Library of RNA oligonucleotides, and method for selecting a plurality of non-identical binding oligonucleotides

Abstract

Libraries of ribocommutation-derived scaffolds and small ribozymes, along with their methods of use, are provided here. The scaffolds of the invention yield aptamers that are easily identified and characterized by virtue of the structural scaffold. The nature of the scaffold predisposes these RNAs to couple to readout domains for engineering biosensors that function in vitro and in vivo. Biosensors, synthetic RNA agents, and synthetic DNA agents, along with their methods of use, are also provided.

Description

1 / 107 RNA oligonucleotide library and method for selecting a plurality of oligonucleotides binding to non-identical ligands. RELATED REQUEST

[0001] This patent application claims the benefit of priority from U.S. Provisional Patent Application 62 / 432,879, filed December 12, 2016, the contents of which are incorporated herein by reference in their entirety for all purposes. DECLARATION REGARDING RESEARCH OR DEVELOPMENT SPONSORED BY THE FEDERAL GOVERNMENT

[0002] This invention was made with government support under grant number CMMI CHE1150834 granted by the National Science Foundation. The government has certain rights in the invention. FUNDAMENTALS

[0003] Allosteric RNA devices are increasingly seen as important tools capable of monitoring enzyme evolution, optimizing modified metabolic pathways, facilitating the discovery of new genes, and regulating nucleic acid-based therapies. A bottleneck in the development of these platforms, however, is the availability of small molecule-binding RNA aptamers that function robustly in the cellular environment. Although aptamers can be created against virtually any desired target through in vitro selection, many of these RNA-based aptamers cannot be easily integrated into devices or do not function reliably in a cellular context. Consequently, the need for aptamers and methods remains. Petition 870250088301, dated 09 / 29 / 2025, page 7 / 175 2 / 107 to develop aptamers. SUMMARY

[0004] An innovative approach is described here using scaffolds derived from riboswitchers and small ribozymes. This approach, applied here to 5-hydroxytryptophan in an exemplary aspect, produces aptamers that are easily identified and characterized by virtue of the structural scaffold. The nature of the scaffold predisposes these RNAs to coupling to reading frames to design nucleic acid devices that function in vitro and in the cellular context.

[0005] In one aspect, an oligonucleotide library is provided comprising a plurality of non-identical oligonucleotides. The individual oligonucleotides of the library comprise a first sequence comprising a helix domain, a second sequence comprising a first hairpin domain, and a third sequence comprising a second hairpin domain, wherein the helix domain, the first hairpin domain, and the second hairpin domain form an oligonucleotide junction containing a ligand-binding domain, and wherein the library comprises a plurality of non-identical ligand-binding domains.

[0006] In one embodiment, each helix domain is independently a fully complementary helix optionally comprising one or more destabilizing nucleotides selected from the group consisting of a non-matching base pair, a G·U wobble base pair, and a bulge.In one modality, each domain of the helix is ​​a fully complementary helix.

[0007] In one embodiment, each first hairpin domain independently comprises one or more nucleotides. Petition 870250088301, dated 09 / 29 / 2025, page 8 / 175 3 / 107 destabilizers selected from the group consisting of a non-matching base pair, a G*U wobble base pair and a protrusion and / or each second hairpin domain independently comprises one or more destabilizing nucleotides selected from the group consisting of a non-matching base pair, a G*U wobble base pair and a protrusion.

[0008] In one embodiment, the helix domain has at least 4 to 10 base pairs in length or at least 10 base pairs in length.

[0009] In one embodiment, oligonucleotides are oligoribonucleotides.

[00010] In one embodiment, the oligonucleotides individually comprise a sequence that has a series of linked sequences according to Formula I: P1-J1 / 2-P2-L2-P2'-J2 / 3-P3L3-P3'-J3 / 1-P1' (1), wherein - represents a linkage, P1 and P1' form the helix, P2, L2 and P2' form the first hairpin, P3, L3 and P3' form the second hairpin and J1 / 2, J2 / 3 and J3 / 1 together form the oligonucleotide junction. In one embodiment, J2 / 3 comprises a T-loop motif. In one embodiment, the T-loop motif optionally comprises the sequence UUGAA, wherein the guanosine of the T-loop forms a Watson-Crick base pair with a cytidine at J3 / 1.

