutant SSIIaB polypeptide if it is more closely related to SEQ ID NO:2 than to SEQ ID NOs:1 or 3, and a mutant SSIIa polypeptide is a mutant SSIIa-D polypeptide if it is more closely related to SEQ ID NO:3 than to SEQ ID NOs:1 and 2. Those skilled in the art are thereby able to classify a mutant SSIIa polypeptide.

[00118] A mutant SSIIa polypeptide may exhibit reduced starch synthase enzyme activity (a partial mutant) or an absence of starch synthase activity (a null mutant polypeptide). A mutant SSIIa gene may be expressed to produce an SSIIa polypeptide in wheat endosperm, for example, a truncated polypeptide, or it may not be expressed and produce no polypeptide at all. It may also be expressed to produce a transcript, but no translation product. Petition 870190000436, dated 03 / 01 / 2019, page 46 / 233 / 187

[00119] It is also understood that SSIIa proteins may be present in the grain, particularly mature grain as commonly harvested commercially, but in an inactive or latent state due to the physiological conditions in the grain. Such polypeptides are included in “SSIIa polypeptides” as used herein. SSIIa polypeptides may be enzymatically active during only part of grain development, particularly in the developing endosperm when starch storage is typically deposited, but in an otherwise inactive state. Such SSIIa polypeptides can be easily detected and quantified using immunological methods, such as Western blot analysis.

[00120] Thus, “wild type” as used herein, when referring to an SSIIa-A polypeptide, means a polypeptide whose amino acid sequence is presented in SEQ ID NO: 1, or enzymatically active variations that are at least 99% identical in amino acid sequence, which are found in nature and which have essentially the same activity as SEQ ID NO: 1; “wild type”, as used herein when referring to SSIIa-B, means a polypeptide whose amino acid sequence is presented in SEQ ID NO: 2, or enzymatically active variations that are at least 99% identical in amino acid sequence, which are found in nature and which have essentially the same activity as the polypeptide whose sequence is provided as SEQ ID NO: 2;“Wild type,” as used herein when referring to SSIIa-D, means a polypeptide whose amino acid sequence is presented in SEQ ID NO: 3, or enzymatically active variations at least 99% identical in amino acid sequence, which are found in nature and which exhibit essentially the same activity as the polypeptide whose sequence is provided as SEQ ID NO: 3. In each case, the wild type polypeptide exhibits amide synthase II activity and has not been modified by the present invention. Petition 870190000436, dated 01 / 03 / 2019, p. 47 / 233 / 187

[00121] Wild wheat produces two other classes of SSII polypeptides, especially SSIIb and SSIIc polypeptides. As used herein, “SSIIb expressed from genome A” or “SSIIb-A” means a polypeptide whose amino acid sequence is presented in SEQ ID NO:10 or that is at least 99% identical to the amino acid sequence presented in SEQ ID NO:10, or comprising a sequence like this. The amino acid sequence provided as SEQ ID NO:10 (derived from the nucleotide sequence of Genbank accession number AK332724) is used herein as the reference sequence for a wild-type SSIIb-A polypeptide. The polypeptide of SEQ ID NO:10 has 676 amino acid residues in length. Enzymatically active variations of this enzyme are included in “SSIIb-A”. SSIIb-A does not include the homologous polypeptide SSIIb-D, which is approximately 90% identical to SEQ ID NO:8.

[00122] As used herein, “SSIIb expressed from genome D” or “SSIIb-D” means a polypeptide whose amino acid sequence is presented in SEQ ID NO:11 or that is at least 99% identical to the amino acid sequence presented in SEQ ID NO:11, or comprising a sequence such as this. The amino acid sequence provided as SEQ ID NO:11 (GenBank accession number ABY56824) corresponds to the starch synthase IIb expressed from the D genome of bread wheat, which is used herein as the reference sequence for a wild-type SSIIb-D polypeptide. The polypeptide in SEQ ID NO:11 is 674 amino acids long. Enzymatically active variations of this enzyme are included in “SSIIb-D”. SSIIb-D does not include the homologous polypeptide SSIIb-A, which is approximately 90% identical to SEQ ID NO:11.

[00123] The amino acid sequences of the SSIIa homolog and the SSIIb homolog are 71-79% identical and therefore the polypeptides can be easily distinguished even when they exhibit similar enzyme activities. Petition 870190000436, dated 01 / 03 / 2019, p. 48 / 233 / 187

[00124] In the manner described in example 2 here, wheat SSIIc sequences have also been identified and can be easily distinguished from SSIIa sequences.

[00125] As used herein, the terms “SSIIa gene,” “wheat SSIIa gene,” and the like refer to genes encoding an SSIIa polypeptide, including wild-type SSIIa polypeptides, such as homologous polypeptides present in other wheat varieties, as well as mutant forms of the genes that may encode SSIIa polypeptides with either reduced activity or undetectable activity, or genes derived from these by mutation. SSIIa genes include, but are not limited to, cloned wheat SSIIa genes, including the genomic and cDNA sequences listed in Table 1, which are annotated as SSIIa genes. The term SSIIa gene collectively includes each of the more specific terms “SSIIa-A gene,” “SSIIa-B gene,” and “SSIIa-D gene,” which encode an SSIIa-A, SSIIa-B, and SSIIa-D polypeptide, respectively, or mutant forms derived from such genes.SSIIa genes, as used here, include mutant forms that do not encode any polypeptide at all, or polypeptides that exhibit no amide synthase activity, in which cases the mutant forms represent null alleles of the genes. Alleles of the genes include mutant alleles, where at least part of the gene is deleted, including where the entire gene is deleted, whose alleles also represent null alleles of the genes.

[00126] An “endogenous SSIIa gene” refers to an SSIIa gene that is in its natural location in the wheat genome, including wild-type and mutant forms. As understood in the art, hexaploid wheats, such as bread wheat, comprise three genomes that are commonly referred to as genomes A, B, and D, while tetraploid wheats, such as durum wheat, comprise two genomes commonly referred to as genomes A and B. Each genome comprises 7 pairs of chromosomes that can be Petition 870190000436, dated 01 / 03 / 2019, p. 49 / 233 / 187 observed by cytological methods during meiosis and thus identified, as is well known in the art. The endogenous SSIIa-A, SSIIa-B, and SSIIa-D genes are located on the short arm of chromosomes 7A, 7B, and 7D, respectively, in hexaploid wheat. Conversely, the terms “isolated SSIIa gene” and “exogenous SSIIa gene” refer to an SSIIa gene that is not in its natural location, for example, one that has been removed from a wheat plant, cloned, synthesized, included in a vector, or in the form of a transgene in a cell, such as a transgene in a transgenic wheat plant. The SSIIa gene in this context can be any of the specific forms described as follows. Table 1. Starch synthase enzyme genes distinguished from cereals. Species Isoform a SS Clone type Accession number Reference Wheat SSI cDNA and genomic AF091803 (cDNA) AF091802 (genomic) Li et al., 1999 Li et al., 1999 SSIIa-A cDNA and genomic AF155217 (cDNA) AB201445 (genomic) Li et al., 1999 Shimbata et al., 2005 SSIIa-B cDNA and genomic AJ269504 (cDNA) AB201446 (genomic) Gao and Chibbar, 2000 Shimbata et al., 2005 SSIIa-D cDNA and genomic AJ269502 (cDNA) AB201447 (genomic) Gao and Chibbar, 2000 Shimbata et al., 2005 SSIIb-A cDNA and genomic AK332724 (cDNA) Traes_6AL_AE01DC0EA, 6A:187503905 bp to 187505233 bp (genomic) Kawaura et al., 2009 The IWGSC SSIIb-B cDNA and genomic database Traes_6BL_61D83E262, 6B:162116364 - 162116691 bp (genomic) The IWGSC SSIIb-D cDNA and genomic database EU333947 (cDNA) Traes_6DL_19F1042C7, 6D: 147050072 - 147051031 bp (genomic) NCBI The IWGSC SSIIc-A cDNA and genomic database Traes_1AL_729BF3204, 1A: 68687585 - 68688377, The IWGSC SSIIc-B cDNA and genomic database Traes_1BL_447468BDE, 1B: 31475067-314776087 bp IWGSC SSIIc-D cDNA and genomic database EU307274 (cDNA) Traes_1DL_F667ED844, IWGSC_CSS_1DL_scaff_22 05619:1950-3041 bp NCBI IWGSC SSIIIa cDNA database AF258608 (cDNA) AF258609 (genomic) Li et al., 2000 Li et al., 2000 SSIIIb cDNA and genomic database EU333946 (cDNA) NCBI SSIVa cDNA AY044844 (cDNA) DQ400416 (genomic) NCBI Leterrier et al., 2008 Rice SSIIa cDNA AF419099 (cDNA) NCBI SSIIb DNAc AF395537 (DNAc) NCBI. Petition 870190000436, dated 03 / 01 / 2019, page 50 / 233 / 187 SSIIc DNAc AF383878 (DNAc) NCBI Cevada SSIIa DNAc AY133249 (DNAc) Li et al., 2003 SSIIb DNAc AK372518 (DNAc) Matsumoto et al., 2011 SSIIc DNAc AK372414 (DNAc) Matsumoto et al., 2011 Milho SSIIa DNAc AF019296 (DNAc) Harn et al., 1998 SSIIb DNAc NM_001112544 (DNAc) Schnable et al., 2009 SSIIc DNAc EU284113 (DNAc) Yan et al., 2008 Arabidopsis SSII DNAc NM_110984 (DNAc) Salanoubat et al. 2000

[00127] As used herein, “an SSIIa gene in the wheat A genome” or “SSIIa-A gene” means any polynucleotide encoding an SSIIa-A polypeptide, as defined herein, or derived from a polynucleotide encoding SBEIIa-A in a wheat plant, including naturally occurring polynucleotides, sequence variations, or synthetic polynucleotides, including “wild-type SSIIa-A gene(s)” encoding an SSIIa-A polypeptide with essentially wild-type SSIIa activity, and “mutant SSIIa-A gene(s)” that do not encode an SSIIa-A polypeptide with essentially wild-type activity but are recognizably derived from a wild-type SSIIa-A gene. Comparison of the nucleotide sequence of a mutant form of an SSIIa gene with a set of wild-type SSIIa genes is used to determine which of the SSIIa genes are derived from these and thus to classify them.For example, a mutant SSIIa gene is considered a mutant SSIIa-A gene if its nucleotide sequence is more specifically related, that is, with a higher degree of sequence identity, to a wild-type SSIIa-A gene than to any other SSIIa gene. A mutant SSIIa-A gene encodes an SSIIa polypeptide with reduced starch synthase enzyme activity (partial mutant), or a polypeptide that does not exhibit starch synthase activity or any protein at all (null mutant gene). An exemplary nucleotide sequence of cDNA corresponding to an SSIIa-A gene is provided in SEQ ID NO:4 (GenBank accession number AF155217; Li et al., 1999). Other exemplary nucleotide sequences are provided in accession numbers AK330838 (cDNA of the SSIIa-A gene from the Chinese Spring cultivar, Kawaura et al., 2009), and... Petition 870190000436, dated 01 / 03 / 2019, p. 51 / 233 / 187 accession number AJ269503, which provides a cDNA of an SSIIa-A gene from the Fielder cultivar (Gao and Chibbar, 2000).

[00128] As used herein, the terms “SSIIa gene in genome B” or “SSIIa-B gene”, and “SSIIa gene in genome D” or “SSIIa-D gene” have meanings corresponding to those for SSIIa-A in the preceding paragraph. An exemplary nucleotide sequence of cDNA corresponding to an SSIIa-B gene is provided in SEQ ID NO:5 (GenBank accession number AJ269504; Gao and Chibbar 2000), and that of an SSIIa-D gene is provided in SEQ ID NO:6 (GenBank accession number AJ269502; from cultivar Fielder, Gao and Chibbar, 2000). Sequences of parts of SSIIa genes are also provided herein as described in Figures 2-4.

[00129] As used herein, “an SSIIb gene in the wheat A genome” or “SSIIb-A gene” means any polynucleotide encoding an SSIIb-A polypeptide, as defined herein, or derived from a polynucleotide encoding SSIIb-A in a wheat plant, including naturally occurring polynucleotides, sequence variations, or synthetic polynucleotides, including “wild-type SSIIb-A gene(s)” that encode an SSIIb-A polypeptide with essentially wild-type SSIIb activity, and “mutant SSIIb-A gene(s)” that do not encode an SSIIb-A polypeptide with essentially wild-type activity but are recognizably derived from a wild-type SSIIb-A gene. Comparison of the nucleotide sequence of a mutant form of an SSIIb gene with a set of wild-type SSIIb genes is used to determine which of the SSIIb genes is derived from it and thus classify it.For example, a mutant SSIIb gene is considered a mutant SSIIbA gene if its nucleotide sequence is more specifically related, that is, with a higher degree of sequence identity, to a wild-type SSIIb-A gene than to any other SSIIb gene. A mutant SSIIb-A gene encodes an SSIIb polypeptide with amide synthase enzyme activity. Petition 870190000436, dated 01 / 03 / 2019, p. 52 / 233 / 187 reduced (partial mutant), or a polypeptide that does not exhibit amide synthase activity or any protein whatsoever (null mutant gene). An exemplary nucleotide sequence of cDNA corresponding to an SSIIb-A gene is provided in SEQ ID NO:12 (GenBank accession number AK332724).

[00130] As used herein, the terms “SSIIa gene in genome B” or “SSIIa-B gene”, and “SSIIa gene in genome D” or “SSIIa-D gene” have meanings corresponding to those of SSIIa-A in the preceding paragraph. An exemplary nucleotide sequence of cDNA corresponding to an SSIIa-B gene is provided in SEQ ID NO:5 (GenBank accession number AJ269504; Gao and Chibbar 2000), and that of an SSIIa-D gene is provided in SEQ ID NO:6 (GenBank accession number AJ269502; from cultivar Fielder, Gao and Chibbar, 2000).

[00131] SSIIa genes as defined above include any of the regulatory sequences that are 5' or 3' from the transcript region, including the promoter region, which regulates the expression of the associated transcript region, and introns in the transcript regions. An exemplary nucleotide sequence of an SSIIa gene is provided as SEQ ID NO:7, which provides the nucleotide sequence of an SSIIa-A gene from the wheat A genome; accession number AB201445. Similarly, the nucleotide sequence of a wild-type SSIIa-B wheat gene is provided as accession number AB201446 (IWGSC: Chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp strand sense), and that of a wheat SSIIa-D gene is provided as accession number AB201447 (IWGSC: Chromosome 7DS, Traes_7DS_E6C8AF743, 3877787: 1 to 396 bp, 5137 to 5419 bp strand sense). Each of these wild-type genes was from the wheat cultivar Chinese Spring (Shimbata et al., 2005).

[00132] It should be understood that there is natural variation in the SSIIa gene sequences of different wheat varieties. Homologous genes are Petition 870190000436, dated 01 / 03 / 2019, p. 53 / 233 / 187, easily recognizable by those skilled in the art, based on sequence identity. The degree of sequence identity between the nucleotide sequences of wild-type homologous SSIIa genes and the amino acid sequences of wild-type polypeptides is 95-96%.

[00133] An allele is a variation of a gene at a single genetic locus. A diploid organism has two sets of chromosomes. Hexaploid wheat has six sets of chromosomes, 7 chromosomes in each set, and is believed to originate from the hybridization of three diploid parent plants that contribute genomes A, B, and D. Each chromosome in a chromosome pair has one copy (i.e., one allele) of each gene. If both alleles of a gene are the same, the organism is homozygous for that allele or gene. If the two alleles of a gene are different, the organism is heterozygous for that gene. The interaction between alleles at a locus is generally described as dominant or recessive.The two alleles of a gene in a wheat or grain plant may carry the same mutation as each other, thus being considered homozygous for this mutation, or the two alleles may comprise different mutations for each and are considered heterozygous for these mutations. Different alleles of a gene, or for multiple genes, can be combined using methods known in the art. For example, two parental wheat plants that carry different alleles for a gene can be crossed to produce offspring (F1) that contain both alleles in the heterozygous state, and the offspring plants are then self-fertilized to produce an additional generation of plants (F2), which comprise one or the other of the alleles in the homozygous state or both alleles in the heterozygous state, according to Mendelian genetics.

[00134] Alleles that do not code for or are not capable of leading to the production of any active enzyme are null alleles. Such null alleles may or may not code for a polypeptide, for example, that codes for a polypeptide Petition 870190000436, dated 03 / 01 / 2019, page 54 / 233 / 187 truncated or a polypeptide with an inactivating alteration in the amino acid sequence relative to a wild-type SSIIa polypeptide.

[00135] Reference to null mutation(s) includes a null mutation independently selected from the group consisting of a deletion mutation, an insertion mutation, a junction mutation, a translation termination mutation, and a reading frame mutation, or any combination thereof. In one embodiment, one or more of the null mutations are non-conservative amino acid substitution mutations or a null mutation exhibits a combination of two or more non-conservative amino acid substitutions. In this context, non-conservative amino acid substitutions are as defined herein.

[00136] A loss-of-function mutation, which includes a partial loss-of-function mutation in an allele of a gene as well as a complete loss-of-function mutation (null mutation), means a mutation in the allele that leads to a reduced level or activity of the enzyme, such as an SSIIa enzyme in grain. The mutation in the allele may mean, for example, that less protein with wild-type or reduced activity is translated, or that wild-type or reduced levels of transcription are followed by translation of an enzyme with reduced enzymatic activity, or preferably the mutant allele is either transcribed at a reduced rate compared to the wild type or any translation product exhibits less activity than the corresponding wild-type polypeptide.The mutation may result, for example, in no or less RNA being transcribed from the gene comprising the mutation, or that the polypeptide that is produced has no or reduced activity compared to the wild type, preferably both. If no transcript is detected from an allele, for example, by RT-PCR assay, this result indicates that the allele is a null allele.

[00137] A “point mutation” refers to a single change in Petition 870190000436, dated 03 / 01 / 2019, page 55 / 233 / 187 nucleotide base that includes a deletion, substitution, or insertion of a single nucleotide. A point mutation may additionally be a junction mutation, a translation termination mutation, a reading frame mutation, or another loss-of-function mutation, where the mutation results in no protein being produced, or the protein is produced in smaller quantities, or the protein produced exhibits reduced SSII activity. A reading frame mutation in a protein-coding region of a gene is considered a null mutation due to its effect on the structure of the encoded polypeptide. Similarly, a translation termination mutation is considered a null mutation unless it occurs very close to the C-terminus of the protein-coding region of the gene, in which case an enzyme assay can be used to determine if the polypeptide exhibits enzymatic activity.In some forms, the point mutation results in a conservative amino acid substitution or, preferably, a non-conservative one.

[00138] A “reduced” or “lower” amount or level of polypeptide or enzymatic activity means a reduced or lower amount or level relative to the amount or level produced by the corresponding wild-type allele or gene. Typically, the reduction is at least 40%, preferably at least 50% or at least 60%, more preferably at least 80% or 90% relative to the wild type. In a more preferred embodiment, the protein is not detected, for example, in a Western blot assay in the manner described herein, preferably for each of SSIIa-A, SSIIa-B and SSIIa-D.

[00139] “Reduced” activity means reduced relative to the corresponding wild-type enzyme, such as an SSIIa, SSSIIa or other enzyme.

[00140] “Activity” of protein refers to SS activity which can be assessed directly or indirectly by various means known in the art. Petition 870190000436, dated 03 / 01 / 2019, page 56 / 233 / 187 and in the manner described herein.

[00141] In some embodiments, the weight quantity of an SSIIa or other polypeptide is reduced even though the number of polypeptide molecules in the grain is the same as in the wild type, but each molecule has less activity than the wild type. For example, the polypeptides produced are shorter than the wild-type SSIIa protein or other protein, as occurs if the mutant SSIIa protein or other protein is truncated due to a premature translation termination signal.

[00142] As used here, “two identical alleles of an SSIIa-A gene” means that the two alleles of the SSIIa-A gene are identical to each other, that is, the plant or grain is homozygous for these alleles or this gene; “two identical alleles of an SSIIa-B gene” means that the two alleles of the SSIIa-B gene are identical to each other; “two identical alleles of an SSIIa-D gene” means that the two alleles of the SSIIa-D gene are identical to each other.

[00143] The wheat plants of the invention can be produced and identified after mutagenesis. In some embodiments, the wheat plant is non-transgenic, which is desirable in some markers, or is free of any exogenous nucleic acid molecule that reduces the expression of an SSIIa gene. In another embodiment, the wheat plant is transgenic, for example, comprising an exogenous nucleic acid molecule other than one that reduces the expression of an SSIIa gene and / or an SBEIIa gene, such as, for example, an exogenous nucleic acid molecule encoding a polypeptide that confers herbicide tolerance to the plant.

[00144] Mutant wheat plants with a mutation in a single SSIIa gene, which can be combined by crossing plants and selecting progeny with other SSIIa gene mutations to generate the wheat plants of the invention, can be either synthetic, for example, by performing local-directed mutagenesis in the nucleic acid, or induced by mutagenic treatment, Petition 870190000436, dated 03 / 01 / 2019, page 57 / 233 / 187, which may be of natural occurrence, that is, isolated from a natural source. In some embodiments, a parent plant cell, tissue, seed or plant may be subjected to mutagenesis to produce single or multiple mutations, such as nucleotide substitutions, deletions, insertions and / or codon modifications. Preferred wheat and grain plants of the invention comprise at least one introduced SSIIa gene mutation, more preferably two or more introduced SSIIa gene mutations, and may comprise none of the mutations from a natural source, that is, all SSIIa mutant alleles in the plant were obtained by synthetic means or by mutagenic treatment.In the sense used here, an "induced mutation" or "introduced mutation" is an artificially induced genetic variation that can be the result of chemical, radiation, or biological mutagenesis, for example, transposon or T-DNA insertion, or an endonuclease-induced mutation.

[00145] Mutagenesis can be achieved by chemical or radiation means, for example, seed treatment with EMS or sodium azide (Zwar and Chandler, 1995), or gamma irradiation, which are well known in the art. Chemical mutagenesis tends to favor nucleotide substitutions rather than deletions. Heavy ion beam irradiation (HIB) is known as an efficient technique for creating mutations, to produce new plant cultivars, see, for example, Hayashi et al., 2007 and Kazama et al., 2008. Ion beam irradiation presents two physical factors, dose (gy) and LET (linear energy transfer, keV / um) for biological effects that determine the amount of DNA damage and the size of DNA deletion, and these can be adjusted according to the desired extent of mutagenesis. HIB generates a collection of mutants, many of which comprise deletions that can be subjected to mutation screening in specific SSIIa genes.Mutants that are identified can be backcrossed with non-mutated wheat plants as recurrent parents, a. Petition 870190000436, dated 01 / 03 / 2019, p. 58 / 233 / 187 in order to remove and therefore reduce the effect of unlinked mutations in the mutagenized genome.

[00146] Isolation of mutants can be achieved by screening mutagenized plants or seeds. For example, a mutagenized wheat population can be subjected to direct screening for the SSIIa genotype or indirect screening for a phenotype resulting from mutations in the SSIIa genes. Direct genotype screening preferably includes assays looking for the presence of mutations in the SSIIa genes, which can be observed in PCR assays by the absence of specific SSIIa markers, as expected when some of the genes are deleted, or heteroduplex-based assays such as in tiling. Screening is preferably based on nucleotide sequencing, which is often based on clustering of candidate mutants. Phenotype screening may involve screening for a loss or reduction in the amount of one or more SSIIa polypeptides by ELISA or affinity chromatography, or altered starch phenotypes in grain starch.In hexaploid wheat, screening is preferably performed on a genotype that does not yet exhibit one or two of the SSIIa activities, for example, on a wheat plant that is already mutant in the SSIIa genes of two of the three genomes, so that a mutant that does not yet exhibit the functional activity is obtained. Affinity chromatography can be performed to distinguish the SSIIa-A, SSIIa-B, and SSIIa-D polypeptides. Large populations of mutagenized seeds (thousands or tens of thousands of seeds) can be screened for high-amylose phenotypes using near-infrared (NIR) spectroscopy. By these means, high-throughput screening is easily achievable and allows the isolation of mutants at a frequency of approximately one per several hundred seeds.

[00147] Plants and seeds of the invention can be produced using the process known as TILLING (Local lesions induced by Petition 870190000436, dated 03 / 01 / 2019, page 59 / 233 / 187 (targeting in genomes), in which one or more mutations in wheat or grain plants can be produced by this method. In a first step, the introduced mutations, such as novel single base pair alterations, are induced in a plant population by treating seeds or pollen with a chemical or radiation mutagen, and then promoting plants to a generation where mutations will be stably inherited, typically an M2 generation where homozygous mutants can be identified. DNA is extracted, and seeds are stored from all elements of the population to create a resource that can be accessed repeatedly over time. For a TILLING assay, PCR primer oligonucleotides are designed to specifically amplify a single target gene of interest.Next, dye-labeled oligonucleotide primers can be used to amplify PCR products from pooled DNA from multiple individuals. These PCR products are denatured and re-annealed to allow the formation of mismatched base pairs. Mismatches, or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants in the population are likely to carry the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to exhibit the mutation). After heteroduplex formation, the use of an endonuclease, such as Cel I, which recognizes and cleaves mismatched DNA, or the use of high-resolution fusion, is used to discover novel SNPs in a tiling population. For example, see Botticella et al., 2011.

[00148] Using this approach, thousands of plants can be screened to identify any individual with a single base alteration or small insertions or deletions (1-30 bp) in any specific gene or region of the genome. Genomic fragments that are assayed can vary in size from around 0.3 to 1.6 kb. In the clustering of 8 Petition 870190000436, dated 03 / 01 / 2019, page 60 / 233 / 187 times and amplification of 1.4 kb fragments with 96 channels per assay, this combination allows screening of up to one million base pairs of genomic DNA per single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and Knauf, 2005, and Henikoff et al., 2004.

[00149] In addition to enabling efficient mutation detection, high-throughput TILLING technology is ideal for detecting natural polymorphisms. Therefore, searching for unknown homologous DNA via heteroduplex on a known sequence reveals the number and position of polymorphic sites. Both nucleotide changes and small insertions and deletions are identified, including at least some repeat number polymorphisms. This has been termed EcoTilling (Comai et al., 2004). Plates containing pooled ecotypic DNA can be screened, instead of DNA clusters from mutagenized plants. Because detection is on gels with close base pair resolution, and background patterns are uniform across the channels, bands of identical size can be combined, thus discovering and genotyping mutations in a single step. In this way, mutant gene sequencing is simple and efficient.

[00150] As used herein, the term “biological agents” means an agent used in the production of site-specific mutants, and includes enzymes that induce double-strand breaks in DNA that stimulate endogenous repair mechanisms. These include endonucleases, zinc finger nucleases, TAL effector proteins, transposases, site-specific recombinases, and are preferably CRISPR endonucleases. Zinc finger nucleases (ZFNs), for example, facilitate site-specific cleavage in a selected gene in a genome, allowing endogenous or other end-join repair mechanisms to introduce deletions or insertions to repair the break. Zinc finger nuclease technology is reviewed in Le Petition 870190000436, dated 03 / 01 / 2019, page 61 / 233 / 187 Provost et al., 2009, See also Durai et al., 2005 and Liu et al., 2010.

[00151] Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) are segments of prokaryotic DNA containing short repeats of base sequences. Each repeat is followed by short segments of “spacer DNA” from previous exposures to a bacteriophage or plasmid virus. The CRISPR / Cas system is a prokaryotic immune system that confers resistance to external genetic elements, such as those present in plasmids and phages, and provides a form of acquired immunity. CRISPR spacers recognize and cut these exogenous genetic elements in a manner analogous to RNA interference in eukaryotic organisms. CRISPRs are found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea.

[00152] By releasing the Cas9 nuclease and appropriate guide RNAs into a cell, the cell's genome can be cut at a desired location, allowing existing genes to be removed and / or new ones to be added. CRISPRs have been used in partnership with specific endonuclease enzymes for gene assembly and regulation in several species. Additional information related to CRISPR can be found in WO 2013 / 188638, WO 2014 / 093622 and Doudna et al., (2014).

[00153] Transcription activator-type effector nucleases (TALENs) are restriction enzymes that can be genetically modified to cut specific DNA sequences. They are prepared by fusing an effector DNA-binding domain to a DNA-cleavage domain (a nuclease that cuts DNA strands). Transcription activator-type effectors (TALEs) can be genetically modified to bind to virtually any desired DNA sequence, so when combined with a nuclease, DNA can be cut at specific locations. Restriction enzymes can be introduced into cells for use in the assembly of or for the assembly of Petition 870190000436, dated 03 / 01 / 2019, page 62 / 233 / 187 genome in situ, a technique known as genome assembly with genetically modified nucleases. Along with zinc finger nucleases and CRISPR / Cas9, TALEN is a notable tool in the field of genome assembly. Additional information regarding TALEN can be found in Boch (2011); Juong et al., (2013) and Sune et al., (2013).

[00154] Identified mutations can then be introduced into desirable genetic origins by crossing the mutant with a plant of the desirable genetic origin, and performing an appropriate number of backcrosses to cross the originally undesired parental origin. See, for example, example 3 here.

[00155] In some forms, mutations are null mutations such as nonsense mutations, reading frame mutations, deletions, insertion mutations, or junction site variations that completely inactivate the gene. Nucleotide insertion derivatives include 5' and 3' terminal fusions, as well as insertions between single or multiple nucleotide sequences.

[00156] Insertion nucleotide sequence variations are those in which one or more nucleotides are introduced at a location in the nucleotide sequence, each at a predetermined location as is possible with zinc finger nucleases (ZFNs), CRISPR nucleases or other homologous recombination methods, or by random insertion with appropriate screening of the resulting product.

[00157] Deletion variations are distinguished by the removal of one or more nucleotides from the sequence. In one embodiment, a mutant gene exhibits only a single insertion or deletion of a nucleotide sequence relative to the wild-type gene. The deletion may be extensive enough to include one or more exons or introns, both exons and introns, an intron-exon boundary, a portion of the promoter, the translation initiation site, or even the entire gene. Deletions may extend sufficiently Petition 870190000436, dated 03 / 01 / 2019, page 63 / 233 / 187 to include at least part of, or the entirety of, an SSIIa gene and one or more adjacent genes in the A, B, or D genome. Insertions or deletions in the exons of the protein-coding region of a gene that insert or delete numerous nucleotides that are not exact multiples of three, thus causing a frameshift during translation, almost always abolishing the activity of the mutant gene comprising such insertion or deletion; such mutations are null mutations. Insertions or deletions in the exons of the protein-coding region of a gene that insert or delete numerous nucleotides that are exact multiples of three may or may not abolish the activity of the gene comprising such insertion or deletion. In the case of a deletion of an exact multiple of three nucleotides, the deletion would be expected to inactivate the encoded polypeptide if the deleted nucleotides encode a highly conserved amino acid.Enzyme assays or phenotypic assays can be used to determine whether insertion or deletion mutations are null mutations.

[00158] Nucleotide substitution variations are those in which at least one nucleotide in the sequence has been removed and a different nucleotide has been inserted in its place. In some embodiments, the number of nucleotides affected by substitutions in a mutant gene relative to the wild-type gene is at most ten nucleotides, more preferably at most 9, 8, 7, 6, 5, 4, 3, or 2, or above all preferably only one nucleotide. Substitutions can be “silent,” where the nucleotide substitution does not alter the amino acid defined by the codon. Nucleotide substitutions can reduce translation efficiency and thus reduce the expression level of the affected SSIIa gene, for example, by reducing mRNA stability or, if close to an exon-intron splicing boundary, altering splicing efficiency.Silent substitutions that do not alter the translation efficiency of an SSI1a gene are not expected to alter gene activity and are therefore considered here as non-mutant, i.e., such genes. Petition 870190000436, dated 01 / 03 / 2019, p. 64 / 233 / 187, refers to active variations not included in a “mutant gene”. Alternatively, the nucleotide substitution(s) may alter the encoded amino acid sequence, thereby altering the activity of the encoded enzyme, particularly if conserved amino acids are replaced by a significantly different amino acid, i.e., a non-conservative substitution. Regarding conservative substitutions, see Table 3. The conserved amino acids in SSIIa wheat polypeptides can be identified by aligning the SSIIa amino acid sequences of different species, for example, by aligning SEQ ID NO:1 with an SSII from Arabidopsis thaliana and determining which amino acids are common.

[00159] The term “mutation” as used here does not include silent nucleotide substitutions that do not affect gene activity and therefore includes only changes in the gene sequence that affect gene activity. The term “polymorphism” refers to any change in the nucleotide sequence of the gene, including such silent nucleotide substitutions. Screening methods may involve first screening for polymorphisms and secondly for mutations within a group of polymorphic variations. Mutations include deletions of all or part of a gene, insertions such as an insertion into an exon of a gene, and nucleotide substitutions, and any combination thereof.

[00160] The terms “plant(s)” and “wheat plant(s)”, as used herein as a noun, generally refer to whole plants, but when “plant” or “wheat” is used as an adjective, the terms refer to any substance that is present in, obtained from, derived from, or related to a plant or a wheat plant such as, for example, plant organs (e.g., leaves, stems, roots, flowers), single cells (e.g., pollen), seeds or grains, plant cells including, for example, cells grown in tissue, products produced from the plant such as “wheat flour”, “wheat grain”, “wheat starch”, “granules of Petition 870190000436, dated 03 / 01 / 2019, page 65 / 233 / 187 wheat starch” and similar terms. Seedlings and germinated grain, from which roots and shoots have emerged, are also included in the meaning of “plant”. The term “plant parts”, as used herein, refers to one or more plant tissues or organs that are obtained from a whole plant, preferably a wheat plant. Plant parts, as used herein, comprise plant cells. Plant parts include vegetative structures (e.g., leaves including the leaf sheath and leaf blade, stems including internodes), roots, tillers, floral organs / structures such as the ear (also called the ear or head), pollen, ovules, seed (including embryo, endosperm and seed coat), plant tissue (e.g., vascular tissue, soil tissue and the like), cells and progeny thereof.The term “plant cell,” as used herein, refers to a cell obtained from or in a plant, preferably a wheat plant, and includes protoplasts or other plant-derived cells, gamete-producing cells, and cells that regenerate into whole plants. Plant cells may be cultured cells. “Plant tissue” means differentiated tissue in or obtained from a plant (“explant”) or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, pollen, and various forms of aggregations of plant cells in culture, such as calluses. Plant tissues in or of seeds, such as wheat grain, are the seed coat, endosperm, scutellum, aleurone layer, and embryo. Each of the wheat plant tissues or organs and wheat cells comprises genetic material (nucleic acid) of the wheat plant from which it is obtained.

[00161] Cereals, as used herein, means plants or grains of the monocotyledonous families Poaceae or Graminae, which are cultivated for the edible components of their grain, and include wheat, barley, maize, oats, rye, rice, sorghum, triticale, millet, buckwheat. Preferably, the cereal plant or grain is a wheat or grain plant. In Petition 870190000436, dated 01 / 03 / 2019, p. 66 / 233 / 187 an additionally preferred embodiment, the cells, plant or grain of wheat, or products derived therefrom, of the invention is of the species Triticum aestivum.

[00162] As used herein, the term “wheat” refers to any species of the genus Triticum, including its progenitors, as well as its progeny produced by crosses with other species. Wheat includes “hexaploid wheat” which has a genome organization of AABBDD, comprising 42 chromosomes, and “tetraploid wheat” which has a genome organization of AABB, comprising 28 chromosomes. The plants and grain of the invention are of the hexaploid species T. aestivum, and do not include the tetraploid species T. durum, also known as durum wheat or Triticum turgidum ssp. durum. Diploid progenitors of T. aestivum are known to be T. uartu, T. monococcum, or T. boeoticum for genome A, Aegilops speltoides for genome B, and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii) for genome D. Preferably the plant of T.The wheat of the invention is suitable for the commercial production of grains with suitable agricultural characteristics, which are known to those skilled in the art. Above all, preferably, the wheat is Triticum aestivum ssp. aestivum, here also referred to as "bread wheat".

[00163] Aspects of the invention provide methods of planting and harvesting wheat grain of the invention, and methods of producing wheat grain silos of the invention. For example, after the soil has been prepared by plowing and / or other certain methods, the seeds are typically planted by sowing through perforated furrows and planting the seeds in rows. To prevent the dispersal of the grain produced at plant maturity, the wheat may be harvested before it is fully mature, but it is typically harvested when the plants show complete loss of green color. There are several steps in harvesting: cutting or mowing the stalks; threshing and winnowing to separate the grain from the ears, glumes and other debris; sifting and classifying the grain; typically Petition 870190000436, dated 03 / 01 / 2019, page 67 / 233 / 187, carried out by a combine harvester, thus placing the grain in trucks. In some embodiments, the harvested wheat grain can be stored in dry, well-ventilated buildings that prevent insect pests. In some embodiments, the harvested wheat grain can be stored for a short period in silos or granaries. The wheat grain can then be transported to point-of-shipment elevators, tall structures where the grain is dried and stored until it is sold or sent to terminal elevators. Therefore, embodiments of the invention provide a process for producing wheat grain silos comprising: a) harvesting wheat stalks comprising wheat grain in the manner defined herein; b) threshing and / or winnowing the stalks to separate the grain from the lye; (c) sift and / or classify the grain separated in step (b), and place the sifted and / or classified grain in silos, thus producing wheat grain silos.

[00164] The wheat and grain plants of the invention have uses other than for food or animal feed, for example, uses in research or breeding. In seed-propagated crops, such as wheat, plants can be self-crossed to produce a plant that is homozygous for the desired genes, or haploid tissues, such as developing germ cells, can be induced to duplicate the chromosome complement to produce a homozygous plant. The natural wheat plant of the invention thereby produces grain containing the combination of homozygous SSIIa mutant alleles. The grain can be grown to produce plants that can exhibit the selected phenotype, such as, for example, a high amylose content in their starch.

[00165] The wheat plants of the invention can be crossed with plants containing a more desirable genetic origin and, therefore, the invention includes the transfer of the reduced SSIIa traits to other genetic origins. As used herein, “crossing” or “crossing” refers to the process by which pollen from a flower onto a plant is applied. Petition 870190000436, dated 03 / 01 / 2019, page 68 / 233 / 187 (artificially or naturally) on the stigma of a flower from another plant. After the initial cross, an appropriate number of backcrosses can be performed to remove a less desirable origin. SSIIa allele-specific PCR-based markers, such as those described herein, can be used for screening or identifying plants or grain progeny with the desired combination of alleles, thus monitoring the presence of alleles in the breeding program. The desired genetic origin may include a suitable combination of genes, providing commercial yield and other characteristics such as agronomic performance or resistance to abiotic stress. The genetic origin may also include other altered starch biosynthesis or gene modification, for example, null alleles of SSIIIa genes or favorable alleles of GBSS genes.The genetic origin may include one or more transgenes, such as, for example, a gene that confers tolerance to an herbicide, such as glyphosate.

[00166] The desired genetic origin of the wheat plant will include considerations of agronomic yield and other characteristics. Such characteristics may include whether a winter or spring type is desirable, agronomic performance, disease resistance, and resistance to abiotic stress. With regard to Australian use, one may wish to cross the altered starch trait of the wheat plant of the invention into wheat cultivars such as Baxter, Kennedy, Janz, Frame, Rosella, Cadoux, Diamondbird, or other commonly grown varieties. Other varieties will be suitable for other growing regions.It is preferable that the wheat plant of the invention provide a grain yield (tons / hectare) of at least 50% relative to the yield of the corresponding wild-type variety in at least some growing regions, more preferably at least 60% or at least 70%, or at least 80% or at least 90%, relative to a wild-type variety with approximately the same genetic origin, grown under the same conditions. In one embodiment, the... Petition 870190000436, dated 01 / 03 / 2019, p. 69 / 233 / 187 grain yield is less than 90% compared to a wild-type variety with approximately the same genetic origin, grown under the same conditions. The yield can be easily evaluated in controlled field tests, or in simulated field tests in the greenhouse, preferably in the field.

[00167] Marker-assisted selection is a well-recognized method of selecting heterozygous plants obtained during backcrossing with a recurrent parent in a classical breeding program. The plant population in each backcross generation will be heterozygous for the gene(s) of interest, generally present in a 1:1 ratio in a backcross population, and a molecular marker linked to a gene can be used to distinguish the two alleles of the gene. The presence of two markers can be assayed, one for a mutant allele and the other for the wild-type allele. By extracting DNA, for example, from young shoots and testing with a specific marker for the desired introgressed trait, early selection of plants for further backcrossing is carried out while energy and resources are concentrated on smaller plants.Procedures such as wheat plant crossing, self-fertilization of wheat plants, or marker-assisted selection are standard and well-known procedures in the art. Transferring alleles from tetraploid wheat, such as durum wheat, to a hexaploid or other forms of hybridization is more difficult, but is also known in the art.

[00168] To identify the desired phenotypic trait, wheat plants containing a combination of mutant ssIIa or other desirable genes are typically compared with a control plant. During the evaluation of a phenotypic trait associated with mutant ssIIa genes, such as amylose content in the grain starch, or total fiber content or grain weight or yield, the plants to be tested and control plants are grown in a growth chamber, greenhouse, or preferably in controlled conditions. Petition 870190000436, dated 03 / 01 / 2019, page 70 / 233 / 187 field, under the same conditions (temperature, soil, moisture supply, fertilizer supply, season, etc.). The identification of a particular phenotypic characteristic and comparison with controls is based on routine statistical analysis and classification. Gene expression or enzymatic activity is compared in relation to growth, development, and yield parameters that include one or more of germination rate, seedling vigor including seedling emergence, plant morphology, color, number, size, dimensions, dry and wet weight, maturity, above- and below-ground biomass ratios, and periodicity, rates, and duration of various growth stages through senescence, including vegetative growth, fruiting, flowering, grain yield and dormancy, harvest index, and soluble carbohydrate content, including sucrose, glucose, fructose, and starch levels, as well as endogenous starch levels.In some embodiments, the wheat plants of the invention differ from wild-type plants in one or more of these parameters by less than 50%, more preferably less than 40%, less than 30%, less than 20%, less than 15%, less than 10%, less than 5%, less than 2%, or less than 1% when grown under the same conditions. Preferably, the plant or grain of the invention is about the same as the wild-type plant or grain for one or more of these parameters.

[00169] As used here, the term “linked” or “genetically linked” refers to a marker locus and a second locus that are sufficiently close on a chromosome that they will be inherited together in more than 50% of meiotic divisions, for example, not randomly. This definition includes the situation where the marker locus and the second locus are part of the same gene. Furthermore, this definition includes the situation where the marker locus comprises a polymorphism that is responsible for the characteristic of interest, in which case the polymorphism will be 100% linked to the phenotype. Thus, the percentage of recombination observed between the loci... Petition 870190000436, dated 01 / 03 / 2019, p. 71 / 233 / 187 generation (calculated as centimorgans (cM)) will be less than 50. In particular embodiments of the invention, genetically linked loci may have 45, 35, 25, 15, 10, 5, 4, 3, 2, or 1 or less cM apart on a chromosome. Preferably, the markers have less than 5 cM or 2 cM apart, and above all preferably essentially 0 cM apart.

[00170] In the manner used herein, the “other genetic markers” may be any of the molecules that are linked to a desired characteristic in the wheat plants of the invention. Such markers are well known in the art and include molecular markers linked to genes that determine characteristics such as disease resistance, yield, plant morphology, grain quality, other dormancy characteristics such as grain color, gibberellic acid content in the seed, plant height, flour color and the like. Examples of such genes are stem rust resistance genes Sr2 or Sr38, streak rust resistance genes Yr10 or Yr17, nematode resistance genes such as Crel and Cre3, alleles at glutenin loci that determine biomass strength such as Ax, Bx, Dx, Ay, By and Dy alleles, and Rht genes that determine a semi-dwarf growth habit and therefore lodging resistance (Eagles et al., 2001; Langridge et al., 2001; Sharp et al., 2001).

[00171] The wheat plants, wheat plant parts and products thereof of the invention are preferably non-transgenic with respect to genes that inhibit the expression of an SSIIa gene and / or an SBEIIa gene, i.e., they do not comprise a transgene encoding an RNA molecule that reduces the expression of an endogenous SSIIa gene, although in this embodiment they may comprise other transgenes, for example, herbicide tolerance genes such as glyphosate tolerance. More preferably, the wheat plant, grain and products thereof are non-transgenic, i.e., they do not contain any transgene, which is preferred in some markers. Such products are also described herein as “unprocessed” products. Such plants and grain do not Petition 870190000436, dated 03 / 01 / 2019, page 72 / 233 / 187 transgenic organisms comprise the multiple mutant SSIIa alleles, as described herein, such as those produced after mutagenesis.

[00172] The terms “transgenic plant” and “transgenic wheat plant,” as used herein, refer to a plant that contains a genetic construct (“transgene”) not found in a wild-type plant of the same species, variety, or cultivar. That is, transgenic plants (transformed plants) contain genetic material that they did not contain before transformation. A “transgene” or “genetic construct,” as used herein, has the normal meaning in biotechnology and refers to a genetic sequence that has been produced or altered by recombinant DNA or RNA technology. If present in a plant cell, the transgene has been introduced into the plant cell or a progenitor cell by a human. The transgene may include genetic sequences obtained or derived from a plant cell, or another plant cell, or a different plant source, or a synthetic sequence.Typically, the transgene is introduced into the plant by human manipulation such as, for example, by transformation, but any method may be used provided those skilled in the art recognize it. The genetic material is typically stably integrated into the plant genome. The introduced genetic material may comprise sequences that occur naturally in the same species, but in a rearranged order or in a different arrangement of elements, for example, an antisense sequence or a sequence expressing an inhibitory double-stranded RNA. Plants containing such sequences are included herein as “transgenic plants”. Transgenic plants as defined herein include all the progeny of an initial transformed and regenerated plant (T0 plant), which has been genetically modified using recombinant techniques, where the progeny comprises the transgene.Such offspring can be obtained by self-fertilization of the primary transgenic plant or by crossing such plants with another plant of the same species. In one embodiment, aso. Petition 870190000436, dated 03 / 01 / 2019, page 73 / 233 / 187 transgenic plants are homozygous for each of the genes that were introduced (transgene), so that their progeny do not segregate to the desired phenotype. The parts of the transgenic plant include all parts and cells of said plants that comprise the transgene such as, for example, seeds, cultivated tissues, calluses and protoplasts.

[00173] A “non-transgenic plant”, preferably a non-transgenic wheat plant, is one that has not been genetically modified by the introduction of genetic material by recombinant DNA techniques. The presence in a plant or grain of deletions of part of a gene, in the manner generated by specific local endonucleases such as ZFN, TAL effectors of CRISPR-type nucleases, followed by non-homologous end-joint repair in the plant cell and its progeny, are hereby included as “non-transgenic”. As used herein, “progeny” includes all descendants of a wheat plant, both immediate and subsequent generations, and both plants and seed (grain). Progeny includes seeds and plants obtained after self-fertilization (“self-pollination”), and the grain and plants resulting from a cross between two parental plants, such as the F1 (first generation), F2, F3, F4, etc. offspring, the second generation being the offspring, etc., generation after self-fertilization of F1 plants.

[00174] As used herein, the term “corresponding non-transgenic plant” refers to a plant that is the same or similar in many characteristics, preferably isogenic or nearly isogenic with respect to the transgenic plant, but without the transgene of interest. Preferably, the corresponding non-transgenic plant is of the same cultivar or variety as the parent of the transgenic plant of interest, or a sister plant line that does not have the construct, often referred to as a “segregant”, or a plant of the same cultivar or variety transformed with an “empty vector” construct, and may be a non-transgenic plant.

[00175] “Wild type”, as used here, refers to a Petition 870190000436, dated 01 / 03 / 2019, p. 74 / 233 / 187 cell, tissue, plant or part of a plant, preferably a plant, part of a plant or grain of Triticum aestivum, which has not been modified in accordance with the invention. A wild-type plant or grain such as these is at least wild-type with respect to the SSIIa genes. “Corresponding wild type” refers to a wild-type cell, tissue, plant, part of a plant or plant product that is suitable as a comparison to the cell, tissue, plant, part of a plant or plant product of the invention, in the manner readily understood in the art. In general, the corresponding wild type is a wheat plant or part of a plant that is genetically similar, preferably isogenic, to the plant or part of a plant of the invention, but without the mutations in the ssIIa gene.Wild-type cells, tissues, or plants are known in the art and can be used as controls to compare gene or polypeptide sequences, in particular SSIIa gene sequences, expression levels of an SSIIa gene, or the extent and nature of trait modification with cells, tissues, or plants modified in the manner described herein. In the manner used herein, "wild-type wheat grain" means a corresponding non-mutaged, non-transgenic wheat grain. Specific wild-type wheat grains, in the manner used herein, include, but are not limited to, Sunstate, Chara, and Cadoux. The Sunstate wheat cultivar is described in Ellison et al., (1994).

[00176] Any of several methods can be employed to determine the presence of a transgene in a transformed plant. For example, polymerase chain reaction (PCR) can be used to amplify sequences that are unique to the transformed plant, with detection of the amplified products by gel electrophoresis or other methods. DNA can be extracted from plants using conventional methods and the PCR reaction performed using oligonucleotide primers that will distinguish transformed and non-transformed plants. An alternative method to confirm a positive transformant is by Petition 870190000436, dated 01 / 03 / 2019, p. 75 / 233 / 187 Southern blot hybridization, well known in the art. Wheat plants that are transformed can also be identified, that is, distinguished from non-transformed or wild-type wheat plants by their phenotype, for example, conferred by the presence of a selectable marker gene, or by immunoassays that detect or quantify the expression of an enzyme encoded by the transgene, or any other phenotype conferred by the transgene.

[00177] Wheat plants, preferably of the species Triticum aestivum, of the present invention can be grown or harvested in relation to the grain, mainly for use as food for human consumption or as animal feed, or for fermentation or production of industrial raw materials such as ethanol production, among other uses. Alternatively, the aerial green parts of wheat plants can be used directly as animal feed, both by grazing directly in the field and after harvesting. Straw and trimmings can also be used as feed or for non-food uses. The plant of the present invention is preferably used for food production and in particular for commercial food production for human consumption. Such food production may include the preparation of flour, dough, semolina or other grain products, such as starch granules or isolated starch, which can be an ingredient in commercial food production.

[00178] As used herein, the term “grain” generally refers to the mature, harvested seed (also called the kernel) of a plant, but may also refer to the grain after soaking or germination, depending on the context. Grain includes mature kernels produced by growers for purposes other than the growth of additional plants. Mature cereal grain such as wheat commonly has a moisture content of less than about 18-20%, typically about 8-10% moisture. As used herein, the term “seed” includes harvested seed, Petition 870190000436, dated 03 / 01 / 2019, page 76 / 233 / 187, but also includes seed that develops in the plant after anthesis, and mature seed contained in the plant before harvest. The parts of the grain include the testa (seed coat), the pericarp (fruit skin), the aleurone layer, the starch-rich endosperm, and the embryo (germ) which consists of the scutellum, the plumule (shoot), and the radicle (primary root). Testa, pericarp, and aleurone layer combined are commonly referred to as "bran," which can be removed from the grain by grinding, and may also include the germ. The scutellum is the region that secretes some of the enzymes involved in germination and absorbs the soluble sugars from the breakdown of starch in the endosperm for seedling growth after germination. The aleurone surrounding the starch-rich endosperm also secretes enzymes during germination.