[00011] In one embodiment, the helix domain has a first end and a second end, and the first end is close to the oligonucleotide junction and the second end is linked to an oligonucleotide-based reading module. In one embodiment, the oligonucleotide-based reading module is fluorogenic, for example, a broccoli fluorophore-binding aptamer or a reading module based on Petition 870250088301, dated 09 / 29 / 2025, page 9 / 175 4 / 107 in exchange, for example, a pbuE exchange. In one embodiment, the oligonucleotide-based reading frame is an oligoribonucleotide-based reading frame.

[00012] In one embodiment, individual oligonucleotides have sequence correspondence with a Bacillus subtilis xpt-pbuX guanine riboswitcher sequence comprising about 23 variable nucleotide residues within the oligonucleotide junction or individual oligonucleotides have sequence correspondence with a Vibrio cholerae cyclic di-GMP Vc2 riboswitcher sequence comprising about 21 variable nucleotide residues within the oligonucleotide junction or individual oligonucleotides have sequence correspondence with a Schistosoma mansoni hammerhead ribozyme sequence comprising about 21 variable nucleotide residues within the oligonucleotide junction.

[00013] In one embodiment, the oligonucleotide junction is an N-way junction, wherein N is two, three, four, or five, or wherein N is two, or wherein N is three, or wherein N is four, or wherein N is five.

[00014] In one embodiment, the library comprises approximately 421 to approximately 423 non-identical members.

[00015] In another aspect, an oligonucleotide library is provided comprising a plurality of non-identical oligonucleotides. The individual oligonucleotides in the library comprise a first sequence comprising a helix domain, a second sequence comprising a first hairpin domain, and a third sequence comprising a second hairpin domain, wherein the helix domain, the first hairpin domain, and the second hairpin domain are the same. Petition 870250088301, dated 09 / 29 / 2025, page 10 / 175 5 / 107 hairpin domains form an oligonucleotide junction containing a pre-selected ligand-binding domain, wherein the library comprises a plurality of non-identical ligand-binding domains.

[00016] In one embodiment, each helix domain is independently a fully complementary helix optionally comprising one or more destabilizing nucleotides selected from the group consisting of a non-matching base pair, a G · U wobble base pair, and a bulge. In one embodiment, each helix domain is a fully complementary helix.

[00017] In one embodiment, each first hairpin domain independently comprises one or more destabilizing nucleotides selected from the group consisting of a non-matching base pair, a G»U wobble base pair and a protrusion and / or each second hairpin domain independently comprises one or more destabilizing nucleotides selected from the group consisting of a non-matching base pair, a G*U wobble base pair and a protrusion.

[00018] In one embodiment, the helix domain has at least 4 to 10 base pairs in length or at least 10 base pairs in length.

[00019] In one embodiment, oligonucleotides are oligoribonucleotides.

[00020] In one embodiment, the individual oligonucleotides comprise a sequence that has a series of linked sequences according to Formula I: P1-J1 / 2-P2-L2-P2'-J2 / 3-P3-L3-P3'J3 / 1-P1'(I), wherein “-” represents a linkage, P1 and P1' form the helix, P2, L2 and P2' form the first hairpin, P3, L3 and P3' Petition 870250088301, dated 09 / 29 / 2025, p. 11 / 175 6 / 107 form the second hairpin and J1 / 2, J2 / 3 and J3 / 1 together form the oligonucleotide junction. In one embodiment, J2 / 3 comprises a T-loop motif. In another embodiment, the T-loop motif optionally comprises the UUGAA sequence, wherein the guanosine of the T-loop forms a Watson-Crick base pair with a cytidine at J3 / 1.

[00021] In one embodiment, the helix domain has a first end and a second end, and the first end is close to the oligonucleotide junction and the second end is linked to an oligonucleotide-based reading module. In one embodiment, the oligonucleotide-based reading module is a fluorogen, for example, it is a broccoli fluorophore-binding aptamer, or an exchange-based reading module, for example, a pbuE exchange. In another embodiment, the oligonucleotide-based reading module is an oligoribonucleotide-based reading module.