[00179] As used herein, “germination” refers to the emergence of the root tip (radicle) from the seed coat after soaking. The radicle generally emerges first, followed by the plumule. “Germination rate” refers to the percentage of seeds in a population that have germinated over a period of time, for example, 7 or 10 days, after soaking. Germination rates can be calculated using techniques known in the art. For example, a seed population, typically at least 100 grains, can be assessed daily for several days to determine the percentage of germination over time. With respect to the grain of the present invention, as used herein, the term “germination rate that is substantially the same” means that the germination rate of the grain is at least 90% of that of the corresponding wild-type grain.In one embodiment, the grain of the invention exhibits a germination rate between about 70% and about 100% relative to wild-type grain, preferably between about 90% and about 100% relative to wild-type grain. During germination measurement, the wheat grain of the invention and the wild-type grain used as a control should be grown in the same conditions. Petition 870190000436, dated 03 / 01 / 2019, page 77 / 233 / 187 conditions and stored under the same conditions, for approximately the same period of time.

[00180] The invention also provides food ingredients such as flour, preferably wholemeal flour, bran and other products produced from the grain. These may be unprocessed or processed, for example, by heat treatment, fractionation or bleaching.

[00181] The grain of the invention can be processed to produce a food ingredient, or a food, or non-food product using any technology known in the art. In one embodiment, the food ingredient is flour such as, for example, whole wheat flour or white flour. As used herein, “flour” is a ground product of the grain that has been ground into a powder. The powder is commonly fractionated by sieving, filtering, centrifuging or by other methods known in the art, and may be further refined, heat-treated and / or bleached. Refined flour, or “white flour”, as used herein, refers to flour that has been enriched with the endosperm-derived part of the ground powder, with respect to whole wheat flour, achieved by removing at least some of the bran and germ components from the ground powder.The Food and Drug Administration (FDA) requires that flour meet certain particle size standards in order to be included in the refined flour category. According to the FDA, the particle size of refined flour is described as flour in which no less than 98% passes through a fabric with openings that are no larger than those of woven wire cloth designated “212 micrometers (US Wire 70)”.

[00182] As used herein, the term “wholemeal flour”, also referred to as whole wheat flour or whole grain flour, is a milled flour that has been essentially made up of 100% of the grain and that includes a refined flour constituent (refined flour or refined flour) and a coarse fraction (an ultrafine milled coarse fraction). The fraction Petition 870190000436, dated 03 / 01 / 2019, page 78 / 233 / 187. Coarse bran includes at least one layer of bran and germ, typically both. The germ is an embryonic plant found in the kernel of the grain, comprising the embryo and scutellum. The germ includes lipids, fiber, vitamins, protein, minerals, and phytonutrients, such as flavonoids, at higher levels than in the mature endosperm of the grain. The bran includes several cell layers, including the pericarp (fruit peel) and testa (seed coat), and also contains a significant amount of lipids, fiber, vitamins, protein, minerals, and phytonutrients, such as flavonoids. The aleurone layer, although technically considered part of the endosperm of the mature grain, exhibits many of the same characteristics as the bran and, therefore, is typically removed with the bran and germ during the milling and / or sifting process.The aleurone layer also includes lipids, fiber, vitamins, protein, minerals, and phytonutrients such as flavonoids and ferulic acid.

[00183] Additionally, the coarse fraction can be mixed with the refined flour constituent. Preferably, the coarse fraction is homogeneously mixed with the refined flour constituent. The coarse fraction can be mixed with the refined flour constituent to form wholemeal flour, thus providing a wholemeal flour with higher nutritional value, fiber content, and antioxidant capacity compared to refined flour. For example, the coarse fraction or wholemeal flour can be used in various quantities to replace refined flour in baked goods, snack products, and food products. The wholemeal flour of the present invention (i.e., ultrafine ground whole grain flour) can also be marketed directly to consumers for use in their homemade baked goods.In an exemplary embodiment, the granulation profile of whole wheat flour is such that 98% of the particles by weight of the whole wheat flour are less than 212 micrometers in diameter.

[00184] In additional embodiments, enzymes found in bran and Petition 870190000436, dated 03 / 01 / 2019, page 79 / 233 / 187. The germ of wholemeal flour and / or the coarse fraction are inactivated in order to stabilize the wholemeal flour and / or the coarse fraction. It is contemplated by the present invention that "inactivated" may also mean inhibited, denatured, or similar. Stabilization is a process that uses steam, heat, radiation, or other treatments to inactivate enzymes found in the bran and germ layer. In the absence of stabilization, naturally occurring enzymes in the bran and germ catalyze changes in the compounds in the flour, which can adversely affect the baking characteristics of the flour and its shelf life. Inactivated enzymes do not catalyze changes in the compounds observed in the flour; therefore, flour that has been stabilized retains its baking characteristics and has a longer shelf life. For example, the present invention can implement a two-stream milling technique to mill the coarse fraction.Once the coarse fraction is separated and stabilized, it is then ground using a grinder, preferably a slot mill, to form a coarse fraction with a particle size distribution of approximately 500 micrometers or less. After sieving, any ground coarse fraction with a particle size greater than 500 micrometers can be returned to the process for further grinding.

[00185] In additional embodiments, flour, wholemeal flour or coarse flour may be a component of a food product, for example, it may be used as an ingredient in food production. The food product may be, for example, a donut, a biscuit, a bread, a sweet bread, a croissant, a baked muffin, a cake such as an English cake, a pita bread, a quick bread, a chilled or frozen flour dough product, flour dough, baked beans, a burrito, chili, a taco, a tamale, a tortilla, a pie, a ready-to-eat cereal, a ready-to-eat meal, a filling, a microwaveable meal, a chocolate cake, a cake, a cheesecake, a coffee cake, Petition 870190000436, dated 03 / 01 / 2019, page. 80 / 233 / 187 a biscuit, a sweet, a dough, a sweet bread, a chocolate bar, a pie crust, pie filling, baby food, a baking mix, a dough, a breaded product, a sauce mix, a meat extender, a meat substitute, a seasoning mix, a soup mix, a sauce, a flour and butter mix, a salad dressing, a soup, sour cream, a noodle, a pasta, ramen noodles, Chinese food noodles, yakisoba noodles, an ice cream inclusion, an ice cream bar, an ice cream cone, an ice cream sandwich, a cookie, a toasted bread cube, a donut, a spring roll, an extruded snack, a grain bar, a microwave-prepared snack product, a nutritional bar, a pancake, a par-baked bakery product, a pretzel, a pudding, a granola-based product, a savory snack, a snack food, a snack mix, a waffle,a pizza crust, animal feed, or pet food.

[00186] In other embodiments, flour, wholemeal flour, or coarse fraction may be a component of a nutritional supplement. For example, the nutritional supplement may be a product that is added to the diet containing one or more ingredients, typically including: vitamins, minerals, lipids such as omega-3 fatty acids, amino acids, enzymes, antioxidants such as lutein, herbs, spices, probiotics, extracts, prebiotics, and fiber. The flour, wholemeal flour, or coarse fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber. For example, the coarse fraction contains a concentrated amount of dietary fiber, as well as other essential nutrients such as B vitamins, selenium, chromium, manganese, magnesium, and antioxidants that are essential for a healthy diet. For example, 15 grams of the coarse fraction of the present invention releases 33% of the recommended daily fiber intake for an individual.Additionally, 9 grams is all that is needed. Petition 870190000436, dated 03 / 01 / 2019, page 81 / 233 / 187, releases 20% of the recommended daily fiber intake for an individual. Thus, the coarse fraction is an excellent supplemental source for meeting an individual's fiber requirement.

[00187] In further embodiments, wholemeal flour or coarse fraction may be a fiber supplement or a component thereof. Many current fiber supplements such as psyllium husks, cellulose derivatives and hydrolyzed guar gum have limited nutritional value beyond their fiber content. Additionally, many fiber supplements have an undesirable texture and poor taste. Therefore, in one embodiment, the food ingredients of the invention do not contain fiber supplements derived from sources other than wheat grain. Supplements consisting of wholemeal flour or coarse fraction of wheat grain thus release fiber, as well as protein and antioxidants. The fiber supplement may be released, but not limited to, in the following forms: instant beverage mixes, ready-to-drink beverages, nutritional bars, wafers, biscuits, cookies, gel doses, capsules, chewing gum, chewable tablets and pills.One formulation releases the fiber supplement in the form of a flavored shake or malt-type beverage; this formulation may be particularly appealing as a fiber supplement for children.

[00188] In a further embodiment, a milling and mixing process can be used to prepare a multi-grain flour or a multi-grain coarse fraction. For example, bran and germ of one type of grain, such as the grain of the invention, can be milled and mixed with milled endosperm or whole grain flour of another type of wheat or other cereal. It is contemplated that the present invention includes mixing any combination of one or more bran, germ, endosperm, and whole grain flour from one or more grains. This multi-grain approach can be used to prepare customized flour and capitalize on the qualities and nutritional content of multiple types of grains, such as wheat, to prepare a flour. Petition 870190000436, dated 03 / 01 / 2019, page 82 / 233 / 187

[00189] The flour or wholemeal flour of the present invention can be produced by any milling process known in the art. An exemplary embodiment involves grinding the grain in a single stream, without separating the endosperm, bran, and germ of the grain into separate streams. The clean and tempered grain is conveyed to a first-pass mill, such as a hammer mill, roller mill, pin mill, impact mill, disc mill, air friction mill, slot mill, or similar. After grinding, the grain is discarded and conveyed to a sieve. Any sieve known in the art for sieving a ground particle can be used. The material that passes through the sieve screen is the whole grain flour of the present invention and requires no further processing. The material that remains on the screen is said to be a second fraction. The second fraction requires further particle reduction.Thus, this second fraction can be transported to a second through-mill. After grinding, the second fraction can be transported to a second sieve.

[00190] It is contemplated that the flour, wholemeal flour, coarse fraction and / or grain products of the present invention may be modified or improved by means of various other processes, such as: fermenting, instantizing, extruding, encapsulating, roasting, baking or similar. The flour and wholemeal flour of the invention comprise the genetic material, including DNA, of the wheat grain from which they were derived, as well as the food products produced therefrom. See, for example, Tilley (2004) and Bryan et al., (1998).

[00191] A malt-based beverage provided by the present invention involves alcoholic beverages (including distilled beverages) and non-alcoholic beverages that are produced using malt as part or all of the starting material. Examples include beer, happoshu (low-malt beer), whiskey, low-alcohol malt-based beverages (e.g., malt-based beverages containing less than 1% alcohol), and Petition 870190000436, dated 01 / 03 / 2019, p. 83 / 233 / 187 non-alcoholic beverages.

[00192] Malting is a process of controlled steeping and germination, followed by drying of the grain. This sequence of events is important for the synthesis of various enzymes that cause modification in the grain, a process that primarily depolymerizes the cell walls of the dead endosperm and mobilizes the grain's nutrients. In the subsequent drying process, flavor and color are produced by virtue of chemical browning reactions. Although the main use of malt is for beverage production, it can also be used in other industrial processes, for example, as an enzyme source in the baking industry, or as a flavoring or coloring agent in the food industry, for example, as malt or as malt flour, or indirectly as a malt syrup, etc.

[00193] In one embodiment, the present invention relates to methods of producing a malt composition. The method preferably comprises the steps of: (i) provide wheat grain of the invention, (ii) macerate said grain, (iii) germinate the macerated grains under predetermined conditions and (iv) dry said germinated grains.

[00194] Malt can be prepared using only the grain of the invention or in mixtures comprising other grains. Malt is mainly used for brewing beer, but also for the production of distilled spirits. Brewing beer comprises wort production, primary and secondary fermentations, and post-treatment. First, the malt is crushed, stirred in water, and mashed. During this “mashing,” the enzymes activated in malting degrade the core starch into fermentable sugars. The resulting wort is clarified, yeast is added, the mixture is fermented, and a Petition 870190000436, dated 03 / 01 / 2019, page 84 / 233 / 187 post-treatment is carried out.

[00195] In general, the first step in the wort production process is the milling of the malt, so that water can gain access to the grain particles in the mashing phase, which is fundamentally an extension of the malting process with enzymatic depolymerization of substrates. During mashing, the crushed malt is incubated with a liquid fraction, such as water. The temperature is either kept constant (isothermal mashing) or gradually increased. In each case, soluble substances produced in malting and mashing are extracted in said liquid fraction, before being separated by filtration into wort and residual solid particles called spent grains. The wort composition can also be prepared by incubating the wheat grain of the invention, or parts thereof, with one or more suitable enzymes, such as enzyme compositions or enzyme mixture compositions, for example, Ultraflo or Cereflo (Novozymes).The wort composition can also be prepared using a mixture of malt and unmalted plants, or parts thereof, optionally adding one or more suitable enzymes during said preparation.

[00196] The starch from wholemeal flour or wholemeal flour when incorporated into food products provides modified digestive properties, for example, the food ingredient comprises more resistant starch compared to a corresponding food ingredient produced from wild wheat grain, including as much as 1% to 20%, 2% to 18%, 3% to 18% or 5% to 15% resistant starch, and a lowered glycemic index (GI), such as a reduction of at least 5 units, preferably between 5 and 25 units. This may be in combination with an increased total fiber content, for example, from 15% to 30% by weight in the food ingredient.

[00197] Carbohydrates, compounds comprising one or more saccharide units consisting of carbon, hydrogen, and oxygen, can be classified according to the number and composition of the units of Petition 870190000436, dated 03 / 01 / 2019, page 85 / 233 / 187 monosaccharides that constitute the carbohydrate. These include polysaccharides (>10 monosaccharide units), oligosaccharides (3-10 monosaccharide units), disaccharides and monosaccharides including glucose, fructose, xylulose and arabinose. Carbohydrates constitute more than 65% by weight of mature wild wheat grain, including 65-75% starch and about 10% cell wall polysaccharides such as cellulose, arabinoxylan and BG.

[00198] Starch is the principal storage carbohydrate in most plants, including cereals such as wheat. “Starch” is here defined as a polysaccharide composed of glucopyranose units polymerized via α-1,4 linkages and both no and some α-1,6 linkages. Starch is synthesized in amyloplasts and is formed and stored in granules in the developing storage organ such as the grain; it is here referred to as “storage starch” or “grain starch” or “grain starch”. In cereal grains, including Triticum aestivum, the vast majority of storage starch is deposited in the endosperm as starch granules. Starch is synthesized and deposited in amyloplasts during grain development, particularly the grain-filling phase of the growing plant, and forms discrete crystalline structures called starch granules.In wild-type Triticum aestivum, the starch granules are of two size classes, especially larger ellipsoidal granules ranging from 10-40 μm in diameter (type A granules), and smaller spherical granules ranging from 1-10 μm in diameter (type B granules).

[00199] Starch molecules are classified as belonging to two component fractions, known as amylose and amylopectin, which are distinguished on the basis of their degree of polymerization (DP), and the ratio of α-1,6 to α-1,4 linkages in the polymers. Amylose comprises almost entirely linear α-1,4-linked glycosyl chains, which may have either no or few glucan chains linked by an α-1,6 linkage. Petition 870190000436, dated 03 / 01 / 2019, page 86 / 233 / 187 The other chain is linked to α-1,6, and has a molecular weight of 10⁴ to 10⁵ daltons. The term “amylose” is defined here as essentially including linear molecules of α-1,4-linked glycosidic units (glucopyranose), sometimes referred to as “true amylose,” and long-chain amylose-type starch, which is sometimes referred to as “intermediate material” or “amylose-type amylopectin,” which appears as iodine-bound material in an iodometric assay along with true amylose (Takeda et al., 1993; Fergason, 1994). Linear molecules in true amylose typically have a DP between 500 and 5,000 and contain less than 1% α-1,6 linkages. Recent studies have shown that approximately 0.1% of α-1,6 glycosidic branching sites can occur in amylose, therefore it is described as "essentially linear".In this context, the percentage (%) refers to the number of α-1,6 glycosidic linkages in relation to the total number of glycosidic linkages, being the sum of α-1,4-glycosidic linkages and α-1,6-glycosidic linkages. Granule-linked starch synthase (GBSS) is the main enzyme involved in amylose synthesis.

[00200] Amylopectin is a glucan polymer with relatively high branching in which α-1,4-linked glycosyl chains with 3 to 60 glycosyl units are connected by α-1,6 linkages, such that approximately 4-6% of the total number of glycosyl linkages are α-1,6 linkages. Therefore, amylopectin is a much larger molecule with a DP ranging from 5,000 to 500,000 and is much more branched than amylose. Amylose has a helical conformation with a molecular weight of about 10⁴ to about 10⁶ Daltons, while amylopectin has a molecular weight of about 10⁷ to about 10⁸ Daltons. These two types of starch can be easily distinguished or separated by methods well known in the art, for example, by size exclusion chromatography or by their different binding affinity for iodine. Amylose is digested more slowly by α-amylases in the small intestine than amylopectin, the latter. Petition 870190000436, dated 03 / 01 / 2019, page 87 / 233 / 187 with multiple sites for enzymatic hydrolysis, due to its highly branched structure.

[00201] Wild grain starch from Triticum aestivum typically comprises 20%-30% amylose and about 70%-80% amylopectin, as measured by an iodometric method, whereas the grain starch of the invention has an amylose content of about 45% to about 70% on a weight basis. The amylose content may be between 45% and 70%, in some embodiments between 45% and 65%, or about 50%, about 55%, about 60% or about 65%. The higher the level, the more preferred the grain. The proportion of amylose in the starch, as defined herein, is on a weight / weight (w / w) basis, i.e., the weight of amylose as a percentage of the weight of total starch extracted from the grain, with respect to the starch before any fractionation into amylose and amylopectin fractions. The terms "amylose proportion in starch" and "amylose content," when used herein in the context of the grain, flour, or other product of the invention, are essentially interchangeable terms.Amylose content can be determined by any of the methods known in the art, including high-performance liquid chromatography size exclusion (HPLC), for example, in 90% (w / v) DMSO, concanavalin A methods (Megazyme Int, Ireland), or preferably by an iodometric method, for example, in the manner described in Example 1. The HPLC method may involve starch debranching (Batey and Curtin, 1996) or may not involve debranching. It will be understood that methods such as the HPLC method of Batey and Curtin, 1996, which assays only “true amylose,” may underestimate the amylose content in the manner defined herein. Methods such as HPLC or gel permeation chromatography depend on the fractionation of starch into amylose and amylopectin fractions, while iodometric methods depend on differential iodine binding and therefore do not require fractionation.

[00202] Based on the grain weight and amylose content, the amount of Petition 870190000436, dated 03 / 01 / 2019, page 88 / 233 / 187 amylose deposited per grain can be calculated and compared with test and control lines.

[00203] Starch is easily isolated from wheat grain using standard methods, for example, the method of Schulman and Kammiovirta, 1991. On an industrial scale, wet or dry milling can be used. The size of the starch granule is important in the starch processing industry, where there can be separation of the larger A granules from the smaller B granules.

[00204] Commercially grown wild wheat has a grain starch content that is generally in the range of 55-75%, depending somewhat on the cultivar grown. In comparison, the grain of the invention has a starch content of about 25% to about 70%, thus in most embodiments its starch content is reduced relative to the corresponding wild wheat grain. In the embodiments, the starch content of the grain of the invention is between 25% and 65%, between 25% and 60%, between 25% and 55%, between 25% and 50%, between 30% and 70%, between 30% and 65%, between 30% and 60%, between 30% and 55%, or between 30% and 50%. In further embodiments, the starch content is about 35%, about 40%, about 45%, about 50%, about 55%, about 60% or about 65% as a percentage of the grain weight (w / w). The starch content of the grain of the invention may also be defined on a relative basis, i.e., with respect to the starch content of the corresponding wild-type grain.In these varieties, the starch content ranges from approximately 50% to approximately 90%, or from 50% to 80%, from 50% to 75%, from 50% to 70%, from 60% to 90%, or from 60% to 80%, each relative to that of wild-type grain. The starch content can also be between 90% and 100% relative to the starch content of wild-type grain. In each case, the comparison can be made by growing the plants under the same conditions, for example, in field tests.

[00205] Flour, starch granules and bran of the invention can be obtained from the grain by a milling process, optionally followed by a Petition 870190000436, dated 03 / 01 / 2019, page 89 / 233 / 187 separation or sieving process. Purified starch can also be obtained from the grain by a milling process, for example, a wet milling process, followed by further separation of the starch from the protein, oil and fiber of the grain. As used herein, the term "milled product" refers to a product produced from the milling of the grain, preferably wheat grain of the invention, and includes flour (e.g., wholemeal flour), bran (also known as wheat bran), bran (including the germ) and starch granules. The bran is generally in the form of granular particles and includes bran and germ of the grain, and typically comprises about 18% protein, 20-30% starch, and about 5-6% lipid. This fraction of the milling process is relatively nutrient-dense compared to white flour.Grain shape is a characteristic that can impact the commercial usefulness of a plant, since grain shape can affect the ease or other manner in which the grain can be crushed. Grinding yield is an important parameter for the commercial usefulness of the grain. The grinding yield of the grain of the invention can be reduced by at least 10% compared to wild-type grain, but alternatively it can be about the same as wild-type grain.

[00206] In another aspect, the invention provides starch granules or starch obtained from the grain of the plant of the invention. The starch in the granules has a higher proportion of amylose and a reduced proportion of amylopectin compared to wild wheat starch granules. The initial product of the milling process is a mixture or composition that includes starch granules such as, for example, white flour or wholemeal flour, and the invention therefore includes such granules. Wild wheat starch granules comprise proteins bound to the starch granule, including GBSS, SSI, SBEIIa and SBEIIb among other proteins, and therefore the presence of these proteins distinguishes wheat starch granules from starch granules of other cereals. In contrast, the starch granules from the wheat grain of the Petition 870190000436, dated 03 / 01 / 2019, page 90 / 233 / 187 invention comprises wheat GBSS, including the GBSS polypeptides encoded for each of the A, B, and D genomes of hexaploid wheat, but are reduced in relation to the SSIIa polypeptide; in fact, some embodiments lack SSIIa polypeptide. These starch granules may also comprise reduced levels of one or more, or all of the SSI, SBEIIa, and SBEIIb wheat polypeptides, even if the wheat grain is wild-type with respect to the genes encoding these enzymes. The wheat grain starch granules of the invention are typically distorted in shape and surface morphology when observed under optical microscopy, see example 7, particularly for wheat grain with an amylose content of at least 45% or at least 50% as a percentage of the total starch in the grain.In one embodiment, at least 50%, preferably at least 60% or at least 70%, more preferably at least 80% of the starch granules obtained from the grain of the invention exhibit distorted shape and / or surface morphology. The starch granules also show a loss of birefringence when observed under polarized light. See, for example, Example 7 herein to determine the incidence of birefringence. For example, less than 50% or less than 25% of the starch granules show the “Maltese cross,” which is observed when wild-type starch granules are observed under polarized light.

[00207] The starch from starch granules can be purified by removing proteins after breaking and dispersing the starch granules by thermal and / or chemical treatment. The grain starch, the starch from starch granules, and the purified starch of the invention can be further distinguished by one or more or all of the following properties: i) its amylose content is at least 45% (w / w), preferably between 45% and 70% on a weight basis, or at least 50% (w / w), or about 60% (w / w) of amylose as a proportion of the total starch; ii) comprise at least 2% resistant starch, Petition 870190000436, dated 01 / 03 / 2019, p. 91 / 233 / 187 preferably at least 3% resistant starch; iii) starch is distinguished by a reduced glycemic index (GI); iv) starch granules that are distorted in shape; (v) starch granules with reduced birefringence when viewed under polarized light; vi) starch distinguished by a reduced volume of swelling; vii) modified chain length distribution and / or branching frequency in starch; viii) starch distinguished by a reduced peak at the gelatinization temperature; ix) starch distinguished by a reduced peak in viscosity; x) reduced starch paste temperature; xi) molecular weight with a reduced amylose peak, as determined by size exclusion chromatography; xii) reduced starch crystallinity; and xiii) reduced proportion of type A and / or type B starch, and / or increased proportion of type V crystalline starch; each property being related to starch granules or wild wheat starch.

[00208] The flour or starch of the invention can also be distinguished by its swelling volume in excess heated water, compared to starch or flour. Swelling volume is typically assessed by mixing either a starch or flour with excess water and heating at elevated temperatures, typically over 90°C. The sample is then collected by centrifugation and the swelling volume is expressed as the mass of the sedimented material divided by the dry weight of the sample. A low swelling characteristic is used where it is desired to increase the starch content of a food preparation, in particular a hydrated food preparation. Petition 870190000436, dated 03 / 01 / 2019, page 92 / 233 / 187 The flour and starch of the invention preferably exhibit a smaller swelling volume, for example, 30-70% less than wild wheat flour or starch.

[00209] An assessment of an altered amylopectin structure is the chain length distribution, or the degree of starch polymerization. The chain length distribution can be determined using fluorophore-assisted carbohydrate electrophoresis (FACE) after isoamylase debranching. The amylopectin starch of the invention may exhibit a chain length distribution in the range of 5 to 60, or in a sub-range such as SD 7-11, which is greater than the chain length distribution of corresponding wild-type plant starch, and / or reduced in frequency in other sub-ranges, for example, SD 12-24. See, for example, Example 7 here. Starch with longer chain lengths will also exhibit a proportional decrease in branching frequency. The grain starch of the invention is distinctly different from wheat grain starch with reduced SBEIIa activity (Regina et al., 2006), where grain amylopectin comprises a greater proportion of the DP 4-12 chain length fraction compared to wild-type grain amylopectin, as assessed after isoamylase debranching the amylopectin. The difference can be easily determined by FACE.

[00210] In another aspect of the invention, wheat starch may exhibit an altered gelatinization temperature, preferably a reduced gelatinization temperature, which is rapidly assessed by differential scanning calorimetry (DSC). Gelatinization is the heat-directed collapse (rupture) of molecular order in the starch granule in excess water, with concomitant and irreversible changes in properties such as granular swelling, crystallite melting, loss of birefringence, viscosity development, and starch solubilization. The gelatinization temperature may be either increased or decreased, Petition 870190000436, dated 01 / 03 / 2019, p. 93 / 233 / 187 compared to wild-type plant starch, depending on the length of the remaining amylopectin chain. High-amylose starch from maize amylose extender (ae) mutants showed a higher gelatinization temperature than normal maize (Fuwa et al., 1999; Krueger et al., 1987).