[00022] In one embodiment, individual oligonucleotides comprise sequences with sequence correspondence to a Bacillus subtilis xpt-pbuX guanine riboswitcher sequence comprising about 23 variable nucleotide residues within the oligonucleotide junction or individual oligonucleotides comprise sequences with sequence correspondence to a Vibrio cholerae Vc2 cyclic di-GMP riboswitcher sequence comprising about 21 variable nucleotide residues within the oligonucleotide junction or individual oligonucleotides comprise sequences with sequence correspondence to a Schistosoma mansoni hammerhead ribozyme sequence comprising about 21 variable nucleotide residues within the oligonucleotide junction. Petition 870250088301, dated 09 / 29 / 2025, page 12 / 175 7 / 107

[00023] In one embodiment, the oligonucleotide junction is an N-way junction, wherein N is two, three, four, or five, or wherein N is two, or wherein N is three, or wherein N is four, or wherein N is five.

[00024] In one embodiment, the pre-selected ligand binding site comprises a binding site for a compound selected from the group consisting of an amino acid, a peptide, a nucleobase, a nucleoside, a nucleotide, a metal ion, a neurotransmitter, a hormone, an active pharmaceutical ingredient, and derivatives thereof. In one embodiment, the pre-selected ligand binding site comprises a binding site for a ligand selected from the group consisting of an amino acid, a nucleobase, a nucleoside, a nucleotide, a neurotransmitter, a hormone, and derivatives thereof. In one embodiment, the pre-selected ligand binding site comprises a binding site for at least one ligand selected from the group consisting of 5-hydroxy-L-tryptophan, L-tryptophan, serotonin, and 5-hydroxy-L-tryptophan-methylamide. In one embodiment, the ligand is at least one of 5-hydroxy-L-tryptophan or serotonin.

[00025] In yet another aspect, a method is provided for selecting a plurality of non-identical ligand-binding oligonucleotides. The method includes a step of bringing an oligonucleotide library comprising a plurality of oligonucleotides into contact with a ligand under suitable conditions for ligand binding, wherein individual oligonucleotides comprise a first sequence comprising a helix domain, a second sequence comprising a first hairpin domain, and a third sequence comprising a second hairpin domain, wherein the domain of Petition 870250088301, dated 09 / 29 / 2025, page 13 / 175 8 / 107 helix, the first hairpin domain and second hairpin domain form an oligonucleotide junction and a partitioning step of the oligonucleotide library into a spatially addressable, such that the plurality of non-identical ligand-binding oligonucleotides is selected, wherein the oligonucleotides that have the oligonucleotide junction additionally comprise a ligand-binding domain and wherein the ligand-binding domains of the oligonucleotide library comprise variable nucleotide residues, is selected.

[00026] In one embodiment, the method further comprises a step comprising competitively partitioning the oligonucleotide library with a free ligand solution between the contact step and the separation step. BRIEF DESCRIPTION OF THE DRAWINGS

[00027] The foregoing and other features and advantages of the present invention will be more fully understood in the following detailed description of illustrative embodiments taken together with the accompanying drawings. This patent file or patent application contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[00028] Figure 1A shows the GR scaffold. The GR scaffold is derived from the aptamer domain of the guanine riboswitcher of B. subtilis xpt-pbuX (SEQ ID NO: 42). The aptamer consists of three paired regions (P) linked by the junction regions (J) of the three-way junction containing the guanine binding site (Gua, magenta) (dashed lines represent direct RNA-ligand interactions). Nucleotides in outlined cyan are the Petition 870250088301, dated 09 / 29 / 2025, page 14 / 175 9 / 107 were randomized for selection. The terminal turns of P2 and P3 (L2 and L3, green box) participate in a tertiary interaction that organizes the domain. Below is the three-dimensional RNA structure (PDB ID 4FE5) with the same color scheme emphasizing the spatial relationship between the ligand binding site and the randomized nucleotides.

[00029] Figure 1B shows the CDG scaffold (SEQ ID NO: 43). The secondary (top) and tertiary (bottom) structure of the CDG scaffold is derived from the Vc2 cyclic d i-GMP riboswitcher of V. cholera from the aptamer domain (PDB ID 3IWN). The labeling and staining scheme is as described in Figure 1A.

[00030] Figure 1C shows the HH scaffold (SEQ ID NO: 44). The secondary (top) and tertiary (bottom) structure of the HH scaffold is derived from the hammerhead ribozyme of S. mansoni (PDB ID 3ZP8). The labeling and staining scheme is as described in Figure 1A.

[00031] Figure 2A shows the chemical structure of 5-hydroxyL-tryptophan.

[00032] Figure 2B shows an unrooted phylogenetic tree representation of the distance matrix of sequences derived from cycle 7 of GR-SSIII selection. The sequences are grouped into three main clusters, which are colored independently. Distance is expressed as the maximum likelihood estimate (MLE) of how many substitutions occurred per site between two nodes of the tree (bar shown for scale).

[00033] Figure 2C shows an unrooted phylogenetic tree representation of the sequence distance matrix derived from cycle 7 of GR-GsI selection. The four clusters from which representative sequences were analyzed are shown in independent colors (legend shown on the right); Petition 870250088301, dated 09 / 29 / 2025, page 15 / 175 10 / 107 black region represents groupings and regions of the tree that were not analyzed.

[00034] Figure 2D shows a covariation model of six observed clusters derived from GR selections (5HTP-I (SEQ ID NO: 45), 5HTP-II (SEQ ID NO: 46), 5HTP-III (SEQ ID NO: 47), 5HTP-III (Trp aptamer) (SEQ ID NO: 48), 5HTP-IV (SEQ ID NO: 49), 5HTP-V (SEQ ID NO: 50), 5HTP-VI (SEQ ID NO: 51)); the colors are consistent with Figures 2B and 2C. Dashed lines correspond to scaffold regions that were randomized, and lines connecting L2 and L3 denote clusters where sequences were retained that would support tertiary interaction.

[00035] Figure 3A shows the result of selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemical probe of three sequences (5HTP-I, -II and -III) compared to the native guanine xpt riboswitcher. For clarity, the gel regions corresponding to the J2 / 3 and L3 chains are shown (entire gel shown in supplementary Figure 4a). While all three RNAs reveal ligand-dependent reductions in the chemical reactivity of the RNA main chain within or adjacent to J2 / 3, only 5HTP-II preserves a crucial reactivity signature point at L3 that is indicative of the formation of its interaction with L2 in the guanine xpt riboswitcher.

[00036] Figure 3B is a quantification of the ligand-dependent differential intensities of the 5HTPII SHAPE probe in the presence and absence of 5HTP, revealing that most of the reactivity changes are localized at the junction. The increased L3 signal suggests coupling between ligand binding at the junction and tertiary structure formation.

[00037] Figure 3C shows a calorimetric analysis of Petition 870250088301, dated 09 / 29 / 2025, page 16 / 175 11 / 107 Isothermal titration (ITC) of 5HTP binding to 5HTP-II with (left) and without (right) the 5'- and 3'- amplification cassettes, demonstrating that these regions do not affect ligand binding.

[00038] Figure 3D shows a crystal structure of the 5HTP-II aptamer in the complex with 5-hydroxytryptophan (magenta). Green highlights the L2-L3 interaction of the originating scaffold (Figure 1A) and cyan indicates the nucleotides that were randomized in the starting RNA library.

[00039] Figure 3E shows an overlay of the SHAPE reactivity data quantified in panel (B) onto the crystal structure, emphasizing the relationship between ligand-dependent changes in RNA backbone dynamics and structure.

[00040] Figure 4A shows the 5HTP-linking pocket in the 5HTP-II aptamer. The 5HTP-linking pocket within the three-way junction forms a cluster of hydrogen bonding interactions that engages every polar functional group in 5-hydroxytryptophan, except for an oxygen atom in the carboxylate group which becomes an amide to immobilize the compound. Furthermore, the complex is stabilized by stacking interactions between the hydroxyindole ring of 5HTP and the adenine bases (A48 and A49) at J2 / 3.