[00211] The gelatinization temperature, in particular the onset temperature of the first peak or the temperature for the apex of the first peak, may be reduced by at least 3°C, preferably at least 5°C or more preferably at least 7°C, as measured by DSC, compared to starch extracted from a similar but unaltered grain. The starch may comprise a high level of resistant starch, with an altered structure indicated by specific physical characteristics, including one or more of the group consisting of physical inaccessibility to digestive enzymes which may be due to altered starch granule morphology, the presence of considerable starch associated with lipid, altered crystallinity, and altered amylopectin chain length distribution. The higher proportion of amylose also contributes to the level of resistant starch when the starch has been heated and then cooled.

[00212] The wheat starch structure of the present invention may also differ, in that the degree of crystallinity is reduced and / or the type of crystallinity is modified, compared to starch isolated from wild wheat grain. Crystallinity is typically investigated by X-ray crystallography. Reduced crystallinity of a starch is also known to be associated with better organoleptic properties and contributes to a smoother mouthfeel.

[00213] The invention also provides wheat grain, flour, wholemeal flour, starch granules and grain starch comprising higher amounts of dietary fiber, through at least a high level of RS, but also through increased levels of other components of Petition 870190000436, dated 03 / 01 / 2019, page 94 / 233 / 187 dietary fiber such as arabinoxylans, β-glucans, and fructans. As used herein, “dietary fiber” (DF) or “total dietary fiber” (TDF) means the sum of carbohydrate polymers in food that are not digested in the small intestine of a healthy human subject and that provide physiological benefit in the large intestine. As used herein, DF is different from “total fiber content” (below). DF is not digested and absorbed in the small intestine but passes into the colon where it can be degraded by bacteria. DF includes RS, non-α-glucan oligosaccharides, and non-starch polysaccharides (NSPs), such as arabinoxylans, β-glucans, and fructans. Fiber is generally divided into forms that are soluble in water (soluble fiber) or not (insoluble fiber), and residual fiber.The most health-promoting fraction of dietary fiber in wild wheat grain is soluble fiber, which mainly comprises the AX component, since wild-type starch is very low in RS. In contrast, in oats and barley, soluble fiber is mainly BG. The National Heart Foundation of Australia recommends a daily intake of 3035 g of DF for cardiovascular and colonic health. A variety of candidate genes have been identified in wheat that affect dietary fiber content (Quraishi et al., 2011), but none at the level provided by the grain of the invention. DF can be assessed by the AOAC 991.43 method (Megazyme).

[00214] As used herein, a “prebiotic” is a non-digestible food ingredient (by human digestive enzymes) that beneficially affects a subject by selectively stimulating the growth and / or activity of one or a limited number of bacteria in the colon after passing through the small intestine. For example, fructans and BG cannot be digested except by bacterial activity, but they can alter the composition of human gut microbes by specific fermentation, producing short-chain carboxylic acids, including acetate, propionate, and butyrate.

[00215] In embodiments, the wheat grain, flour, starch granules, and starch of the invention provide modified digestive properties, such as Petition 870190000436, dated 03 / 01 / 2019, page 95 / 233 / 187 increased resistant starch. As used herein, “resistant starch” (RS) refers to starch and starch digestion products that are not absorbed in the small intestine of healthy individuals but enter the large intestine. This is defined in terms of a percentage of the total starch in the grain, or a percentage of the total starch content in the food, depending on the context. Therefore, resistant starch excludes products digested and absorbed in the small intestine. RS is therefore part of the dietary fiber content of the food ingredient (flour, etc.) or food product of the invention.Resistant starch (RS) is divided into five categories: physically inaccessible starch (RSI), such as in incompletely ground grain; resistant starch granules (RSII), such as those found to a small extent in potatoes and green bananas; retrograded starch (RSIII), which is formed when gelatinized starch is cooled for an extended period of time; chemically modified starch (RSIV), such as that formed by etherifying or esterifying free hydroxyl groups on glycosyl residues; and starch capable of forming complexes between amylose or long branched amylopectin chains with lipids (RSV) (Birt et al., 2013). RSIII is especially formed from longer amylose chains that tend to recrystallize and form retrograded starch after gelatinization. The RS in starch-based products with a high amylose content is mainly retrograded amylose (Hung et al., 2006).The increased resistant starch content (RS) of the grain, starch granules, starch, and products thereof of the invention is known to be due to an increase in the levels of RSII and RSV, and in RSIII after retrogradation, if the starch is heated and then cooled, relative to the corresponding wild-type product. The starch-lipid association, as measured by the crystallinity of complex V, is also likely to contribute to the resistant starch level, increasing the RSV component due to the increased lipid content in the grain of the invention. Some starch may also be in an RSI form, being somewhat inaccessible. Petition 870190000436, dated 03 / 01 / 2019, page 96 / 233 / 187 for processing.

[00216] Several methods are available to assess RS levels in food ingredients or feed, all depending on an initial removal of digestible starch using enzymes that hydrolyze enzymes (Dupuis et al., 2014). The RS estimation by the Prosky method (AOAC 985.29) uses gravimetric determination of dietary fiber after digestion with α-amylase, glucoamylase, and protease (Prosky et al., 1985). The McCleary method (AOAC 2009.01) is the official AOAC method and is commercially available (Megazyme International, Ireland). It is the preferred method for assessing RS, see example 1 here. In this assay, non-resistant starch is solubilized by treatment with pancreatic α-amylase, the RS is recovered and dissolved in 2 M KOH, and then hydrolyzed to glucose with amyloglucosidase and evaluated.

[00217] In the embodiments, the starch contains between 2% and 20%, between 2% and 18%, between 3% and 18%, between 3% and 15%, or between 5% and 15% resistant starch on a weight basis, as a percentage of the total starch content. In the embodiments, the RS content is increased between 2% and 10 times relative to a corresponding food ingredient or food product prepared with an equivalent amount of wild-type wheat starch. In the embodiments, the RS content is increased by approximately 3%, approximately 4%, approximately 5%, approximately 6%, approximately 7%, approximately 8%, or approximately 9% relative to the wild type. The extent of increased RS can be adjusted by mixing the products of the invention with a corresponding wild-type product. The altered starch structure and, in particular, the high amylose levels of the starch of the invention give rise to an increase in SR when consumed in food.RS exhibits beneficial physiological effects associated with the metabolic products released during its fermentation in the intestine (Topping and Clifton, 2001), particularly butyrate, propionate, and acetate of SCFAs, and is efficient in reducing postprandial blood glucose levels. Petition 870190000436, dated 03 / 01 / 2019, page 97 / 233 / 187

[00218] The grain, food ingredients and food products produced from these of the invention can be advantageously used for the provision in the diet of, or production of, compositions enriched with β-glucan, cellulose, fructan or arabinoxylan, based on the increased levels of these components in the grain of the invention. Cereal grain cell walls are complex and dynamic structures composed of a variety of polysaccharides such as cellulose, xyloglucans, pectin (rich in galacturonic acid residues), callose (1,3-εD-glucan), arabinoxylans (arabino-1,4β-D-xylan, hereinafter AX) and BG, as well as polyphenols such as lignin. In the cell walls of grasses and some other monocotyledonous plants, glucuronoarabinoxylans and BG predominate, and the levels of pectic polysaccharides, glucomannans, and xyloglucans are relatively low (Carpita et al., 1993).These polysaccharides are synthesized by a large number of diverse polysaccharide synthases and glycosyltransferases, with at least 70 gene families present in plants and, in many cases, multiple elements from gene families.

[00219] As used herein, the term “(1,3;1,4)-εD-glucan”, also referred to as “β-glucan” and abbreviated here as “BG”, refers to an essentially linear polymer of unsubstituted and essentially unbranched β-glucopyranosyl monomers, covalently linked primarily through 1,4 linkages with some 1,3 linkages. The glucopyranosyl residues, linked by 1,4 and 1,3 linkages, are arranged in a non-repetitive, but not random, manner; that is, the 1,4 and 1,3 linkages are not arranged randomly, but equally they are not arranged in regular, repeating sequences (Fincher, 2009a, 2009b). Most (about 90%) of the 1,3-linked residues follow 2 or 3 1,4-linked residues in wheat BG, as in oat and barley BG. Therefore, BG can be considered as a chain primarily of β-1,4-linked celotriosyl groups (each with 3 glucopyranosyl residues) and celotriosyl units (each with 4 residues of Petition 870190000436, dated 03 / 01 / 2019, page 98 / 233 / 187 glucopyranosyl) linked together by single β-1,3 linkages with approximately 10% of cellodextrin units linked to longer β-1,4 linkages of four to about ten glucopyranosyl residues linked to 1,4, up to about 28 glucopyranosyl residues (Fincher and Stone, 2004). Typically, BG polymers have at least 1,000 glycosyl residues and adopt an extended conformation in aqueous media. The ratio of tri- to tetra-saccharide units (DP3 / DP4 ratio) varies between species and is therefore characteristic of BG from a species. BG from different cereals differ in their solubility, with oat BG being more soluble than wheat BG. This is considered to be related to the DP3 to DP4 ratio of the BG polymer.

[00220] In wild wheat grain, BG levels are higher in the whole grain than in the endosperm (Henry, 1985). The BG content of wild whole wheat grain was about 0.6% on a weight basis, compared to about 4.2% for barley, 3.9% for oats, and 2.5% for rye (Henry 1987). In wild wheat grain, the range was 0.4-1.4% by weight (Lazaridou et al., 2007). Wheat grain BG typically has a SD3 / SD4 ratio of 3-4.5 (Lazaridou et al., 2007). While barley BG has been associated with decreased plasma cholesterol, reduced glycemic index, and reduced risk of colon cancer, wheat BG has not been associated with these effects, since wheat grain has much lower BG levels than barley. The BG level in the grain is commonly assessed by grinding the grain into wholemeal flour and evaluating it in relation to BG, for example, by the method described in example 1.

[00221] In wild wheat grain, the fructan level is only 0.6%-2.6% by weight of the grain. As used herein, the term “fructan” means fructose polymers comprising fructosyl residues polymerized into a single terminal glucose unit. Fructans are synthesized from sucrose, accounting for the terminal glucose. The fructose moieties are linked to each other by β-1,2 and / or β-2,6 linkages, and the glucose Petition 870190000436, dated 03 / 01 / 2019, page 99 / 233 / 187 can be linked to the end of the chain by an α-1,2 linkage, as occurs in sucrose, being formed by repeated fructosyl transfer from sucrose. The enzymes involved in fructan synthesis include sucrose fructosyltransferase (EC 2.4.1.99), which forms ketose, and both 1- and 6-fructan fructosyltransferase (EC 2.4.1.100). The degree of polymerization (DP) varies from 3 to several hundred, but is typically 3-60, and in the grain of the invention mainly DP 3-10. In view of this composition, fructans are very soluble in water and do not precipitate in 78% ethanol. The linkages between fructosyl residues are either exclusively of the β-1,2 type, forming a linear molecule (inulin) in which the fructosyl residues are attached to the fructosyl residue of the initiating sucrose, or of the β-2,6 type (levano), or both types of linkage occur in branched fructans (graminans).Graminans, which comprise β-2,6-linked fructose units with β-1,2 branching points and are therefore more complex structures, may also be present in cereals and can be mixed with levans. The fructan level in the grain of the invention is commonly assessed by grinding the grain into wholemeal flour and testing for fructans, for example, by the method described in Example 1, which is based on that of Prosky and Hoebregs (1999). The method relies on the hydrolysis of fructans, followed by the determination of related sugars.

[00222] Fructans are non-starch carbohydrates with potentially beneficial effects as a food ingredient on human health (Tungland and Meyer, 2002; Ritsema and Smeekens, 2003). The human digestive enzymes α-glucosidase, maltase, isomaltase, and sucrase are unable to hydrolyze fructans due to the β-configuration of fructan linkages. Furthermore, humans and other mammals lack the fructan exohydrolase enzymes in their small intestines that break down fructans; therefore, dietary fructans bypass digestion in the small intestine and reach the large intestine intact. However, bacteria are able to ferment them. Petition 870190000436, dated 03 / 01 / 2019, page 100 / 233 / 187 fructans and can thus utilize them, for example, as a source of energy or carbon for growth and production of short-chain fatty acids (SCFAs). Therefore, dietary fructans are capable of stimulating the growth of beneficial bacteria such as bifidobacteria in the colon, which help prevent intestinal disorders such as constipation and infection by pathogenic intestinal bacteria. Dietary fructans also improve the absorption of nutrients from diets, particularly calcium and iron, possibly through the production of SCFAs, which in turn reduces luminal pH and modifies calcium speciation and consequently solubility, or exerts a direct effect on the mucosal transport pathway, thus improving bone mineralization and reducing the risk of iron deficiency anemia.Furthermore, a diet high in fructans may improve the health of patients with diabetes and reduce the risk of colon cancers by suppressing abnormal crypt foci, which are precursors to colon cancer (Kaur and Gupta, 2002). Similarly, fructans have a sweet taste and are increasingly used as low-calorie sweeteners and functional food ingredients.

[00223] The production of isolated fructan from the grain of the invention is economical compared to existing methods of fructan production, for example, involving the extraction of inulins from chicory. Large-scale fructan extraction can be achieved by grinding the grain into whole wheat flour and then extracting the total sugars, including fructans, from the flour in water. This can be carried out at room temperature, and the mixture is then centrifuged or filtered. The supernatant is then heated to about 80°C and centrifuged to remove proteins, then dried. Alternatively, flour extraction can be carried out using 80% ethanol, with subsequent phase separation using water / chloroform mixtures, and the aqueous phase containing sugars and fructan is dried and redissolved in water. The sucrose in the extract prepared in this way can be removed. Petition 870190000436, dated 03 / 01 / 2019, page 101 / 233 / 187 enzymatically by the addition of α-glucosidase, and then hexoses (monosaccharides) are removed by gel filtration to produce fructan fractions of various sizes. This can produce a fructan-enriched fraction of at least 50%, preferably at least 60% or at least 70%, more preferably at least 80% fructan.

[00224] Development of a small-scale fructan assay. The fructan content in cereal grains and their derived food products is commonly assessed using high-performance liquid chromatography (HPLC) (Huynh et al., 2008) or spectrophotometry (McCleary et al., 2000; McCleary et al., 2013; Steegmans et al., 2004). The official AOAC 999.03 (AOAC, 2000b) method based on spectrophotometry has been commercialized as the K-FRUCHK and K-FRUC kits by Megazyme International Limited (Bray, Ireland). These commercial kits are convenient and easy to assess fructan levels in cereal grains (Karppinen et al., 2003; Whelan et al., 2011). In the K-FRUCHK assay, sucrose and low-polymerized (DP) maltosecaccharides are hydrolyzed to fructose and glucose. Their concentration is evaluated using a hexokinase / phosphoglucose isomerase / glucose 6-phosphate dehydrogenase (HK / PGI / G6PGH) system and a spectrophotometer.Following fructan hydrolysis, the total concentration of fructose and glucose is reassessed, and the fructan content is then determined by the difference between the two measurements. In the K-FRUC assay, sucrose, maltose, maltodextrins, and starch are hydrolyzed into fructose and glucose, which are further reduced by sodium borohydride to the corresponding sugar alcohols (sorbitol and mannitol). Fructose and glucose derived from fructan hydrolysis are coupled to 4-hydroxybenzoic acid hydrazide (PAHBAH) to develop color in a boiling water bath, and their absorbance is read using a spectrophotometer to calculate the fructan content.

[00225] A simplified enzymatic hydrolysis, followed by HPLC analysis, was recently developed to screen the fructan content in a Petition 870190000436, dated 03 / 01 / 2019, page 102 / 233 / 187 double-haploid (DH) wheat population (Huynh et al., 2008b). There is a need for accurate and rapid assessment of fructan content in high-reproducing populations with hundreds to thousands of lines. However, all current fructan assays used in cereal grains are relatively low-efficiency, allowing about 10 samples per day per worker, and requiring several grams of each flour sample. In order to develop high-throughput fructan assays, the inventors reduced the KFRUCHK and K-FRUC assays to a plate format to allow this, as described in Example 1.

[00226] Arabinoxylan is another polysaccharide found in plant cell walls, including the cell walls in wheat grain. The levels of arabinoxylan in the grain and flour of the invention are increased relative to the corresponding wild-type grain and flour, for example, by at least 1.5-fold or at least 2-fold on a weight basis. The level may be increased between 1.5-fold and 3-fold. As used herein, “arabinoxylan” (AX) refers to a main linear chain portion of β-D-xylopyranosyl residues linked via 1,4 glycosidic linkages, with α-L-arabinofuranosyl residues attached to some of the xylopyranosyl residues at O-2, O-3, and / or both O-2,3 positions. Xylopyranosyl residues are any of the following: monosubstituted at O-2 or O-3, disubstituted at O-2,3, and unsubstituted.Lateral branches may contain, in addition to arabinose residues, small amounts of xylopyranose, galactopyranose, α-D-glucuronic acid, or 4-O-methyl-α-D-glucuronic acid residues. In cereals, the Ara / Xyl ratio can vary from 0.3 to 1.1. AX of the outer pericarp, scutellum, and embryonic axis are relatively highly substituted by arabinose, while those of the aleurone and hyaline layer are less substituted. AX may additionally comprise hydrocinnamic acids, ferulic acid, and p-coumaric acid, which are esterified at O-5 of arabinose residues linked to O-3 of xylose residues (Smith et al.). Petition 870190000436, dated 03 / 01 / 2019, page 103 / 233 / 187 Hartley, 1983). The biosynthesis of the main part of 1,4-εD-xylan is catalyzed by 1,4-ε-xylosyltransferase, which uses UDP-D-xylose as a substrate and transfers the xylose unit to the non-reducing end of a xylo-oligosaccharide chain.

[00227] The synthesis of AX in cereals involves xylotransferases that use UDP-Xyl as a substrate and may involve a tetrasaccharide complex as an oligonucleotide initiator (Carpita et al., 2011). Arabinoxylans are only slightly soluble in water and require alkaline solvents for their efficient extraction. For example, barium hydroxide can selectively extract AX (Gruppen et al., 1992). Conversely, sodium hydroxide extracts both BG and AX. The level of AX in the grain is commonly assessed by grinding the grain into wholemeal flour and testing for AX, for example, by the method described in Example 1.

[00228] Studies using AX corn, rye and wheat have demonstrated positive effects on cecal fermentation, SCFA production, reduction of serum cholesterol and improved absorption of calcium and magnesium (Hopkins et al. 2003).

[00229] As used herein, cellulose refers to a crystalline arrangement of approximately 24–36 (1–4)-εD-glucan chains that form microfibrils, found predominantly in plant cell walls. This is one of the most abundant polymers found in nature. The glucan chains are formed by cellulose synthase of the CesA gene family in the plasma membrane (Giddings et al., 1980), and 24 to 36 chains are thus assembled into a functional microfibril. Arabidopsis possesses 10 CesA genes, at least 3 of which are co-expressed during primary cell wall formation and three others during secondary cell wall formation (Carpita et al., 2011), each adding glycosyl residues to the non-reducing end of acceptor glucan chains to extend the polymers. The CesA genes are related to the Csl genes of both Petition 870190000436, dated 03 / 01 / 2019, page 104 / 233 / 187 monocotyledons as well as dicotyledons, which are involved in the synthesis of other polysaccharides. For example, the CslF and CslH enzymes found only in grasses, including cereals, are involved in the synthesis of BG.

[00230] Food products prepared from grain, food ingredients, starch granules, and starch are distinguished by a lower glycemic index. GI is a simple marker for the effect of carbohydrate-rich foods on postprandial blood glucose levels in human subjects. As used herein, “glycemic index” or “GI” means an assessment of the area under the curve of blood glucose concentrations after eating a portion of a test food containing 50 g of carbohydrate, divided by the incremental area achieved with the same amount of carbohydrate present in an equivalent amount of glucose or white bread. Therefore, GI refers to the rate of digestion of food comprising starch and absorption of digestion products, and is a comparison of the effect of a tested food with the effect of white bread or glucose on excursions in blood glucose concentration.GI is thus an assessment of the effect of food on postprandial serum glucose concentration and is associated with insulin demand for blood glucose homeostasis. An important characteristic provided by foods of the invention is a reduced GI compared to a corresponding food prepared with the same amount of wild wheat, flour, starch granules, or starch as a food ingredient. Furthermore, the foods of the invention may exhibit a reduced level of final digestion and, consequently, be relatively low in calories compared to a corresponding food prepared with the same amount of wild wheat as a food ingredient. A low-calorie product may be based on the inclusion of flour produced from crushed wheat grain. Such foods may have the effect of being filling, improving intestinal health, and reducing... Petition 870190000436, dated 03 / 01 / 2019, page 105 / 233 / 187 postprandial serum glucose and lipid concentration, as well as providing a low calorific value food product.

[00231] The GI of starch of the invention, or a food ingredient or food product of the invention, is readily assessed using an in vitro assay in the manner described in Example 9 herein. The in vitro assay simulates the digestion of starch in the products as occurs upon consumption in healthy humans and is predictive of the GI as measured in human subjects after consumption of the products.

[00232] The method of treating the subject, particularly humans, may comprise the step of administering altered wheat grain, flour, starch, or a food or beverage product, as defined herein, to the subject in one or more doses, in an amount and for a period of time whereby the level of one or more intestinal health or metabolic indicators improves. The indicator may change in relation to the consumption of a corresponding unaltered wheat starch, or wheat or wheat product, within a period of up to 24 hours, as in the case of some indicators such as pH, elevation of SCFA levels, postprandial glucose fluctuation, or it may take days, as in the case of increased fecal volume or improved laxation, or perhaps longer, on the order of weeks or months, as in the case where butyrate-enhanced proliferation of normal colonocytes is assessed. It may be desirable that the administration of the altered starch, or wheat, or wheat product be prolonged.However, there are good prospects for compliance by the individual being treated, given the relative ease with which the altered starch can be administered.

[00233] Dosages may vary depending on the condition being treated or prevented, but are intended for humans to be at least 10 g of wheat grain or starch of the invention per day, more preferably at least 15 g per day, preferably at least 20 g or at least 30 g per day. Administration of more than about 100 grams per day may require Petition 870190000436, dated 01 / 03 / 2019, p. 106 / 233 / 187 considerable volumes of release and reduced compliance. Above all, preferably, the dosage for a human is between 10 and 100 g of wheat grain of the invention, or flour, wholemeal flour or modified starch of the invention per day, or for adult humans between 20 and 100 g per day.

[00234] Indicators of better gut health may include, but are not necessarily limited to: i) lower pH of the intestinal contents, ii) increase in the total concentration of SCFAs or total amount of SCFAs in the intestinal contents, iii) increase in the concentration or amount of one or more SCFAs in the intestinal contents, iv) increase in fecal volume, v) increased total intestinal or fecal water volume without diarrhea, vi) increased laxity, vii) increased number or activity of one or more species of probiotic bacteria, viii) increased fecal bile acid excretion, ix) reduced urinary levels of putrefaction products, x) reduced fecal levels of putrefaction products, xi) increased proliferation of normal colonocytes, xii) reduced inflammation in the intestine of individuals with inflamed bowel or a tendency toward inflamed bowel, xiii) reduced levels in the feces or large intestine of any of urea, creatinine, and phosphate in uremic patients, and xiv) any combination of the above.

[00235] Indicators of improved metabolic health may include, but are not necessarily limited to: i) stabilization of postprandial glucose fluctuations, Petition 870190000436, dated 03 / 01 / 2019, page 107 / 233 100 / 187 ii) improved (lower) glycemic response, iii) reduced pro-prandial plasma insulin concentration, iv) improved blood lipid profile, v) decreased plasma LDL cholesterol, vi) reduced plasma levels of one or more urea, creatinine, and phosphate in uremic patients, vii) an improvement in a dysglycemic response, or viii) any combination of the above.

[00236] The pH of the intestinal contents can be reduced by at least 0.1 units, preferably by at least 0.15 or 0.2 units. Each of the other indicators of intestinal health or metabolic health can be improved by at least 10%, preferably by at least 20%.

[00237] It will be understood that a benefit of the present invention is that it provides products, such as bread, that are of particular nutritional benefit and, moreover, does so without the need to modify the starch or other constituents of the wheat grain after harvest. However, it may be desirable to modify the starch or other constituent of the grain, and the invention includes such a modified constituent. Modification methods are well known and include extraction of the starch or other constituent by conventional methods and modification of starches to increase their resistant form. Starch can be modified by heat and / or moisture treatment, physically (e.g., ball mill), enzymatically (using, for example, α- or β-amylase, pulalanase or similar), chemical hydrolysis (wet or dry, using liquid or gaseous reagents), oxidation, cross-linking with dysfunctional reagents (e.g., sodium trimetaphosphate, phosphorus oxychloride), or carboxymethylation.

[00238] Although the invention is particularly used in the treatment or prophylaxis of humans, it should be understood that the invention is also applicable to non-human subjects including, but not limited to, animals. Petition 870190000436, dated 01 / 03 / 2019, pp. 108 / 233 101 / 187 agricultural animals such as cows, sheep, pigs and the like, domestic animals such as dogs or cats, laboratory animals such as rabbits, or rodents such as mice, rats, hamsters, or animals that can be used for sport, such as horses. The method may be particularly applicable to non-ruminant mammals or animals such as monogastric mammals. The invention may also be applicable to other agricultural animals, for example, domestic poultry including, for example, chickens, geese, ducks, turkeys, or quails, or fish.

[00239] The terms “polypeptide” and “protein” are generally used interchangeably herein. The terms “proteins” and “polypeptides” as used herein also include variations, mutants, modifications and / or derivatives of the polypeptides of the invention, as described herein. As used herein, “substantially purified polypeptide” refers to a polypeptide that has been separated from the lipids, nucleic acids, other peptides and other molecules with which it is associated in its natural state. Preferably, the substantially purified polypeptide is at least 60% free, more preferably at least 75% free, and most preferably at least 90% free of other components with which it is naturally associated. “Recombinant polypeptide” means a polypeptide prepared using recombinant techniques, i.e., by expressing a recombinant polynucleotide in a cell, preferably a plant cell and most preferably a wheat cell.In one embodiment, the polypeptide exhibits amido synthase enzyme activity, particularly SSIIa activity, and is at least 98% identical to an SSIIa polypeptide described herein.