[00041] Figure 4B shows the 5HTP-binding pocket in aptamer 5HTP-II. The core of the binding pocket in aptamer 5HTP-II (green) is a T-loop that overlaps almost perfectly with the T-turns of tRNAPhe (orange) and the riboswitcher (cyan) of thiamine pyrophosphate (TPP). In each of the three examples, the space between two purines at positions T4 and T5 (the numbering T15 indicates the position of the nucleotide within the T-loop motif) allows for the intercalation of an aromatic ring.

[00042] Figure 5A shows that a biosensor based on Petition 870250088301, dated 09 / 29 / 2025, page 17 / 175 12 / 107 aptamers of 5HTP work in E. coli. The wild-type 5HTP-II aptamer specifically activates the fluorescence of the Broccoli reporter in the presence of 5HTP. At t = 0 minute, 2 mM 5HTP was added to the medium.

[00043] Figure 5B shows that the wild-type 5HTP-II aptamer does not specifically activate the fluorescence of the broccoli reporter in the presence of L-tryptophan. At t = 0 minute, 5 mM L-tryptophan was added to the medium.

[00044] Figure 5C shows that a point mutation in the 5HTP-binding pocket of the 5HTP-II aptamer (A48U) also eliminates fluorescence in the presence of the fluorophore. At t = 0 minute, 2 mM 5HTP was added to the medium.

[00045] Figure 5D shows single-cell traces of fluorescence induction for the wild-type 5HTP-II-Broccoli sensor in the presence of 5HTP. At t = 0 minute, 2 mM 5HTP was added to the medium.

[00046] Figure 5E shows single-cell traces of fluorescence induction for the wild-type 5HTP-II-Broccoli sensor in the presence of L-tryptophan. At t = 0 minute, 5 mM L-tryptophan was added to the medium.

[00047] Figure 5F shows single-cell traces of fluorescence induction for incompetent binding of the 5HTPII A48U construct in the presence of 5HTP. At t = 0 minute, 2 mM 5HTP was added to the medium.

[00048] Figure 6A shows the secondary structure of an artificial 5HTP / serotonin riboswitcher ON based on the 5HTP-IV aptamer (SEQ ID NO: 52). The 5HTP-IV aptamer is embedded within a dashed line, and the embedded solid nucleotides correspond to nucleotides directly involved in the formation of alternative structures. Petition 870250088301, dated 09 / 29 / 2025, page 18 / 175 13 / 107

[00049] Figure 6B shows quantified single-pass transcription reactions of the riboswitcher demonstrating robust antitermination after the addition of 5HTP, serotonin, or 5HTPNHme. Gel images of the transcription reactions are shown on the right, displaying the ligand-dependent transition from terminated (T) to forward-reading (RT) products. Similar titration with L-tryptophan did not produce forward-reading transcripts.

[00050] Figure 7A shows an unrooted phylogenetic tree representation of the sequence distance matrix derived from cycle 7 of CDG selection using the GsI reverse transcriptase. The cluster from which the 5HTP aptamer was derived is highlighted in red. Distance is expressed as the maximum likelihood estimate (MLE) of how many substitutions occurred per site between two nodes of the tree (bar shown for scale).

[00051] Figure 7B shows a covariation model of aptamer 5HTP-VII (SEQ ID NO: 53); the solid red line corresponds to the bioscaffold regions that were randomized and the line connecting L2 and P3 denotes the tertiary interaction.

[00052] Figure 7C shows an unrooted phylogenetic tree representation of the sequence distance matrix derived from cycle 7 of HH selection using the GsI reverse transcriptase. The cluster from which the 5HTP-VIII aptamer was derived is highlighted in purple; the black regions represent clusters and unanalyzed regions of the tree.

[00053] Figure 7D shows a covariation model of aptamer 5HTP-VIII (SEQ ID NO: 54); the solid purple line corresponds to the bioscaffold regions that were randomized and the line connecting P2 and L3 denotes the tertiary interaction. Petition 870250088301, dated 09 / 29 / 2025, page 19 / 175 14 / 107

[00054] Figure 8A shows a significant accumulation of mutations in the bioscaffold by cycle 7 of selection, with some positions at the 3' end reaching a mutation frequency greater than 90% in the initial selection using SuperScript III (Life Technologies). There is also a strong propensity for the accumulation of mutations in sequence elements fundamental to secondary and tertiary structure (P2 and P3).

[00055] Figure 8B shows that the modified selection protocol using a developed group II RT intron (GsIIIC) shows a reduction in the amount of accumulated mutations in the GR bioscaffold, particularly in the P2 and P3 regions. This allows for the preservation of structural elements designed into the sequence.

[00056] Figure 8C shows the observed error frequencies as a function of nucleotide position in cycle 7 of CDG / GsI selection.

[00057] Figure 8D shows the observed error frequencies as a function of nucleotide position in cycle 7 of HH / GsI selection.

[00058] Figure 9A shows a SHAPE analysis of the 5HTP-IV, -V, and -VI aptamers in the absence and presence of 5HTP. Sidebars highlight the J2 / 3 and L3 regions, which demonstrate various ligand-dependent protections at the three-way junction and the presence of the crucial signature reactivity point in the L3 diagnostic of the L2-L3 interaction.

[00059] Figure 9B shows a SHAPE analysis of a 5HTP-binding aptamer with CDG scaffolding. The crude gel shows clear ligand-dependent modifications at J1 / 2 and J2 / 3. The parental Vc2 RNA shows ligand-dependent protection at P3 in the tetra-loop binding site, while the 5HTP-VII aptamer Petition 870250088301, dated 09 / 29 / 2025, p. 20 / 175 15 / 107 shows a ligand-dependent modification on the opposite side of the helix. Additionally, none of the RNAs show any modification in the presence of the ligand independently.

[00060] Figure 9C shows a SHAPE analysis of a 5HTP-binding aptamer with an HH scaffold. The crude gel shows clear ligand-dependent modifications at J1 / 2 and J2 / 3. The changes at J2 / 3 are mainly located at positions 3 and 4 of a predicted T-loop motif. Furthermore, if the structure is maintained, the terminal loop of P3 (L3) that fits into P2 in the parental RNA shows ligand-dependent protection. The integration of the bands as a function of distance in the gel is shown on the left. The sequence ACU43UG45AAUCU is SEQ ID NO: 119

[00061] Figure 10A shows the 2Fo-Fc electron density map of the 5HTP-II / 5HTP complex around the 2σ-contoured model. All RNA regions are well defined by electron density, making the location of residues and the main chain unambiguous. Cyan nucleotides have been randomized in the original RNA library, and 5HTP is shown in orange.

[00062] Figure 10B shows a composite omission of the ligand-binding pocket of the 5HTP-II / 5HTP complex outlined in 1σ showing a light density support location of the ligand (5HTP) and adjacent hexammine iridium (IrHex).

[00063] Figure 10C shows the electron density map of the 2Fo-Fc terminal of the 5HTP binding pocket of the 5HTP-II / 5HTP complex contoured in 1σ.

[00064] Figure 11A shows an R2R diagram derived from the J2 / 3 variance analysis of aptamer 5HTP-VIII (SEQ ID NO: 55) from the most populous cluster of the HH / GsI selection.

[00065] Figure 11B shows a variation analysis of J2 / 3 of Petition 870250088301, dated 09 / 29 / 2025, page 21 / 175 16 / 107 5HTP-VIII aptamer comparing the T-turn variation pattern found in biological RNAs1(top) and the cluster containing the 5HTP-VIII aptamer.

[00066] Figure 12 shows the construction scheme of the 5HTP-Broccoli biosensors (5HTP-II (SEQ ID NO: 56), 5HTP-IV (SEQ ID NO: 57), 5HTP-VII (SEQ ID NO: 58), 5HTP-VIII (SEQ ID NO: 59), Broccoli (SEQ ID NO: 60 and SEQ ID NO: 61). The red nucleotides in the secondary structure of Broccoli indicate the G-quartet that forms the platform for DFHBI, and the green nucleotides indicate the differences between spinach and Broccoli.