[00240] The percentage identity of a polypeptide with respect to a reference polypeptide can be determined by any program known in the art for aligning amino acid sequences, such as the GAP program (Needleman and Wunsch, 1970, GCG program) with a Petition 870190000436, dated 01 / 03 / 2019, p. 109 / 233 102 / 187 gap creation penalty = 5, and a gap extension penalty = 0.3. The analysis aligns the two sequences relative to the full-length amino acid sequence of the reference sequence. For example, if the reference sequence is the amino acid sequence shown as SEQ ID NO:1, the alignment is along the full length of SEQ ID NO:1. A gap in an aligned sequence is considered a non-identity position for each missing amino acid.

[00241] With respect to a defined polypeptide, it will be understood that the % of identity figures greater than those previously provided will include preferred embodiments. Thus, where applicable, in light of the minimum % of identity figures, it is preferable that the polypeptide comprise an amino acid sequence that is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the SEQ ID NO indicated as relevant.

[00242] Amino acid sequence deletions or insertions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues, and typically about 1 to 5 contiguous residues. However, they may Petition 870190000436, dated 01 / 03 / 2019, p. 110 / 233 103 / 187 being larger than 15 amino acids, up to the total length of the polypeptide. The polypeptide sequence may be a truncated sequence relative to the corresponding wild-type sequence or reference SEQ ID NO. For example, if the protein-coding region encoding the polypeptide has a premature translation termination codon (stop codon), the resulting polypeptide, if translated, will be truncated. The extent of the truncation depends on the position of the stop codon, decreasing the polypeptide by at least 5%, preferably at least 10%, relative to the wild-type sequence.

[00243] The protein-coding region of a gene of the invention may be disrupted by the presence of a mutation at the junction site, which causes a missplice and may result in an altered RNA transcript, such that the open reading frame is interrupted. The amino acid sequence of the polypeptide may then be identical to the wild type up to or downstream of the missplice, and thereafter diverge from the wild type. Such polypeptides are generally affected in their activity in the same way as a truncated polypeptide. Examples of stop codons and junction site mutations in an SSIIa gene are described in Example 11 herein.

[00244] Substitutional mutants have at least one amino acid residue removed from the polypeptide and a different residue inserted in its place. The sites of greatest interest for substitutional mutagenesis for reduced polypeptide activity include sites identified as the active site(s). Other sites of interest are those in which particular residues obtained from various strains or species are identical, i.e., conserved amino acids. These positions are likely important for biological activity. These amino acids, especially those in a contiguous sequence of at least three other identically conserved amino acids, are preferably substituted in a way Petition 870190000436, dated 03 / 01 / 2019, page 111 / 233 104 / 187 relatively conservative, in order to maintain function such as SSIIa enzymatic activity, or in a non-conservative manner for reduced activity. Conservative substitutions are shown in Table 3 under the heading “exemplary substitutions”. “Non-conservative amino acid substitutions” are defined here as substitutions other than those listed in Table 3 (Exemplary conservative substitutions). Non-conservative substitutions in an SSIIa polypeptide are expected to reduce enzyme activity and many will correspond to an SSIIa encoded by a “partial loss of function mutant SSIIa gene”. Table 2. Amino acid subclassification Amino Acid Subclasses Acidic Aspartic acid, glutamic acid Basic Non-cyclic: Arginine, lysine; Cyclic: Histidine Altered Aspartic acid, glutamic acid, arginine, lysine, histidine Small Glycine, serine, alanine, threonine, proline Polar / neutral Asparagine, histidine, glutamine, cysteine, serine, threonine Polar / large Asparagine, glutamine Hydrophobic Tyrosine, valine, isoleucine, leucine, methionine, phenylalanine, tryptophan Aromatic Tryptophan, tyrosine, phenylalanine Residues that influence chain orientation Glycine and proline Table 3. Conserved, exemplary, and preferred amino acid substitutions Original residue Exemplary conservative substitutions Preferred conservative substitutions Ala Val, Leu, Ile Val Arg Lys, Gln, Asn Lys Asn Gln, His, Lys, Arg Gln Asp Glu Glu Cys Ser Ser Gln Asn, His, Lys, Asn Glu Asp, Lys Asp Gly Pro Pro His Asn, Gln, Lys, Arg Arg Ile Leu, Val, Met, Ala, Phe Leu Leu Ile, Val, Met, Ala, Phe Ile Lys Arg, Gln, Asn Arg Met Leu, Ile, Phe Leu Phe Leu, Val, Ile, Ala Leu Pro Gly Gly Ser Thr Thr Thr Ser Ser Trp Tyr Tyr Tyr Trp, Phe, Thr, Ser Phe Val Ile, Leu, Met, Phe, Ala Leu

[00245] In some embodiments, the present invention involves modification of gene activity, particularly of SSIIa gene activity, Petition 870190000436, dated 03 / 01 / 2019, pages 112 / 233 105 / 187 combinations of mutant genes, and the construction and use of chimeric genes. As used herein, the term “gene” includes any deoxyribonucleotide sequence that includes a protein-coding region, or one that is transcribed in a cell but not translated, along with associated non-coding and regulatory regions. The term “gene” also includes mutant forms of a wild-type gene, whose mutant genes cannot be transcribed and / or translated, for example, as if a promoter region had been deleted. Associated non-coding and regulatory regions are typically located adjacent to the protein-coding region at both the 5' and 3' ends, at a distance of about 2 kb on each side.In this regard, the gene includes control signals such as promoters, enhancers, transcription termination signals and / or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is said to be a "chimeric gene". Sequences located 5' from the protein-coding region and present in mRNA are said to be 5' untranslated sequences (5'-UTR). Sequences located 3' or downstream from the protein-coding region and present in mRNA are said to be 3' untranslated sequences (3'-UTR). The term "gene" includes both cDNA and genomic forms of a gene. A "cDNA" is a DNA copy of an RNA transcript of a gene, and is described here as "corresponding to the gene". For example, the cDNA nucleotide sequence shown as SEQ ID NO:4 corresponds to the SSIIa-A gene, whose wild-type sequence is shown as SEQ ID NO:7.The term “gene” includes synthetic or fusion molecules that encode the proteins of the invention described herein. Genes are commonly present in the wheat genome as double-stranded DNA. A chimeric gene can be introduced into an appropriate vector for extrachromosomal maintenance in a cell or for integration into the host genome. In the manner used herein, genes or... Petition 870190000436, dated 03 / 01 / 2019, pages 113 / 233 106 / 187 genotypes are said in italicized form (e.g., SSIIa), while proteins, enzymes, or phenotypes are said in non-italicized form (SSIIa).

[00246] As used herein, the term “genotype” refers to the genetic makeup of a cell, tissue, plant, plant part, or wheat plant product. The genetic makeup will be identical to that of the wheat plant from which the product was obtained. As used herein, the term “phenotype” refers to an observable characteristic, or set of multiple characteristics, of the cell, tissue, plant, plant part, or plant product that result from the interaction between the plant's genotype and the environment in which the plant was grown.

[00247] A genomic form or clone of a gene containing the coding region can be interrupted with non-coding sequences called “introns” or “intervening regions” or “intervening sequences.” An “intron,” as used herein, is a segment of a gene that is transcribed as part of a primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or “switched on” from the nuclear or primary transcript; therefore, introns are absent in messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers. “Exons,” as used herein, refer to the DNA regions that correspond to RNA sequences that are not present in the mature mRNA, or the mature RNA molecule in cases where the RNA molecule is not translated. An mRNA functions during translation to specify the sequence or order of amino acids in an encoded polypeptide.

[00248] The present invention relates to various polynucleotides. As used herein, a “polynucleotide”, or “nucleic acid”, or “nucleic acid molecule” means a polymer of nucleotides, which may be DNA or RNA and includes, for example, cDNA, mRNA, tRNA, siRNA, shRNA, hpRNA and single-stranded or double-stranded DNA. It may be DNA or RNA of Petition 870190000436, dated 01 / 03 / 2019, pp. 114 / 233 107 / 187 cellular, genomic, or synthetic origin. Preferably, the polynucleotide is composed only of DNA or only of RNA, as occurs in a cell. The polymer can be single-stranded, essentially double-stranded, or partially double-stranded. An example of a partially double-stranded RNA molecule is a hairpin RNA (hpRNA), small hairpin RNA (shRNA), or self-complementary RNA, which includes a double-stranded stem formed by base pairing between a nucleotide sequence and its complement, and a loop sequence that covalently links the nucleotide sequence and its complement. Base pairing as used here refers to standard base pairing between nucleotides, including G:U base pairs in an RNA molecule. “Complementary” means that two polynucleotides are capable of base pairing along part of their lengths, or along the entire length of one or both (fully complementary).

[00249] “Isolated” means material that is substantially or essentially free of components that generally accompany it in its natural state. As used herein, an “isolated polynucleotide” or “isolated nucleic acid molecule” means a polynucleotide that is at least partially separated from, preferably substantially or essentially free from, the polynucleotide sequence of the same type with which it is associated or linked in its natural state. For example, an “isolated polynucleotide” includes a polynucleotide that has been purified or separated from the sequences that flank it in a naturally occurring state, for example, a DNA fragment that has been removed from the sequences that are generally adjacent to the fragment. Preferably, the isolated polynucleotide is also at least 90% free of other components, such as proteins, carbohydrates, lipids, etc.The term "recombinant polynucleotide," as used herein, refers to a polynucleotide formed in vitro by manipulating nucleic acid into a non-recombinant form. Petition 870190000436, dated 03 / 01 / 2019, pages 115 / 233 108 / 187 commonly found in nature. For example, recombinant polynucleotides may be in the form of an expression vector. In general, such expression vectors include transcriptional and translational regulatory nucleic acids, operably connected to the nucleotide sequence to be transcribed in the cell.

[00250] The present invention relates to the use of oligonucleotides that can be used as “probes” or “oligonucleotide primers”. As used herein, “oligonucleotides” are polynucleotides of up to 50 nucleotides in length, preferably 15-50 nucleotides in length. They can be RNA, DNA, or combinations or derivatives thereof. Oligonucleotides are typically relatively short single-stranded molecules of 10 to 30 nucleotides, commonly 15-25 nucleotides in length, typically comprising 10-30 or 15-25 nucleotides, which are identical to, or complementary to, part of an SSIIa gene or cDNA corresponding to an SSIIa gene. When used as a probe or as an oligonucleotide primer in an amplification reaction, the minimum size of an oligonucleotide like this is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence in a target nucleic acid molecule.Polynucleotides used as a probe are typically conjugated with a detectable label, such as a radioisotope, an enzyme, biotin, a fluorescent molecule, or a chemiluminescent molecule. Oligonucleotides and probes of the invention are used in methods of detecting an allele of an SSIIa gene, or other gene, associated with a trait of interest, for example, modified starch. Such methods employ nucleic acid hybridization and, in many examples, include extension of the primer oligonucleotide by a suitable polymerase, for example, in the manner used in PCR for detection or identification of wild-type or mutant alleles. Preferred oligonucleotides and probes hybridize. Petition 870190000436, dated 01 / 03 / 2019, pp. 116 / 233 109 / 187 in an SSIIa gene sequence from wheat or other cereals, including any of the sequences described here, for example, SEQ ID NOs: 15 to 49. Preferred oligonucleotide pairs are those spanning one or more introns, or a portion of an intron, and therefore can be used to amplify an intron sequence in a PCR reaction. Several examples are provided in the Examples here.

[00251] The terms “polynucleotide variant,” and “variant,” and similar terms refer to polynucleotides that exhibit substantial sequence identity with a reference polynucleotide sequence and that are capable of functioning in a manner analogous to, or with the same activity as, the reference sequence. These terms also include polynucleotides that are distinguished from a reference polynucleotide by the addition, deletion, or substitution of at least one nucleotide, or that exhibit, when compared to naturally occurring molecules, one or more mutations. In this way, the terms “polynucleotide variant” and “variant” include polynucleotides in which one or more nucleotides have been added or deleted, or substituted with different nucleotides.In this regard, it will be well understood in the art that certain alterations, including mutations, additions, deletions, and substitutions, can be made to a reference polynucleotide, whereby the altered polynucleotide retains the biological function or activity of the reference polynucleotide. Thus, these terms include polynucleotides that encode polypeptides exhibiting enzymatic or other regulatory activity, or polynucleotides capable of functioning as selective probes or other hybridization agents. The terms "polynucleotide variation" and "variation" also include naturally occurring allelic variations. Mutants can be either naturally occurring (meaning isolated from a natural source) or synthetic (e.g., performing local-directed mutagenesis in the nucleic acid). Preferably... Petition 870190000436, dated 03 / 01 / 2019, pages 117 / 233 110 / 187 a polynucleotide variation of the invention encoding a polypeptide with enzymatic activity exhibits at least 90% in length relative to the wild type, up to the full gene length.

[00252] A variation of an oligonucleotide of the invention includes molecules of varying sizes that are capable of hybridizing, for example, in the wheat genome at a position close to that of the specific oligonucleotide molecules defined herein. For example, variations may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or fewer nucleotides, provided they still hybridize in the target region. Furthermore, a few nucleotides may be substituted without influencing the oligonucleotide's ability to hybridize in the target region. In addition, variations can be easily designed which hybridize close (for example, but not limited to, within 50 nucleotides) in the region of the plant genome where the specific oligonucleotides defined herein hybridize.

[00253] “Corresponds to” or “corresponding to”, in the context of polynucleotides or polypeptides, means a polynucleotide (a) with a nucleotide sequence that is substantially identical or complementary to at least a portion of, preferably all of (fully complementary), a reference polynucleotide sequence, or (b) that encodes an amino acid sequence identical to an amino acid sequence in a polypeptide. This term also includes within its scope a polypeptide with an amino acid sequence that is substantially identical to an amino acid sequence in a reference polypeptide.Terms used to describe sequence relationships between two or more polynucleotides or polypeptides include "reference sequence," "sequence identity," "percent sequence identity," "substantial identity," and "identical," and are defined with respect to a defined minimum number of nucleotides or amino acid residues, or preferably with respect to the full length. The terms "identity" and "identity" are also used to describe sequence relationships between two or more polynucleotides or polypeptides. Petition 870190000436, dated 03 / 01 / 2019, pages 118 / 233 111 / 187 of sequence” and “identity” are used interchangeably here to refer to the extent to which sequences are identical on a nucleotide-by-nucleotide base or an amino acid-by-amino acid base, with respect to a comparison window. Thus, a “percent sequence identity” is calculated by comparing two sequences aligned optimally with respect to the comparison window, determining the number of positions where the identical nucleic acid base (e.g., A, T, C, G, U) or the identical amino acid residue occurs in both sequences to yield the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percent sequence identity.

[00254] The % identity of a polynucleotide to a reference polynucleotide can be determined by any program known in the art for this purpose, such as, for example, GAP (Needleman and Wunsch, 1970, GCG program) with a gap creation penalty of 5 and a gap extension penalty of 0.3. Reference is also made to the BLAST family of programs, for example, as described by Altschul et al., 1997. A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al., 1994-1998, chapter 15. Unless otherwise stated, alignment is performed along the entire length of the reference sequence.

[00255] Nucleotide or amino acid sequences are indicated as “essentially similar” when such sequences exhibit a sequence identity of at least 98%, more particularly at least about 98.5%, very particularly about 99%, especially about 99.5%, half especially about 99.8%, and includes when the sequences are identical. It is evident that, when RNA sequences are described as essentially similar to, or exhibit a certain degree of Petition 870190000436, dated 01 / 03 / 2019, pp. 119 / 233 112 / 187 sequence identity with, DNA sequences, thymine (T) in the DNA sequence is considered equal to uracil (U) in the RNA sequence.

[00256] With respect to the defined polynucleotides, it will be understood that a higher % of identity figures will include the preferred embodiments. Thus, where applicable, in light of the minimum % of identity figures, it is preferable that the polynucleotide comprises a polynucleotide sequence that is at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant SEQ ID NO.

[00257] In some embodiments, the present invention relates to the severity of hybridization conditions to define the extent of complementarity of two polynucleotides. “Severity,” as used herein, refers to temperature and ionic concentration conditions, and the presence or absence of certain organic solvents, during hybridization. The greater the severity, the greater the degree of complementarity between a target nucleotide sequence and the labeled polynucleotide sequence. “Severe conditions” refers to temperature and ionic conditions under which only nucleotide sequences with a high frequency of complementary bases will hybridize. As used herein, the term “hybridizes under conditions of Petition 870190000436, dated 03 / 01 / 2019, pages 120 / 233 113 / 187 low severity, medium severity, high severity, or very high severity” describes conditions for hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, NY (1989), 6.3.1-6.3.6, incorporated here by reference.The specific hybridization conditions described here are as follows: 1) low severity hybridization conditions in sodium chloride / sodium citrate (SSC) 6X at approximately 45°C, followed by two washes in SSC 0.2X, SDS 0.1% at 50-55°C; 2) medium severity hybridization conditions in SSC 6X at approximately 45°C, followed by one or more washes in SSC 0.2X, SDS 0.1% at 60°C; 3) high severity hybridization conditions in SSC 6X at approximately 45°C, followed by one or more washes in SSC 0.2X, SDS 0.1% at 65°C; and 4) Hybridization conditions in very high severity are 0.5 M sodium phosphate, 7% SDS at 65°C, followed by one or more washes in 0.2 X SSC, 1% SDS at 65°C.

[00258] As used herein, a “chimeric gene” or “genetic construct” refers to any gene that is not a natural gene in its natural location, i.e., it has been artificially manipulated, including a chimeric gene or genetic construct that is integrated into the wheat genome. Typically, a chimeric gene or genetic construct comprises regulatory and transcribed protein-coding sequences that are not found together in nature. Thus, a chimeric gene or genetic construct may comprise regulatory and coding sequences that are derived from different sources, or regulatory and coding sequences derived from the same source but arranged in a manner different from that found in nature.The term “endogenous” is used here to refer to a substance that is normally produced in an unmodified plant at the same developmental stage as the plant under investigation, preferably a wheat plant, such as starch or an SSIIa polypeptide gene. An “endogenous gene” refers to a gene. Petition 870190000436, dated 01 / 03 / 2019, pp. 121 / 233 114 / 187 natural in its natural location in the genome of an organism, preferably an SSIIa gene in a wheat plant. The terms “external polynucleotide”, or “exogenous polynucleotide”, or “heterologous polynucleotide” and the like refer to any nucleic acid that is introduced into the genome of a cell by experimental manipulations, preferably the wheat genome, but which does not occur naturally in the cell. These include modified forms of gene sequences found in this cell, provided that the introduced gene contains some modification, for example, an introduced mutation or the presence of a selectable marker gene, with respect to the naturally occurring gene. External or exogenous genes may be genes found in nature that are inserted into a non-natural organism, natural genes introduced into a new location in the natural host, or chimeric genes or genetic constructs.The term "genetically modified" includes introducing genes into cells, mutating genes in cells, and artificially altering or modulating the regulation of a gene in a cell by modifying the genome, or organisms in which these acts have been performed, or their offspring or parts, such as grain.

[00259] The present invention relates to elements that are operably connected or linked. “Operably connected,” or “operably linked,” and similar terms refer to a linkage of polynucleotide elements in a functional relationship. Typically, operably connected nucleic acid sequences are linked contiguously and, where necessary to join two protein-coding regions, contiguous and in the reading frame. A coding sequence is “operably connected to” another coding sequence when RNA polymerase transcribes the two coding sequences into a single RNA, which, if translated, is then translated into a single polypeptide with amino acids derived from both coding sequences. The coding sequences need to be contiguous to each other so that the expressed sequences are ultimately Petition 870190000436, dated 03 / 01 / 2019, pages 122 / 233 115 / 187 processed to produce the desired protein.

[00260] As used herein, the term “cis-action sequence”, “cis-action element”, or “cis-regulatory region”, or “regulatory region”, or similar term shall be considered to mean any nucleotide sequence that regulates the expression of the gene sequence. This may be a naturally occurring cis-action sequence in its natural context, for example, regulating a wheat SSIIa gene, or a sequence in a genetic construct that, when appropriately positioned relative to a gene sequence that is expressive, regulates its expression. A cis-regulatory region such as this may be able to activate, silence, enhance, repress, or otherwise alter the level of expression, and / or cell type specificity, and / or developmental specificity of a gene sequence at the transcriptional or post-transcriptional level.For example, the presence of an intron in the 5'-leader (UTR) of genes has been shown to improve gene expression in monocotyledonous plants such as wheat (Tanaka et al., 1990). Another type of cis-acting sequence is a matrix attachment region (MAR), which can influence gene expression by anchoring active chromatin domains to the nuclear matrix.

[00261] “Vector” means a nucleic acid molecule, preferably a DNA molecule derived from a plasmid or plant virus, into which a nucleic acid sequence can be inserted. The vector may also include a selection marker, such as an antibiotic resistance gene that can be used for selection of suitable bacterial or plant transformants, or sequences that enhance the transformation of prokaryotic or eukaryotic cells (especially wheat), such as T-DNA or P-DNA sequences. Examples of such resistance genes and sequences are well known to those skilled in the art.

[00262] “Marker gene” means a gene that transmits a distinct phenotype to cells that express the marker gene and thus allows such Petition 870190000436, dated 01 / 03 / 2019, pp. 123 / 233 116 / 187 Transformed cells are distinguished from cells that do not have the marker, and are well known in the art. A “selectable marker gene” confers a characteristic for which one can “select” based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment that damages non-transformed cells), or based on a growth advantage in the presence of a metabolizable substrate. Exemplary selectable marker genes for plant transformant selection include, but are not limited to, a hyg gene that confers resistance to hygromycin B; a neomycin phosphotransferase (npt) gene that confers resistance to kanamycin and the like, for example, in the manner described by Potrykus et al., 1985; a glutathione-S-transferase gene from rat liver that confers resistance to glutathione-derived herbicides, for example, in the manner described in EPA-256223; a glutamine synthetase gene that confers, through overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin, for example, as described in WO87 / 05327; an acetyltransferase gene from Streptomyces viridochromogenes that confers resistance to the selective agent phosphinothricin, for example, as described in EP-A-275957; a gene encoding a 5-enolshikimate-3-phosphate synthase (EPSPS) that confers tolerance to N-phosphonomethylglycine, for example, as described by Hinchee et al., 1988; a bar gene that confers resistance against bialaphos, for example, as described in WO91 / 02071; or a nitrilase gene such as bxn from Klebsiella ozaenae, which confers resistance to bromoxynil (Stalker et al., 1988).Preferred triage markers include, but are not limited to, a uidA gene encoding a β-glucuronidase (GUS) enzyme for which several chromogenic substrates are known, a β-galactosidase gene encoding an enzyme for which chromogenic substrates are known, and an aequorin gene (Prasher et al., 1985), which can be employed in detection by... Petition 870190000436, dated 01 / 03 / 2019, pp. 124 / 233 117 / 187 calcium-sensitive bioluminescence; a green fluorescent protein gene (GFP, Niedz et al., 1995) or one of its variations; a luciferase (luc) gene (Ow et al., 1986) that allows detection by bioluminescence, and others known in the art.

[00263] In some embodiments, the level of enzymatic activity is modulated by decreasing the expression level of genes encoding the enzyme in the wheat plant, or by increasing the expression level of a nucleotide sequence encoding the enzyme in a wheat plant. The highest expression can be achieved at the transcriptional level using promoters of different concentrations or inducible promoters, which are capable of controlling the level of transcription expressed from the coding sequence. Heterologous sequences that can be introduced encode transcription factors that modulate or enhance gene expression, whose products downregulate starch synthesis, such as SSIIa. The gene expression level can be modulated by altering the number of copies per cell of a construct comprising the coding sequence and a transcriptional control element that is operably connected to it and is functional in the cell.Alternatively, a plurality of transformants can be selected and subjected to screening for those with a favorable level and / or specificity of transgene expression arising from influences of endogenous sequences around the transgene integration site. A favorable level and standard of transgene expression is one that results in a substantial increase in amylose content in the wheat plant. This can be detected simply by testing the transformants.

[00264] The reduction in gene expression can also be achieved through the introduction and transcription of a “chimeric gene silencer” into the wheat plant. The chimeric gene silencer is preferably introduced stably into the wheat genome, preferably into the wheat nuclear genome, so that it is inherited. Petition 870190000436, dated 01 / 03 / 2019, pp. 125 / 233 118 / 187 stably in the progeny. As used herein, “gene silencing effect” refers to the reduction in expression of a target nucleic acid in a wheat cell, preferably an endosperm cell during seed development while the plant is growing, which can be achieved by introducing a silencing RNA. In a preferred embodiment, a chimeric gene silencing gene encoding an RNA molecule is introduced, which reduces the expression of one or more endogenous genes, for example, genes other than the SSIIa genes, or preferably the three endogenous SSIIa genes. Such a reduction may be the result of transcriptional reduction, including by methylation of promoter regions via chromatin remodeling, or post-transcriptional modification of RNA molecules, including by RNA degradation, or both. Gene silencing should not necessarily be understood as an abolition of the expression of the target nucleic acid or gene.It is sufficient that the expression level of the target nucleic acid in the presence of the silencing RNA be lower than in its absence. The expression level of the targeted gene can be reduced by at least about 40%, or at least about 45%, or at least about 50%, or at least about 55%, or at least about 60%, or at least about 65%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or efficiently eliminated to an undetectable level.

[00265] Antisense techniques can be used to reduce gene expression in wheat cells. The term “antisense RNA” will be understood as an RNA molecule that is complementary to at least a portion of a specific mRNA molecule and capable of reducing the expression of the gene encoding the mRNA, preferably an SSIIa gene. Such reduction typically occurs in a sequence-dependent manner, and is known to occur through interference with a post-transcriptional event, such as Petition 870190000436, dated 03 / 01 / 2019, pages 126 / 233 119 / 187 transport mRNA from the nucleus to the cytoplasm, stability or inhibition of mRNA translation. The use of antisense methods is well known in the technique (see, for example, Hartmann and Endres, 1999).