[00067] Figure 13 is a graphical summary showing the design of innovative scaffold aptamers of the invention.

[00068] Figure 14A is a schematic of the secondary structure of genetically encoded 5HTP and L-DOPA biosensors in which a GR scaffold aptamer (cyan) is coupled to a fluorogenic aptamer (Broccoli, green) via a communication module (orange, CM; sequences in the background) and stabilized in vivo with tRNA support (yellow).

[00069] Figure 14B and Figure 14C illustrate heatmaps of ligand-induced fluorescence observed (top) and ligand-linked sensor brightness relative to a tRNA / Broccoli control (bottom) for a series of broccoli-coupled GR scaffold aptamers with CMs of 2 to 5 base pairs.

[00070] Figure 14D and Figure 14E depict heat maps of the performance of the same sensors in E. coli.

[00071] Figure 15A and Figure 15B show that the wild-type aptamer 5GR-II specifically activates the fluorescence of the Broccoli reporter in the presence of 5HTP, but not in the presence of L-tryptophan.

[00072] Figure 15C shows that a point mutation in the bag Petition 870250088301, dated 09 / 29 / 2025, page 22 / 175 The 17 / 107 5HTP linkage of the 5GR-II aptamer (A48U) also eliminates fluorescence in the presence of the fluorophore.

[00073] Figure 15D, Figure 15E and Figure 15F represent single-cell fluorescence induction traces for the wild-type 5GR-II-Broccoli sensor in the presence of 5HTP, L-tryptophan and the A48U binding-incompetent 5GR-II construct in the presence of 5HTP. At t = 0 minute, both 2 mM 5HTP and 5 mM L-tryptophan were added to the medium.

[00074] Figure 16A shows the overlap of the parental guanine riboswitcher RNA of B. subtillis xpt and 5GR-11 over all atoms of the main chain. The guanine riboswitcher (PDB 4FE5) is shown in red and its ligand, hypoxanthine, is shown in magenta. The 5GR-II aptamer is shown in blue and its ligand, 5HTP, is shown in green.

[00075] Figure 16B shows the overlap of the two RNAs using atoms from the main chain only at P2 and P3.

[00076] Figure 16C represents a view of the overlap of two basis quadruples comprising the core of the L2-L3 interaction, showing complete preservation of the individual basis interactions that establish this tertiary interaction.

[00077] Figure 17A - Figure 17D represents the sequence and secondary structure of the initial RNA libraries. The green box highlights the constant region used for initiation, and the yellow box highlights the barcode specific to each scaffold. Nucleotide positions that were randomized in the initial library are highlighted in cyan.

[00078] Figure 17A represents the RNA library sequence of the guanine riboswitcher aptamer (GR) for selection using SuperScript III RT (SEQ ID NO: 62).

[00079] Figure 17B represents the library sequence of Petition 870250088301, dated 09 / 29 / 2025, page 23 / 175 18 / 107 RNA from GR used for selection using GsI-IIC RT (SEQ ID NO: 63).

[00080] Figure 17C represents the sequence of the dicyclic GMP (CG) riboswitcher aptamer library (SEQ ID NO: 64).

[00081] Figure 17D represents the sequence of the hammerhead (HR) ribozyme library (SEQ ID NO: 65).

[00082] Figure 18A - Figure 18C represents the selection of scaffold aptamers that selectively bind 3,4-dihydroxyphenylalanine (L-DOPA).

[00083] Figure 18A represents the chemical structure of dopamine (1) and L-DOPA (2).

[00084] Figure 18B represents an unrooted phylogenetic tree representation of the sequence distance matrix derived from cycle 7 of a GR-GsI-IIC selection against L-DOPA. The four clusters from which representative sequences were incorporated into fluorogenic biosensors are shown in independent colors. The black region represents clusters and unanalyzed regions of the tree.

[00085] Figure 18C represents the covariation models of the four clusters (DGR-I (SEQ ID NO: 66), DGR-II (SEQ ID NO: 67), DGR-III (SEQ ID NO: 68), DGR-IV (SEQ ID NO: 69), with colors consistent with those of panel (B). Note that the DGR-III MFE structure has an alternative secondary structure which, if correct, eliminates the Tertiary loop-loop interaction.