[00266] As used here, “artificially introduced dsRNA molecule” refers to the introduction of a double-stranded RNA (dsRNA) molecule, preferably synthesized in the wheat cell by transcription of a chimeric gene encoding such a dsRNA molecule. RNA interference (RNAi) is particularly used to specifically reduce the expression of a gene or inhibit the production of a particular protein, also in wheat (see, for example, Regina et al., 2006). This technology depends on the presence of dsRNA molecules containing a sequence that is essentially identical to the mRNA of the gene of interest or part thereof, and its complement, thus forming a dsRNA.Conveniently, dsRNA can be produced from a single promoter in the host cell, where sense and antisense sequences are transcribed to produce a hairpin RNA, in which the sense and antisense sequences hybridize to form the dsRNA region with a related (in an SSIIa gene) or unrelated sequence, forming a loop structure; thus, the hairpin RNA comprises a stalk-like loop structure. The design and production of suitable dsRNA molecules for the present invention is well within the capabilities of those skilled in the art, particularly considering Waterhouse et al., 1998; Smith et al., 2000; WO 99 / 32619; WO 99 / 53050; WO 99 / 49029; and WO 01 / 34815.

[00267] The DNA encoding dsRNA typically comprises both sense and antisense sequences, arranged as an inverted repeat. In a preferred embodiment, the sense and antisense sequences are separated by a spacer region that may (or may not) comprise an intron which, when transcribed into RNA, is spliced. This arrangement has been shown to result in greater gene silencing efficiency (Smith et al., Petition 870190000436, dated 01 / 03 / 2019, pp. 127 / 233 120 / 187 (2000). The double-stranded region may comprise one or two RNA molecules, transcribed from either one or two DNA regions. dsRNA can be classified as long hpRNA, with long sense and antisense regions that may be highly complementary, but need not be fully complementary (typically larger than about 200 bp, for example, between 200 and 1000 bp). An hpRNA can also be very small, with the double-stranded portion ranging in size from about 30 to about 42 bp, but not much larger than 94 bp (see WO04 / 073390). The presence of the double-stranded RNA region is known to trigger a response from an endogenous plant system that destroys both the double-stranded RNA and the homologous RNA transcription of the target plant gene(s), efficiently reducing or eliminating the target gene activity.

[00268] The length of the hybridizing sense and antisense sequences may each have at least 19 or at least 21 contiguous nucleotides, preferably at least 30 or 50 nucleotides, and more preferably at least 100, 200, 500, or 1000 nucleotides. The total sequence length corresponding to the entire gene transcript may be used. The lengths above all preferably have 100–2000 nucleotides. The degree of identity of the sense and antisense sequences with the target transcript may be at least 85%, preferably at least 90%, and more preferably 95–100%. The longer the sequence, the less stringent the requirement for complete sequence identity. The RNA molecule may certainly comprise unrelated sequences that may function to stabilize the molecule.The promoter used to express the dsRNA construct can be any type of promoter expressed in cells that express the target gene, preferably a promoter that is preferentially expressed in the endosperm of the developing wheat grain, relative to non-grain-associated tissues of the wheat plant. When the target gene is SSIIa or... Petition 870190000436, dated 03 / 01 / 2019, pages 128 / 233 121 / 187 another gene selectively expressed in the endosperm, an endosperm-specific promoter is preferred, which is not expressed in the leaf or stem tissues, so as not to affect the expression of the target gene(s) in other tissues.

[00269] In the manner used here, “silencing RNAs” are RNA molecules that have 21 to 24 contiguous nucleotides that are complementary to a region of mRNA transcribed from the target gene, preferably SSIIa. The sequence of 21 to 24 nucleotides is preferably fully complementary to a sequence of 21 to 24 contiguous nucleotides of the mRNA, that is, identical to the complement of the 21 to 24 nucleotides of the mRNA region. However, mRNA sequences that have up to five mismatches in the mRNA region can also be used (Palatnik et al., 2003), and base pairing may involve one or two GU base pairs. When not all 21 to 24 nucleotides of the silencing RNA are able to base pair with the mRNA, it is preferable that there are only one or two mismatches between the 21 to 24 nucleotides of the silencing RNA and the mRNA region.With regard to mRNAs, it is preferable that any of the mismatches, up to a maximum of five, be found at the 3' end of the mRNA. In a preferred embodiment, there are no more than one or two mismatches between the silencing RNA sequences and its target mRNA.

[00270] Silencing RNAs are derived from larger RNA molecules that are encoded by the chimeric DNAs of the invention. The larger RNA molecules, also referred to herein as "precursor RNAs," are the initial products produced by transcription from the chimeric DNAs in wheat cells, and exhibit a partially double-stranded nature formed by intramolecular base pairing between complementary regions. The precursor RNAs are processed by a specialized class of RNases, commonly referred to as "Dicer(s)," into silencing RNAs, typically 21 to 24 nucleotides in length. Silencing RNAs, in the manner described herein Petition 870190000436, dated 01 / 03 / 2019, pp. 129 / 233 122 / 187 used, include small interfering RNAs (ssiRNAs) and micro RNAs (smiRNAs), which differ in their biosynthesis. siRNAs are derived from completely or partially double-stranded RNAs with at least 21 contiguous base pairs, including possible GU base pairs, without mismatches or unpaired nucleotides protruding from the double-stranded region. These double-stranded RNAs are formed from a single self-complementary transcript that forms by folding around itself and forming a stalk-like loop structure, here referred to as a "hairpin RNA," or from two separate RNAs that are at least partially complementary and that hybridize to form a double-stranded RNA region.Subsynonymous RNAs (smRNAs) are produced by processing longer single-stranded transcripts that include complementary regions that are not fully complementary, thus forming an imperfect base-pair structure with mismatched nucleotides or base pairs that do not match in the partially double-stranded structure. The base-pair structure may also include GU base pairs. Processing precursor RNAs to form smRNAs leads to the preferential accumulation of one or more small, distinct RNAs, each with a specific sequence, the smRNA(s). These are derived from one strand of the precursor RNA, typically the "antisense" strand of the precursor RNA, whereas processing long complementary precursor RNAs to form siRNAs produces a population of siRNAs that are not uniform in sequence but correspond to many portions and from both strands of the precursor.

[00271] Precursor RNAs of the invention, also referred to herein as “artificial mRNA precursors”, are typically derived from naturally occurring mRNA precursors by altering the nucleotide sequence of the mRNA portion of the naturally occurring precursor so that it is complementary, preferably fully complementary, to the nucleotide region 21 to 24 of the target mRNA, and altering the Petition 870190000436, dated 03 / 01 / 2019, pages 130 / 233 123 / 187 nucleotide sequence of the complementary region of the miRNA precursor that pairs bases in the miRNA sequence to maintain base pairing. The remainder of the miRNA precursor RNA may be unchanged and thus have the same sequence as the naturally occurring miRNA precursor, or it may also be altered in sequence by nucleotide substitutions, nucleotide insertions, or preferably nucleotide deletions, or any combination thereof. The remainder of the miRNA precursor RNA is known to be involved in structure recognition by the Dicer enzyme, called Dicer type 1 (DCL1), and therefore it is preferable that few alterations, if any, are made to the remainder of the structure. For example, nucleotide base pairs may be substituted for other nucleotide base pairs without major alteration to the overall structure.The naturally occurring mRNA precursor, from which the artificial mRNA precursor of the invention is derived, may be from wheat, another plant such as another cereal plant, or non-plant sources. Examples of such precursor RNAs are the mi395 precursor from rice, the mi159b precursor from Arabidopsis, or the mi172 precursor. The use of artificial mRNAs has been demonstrated in plants, for example, Alvarez et al., 2006; Parizotto et al., 2004; Schwab et al., 2006.

[00272] Another molecular biological approach that can be used to downregulate endogenous gene expression is co-suppression. The mechanism of co-suppression is not well understood, but it is known to involve post-transcriptional gene silencing (PTGS) and, in this respect, may be very similar to many examples of antisense suppression. It involves introducing an extra copy of a gene or a fragment thereof into a plant in the “sense orientation,” with respect to a promoter for its expression, which, as used here, refers to the same orientation of transcription and translation (if it occurs) of the sequence with respect to the sequence in the target gene. The size of the sense fragment, its Petition 870190000436, dated 03 / 01 / 2019, pages 131 / 233 124 / 187 correspondence with target gene regions, and their degree of homology with the target gene are the same as for the antisense sequences described previously. In some examples, the additional copy of the gene sequence interferes with the expression of the plant target gene. Reference is made to the descriptive report of patent WO 97 / 20936 and the descriptive report of European patent 0465572 for methods of implementing co-suppression approaches.

[00273] Any of these technologies for reducing gene expression can be used to coordinately reduce the activity of multiple genes. For example, an RNA molecule can be targeted against a family of related genes by targeting a region of the genes that is common. Alternatively, unrelated genes can be targeted by including multiple regions in an RNA molecule, each region targeting a different gene. This can be easily accomplished by fusing the multiple regions under the control of a single promoter.

[00274] Numerous techniques are available for introducing nucleic acid molecules into a wheat cell, which are well known to those skilled in the art. The term “transformation,” as used herein, means alteration of the genotype of a cell, for example, a bacterium or a plant, particularly a wheat plant, by the introduction of an external or exogenous nucleic acid. “Transformant” means an organism thus altered. The introduction of DNA into a wheat plant by crossing parental plants or by mutagenesis per se is not included in transformation. The nucleic acid molecule may be replicated as an extrachromosomal element, or is preferably stably integrated into the plant genome. “Genome” means the total inherited genetic complement of the cell, plant, or part of the plant, and includes chromosomal DNA, plastid DNA, mitochondrial DNA, and extrachromosomal DNA molecules. In one embodiment, a transgene is integrated into the Petition 870190000436, dated 01 / 03 / 2019, pp. 132 / 233 125 / 187 wheat nuclear genome, which in hexaploid wheat includes subgenomes A, B and D, here referred to as “genomes” A, B and D.

[00275] The most commonly used methods for producing fertile transgenic wheat plants comprise two steps: the release of DNA into regenerable wheat cells and plant regeneration via in vitro tissue culture. Two methods are commonly used to release the DNA: DNA-T transfer using Agrobacterium tumefaciens or related bacteria, and targeted DNA introduction via particle bombardment, although other methods have been used to integrate DNA sequences into wheat or other cereals. It will be evident to those skilled in the art that the particular choice of a transformation system for introducing a nucleic acid construct into plant cells is not essential, or a limitation of the invention, provided that it achieves an acceptable level of nucleic acid transfer. Such techniques for wheat are well known in the art.

[00276] Transformed wheat plants can be produced by introducing a nucleic acid construct, according to the invention, into a recipient cell and growing a new plant comprising and expressing a polynucleotide according to the invention. The process of growing a new plant from a transformed cell that is in cell culture is referred to here as “regeneration”. Regenerable wheat cells include cells from mature embryos, meristematic tissue such as mesophyll cells from the base of the leaf, or preferably from the scutellum of immature embryos, obtained 12-20 days after anthesis, or callus derived from any of these. The most commonly used route to recover regenerated wheat plants is somatic embryogenesis, using media such as MS agar supplemented with an auxin, such as 2,4-D, and a low level of cytokinin (see Sparks and Jones, 2004).

[00277] The transformation of wheat mediated by Agrobacterium can be Petition 870190000436, dated 01 / 03 / 2019, pp. 133 / 233 126 / 187 performed using the methods of Cheng et al., 1997; Weir et al., 2001; Kanna and Daggard, 2003 or Wu et al., 2003. Any Agrobacterium strain with sufficient virulence can be used, preferably strains with additional virulence gene functions such as LBA4404, AGL0 or AGL1 (Lazo et al., 1991), or C58 versions. Agrobacterium-related bacteria can also be used. The DNA that is transferred (T-DNA) from Agrobacterium to recipient wheat cells is included in a genetic construct (chimeric plasmid), which contains one or two end regions of a T-DNA region of a wild-type Ti plasmid flanking the nucleic acid to be transferred. The genetic construct may contain two or more T-DNAs, for example, where one T-DNA contains the gene of interest and a second T-DNA contains a selectable marker gene, providing independent insertion of the two T-DNAs and possible segregation of the selectable marker gene away from the transgene of interest.The T-DNA vector is preferably a "super-binary" plasmid known in the art.

[00278] Any type of wheat that is regenerable can be used; varieties Bob White, Fielder, Veery-5, Cadenza, and Florida have been reported successfully. Transformation events in one of these more easily regenerable varieties can be transferred to any other wheat cultivar, including elite varieties by standard backcrossing. Other methods involving the use of Agrobacterium include: co-cultivation of Agrobacterium with cultured isolated protoplasts; transformation of seeds, tips, or meristems with Agrobacterium; or inoculation into the plant, such as the floral immersion method for Arabidopsis, as described by Bechtold et al., 1993.

[00279] Another method commonly used to introduce nucleic acid building blocks into a plant cell is high-speed biolistic penetration by small particles (also known as Petition 870190000436, dated 03 / 01 / 2019, pages 134 / 233 127 / 187 particle bombardment or microprojectile bombardment), with the nucleic acid to be introduced contained either in the matrix of spheres or small particles, or on their surface, for example, in the manner described in Klein et al., 1987.

[00280] Preferred selectable marker genes for use in wheat transformation include the bar gene or pat gene of Streptomyces hygroscopicus, along with selection using the herbicide glufosinate ammonium, the hpt gene along with the antibiotic hygromycin, or the nptII gene with kanamycin or G418. Alternatively, positively selectable markers such as the manA gene, which encodes phosphomannose isomerase (PMI) with the sugar mannose-6-phosphate as the sole source of C, can be used.

[00281] The present invention is further described by the following non-limiting examples. EXAMPLE 1: Materials and methods

[00282] Plant material. Three wheat cultivars, each comprising unique null mutations in an SSIIa gene in the A, B, or D genomes, were kindly provided by Dr. M. Yamamori, National Institute of Agrobiological Resources, Tsukuba, Japan. These were Chousen 57 (C57) comprising a null mutation in SSIIa-A and therefore lacking SSIIa-A polypeptide (SGP-A1), Kanto 79 (K79) comprising a null mutation in SSIIa-B and therefore lacking SSIIa-B polypeptide (SGP-B1), and Turkey 116 (T116) comprising a null mutation in SSIIa-D and therefore lacking the SGP-D1 polypeptide (Yamamori et al., 2000).

[00283] Nullisomic / tetrasomic Chinese Spring (CS) strains for the homologous seven-chromosome group, designated N7AT7D, N7BT7D and N7DT7B (Sears and Miller, 1985), were kindly provided by Dr. E. Lagudah (CSIRO Agriculture, Canberra, Australia).

[00284] Wheat plants including C57, K79, T116, three cultivars of Petition 870190000436, dated 03 / 01 / 2019, pages 135 / 233 128 / 187 Australian wheat varieties Sunco, EGA Hume, and Westonia were grown at CSIRO Agriculture, Canberra, in a greenhouse with natural light and temperatures of 18°C ​​(night) and 24°C (day). Mature grain from each variety was harvested and air-dried to a moisture content of approximately 9%. Unless otherwise specified, 5 g of dried grain per variety was milled using a Udy Cyclone mill (Fort Collins, CO, USA) with a 0.5 mm sieve mesh to produce whole wheat flour, or using a Brabender Quadrumat Junior mill (Brabender® GmbH & Co. KG, Duisburg, Germany) to obtain white flour.

[00285] For analysis of proteins and starch in developing and mature grain, as described in Example 12, mutant and wild-type wheat plants (ssIIa and SSIIa, respectively) were obtained from a double-haploid population reported by Konik-Rose et al. (2007). Twenty to forty developing endosperms were collected 15 days after anthesis (DPA) in tubes on dry ice and stored at -80°C for analysis of RNA, soluble proteins, and starch-bound proteins, as described in Example 12. For analysis of protein and starch properties in the grain, the grain was harvested when mature from plants in the greenhouse or grown in the field.

[00286] Analysis of wheat plant DNA. To detect the presence or absence of mutant or wild-type SSIIa alleles by PCR in genomic DNA samples, young leaves were harvested from plants and genomic DNA was extracted using a rapid DNA kit (BIO101 system, Q-BIO gene). For marker-assisted reproduction, primer oligonucleotide pairs JKSS2AP1F (5'-TGCGTTTACCCCACAGAGCA CA-3' (SEQ ID NO:15) located between nucleotides 91 and 113 of the nucleotide sequence, accession number AB201445) and JKSS2AP2R (5'TGCCAAAGGTCCGGAATCATGG-3' (SEQ ID NO:16) located between nucleotides 1225 and 1246 of AB201445) were used for the SSIIa gene of Petition 870190000436, dated 03 / 01 / 2019, pages 136 / 233 129 / 187 genome A (Figure 2); oligonucleotide primers JKSS2BP7F (5'GCGGACCAGGTTGTCGTC-3' (SEQ ID NO:17) located between nucleotides 5978 and 5995 of nucleotide sequence, accession number AB201446) and JLTSS2BPR1 (5'CTGGCTCACGATCCAGGGCATC-3' (SEQ ID NO:18) located between nucleotides 6313 and 6335 of AB201446) for the SSIIa gene of genome B (Figure 3); and oligonucleotide primers JTSS2D3F (5'-GTACCAAGGTATGGGGACTATGAA-3' (SEQ ID NO: 19) located between nucleotides 2369 and 2392 of nucleotide sequence, accession number AB201447) and JTSS2D4R (5'GTTGGAGAGATACCTCAACAGC-3' (SEQ ID NO: 20) located between nucleotides 2774 and 2796 of AB201447) were used for the wheat SSIIa gene of the D genome (Figure 4).

[00287] The PCR reactions contained 50 ng of genomic DNA, 1.5 mM MgCl2, 0.125 mM of each dNTP, 10 pmol of oligonucleotide primers, 0.5 M glycine betaine, 1 μL of dimethyl sulfoxide (DMSO), and 1,53.5 U of Hot-star Taq polymerase (QIAGEN) in reaction volumes of 20 μL. Amplification reactions were performed using a HYBAID PCR Express (Integrated Sciences) with one cycle at 95°C for 5 minutes, 35 melt cycles at 94°C for 45 seconds, annealing temperature of 52°C (genome A) or 60°C (for genomes B and D) for 30 seconds, and extension at 72°C for 2 minutes and 30 seconds, followed by one cycle at 72°C for 10 minutes, followed by cooling to 25°C. The resulting PCR fragments were separated onto 1% or 2% agarose gels and visualized (UVitec) after staining with ethidium. Other standard amplifications used 59°C for the annealing temperature, but otherwise used the same PCR conditions unless otherwise stated.

[00288] Southern Blot hybridization analysis was performed on DNA from a large-scale extraction (9 mL) of lyophilized ground tissues (Stacey and Isaac, 1994). The DNA samples were fitted in Petition 870190000436, dated 03 / 01 / 2019, pages 137 / 233 130 / 187 0.2 mg / mL and digested with restriction enzymes such as BamHI and EcoBl. Restriction enzyme digestion, gel electrophoresis, and vacuum blotting were performed as described by Stacey and Isaac (1994). 32P-labeled probes were produced from cDNA and used for hybridization in Southern blots. Hybridizing sequences were detected by autoradiography according to the method of Jolly et al. (1996).

[00289] RNA extraction and quantitative real-time PCR (qRT-PCR). Total RNA from endosperms at 15 DPA was extracted using a NucleoSpin® Plant RNA Kit (Macherey-Nagel) and quantified using Nanodrop 1000 (Thermo Scientific). Quantities of 0.5 pg of RNA templates were used for cDNA synthesis in 50 pL reactions at 50°C using SuperScript III reverse transcriptase (Invitrogen). The cDNA template (100 ng) was used in a 10 pL qRT-PCR reaction with an annealing temperature of 58°C, using RT-PCR oligonucleotide primers (Table 4). As a quantification control, a pair of oligonucleotide primers was used to amplify a region located in an exon at the 3' end of a tubulin gene. The amplification reactions were performed on a Rotor-Gene 6000 (Corbett), using a Rotor-Gene™ with SYBR® Green PCR Kit (QIAGEN).Comparative quantification was analyzed using tubulin gene fragment amplification as a reference amplification in the Real Time Rotary Analyzer software (Corbett). For each sample, triplicate qRT-PCR reactions were performed. Table 4. QRT-PCR primer oligonucleotides used for RNA expression determination Cereal Name Oligonucleotide Sequence SEQ ID NO Reference Barley ZLBSSI-1RTR3 AAGGTCTCCACCGTGTCTCG AAG 21 This study ZLBSSI-1RTF3 GACGTACAGTTTGTCATGCTT GG 22 This study ZLBSSIIaF CTGCTGGACAGGATATGGAA GTG 23 This study ZLBSSIIaR GTATCACCATAACGGAGCGA CTG 24 This study ARHv2aFl CAATCACTGATGGTGTAACC AAAGG 25 Regina et al., 2010 Petition 870190000436, dated 01 / 03 / 2019, pp. 138 / 233 131 / 187 Cereal Name Oligonucleotide sequence SEQ ID NO Reference ARHv2aR3 CCTTCATGTTGGTCAATAGC AGC 26 Regina etal., 2010 ARHv2bFl CAGAATGGACAAAGAATCAT CCACG 27 Reginaetal., 2010 lHv2bR GAAAATACATCCATGCCTCC ATCG 28 Reginaetal., 2010 Wheat SSIFw AGGGTACAGGGTGGGCGTTC T 29 Sestili etal., 2010 SSIR GTAGGGTTGGTCCACGAAGG 30 Sestili etal., 2010 SSICGCC AATTCCTCW 13 etal., 2010 SSIIR ACGTCCTCGTAGAGCTTGGC 32 Sestili etal., 2010 SBEIIaFw TGACGAATCTTGGAAAATGG 33 Sestili etal., 2010 SBEIIaR GGCGGCATTTATCATAACTA TTG 34 Sestili etal. GTAGATGCGGTCGTTTACTT GA 35 Sestili etal., 2010 SBEIIbR CCAGCCACCTTCTGTTTGTT 36 Sestili etal., 2010 Arroz JLRSSI-RTF GGGCCTTCATGGATCAACC 37 Ohdan et al., 2005 JLCRCRATCCAGTCCATTCATT38 Ohdan et al. al., 2005 JLRSSIIa-RTF CTGGACAGGATCTGGAAGTG AAA 39 This study JLRSSIIa-RTR GGAACCTCAACAGCAGCCTT AC 40 This study JLRSBEIIa-RTF GCCAATGCCAGGAAGATGA 41 Ohdan et al., 2005 JLRSSIIa-RTF-RTB GCGCAACATAGGATGGGTTT 42 Ohdan et al., 2005 sbe2b-f TACGAATTCTCCAGCGGAAT GAGAACACCA 43 Nishi et al., 2001 sbe2b-r TACGGTACCCAAGATGTACA GAAGTGCAGA 44 Nishi et al., 2001 a-tublin-f GGAAATACATGTTGTTGTT 2005, Toyota et al. a-tublin-r TCTCTTCCGTCTTGATGGTTGC A 46 Toyota et al., 2006 Comum JLRHvTaTub-RTF CAGGCTTGTATCCCAGGTCA 47 This study JLRHvTaTub-RTR GCGTAGGAGGAAAGCATGA A 48 This study.

[00290] Isolation of soluble and starch-bound proteins from developing endosperm. Developing endosperms from developing seeds harvested 15 DPA were homogenized and suspended in pre-chilled soluble protein extraction buffer at 1.5 pL / mg (0.25 M K2HPO4, pH 7.5, 0.05 M EDTA, 20% glycerol, Sigma protease inhibitor cocktail, and 0.5 M DTT). The homogenate was centrifuged at 16,000 g for 15 minutes at 4°C. The supernatant containing soluble proteins was used for protein concentration estimation using Coomassie Plus protein assay reagent (Bio-Rad). If desired, samples were stored at -20°C before analysis. Precipitates retained in the soluble protein preparation were Petition 870190000436, dated 03 / 01 / 2019, pages 139 / 233 132 / 187 treated directly with proteinase K after washing with water, and then the starch was purified as follows. Starch-bound proteins were prepared from purified starch according to Rahman et al. (1995) with minor modifications. Starch granules were boiled for 5–10 minutes in protein denaturing extraction buffer (50 mM Tris buffer, pH 6.8, 10% glycerol, 5% SDS, 5% β-mercaptoethanol, and bromophenol blue) at a ratio of 15 pL / mg starch. After centrifugation at 13,000 g for 20 minutes, the supernatant was used for SDS-PAGE analysis.

[00291] Isolation of starch and extraction of starch-bound proteins from mature grains. Whole grains (100-150 mg) from each plant were milled in a ball bearing mill at a speed of 30 rpm for 30 seconds using an MSD WIG-LBUG mixer (United States). The wholemeal flour products were first treated with 12.5 mM NaOH, filtered through 0.5 mm nylon sieves, washed with water three times, and then incubated with 0.5 mg proteinase K in 1 mL of 50 mM phosphate buffer at 37°C for 2 hours. Starch precipitates obtained by centrifugation at 5,000 g were suspended and washed with water three times, followed by centrifugations after each wash. After washing with acetone, the residual starches were air-dried at 37°C overnight. The preparation of starch-bound proteins from mature grain starches was the same as that previously described for starches from the developing endosperm.

[00292] SDS-PAGE and gel staining. For the quantification of protein content in starch, an equal amount of starch (4 mg) was used for the extraction of proteins bound to the starch granule. The same volume of supernatant containing total protein was filled for each sample into Novex 4-12% Bis-Tris Gels (Life Technologies) NuPAGE. This allowed the detection of variation in protein binding patterns from the same amount of starch. Samples containing 20 pg of total protein were Petition 870190000436, dated 01 / 03 / 2019, pp. 140 / 233 133 / 187 used for soluble proteins. SDS-PAGE gels were run and detected in the manner described previously (Butardo et al. 2012).

[00293] Immunoblotting. Antisera against GBSSI, SSI, SSIIa, SBEIIa, and SBEIIb from previous studies are listed and enumerated in Table 5, including their sources and antigen specificities. Western blotting and detection were performed in the manner previously described (Butardo et al. 2012) using the same protein standards as before. Table 5. Polyclonal antibodies used to detect cereal starch synthase proteins. Antibody Dilution Antigen Source Specificity Reference Anti-GBSSI 1:3000 wheat barley, wheat, rice Li et al., 1999 Anti-SSI 1:4000 wheat barley, wheat, rice Rahman et al., 1995 Anti-SSIIa 1:500 rice barley, wheat, rice Kosar-Hashemi et al., 2007 Anti-SBEI 1:2000 wheat barley, wheat, rice Butardo et al., 2012 Anti-SBEIIa 1:2000 wheat, rice barley, wheat, rice Regina et al., 2005 Anti-SBEIIb 1:3000 wheat, rice barley, wheat, rice Regina et al., 2005

[00294] Quantification of protein bands in SDS-PAGE gels and immunoblots. To quantify and compare protein abundance among different genotypes, two protein bands (80 kDa and 60 kDa) in 5 μL of MagicMark™ X-ray protein ladders (Invitrogen) were used as references. After visualizing the protein bands, SDS-PAGE gels and immunoblots were digitized (Epson Perfection 2450 PHOTO; Epson America Inc., CA, USA) into image files for band intensity analysis using the Quantity One software package following prescribed methods (Bio-Rad). The 80 kDa band was used for the quantification of SBEIIa, SBEIIb, and SSIIa, and the 60 kDa band for SSI and GBSSI.

[00295] Mass spectrometry. Gel proteolytic digestion can be performed on selected protein bands from SDS-PAGE gels stained with Coomassie blue. Tandem MS ion trapping can be performed as described by Butardo et al. (2012).Proteins can be identified by uninterrupted MS correlation to entries in SwissProt / TREMBL, using the ProteinLynx Global server (Version 1, Micromass) (Colgrave et al. 2013). Petition 870190000436, dated 03 / 01 / 2019, pages 141 / 233 134 / 187

[00296] Grain weight. The grain was harvested from mature plants, which was obtained when the plants were fully yellowed. The heads were harvested and stored at 37°C for at least two weeks to ensure complete drying, then stored at room temperature if additional storage was required, and then threshed to provide the mature grain. This grain, or wholemeal flour obtained from it, was analyzed in relation to the parameters described herein, which depend on the grain weight as well as the grain weight itself. The grain weight for each wheat lineage was determined from the total weight of 100 grains. The grain moisture content was evaluated with an MPA FT-NIR spectrophotometer (BRUKER); this was typically around 9% on a mature grain weight basis. Parameters that depend on grain weight, such as starch content, BG content, fructan content, etc., as described herein, were calculated on a dry weight basis, assuming a moisture content of 9% (w / w) if not measured by NIR.

[00297] Analysis of lipids in wheat grain. Total lipids from whole wheat flour samples of approximately 300 mg were extracted with a chloroform / methanol / 0.1 M KCl mixture (in a 2:1:1 v / v / v ratio). Fatty acid methyl esters (FAMEs) were prepared by incubating lipid samples in 1 N Methanol-HCl (Supelco, Bellefonte, PA) at 80°C for 2 hours. TAG and polar membrane lipid clusters were fractionated from total lipids by thin-layer chromatography (TLC) (Silica gel 60, Merck, Germany) using a solvent mixture of hexane:diethyl ether:acetic acid (70:30:1, v / v / v), and individual membrane lipid classes were separated by TLC using a solvent mixture of chloroform / methanol / acetic acid / water (90 / 15 / 10 / 3, v / v / v / v). Authentic lipid standards were loaded and run in separate channels on the same plates for lipid class identification.Silica bands, containing individual classes of lipids, were used for preparation. Petition 870190000436, dated 03 / 01 / 2019, pages 142 / 233 135 / 187 FAME, as previously mentioned, and were analyzed by GC-FID 7890A gas chromatography (Agilent Technologies, Palo Alto, CA, United States), which was fitted with a 30 m BPX70 column (SGE, Austin, TX, United States) to quantify individual fatty acids based on the peak area of ​​the known amount of heptadecanoin, which was added as an internal standard.

[00298] Starch extraction. Unless otherwise stated, starch was extracted from grain samples by first milling the grain (10 g) into wholemeal flour using a Cyclone milling machine (Cyclote 1093, Tecator, Sweden). Starch was isolated from wholemeal flour by a protease extraction method (Morrison et al., 1984), and washed with water using 10 mL of water per gram of wholemeal flour at room temperature, removing residues. The starch was then freeze-dried and weighed for analysis. Starch is also isolated on a small scale from developing wheat grain using the method of Regina et al., (2006).

[00299] Starch content. The total starch content of the grain was evaluated by the AACC 76.13 method, using the Total Starch Analysis Kit (K-TSTA) supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland), and calculated on a weight basis as a percentage of the weight of the mature unmilled grain. Subtracting the weight of the starch from the total weight of the grain to provide a total non-starch content of the grain determined whether the reduction in total weight was due to a reduction in starch content.

[00300] Amylose content. Unless otherwise stated, the amylose content of starch samples was determined in triplicate by the iodometric (iodine binding) method of Morrison and Laignelet (1983), with minor modifications as follows. Approximately 2 mg of starch were exactly weighed (accuracy to 0.1 mg) into a 2 mL screw-capped tube fitted with a rubber stopper in the cap. To remove the lipid, 1 mL of 85% (v / v) methanol was mixed with the starch, and the tube was Petition 870190000436, dated 01 / 03 / 2019, pp. 143 / 233 136 / 187 heated in a water bath at 65°C for 1 hour with occasional vortexing. After centrifugation at 13,000 g for 5 minutes, the supernatant was carefully removed and the extraction step was repeated. The starch was then dried at 65°C for 1 hour and dissolved in urea-dimethyl sulfoxide (UDMSO; 9 volumes of dimethyl sulfoxide in 1 volume of 6 M urea) solution, using 1 mL of UDMSO per 2 mg of starch. The mixture was immediately vigorously vortexed and incubated in a water bath at 95°C for 1 hour, with intermittent vortexing for complete starch dissolution. An aliquot of the starch-UDMSO solution (50 pL) was treated with 20 pL of I2KI reagent containing 2 mg of iodine and 20 mg of potassium iodide per mL of water. The mixture was made up to 1 mL with water. The absorbance of the mixture at 620 nm was evaluated by transferring 200 pL to a microplate and reading the absorbance using an Emax Precision microplate reader (Molecular Devices, United States).Standard samples containing 0 to 100% amylose, and 100% to 0% amylopectin were prepared from potato amylose (Sigma catalog number A-0512) and potato amylopectin (Sigma catalog number A-8515), and treated as test samples. Amylose content (percentage of amylose) was determined from absorbance values ​​using a regression equation derived from the absorbances for the standard samples.

[00301] The amylose content of the starch samples was also determined, when indicated, by debranching starch samples and then evaluated using size exclusion chromatography (SEC), as previously described (Butardo et al. 2012; Castro et al. 2005). In this method, the short chains resulting from amylopectin debranching were separated from the longer amylose chains, and the relative amounts were determined. Pullulan (Shodex P-82) standards calibrated with the Mark-Houwink-Sakaruda equation were used to estimate molecular weight from elution time. Samples were prepared and Petition 870190000436, dated 03 / 01 / 2019, pages 144 / 233 137 / 187 analyzed in triplicate.

[00302] The analysis of the amylose / amylopectin ratio of non-debranched starches can also be performed according to Case et al., (1998) or by an HPLC method using 90% DMSO to separate debranched starches, as described by Batey and Curtin, (1996).

[00303] Resistant starch (RS) content. The RS content of the grain was determined in triplicate using the RS analysis kit (K-RSTARCH), supplied by Megazyme (Bray, Co Wicklow, Republic of Ireland) and calculated on a weight basis as a percentage of the starch. Instead of the 100 mg sample proposed in the RS analysis kit, a reduced amount of wholemeal flour (40 mg) was used for each assay in this work, in a 15 mL conical-bottom tube with a cap (catalog number: 188271, Greiner bio-one), using pro rata amounts of solutions and buffers from the kit. Standard samples containing 0 to 20 mg / mL of glucose were prepared from glucose (K-RSTARCH kit) and treated as for the test samples. The RS content on a weight basis and the non-resistant starch content for the test samples were determined from the absorbance values, using a regression equation derived from the absorbance of the standard samples.The RS content was then calculated as the weight of RS as a percentage of the total starch content weight.

[00304] The RS level in food samples, such as bread, can also be measured in vitro in the manner described in WO2012 / 058730. This method describes the sample preparation and in vitro digestion of starch in food, in the manner normally ingested. The method has two sections: firstly, starch in the food is hydrolyzed under simulated physiological conditions; secondly, by-products are removed by washing and the RS is determined after homogenization and drying of the sample. Starch quantified at the end of the digestion treatment represented the RS content of the food. Petition 870190000436, dated 03 / 01 / 2019, pages 145 / 233 138 / 187

[00305] β-glucan (BG). BG levels were determined in triplicate using the kit (K-BGLU) supplied by Megazyme (Bray, Co, Wicklow, Republic of Ireland).

[00306] Fructan content. Fructan extraction and assay were performed in 2 mL tubes or 96-well plates (2 mL per well) using a Megazyme modified fructan kit (KFRUC) assay procedure as follows. Whole wheat flour (40 mg) was mixed with 1 mL of water (80°C) and incubated with stirring (1200 rpm) at 80°C for 30 minutes. After cooling to room temperature, the tubes were centrifuged for 5 minutes, and 20 μL of supernatant containing fructans and other sugars were removed for fructan assay. Sucrose, maltose, maltodextrins, and starch in the supernatant were hydrolyzed to glucose and fructose by adding 20 μL of enzyme solution containing sucrase, amylase, and maltase from the K-FRUC kit, and incubating the mixtures at 40°C with stirring (1,000 rpm) for 30 minutes. Glucose and fructose in the samples were then reduced by adding 20 μL of 10 mg / mL alkaline borohydride solution and incubating at 40°C with stirring (1,000 rpm) for 30 minutes.Fructans in this solution were hydrolyzed with fructanases (40°C for 30 min, with stirring at 1,000 rpm) into glucose and fructose. p-Hydroxybenzoic acid hydrazide (PAHBAH) was added to develop the color complex at 98°C for 6 minutes. After cooling the samples, the color complex was evaluated at 410 nm using a spectrophotometer, and the absorbance value was converted to fructan content using a standard curve containing 0 to 0.27 mg / mL of fructose (Megazyme, K-FRUC kit), and treated as for the test samples after hydrolysis with fructanase. The fructan content (percentage of fructan) for the test samples was determined from the absorbance values ​​using a regression equation derived from the absorbances for the standard samples.

[00307] Reduced-scale fructan assay in plate format. For a small-scale fructan assay, all quantities for the... Petition 870190000436, dated 03 / 01 / 2019, pages 146 / 233 139 / 187 solutions, buffers, and enzyme reagents in the Megazyme kits were scaled down 10 times, and the reactions were performed in a 96-well plate. 20 mg wholemeal flour samples were used for samples with high fructan content, or 40 mg for samples with lower fructan levels of approximately 0.5-2%. Pre-moistened flours with ethanol were not necessary for fructan extraction – the wholemeal flour was well dispersed in hot water by vortexing before extracting fructans. For fructan extraction, an extraction time of 20 minutes was sufficient. Hydrolysis reactions were performed in 1.1 mL 96-well plates, sealed with lids at 40°C for 30 minutes, with stirring at 1,000 rpm, using a BioShake iQ and a 96-well adapter (Q Instruments, Jena, Germany).In the modified K-FRUC assay, plates after fructan hydrolysis and addition of p-hydroxybenzoic acid hydrazide (PAHBAH) were sealed with lids and firmly clamped in a custom-made plate holder for color development at 100°C for 6 minutes using a water bath (WiseBath, Thermoline Scientific, Wetherill Park, NSW, Australia). The hydrolyzed samples (250 pL) were transferred to a 96-well flat-bottom microtiter plate (UV-Star® microplate or PSMicroplate, Greiner Bio-One, Germany) to read the absorbance at 340 nm (for K-FRUCHK) or 410 nm (for K-FRUC) using a Multiskan Spectrum plate reader (Thermo Scientific, Finland).

[00308] Total Arabinoxylan (AX). AX was measured using 20 mg of wholemeal flour samples in 2 mL screw-capped tubes. Each sample was mixed with 1 mL of 0.5 M sulfuric acid, vortexed, and the mixtures were incubated at 99°C with shaking (1,000 rpm) for 30 minutes. The tubes were then cooled in ice water for 5 minutes. The tubes were centrifuged at 10,000 g for 5 minutes, and the supernatant (800 μL J) from each tube was transferred to a 96-well plate. If desired, these plates were stored at -20°C before further treatment. For Petition 870190000436, dated 03 / 01 / 2019, pages 147 / 233 140 / 187 dilution, 100 μE aliquots of the supernatant were transferred to another 96-well plate (Greiner bio-one Master Block) and 900 μE of Milli Q water were added to each well. The diluted supernatant (100 μE) was transferred to an assay plate (BioRad Microtubes Racked Titration Tube, catalog #223-9390). To prepare xylose standards, 100 μE standard solutions were prepared with concentrations of 30, 50, 75, 100, 150, and 200 μg / mE using a 2 mg / mE stock solution (Sigma, catalog number X-3877). 0.5 mE of freshly prepared phloroglucinol reagent (PGR, see below) was added to each well. The plates were sealed with MicroCap tape (National Scientific, TN3346-08C), secured, and incubated at 100°C for 25 minutes in a fume hood. The samples were then thoroughly mixed by inverting the plates. After this, 200 μE of samples were transferred to a UV-Star plate in a fume hood.The absorbance of each sample was evaluated at 510 and 552 nm using a plate spectrophotometer, for example, Thermo Multiscan.

[00309] The phloroglucinol (PGR) reagent was prepared fresh for each assay in a fume hood. For this purpose, two solutions were prepared separately and then mixed. Solution 1 was prepared by dissolving 0.6 g of phloroglucinol (Sigma, catalog number 7933) in 2.4 mE of absolute ethanol for a few minutes in a 50 mE tube. Solution 2 comprised 55 mE of glacial acetic acid, with 1.1 mE of concentrated hydrochloric acid (HCl) added slowly to the acetic acid. Solution 1 was transferred to a 250 mE flask. The 50 mE tube containing residues of solution 1 was then washed with solution 2 to quantitatively transfer all of solution 1, and then all of solution 2 was mixed with solution 1 in the flask. Finally, 0.6 mE of glucose solution (70 mg / mE in Milli-Q water) was added to the mixture of solutions 1 and 2.

[00310] Cellulose content. The cellulose assay was performed in 2 mE tubes or 96-well plates (2 mE per well), using 50 mg of samples. Petition 870190000436, dated 03 / 01 / 2019, pages 148 / 233 141 / 187 of whole wheat flour. Lignin, hemicellulose, and starch solubilized in the whole wheat flour were removed by adding 600 μL of acetic nitric reagent (10:1 (v / v) mixture of 80% acetic acid: 70% nitric acid) and incubating the mixtures at 99°C with stirring (1,000 rpm) for 1 hour. After cooling, the samples were centrifuged at maximum speed for 5 minutes, and the supernatants were discarded. Each precipitate was washed with 1 mL of water, centrifuged at maximum speed for 5 minutes, and each supernatant was discarded. To solubilize crystalline cellulose in each precipitate, 1 mL of 72% H2SO4 was added to each sample tube. The samples were diluted based on the estimated cellulose content and cellulose standards. For color development, 100 μL of anthrone reagent (0.2% anthrone in 72% H2SO4) were added to each sample tube, and the mixtures were incubated at 98°C for 10 minutes.The absorbance of the treated samples was read at 620 nm using a spectrophotometer, and the cellulose content was calculated by reference to a standard curve that used 0 to 0.75 mg / mL of cellulose (Sigma: catalog number G-6413).

[00311] Chain length distribution analysis. The determination of the amylopectin chain length distribution was performed by fluorescence-activated capillary electrophoresis (FACE), after debranching of the starch samples, using a capillary electrophoresis unit according to Morell et al., (1998). The samples were prepared in the manner previously described (O'Shea and Morell, 1996).

[00312] Starch gelatinization. The gelatinization temperature profiles of starch samples were evaluated in a Pyris 1 differential scanning calorimeter (Perkin Elmer, Norwalk CT, United States). The viscosity of starch solutions was evaluated in a RapidVisco analyzer (RVA, Newport Scientific Pty Ltd, Warriewood, Sydney), for example, using conditions as reported by Batey et al., (1997). The parameters evaluated included peak viscosity (the maximum viscosity of the Petition 870190000436, dated 03 / 01 / 2019, pages 149 / 233 142 / 187 hot paste), maintained concentration, final viscosity, and paste temperature. The swelling volume of flour or starch was determined according to the method of Konik-Rose et al., (2001). Water absorption was measured by weighing the sample before and after mixing the flour or starch samples in water at defined temperatures, and after collecting the gelatinized material.

[00313] Starch granule morphology. The morphology of the starch granule was examined by microscopy. Suspensions of purified starch granules in water were examined in both normal and polarized light using a Leica-DMR compound microscope to determine the morphology of the starch granule. Scanning electron microscopy was performed using a Joel JSM 35C instrument. Purified starches were spray-coated with another and scanned at 15kV at room temperature.

[00314] Endosperm protein expression analysis. The specific expression of SBEI, SBEIIa, and SBEIIb proteins in endosperm, in particular the level of expression or accumulation of these proteins, was analyzed by Western blot procedures. Endosperm was dissected from all maternal tissues, and samples of approximately 0.2 mg were homogenized in 600 µL of 50 mM potassium phosphate buffer (42 mM K2HPO4 and 8 mM KH2PO4), pH 7.5, containing 5 mM EDTA, 20% glycerol, 5 mM DTT, and 1 mM Pefabloc. The ground samples were centrifuged for 10 minutes at 13,000 g, and the supernatant was aliquoted and frozen at -80 °C until use. For an estimate of total protein, a BSA standard curve was established using aliquots of 0, 20, 40, 60, 80, and 100 pL of 0.25 mg / mL BSA standard. Samples (3 pL) were prepared up to 100 pL with distilled water, and 1 mL of Coomassie Plus protein reagent was added to each.The absorbance was read after 5 minutes at 595 nm, using the BSA zero sample from the standard curve as the blank, and the... Petition 870190000436, dated 03 / 01 / 2019, pages 150 / 233 Protein levels in the samples were determined in 143 / 187 samples. Samples containing 20 pg of total protein from each endosperm were run on an 8% non-denaturing polyacrylamide gel containing 0.34 M Tris-HCl (pH 8.8), acrylamide (8.0%), ammonium persulfate (0.06%), and TEMED (0.1%). After electrophoresis, the proteins were transferred to a nitrocellulose membrane according to Morell et al., 1997, and immunoreacted with specific SBEIIa, SBEIIb, or SBEI antibodies (Table 5). Antiserum against wheat SBEIIa protein (anti-wBEIIa) was generated using a synthetic peptide with the amino acid sequence of the N-terminal sequence of mature wheat SBEIIa, AASPGKVLVPDGESDDL (SEQ ID NO: 49) (Rahman et al., 2001). Antiserum against wheat SBEIIb (anti-wBEIIb) was generated in an analogous manner using the synthetic N-terminal peptide, AGGPSGEVMI (SEQ ID NO: 50) (Regina et al., (2005).This peptide is known to represent the N-terminal sequence of the mature SBEIIb peptide and, moreover, was identical to the N-terminus of the barley SBEIIb protein (Sun et al., 1998). A polyclonal antibody against wheat SBEI was synthesized in an analogous manner using the synthetic N-terminal peptide VSAPRDYTMATAEDGV (SEQ ID NO:51) (Morell et al., 1997). Such antisera were obtained from rabbits immunized with the synthetic peptides, according to standard methods.

[00315] Statistical analyses. Statistical analysis of amylose data was performed using the 16th edition of GenStat for Windows (VSN International Ltd, Herts, UK). Other data were subjected to statistical analyses (one-tailed ANOVA test, with Tukey's post-hoc test) using GraphPad Prism version 5.01. Error bars represent the standard error of the mean (SEM). Statistical significance was defined at P < 0.05 and P < 0.01. Example 2. Identification of cDNA sequences and genomic DNA sequences for wheat SSIIb and SSIIc genes and the encoded polypeptides, and comparison with SSIIa. Petition 870190000436, dated 03 / 01 / 2019, pages 151 / 233 144 / 187

[00316] To identify genes encoding starch synthase II isoenzymes (SSIIb and SSIIc) in wheat, which correspond to SSIIb and SSIIc in rice (Ohdan et al., 2005), and compare them to SSIIa, the NCBI database was searched using rice cDNA sequences, specifically accession number AF419099 for SSIIa, AF395537 for SSIIb, and AF383878 for SSIIc. Wheat homologs were identified as follows. For the wheat SSIIa genes, three homologous cDNA sequences corresponding to the SSIIa genes in wheat were identified. These were the accession numbers: AF155217 (SEQ ID NO:4) for SSIIa-A in genome A, AJ269504 (SEQ ID NO:5) for SSIIa-B in genome B, and AJ269502 (SEQ ID NO:6) for SSIIa-D in genome D. The genomic DNA nucleotide sequences corresponding to these three homologous cDNA sequences were identified: accession number AB201445 for the SSIIa-A gene (SEQ ID NO:7), AB201446 for the SSIIa-B gene (SEQ ID NO:8), and AB201447 for the SSIIa-D gene (SEQ ID NO:9).Searching the IWGSC database, the locations of the three corresponding homologous genes were identified on chromosomes 7AS (Traes_7AS_53CAFB43A, 7A: 52346437 - 52346905 bp, reverse strand), 7BS (IWGSC: Chromosome 7BS, Traes_7BS_7BEAF5EC0, 7B: 31821573 31821749 bp sense strand) and 7DS (IWGSC: Chromosome 7DS, Traes_7DS_E6C8AF743, IWGSC_CSS_7DS_scaff_3877787: 1 to 396 bp, 5137 to 5419 bp sense strand), respectively. The amino acid sequences were respectively: accession number: AAD53263 for SSIIa-A polypeptides, CAB96627 for SSIIa-B, and CAB86618 for SSIIa-D.

[00317] When the amino acid SSIIa and the corresponding nucleotide sequences were pairwise compared by BLAST relative to the full-length sequences, the homologous sequences were 9596% identical for each comparison. Therefore, they were easily distinguished from one another.

[00318] Two cDNA sequences were identified in the database of Petition 870190000436, dated 01 / 03 / 2019, pp. 152 / 233 145 / 187 NCBI data encoding SSIIb genes from wheat, which had accession numbers AK332724 from genome A and EU333947 from genome D. None of the corresponding genomic DNA sequences were identified in the NCBI database; however, genomic DNA sequences were found in the IWGSC database.Three homologous genomic DNA sequences encoding SSIIb have been identified, specifically the SSIIb-A gene on chromosome 6AL (homology with IWGSC: Chromosome 6AL, Traes_6AL_AE01DC0EA, 6A: 187503905 bp to 187505233 bp, reverse strand by BLAST search on the EnsemblPlants website) (cDNA sequence SEQ ID NO:12), the SSIIb-B gene on chromosome 6BL (Chromosome 6BL, gene: Traes_6BL_61D83E262, 6B: 162116364 - 162116691 bp, reverse strand by BLAST search on the EnsemblPlants website) (cDNA sequence SEQ ID NO:13), and the SSIIb-D gene on chromosome 6DL (homology with IWGSC: Chromosome 6DL, gene: Traes_6DL_19F1042C7, 6D: 147050072 - 147051031 bp, reverse strand via BLAST search on the EnsemblPlants website) (cDNA sequence SEQ ID NO:14). An amino acid sequence (accession number: ABY56824, SEQ ID NO:11) that was identified in the NCBI database was 100% identical to the amino acid sequences deduced from EU333947; therefore, it was the SSIIb-D polypeptide sequence.A full-length amino acid sequence (SEQ ID NO:10) was deduced from the nucleotide sequence of AK332724 for the SSIIb-A polypeptide, which showed 90% homology with ABY56824 of SSIIb from genome D. An amino acid sequence for the SSIIb-B polypeptide was deduced from the IWGSC DNA fragment (Traes_6BL_61D83E262, 6B: 162116364 - 162116691 bp, reverse strand). The full-length SSIIb-A and SSIIb-D amino acid sequences were approximately 90% identical. When paired together, the three corresponding nucleotide cDNA sequences were 91-95% identical. When comparing the sequences... Petition 870190000436, dated 01 / 03 / 2019, pp. 153 / 233 146 / 187 of the SSIIa amino acid or nucleotide sequences, the SSIIb sequences were 71-79% identical to the corresponding SSIIa paralog. Therefore, either SSII sequence can be easily identified as SSIIa or SSIIb from both the amino acid and nucleotide sequences.

[00319] Regarding wheat SSIIc genes, a cDNA sequence (accession number: EU307274) was identified in the NCBI database, which corresponded to a gene located on wheat chromosome 1DL (homology with IWGSC: Chromosome 1DL, gene: Traes_1DL_F667ED844, IWGSC_CSS_1DL_scaff_2205619:1950-3041 bp, strand sensed by BLAST search on the EnsemblPlants website), therefore, this corresponded to SSIIc-D. The cDNA sequence for another SSIIc gene was identified by searching the IWGSC database, where the gene was located on chromosome 1AL (IWGSC: Chromosome 1AL, gene: Traes_1AL_729BF3204, 1A: 68687585 - 68688377, strand sense by BLAST search on the EnsemblPlants website). The cDNA sequence showed 98% identity with the nucleotide sequence 1679 to 2469 of accession number: EU307274.A sequence from chromosome 1BL was also identified, which presented a partial-length cDNA sequence for SSIIc-B (IWGSC: Chromosome 1BL, gene: Traes_1BL_447468BDE, 1B: 31475067-314776087 bp, strand sensed by BLAST search on the EnsemblPlants website). An amino acid sequence (accession number: ABY639) was identified in the NCBI database, which showed 100% identity with the amino acid sequence deduced from the cDNA sequence with accession number EU307274. Two partial-length amino acid sequences were also deduced from the nucleotide sequences of the genomic DNA fragments for SSIIc from genomes A and B. When paired, the SSIIc sequences were approximately 98% identical to each other. They were quite divergent in relation to the SSIIa sequences. Petition 870190000436, dated 03 / 01 / 2019, pages 154 / 233 147 / 187

[00320] It was concluded that the SSIIa gene and SSIIa polypeptide sequences can be easily distinguished from the corresponding SSIIb and SSIIc sequences. EXAMPLE 3. Genome-specific DNA markers for marker-assisted reproduction

[00321] In order to generate plants with triple-null mutant ssIIa, which were isogenic with wild-type plants in several different genetic origins, plants from three wheat lines C57 (null for SSIIa-A), K79 (null for SSIIa-B) and T116 (null for SSIIa-D) (Yamamori et al., 2000) were used in a series of crosses, backcrosses and intercrosses. To detect and monitor the mutations, each of which being recessive in the breeding program with molecular markers, genome-specific DNA markers based on SSIIa gene sequences were designed and used. The specific mutations in the SSIIa genes C57, K79 and T116 in genomes A, B and D, respectively, were reported by Shimbata et al., (2005). Each of the mutations was a deletion or insertion of DNA in the respective SSIIa genes (Figures 2 to 4), and therefore these mutations were ideal for designing molecular markers.A DNA marker was designed for each gene, locating a sense oligonucleotide primer upstream of each mutation site and a reverse oligonucleotide primer after each mutation site; the sequences are described in Example 1, "DNA analysis of wheat plants".

[00322] These oligonucleotide primers were used to amplify specific DNA fragments for each genome of wild-type and null mutant plants with respect to ssIIa. With respect to the SSIIa gene of genome A, a 1072 bp fragment was amplified from the wild-type gene and a 778 bp fragment from the null mutant gene for SSIIaA. With respect to the SSIIa gene of genome B, a 374 bp fragment was amplified from the wild-type gene and a 522 bp fragment from Petition 870190000436, dated 03 / 01 / 2019, pages 155 / 233 148 / 187 of the mutant null gene for SSIIa-B. Regarding the SSIIa gene of genome D, a 427 bp fragment was amplified from the wild-type gene and a 364 bp fragment from the mutant null gene for SSIIa-D. These genome-specific fragments were easily distinguished by their size in gel electrophoresis and therefore can be used as co-dominant DNA markers to detect mutant and wild-type alleles. Other oligonucleotide primer pairs based on the SSIIa gene sequence can be easily designed to provide alternative molecular markers. EXAMPLE 4. Generation of triple-null ssIIa mutants from different genetic origins.

[00323] In order to generate triple-null ssIIa mutant plants that are isogenic across several different genetic origins, plants from the three wheat lines C57 (null for SSIIa-A), K79 (null for SSIIa-B), and T116 (null for SSIIa-D) (Yamamori et al., 2000) were used in a series of crosses, backcrosses, intercrosses, and progeny selections, shown schematically in Figures 5-7. The DNA markers described in Example 1 were used to sort the progeny plants in each generation, allowing the distinction between the mutant null alleles for ssIIa and the corresponding wild-type alleles in the Sunco, EGA Hume, or Westonia wheat varieties used as the recurrent parents. Plants of C57, K79, and T116 were first crossed with wheat plants of the Sunco cultivar, using the Sunco plants as the female plants, to produce C57-Sunco F1, K79Sunco F1, and T116-Sunco F1.Double null ssIIa mutants for C57-K79-Sunco F1 and K79-T116-Sunco F1 were then produced by crossing the single-null mutants at the Sunco origin, followed by self-fertilization of the progeny to produce F2 plants from the crosses. DNA markers were used to select progeny that were heterozygous for two null mutations with respect to ssIIa. These mutants were then used in three. Petition 870190000436, dated 03 / 01 / 2019, pages 156 / 233 149 / 187 successive backcrosses on Sunco as the recurrent parent to produce BC3 heterozygotes with two null mutations. The BC3 plants were then crossed and the progeny self-fertilized, with selection of the triplonulo ssIIa mutants (C57-K79-T116-Sunco BC3 F2) in the Sunco genetic lineage (Figure 5).

[00324] To produce BC3F8 seeds for null mutant wheat lines for ssIIa and wild type in cv. origins EGA Hume, Sunco and Westonia. To produce plants and grain in two different genetic origins, other than Sunco, double mutants in Sunco (C57-K79-Sunco F1 or F2, K79T116-Sunco F1 or F2) were used as pollen donors in crosses with plants of the EGA Hume and Westonia cultivars (Figures 6 and 7), using DNA markers in each generation to detect and select mutant alleles in the progeny. The selected double mutant ssIIa progeny was used in three successive backcrosses in EGA Hume or Westonia, as a recurrent parent, resulting in BC3 plants. Double mutants were crossed and self-fertilized, producing the 466 F2 progeny, from which a total of 21 triple-null ssIIa plants (determined as genotype “abd”) were selected (Figures 6 and 7).The 466 progeny included wild-type, single null genotypes for ssIIa, and double null genotypes for ssIIa, as well as all combinations of heterozygotes for the three SSIIa genes.

[00325] After the production and selection of the 21 triple-null mutants that include the three genetic origins, three generations of single-seeded offspring (SSD) were carried out to generate greater homozygosity in each of the three genetic origins, providing the BC3F3, BC3F4, and BC3F5 generations of grain. The BC3F5 grain gained further shape in three growing generations to produce 10 to 20 g of grain from the BC3F8 generation of each of the lines.

[00326] Triple wild-type SSIIa segregants (genotype ABD) were also generated from the crosses and selected as control lines. In each generation, DNA markers for all Petition 870190000436, dated 03 / 01 / 2019, pages 157 / 233 Three genomes (150 / 187) were used to select ssIIa mutant or wild-type SSIIa alleles for each genome in each generation. Eventually, 4, 6, and 11 triple-null mutant ssIIa lines from the BC3F8 generation were generated for the EGA Hume, Sunco, and Westonia genetic origins, respectively, and 5 BC3F8 lines with wild-type SSIIa were generated for each of the EGA Hume, Sunco, and Westonia genetic origins. These were grown concurrently and under the same growing conditions; the grain was harvested at plant maturity, and the grain was dried to approximately 9% moisture content (on a weight basis). These grain batches were analyzed for various parameters, including seed weight, starch content, amylose content, total dietary fiber, lipid content, etc., as described below. EXAMPLE 5. Analysis of grain and starch parameters

[00327] Grain weight. The average grain weight (mg per grain) of the triple-null ssIIa mutants and wild-type grain in the three genetic origins was calculated by evaluating the weight of 100 grains from each line. The average grain weight ranged from 25 mg to 36 mg in null mutants for ssIIa and 29 mg to 48 mg for wild-type lines (Table 6, Figure 8). The plants were grown far from ideal growing conditions, which explains the low weights, even for the wild-type controls. The average data are shown in Figure 9. Compared to the wild-type lines, the grain of the triple-null ssIIa mutant showed lower grain weight, with the differences being significant (P<0.05) for each genetic origin, including Sunco (Table 7, Figure 9). The mutants in Sunco, EGA Hume, and Westonia exhibited grain weights 25%, 15%, and 30% lower, respectively.This was not surprising, considering that SSIIa encodes a starch synthase that is involved in starch production, and it was known that mutants in SSIIa produced less starch (Yamamoto et al., 2000; Konik-Rose et al., 2007).

[00328] There was no statistically significant difference between the grain weight of the Sunco and Westonia mutants. The EGA mutant grain Petition 870190000436, dated 03 / 01 / 2019, pages 158 / 233 151 / 187 Hume exhibited significantly greater grain weight than the triple-null ssIIa mutants in the other two genetic origins.

[00329] Lipid content. Total fatty acid content (lipid content) was evaluated as described in Example 1. Data are shown in Table 5 and Figure 8 for individual lines. Significant increases in TFA content were observed in the triple-null ssIIa lines compared to the wild type. In particular, the grain of three mutant Sunco lines (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294) showed substantially higher lipid content as a percentage of grain weight.

[00330] When lipid content was calculated on a per-grain basis, it was observed that mutant lines exhibited a higher lipid level in mg per grain (Figures 15 and 16).

[00331] Amylose content. The amylose content as a proportion of starch in the grain of triple-null ssIIa mutants and wild-type, in the three genetic origins, was measured by the iodine binding assay, as described in Example 1. Data are provided in Table 6 and Figure 10, and means are shown in Table 7 and Figure 11 (Sunco). The amylose content for the grain of triple-null mutants ranged from 36.6% to 64%, and for the wild-type from 22.6% to 31.0%. Compared to the wild-type grain, the null mutants for ssIIa showed higher amylose content as a proportion of total starch, and the differences were statistically significant. The mutant grain of Sunco, EGA Hume, and Westonia showed 187%, 135%, and 165% of the amylose level, compared to the corresponding wild-type, respectively. Comparing the triple-null mutant grain across the three genetic origins, Sunco's grain contained significantly higher proportions of amylose than the other two samples of the null mutant grain.No statistically significant differences were found between the EGA Hume and Westonia mutants. Similarly, no statistically significant differences were found between the three wild-type grain samples. The grain of three of the 6 Sunco mutant lines. Petition 870190000436, dated 03 / 01 / 2019, pages 159 / 233 152 / 187 triple-null contained 61.6%, 64%, and 55.1% amylose as a proportion of the starch in the grain. These values ​​were much higher than previously observed for the ssIIa mutant grain in hexaploid wheat (Yamamoto et al., 2000; Konik-Rose et al., 2007) and were therefore unexpected and surprising to the inventors.

[00332] When the amylose content was calculated on a per-grain basis (mg of amylose per grain), it was observed that the mutant lines did not generally exhibit a higher level of amylose in mg per grain (Figures 17 and 18), but certainly exhibited a lower level of amylopectin and therefore decreased total starch content. The inventors concluded that this occurred due to mutations in the three SSIIa genes and therefore the loss of SSIIa enzymatic activity during endosperm development, once the plants were growing.

[00333] Starch content. The starch content in the grain for three triple-null ssIIa mutant lines and three wild-type lines was evaluated as described in Example 1. Data are presented in Table 6 and Figure 10, and means are shown in Table 7 (Sunco) and Figure 11. Starch content ranged from 30.4% to 70.0% for the triple-null ssIIa mutant grain and from 58.1% to 74.3% for the wild type. Compared to the starch content of the wild-type lines, the EGA Hume, Sunco, and Westonia mutant grains showed on average 15%, 28%, and 18% less starch, respectively, than their corresponding wild-type lines. These differences were statistically significant (p<0.05). The Sunco mutant grain contained significantly less starch than the ssIIa mutant grain in the other two genetic origins. The starch content of the EGA Hume mutant grain was not significantly different from the Westonia grain.The grain from the three mutant Sunco lines (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294) showed the lowest starch content at 42.5%, 34.8% and 30.4%, respectively. These same lines also showed the highest amylose content. Petition 870190000436, dated 01 / 03 / 2019, pp. 160 / 233 153 / 187 a proportion of its starch, indicating that amylopectin synthesis was more reduced in these lines. When calculated on a mg starch per grain basis, the reduced starch content in the ssIIa mutant grain was evident (Figures 17 and 18), again caused by the loss of SSIIa activity.

[00334] β-glucan content. The β-glucan (BG) content of the triple-null mutant ssIIa grain and the wild-type grain was evaluated as described in Example 1. Data are shown in Table 6 and Figure 12 as a percentage of whole grain weight, and averages are shown in Table 7 (Sunco) and Figure 13. BG content ranged from 1.3% to 3.3% for the triple-null mutant ssIIa grain and from 0.3% to 0.8% for the wild-type grain. Compared to the wild-type grain, the EGA Hume, Sunco, and Westonia mutants showed 144%, 245%, and 177% more BG, respectively. This increase of approximately 1.5 to 2.5 times was surprising to the inventors, since there had been no previous report of such a characteristic in hexaploid wheat. The Sunco mutant grain exhibited significantly more BG than the EGA Hume and Westonia mutant grains (P<0.05).Grain from three mutant Sunco lines (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) that showed the highest amylose levels also contained the highest BG content, at 2.5%, 3.3%, and 3.2%, respectively. This demonstrated the correlation between higher amylose content and higher G content in the ssIIa mutants, each on a weight basis.

[00335] When calculated on a per-grain basis, the mutant grain was observed to have significantly higher levels of BG (Figures 19 and 20). The inventors considered that this was due to a dispersion of carbon, which enters the grain as disaccharides or monosaccharides, of amylopectin in BG, compared to the wild type.

[00336] Fructan content. The fructan content of the triple-null mutant ssIIa grain and the wild-type grain was evaluated in the manner described in Example 1. Petition 870190000436, dated 03 / 01 / 2019, pages 161 / 233 154 / 187 The data are shown in Table 6 and Figure 14 as a percentage of whole grain weight, and the means are shown in Table 7 for Sunco. Fructan content ranged from 3.1% to 10.8% for the triple-null ssIIa mutants and from 0.7% to 1.5% for the wild-type grain. Compared to the wild-type grain, the mutant grains of EGA Hume, Sunco, and Westonia showed 242%, 521%, and 376% more fructan, respectively. The Sunco mutant grain showed significantly more fructan than the mutant grains of EGA Hume and Westonia (P<0.05). The three Sunco mutant lines with the highest amylose content (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) also contained the highest fructan content of 7.7%, 10.8%, and 10.5%, respectively. Such fructan levels on a weight basis had never been previously reported in hexaploid wheat grain. This demonstrated the correlation not only between more amylose and more BG, but also more fructan in the ssIIa mutants.

[00337] When calculated on a per-grain basis, the mutant grain was observed to have significantly higher levels of fructan (Figures 21 and 22). The inventors considered that this was due to a dispersion of carbon, which enters the grain as disaccharides or monosaccharides, from amylopectin to fructan relative to the wild type, during endosperm development.

[00338] Arabinoxylan content. The arabinoxylan (AX) content of the triple-null mutant ssIIa grain and the wild-type grain was measured as described in Example 1. The data are shown in Table 6 and Figure 14 as a percentage of whole grain weight, and the averages are shown in Table 7 for Sunco. The AX content ranged from 6.7% to 8.8% for the triple-null mutant ssIIa and from 4.3% to 5.7% for the wild-type grain. Compared to the wild-type grain, the EGA Hume, Sunco, and Westonia mutant grains showed 35%, 65%, and 43% more AX, respectively. The Sunco mutant grain showed significantly more AX than the EGA mutant grain. Petition 870190000436, dated 03 / 01 / 2019, pages 162 / 233 155 / 187 Hume and Westonia (P<0.05). The three Sunco mutant lines with the highest amylose content (JTSBC3F7_190, JTSBC3F7_287, and JTSBC3F7_294) contained the highest AX content of 8.7%, 8.5%, and 8.4%, respectively. This demonstrated the correlation between the four parameters, especially more amylose, more BG, more fructan, and more AX in the ssIIa mutants. Arabinoxylan contents on a per-grain basis were also significantly higher (Figures 21 and 22).

[00339] Cellulose content. The cellulose content of the ssIIa triplonulo mutant grain and the wild-type grain was evaluated as described in Example 1. Data are shown in Table 6 and Figure 14 as a percentage of whole grain weight, and averages are shown in Table 7 for Sunco. Cellulose content ranged from 2.6% to 4.6% for the ssIIa triple-nulo mutant grain and from 2.0% to 3.4% for the wild type. Compared to the wild-type lines, the EGA Hume, Sunco, and Westonia mutants showed 19%, 43%, and 29% more cellulose, respectively. There were no significant differences in cellulose content among the three null mutants. The three Sunco lines with high amylose content (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294) also contained high cellulose content of 4.3%, 3.9% and 4.6%, respectively. Cellulose contents were not significantly higher on a per-grain basis (Figures 21 and 22).

[00340] Total fiber content. The total fiber content for the triple-null mutant ssIIa grain and the wild-type grain was calculated as the sum of the contents of β-glucan (BG), fructan, arabinoxylan (AX), and cellulose (each as a percentage of grain weight). Data are provided in Table 6 and Figure 12 as a percentage of whole grain weight, and averages are provided in Table 7 and Figure 13. The total fiber content in the grain ranged from 15.9% to 27.5% for ssIIa null mutants and from 8.5% to 10.4% for wild-type grain. Compared to the wild-type grain, the EGA Hume, Sunco, and Westonia mutants showed 68%, 125%, and 88% higher fiber content, respectively. Petition 870190000436, dated 03 / 01 / 2019, pages 163 / 233 156 / 187 total, respectively. The Sunco mutant grain had significantly more total fiber than the EGA Hume and Westonia mutant grains (P<0.05). There was no significant difference in total fiber content between the EGA Hume and Westonia mutant grains. The three Sunco mutant lines with high amylose content (JTSBC3F7_190, JTSBC3F7_287 and JTSBC3F7_294) contained the highest total fiber content at 23.2%, 26.5% and 27.5%, respectively. Total fiber content was also significantly higher on a per-grain basis (Figures 19 and 20).

[00341] Resistant starch (RS) content. The content of resistant starch (RS) as a percentage of the starch in the grain of triple-null ssIIa and wild-type mutants, in the Sunco genetic line, was evaluated using a commercial resistant starch analysis kit, as described in Example 1. The data are provided in Table 8 and the means are shown in Figure 23.The RS content for triple-null mutant grains ranged from 1.0% to 3.8%, and for the wild type from 0.4% to 0.8%. Compared to wild-type grain, ssIIa mutants showed approximately 5 times higher RS ​​content, and the difference was statistically significant. The grain of three of the 6 triple-null ssIIa mutant lines in the Sunco genetic line contained 3.8%, 2.8%, and 3.1% RS as a percentage of the starch in the grain (Figure 23, top panel). The RS levels calculated as mg per grain were also substantially higher (Figure 23, bottom panel).

[00342] Discussion. Numerous starch properties have been previously reported as modified in triple-null hexaploid ssIIa wheat, including starch granule morphology, amylose content, amylopectin chain length distribution, crystallinity and starch gelatinization temperature, RVA, and swelling power (Yamamori et al. 2000; Yamamori et al. 2006; Konik-Rose et al. 2007). The present study ver...

Claims

CLAIMS 1. A method for producing wheat flour, wheat bran or wheat starch granules, the method characterized in that it comprises the step of grinding grains from a wheat plant of the species Triticum aestivum, the grain comprising: i) mutations in each of its SSIIa genes such that the grain is homozygous for a null mutation in its SSIIa-A gene (SEQ ID NO: 7), homozygous for a null mutation in its SSIIa-B gene (SEQ ID NO: 8) and homozygous for a null mutation in its SSIIa-D gene (SEQ ID NO: 9), wherein at least one of the null mutations is an introduced mutation, ii) a total starch content comprising an amylose content and an amylopectin content, iii) a fructan content that is increased relative to wild-type wheat grain on a weight basis, preferably between 3% and 12% of the grain weight, iv) a β-glucan content, v) arabinoxylan content, vi) cellulose content, the grain having a grain weight between 25 mg and 60 mg,wherein the amylose content is between 45% and 70% on a weight basis of the total starch content of the grain, as determined by the iodine binding assay; wherein the amylopectin content on a weight basis is reduced relative to wild wheat grain; wherein each of the β-glucan content, arabinoxylan content, and cellulose content are increased relative to wild wheat grain on a weight basis, such that the sum of the fructan content, β-glucan content, arabinoxylan content, and cellulose content is between 15% and 30% of the grain weight.

2. Wheat starch production method, the method Petition 870260060961, dated 06 / 22 / 2026, page. 12 / 26 2 / 6 characterized in that it comprises the step of extracting starch from wheat grain of the species Triticum getivum, the grain comprising i) mutations in each of the SSIIa genes, such that the grain is homozygous for a null mutation in its SSIIa-A gene (SEQ ID NO: 7), homozygous for a null mutation in its SSIIa-B gene (SEQ ID NO: 8) and homozygous for a null mutation in its SSIIa-D gene (SEQ ID NO: 9), wherein at least one of the null mutations is an introduced mutation, ii) a total starch content comprising an amylose content and an amylopectin content, iii) a fructan content that is increasing relative to wild-type wheat grain on a weight basis, preferably between 3% and 12% of the grain weight, iv) a β-glucan content, v) an arabinoxylan content, vi) a cellulose content, the grain with a grain weight between 25 mg and 60 mg,wherein the amylose content is between 45% and 70% on a weight basis of the total starch content of the grain, as determined by the iodine binding assay, wherein the amylopectin content on a weight basis is reduced relative to wild-type wheat grain, wherein each β-glucan content, arabinoxylan content, and cellulose content is increased relative to wild-type wheat grain on a weight basis, such that the sum of the fructan content, β-glucan content, arabinoxylan content, and cellulose content is between 15% and 30% of the grain weight.

3. Method according to claim 1 or 2, characterized in that the grain additionally comprises one or more or all of the following features: i) a starch content between 30% and 70% of the grain weight, ii) an amylose content between 45% and 65% of the total starch content of the grain, as determined by the iodine binding test, Petition 870260060961, dated 06 / 22 / 2026, p. 13 / 26 3 / 6 iii) the starch content exhibits a chain length distribution as determined by fluorescence-activated capillary electrophoresis (FACE) after debranching of the starch samples that is increased in the proportion of chain lengths DP 7-10 and decreased in the proportion of chain lengths DP 11-24, relative to wild-type wheat starch, iv) the fructan content comprises fructans of DP 3-12, such that at least 50% of the fructan content is DP 3-12, v) the fructan content is increased between 2 times and 10 times relative to wild-type wheat grain on a weight basis,vi) the β-glucan content is increased by 1% or 2% on an absolute basis, and / or is increased between 2 and 7 times relative to wild wheat grain on a weight basis, vii) the β-glucan content is between 1% and 4% of the grain weight, viii) the arabinoxylan content is increased between 1% and 5% on an absolute basis, ix) the cellulose content is increased between 1% and 5% on an absolute basis, x) the grain exhibits a germination rate that is between approximately 70% and approximately 100% relative to wild wheat grain, and xi) the grain, when sown, gives rise to wheat plants that are both male and female fertile.

4. A method according to any one of claims 1 to 3, characterized in that the grain comprises a level and / or activity of SSIIa protein that is less than 5% of the level or activity of SSIIa protein in wild-type wheat grain, or that it does not contain one or more or all of SSIIa-A protein, SSIIa-B protein and SSIIa-D protein.

5. Method according to any one of claims 1 to 4, characterized in that each null mutation is selected independently of the group consisting of a deletion mutation, an insertion mutation, a premature translation stop codon, a junction site mutation and a non-conservative amino acid substitution mutation, preferably wherein the group comprises deletion mutations in each of two or three SSIIa genes.

6. A method according to any one of claims 1 to 5, characterized in that the wheat starch granules or wheat starch comprise between 45% and 70% amylose, each on a weight basis as a proportion of the total starch content of the starch granules or starch, the starch granules preferably comprising wheat GBSSI polypeptide, and wherein the starch granules and / or starch are distinguished by one or more of the following characteristics: a. not having any detectable SSIIa polypeptide, as determined by an immunological medium; b. comprising at least 2% resistant starch on a weight basis; c. the starch being distinguished by a reduced glycemic index (GI); d. the starch granules having a distorted shape; e. the starch granules having reduced birefringence when observed under polarized light; f. the starch being distinguished by a reduced swelling volume; g.modified chain length distribution and / or branching frequency in starch; h. starch distinguished by a reduced peak in gelatinization temperature; i. starch distinguished by a reduced peak in viscosity; j. reduced starch paste temperature; k. molecular weight with a reduced amylose peak, as determined by size exclusion chromatography; Petition 870260060961, dated 06 / 22 / 2026, p. 15 / 26 5 / 6 l. reduced starch crystallinity; and m. reduced proportion of type A and / or type B starch, and / or increased proportion of type V crystalline starch; each property being with respect to wild-type wheat starch granules or wild-type starch.

7. Method according to claim 1, characterized in that the SSIIa-A gene of wheat grain comprises the nucleotide sequence shown as SEQ ID NO:

52.

8. Method according to claim 1, characterized in that the SSIIa-B gene of wheat grain comprises the nucleotide sequence presented as SEQ ID NO:

53.

9. Method according to claim 1, characterized in that the SSIIa-D gene of wheat grain comprises the nucleotide sequence presented as SEQ ID NO:

54.

10. Method according to claim 1, characterized in that i) the SSIIa-A gene of the wheat grain comprises the nucleotide sequence presented as SEQ ID NO: 52; ii) the SSIIa-B gene of the wheat grain comprises the nucleotide sequence presented as SEQ ID NO: 53; and iii) the SSIIa-D gene of the wheat grain comprises the nucleotide sequence presented as SEQ ID NO:

54.

11. Process for producing a food comprising the steps of (i) adding a food ingredient comprising wheat flour produced by the method as defined in claim 1, the flour characterized in that it comprises mutations in each of its SSIIa genes such that the grain is homozygous for a null mutation in its SSIIa-A gene, homozygous for a null mutation in its SSIIa-B gene and homozygous for a null mutation in its SSIIa-D gene, wherein Petition 870260060961, dated 06 / 22 / 2026, page 16 / 26 6 / 6 at least one of the null mutations is an introduced mutation, and wherein the flour starch has an amylose content between 45% and 70% on a weight basis of the total starch content as determined by the iodine binding assay to another food ingredient, and (ii) mixing the food ingredients, thereby producing the food.

12. Process according to claim 11, characterized in that the flour is wholemeal flour.

13. Process according to claim 11 or 12, characterized in that the food ingredient comprises flour at a level of at least 10% on a dry weight basis.

14. Process according to any one of claims 11 to 13, characterized in that it further comprises a step of heating the mixed food ingredients of step (ii) to a temperature of at least 100°C for at least 10 minutes.

Images