[00086] Figure 19 represents the SHAPE analysis of 5HTP-binding aptamers in a GR scaffold. This figure shows the complete gel sequencing region that was used to generate Figure 4A.

[00087] Figure 20 represents the SHAPE analysis of 5HTP-binding aptamers with scaffolding in GR. The complete and unaltered image Petition 870250088301, dated 09 / 29 / 2025, page 24 / 175 19 / 107 of the sequencing gel shown in Figure 4A (regions corresponding to J2 / 3 and L3 were cut to produce Figure 4A). SHAPE analysis of the 5GR-IV, -V, and -VI aptamers is represented in the absence and presence of 5HTP. Sidebars highlight the J2 / 3 and L3 regions which demonstrate various ligand-dependent protections at 3WJ and the presence of the crucial signature reactivity point in the L3 diagnostic of the L2-L3 interaction.

[00088] Figure 21 represents the SHAPE analysis of a 5HTP-binding aptamer from a CG scaffold. The crude gel (insert) shows clear ligand-dependent modifications at J1 / 2 and J2 / 3. The parental Vc2 RNA exhibits a ligand-dependent protection at P3 in the tetra-loop binding site, while the 5CG-I aptamer shows a ligand-dependent modification on the opposite side of the helix. Additionally, none of the RNAs show modifications in the presence of the ligand independently.The integration of the bands as a function of distance in the gel is shown in the background. After normalization and assignment, ligand-dependent changes are still evident (colored asterisks), particularly at J1 / 2.

[00089] Figure 22 represents the SHAPE analysis of a 5HTP-binding aptamer from an HR scaffold. The crude gel (right) shows clear ligand-dependent modifications at J1 / 2 and J2 / 3. The changes at J2 / 3 are mainly located at positions 3 and 4 of a predicted T-loop motif. Furthermore, if the structure is maintained, the terminal loop of P3 (L3) that fits into P2 in the parental RNA shows ligand-dependent protection. The integration of the bands as a function of distance in the gel is shown on the left. After normalization and assignment, the ligand-dependent changes are still evident (colored asterisks). Note that there is no cleavage in the background at the site. Petition 870250088301, dated 09 / 29 / 2025, page 25 / 175 20 / 107 equivalent in parental hammerhead RNA (upper green asterisk). The sequence ACU43UG45AAUCU is SEQ ID NO: 119

[00090] Figure 23 represents engineered modified sensors of the invention that have been synthesized as G-blocks. “N” represents a position in which the composition of A, C, G, and T is approximately 25% each. Aptamer and RNA sensor sequences are given as their equivalent DNA sequences (SEQ ID NOS: 1-13, 70-118). Separate domains of the Broccoli sensors are color-coded to indicate the tRNA structure (gray), the DFHBI-1T binding Broccoli aptamer (yellow), the communication module (cyan), and the GR scaffold aptamer (red). DETAILED DESCRIPTION

[00091] The means to generate synthetic RNA and / or DNA elements with innovative regulatory and detection capabilities are strongly enabled by in vitro selection, and the pool of synthetic aptamers currently available is large. However, only a few small molecule-binding RNA aptamers have transitioned to effective and widely used intracellular biosensors of their cognate ligand or other RNA devices. This discrepancy between in vitro binding and intracellular activity is problematic, suggesting that current selection strategies cannot easily access small molecule-binding RNA aptamers capable of robustly functioning in the cellular environment. Although in vivo selection strategies for small molecule-binding RNAs may be more successful in generating cell-fit aptamers, these approaches are not currently widely practical.Thus, current strategies continue to rely on a prolonged workflow that incorporates selection. Petition 870250088301, dated 09 / 29 / 2025, page 26 / 175 21 / 107 traditional in vitro with tandem and application-specific selections for enhanced function.

[00092] Unlike synthetic aptamers, the small molecule-binding domains of natural riboswitchers have evolved within the cellular context and incorporate additional features that extend beyond the ligand binding site, including high-fidelity folding and an ability to communicate with downstream regulatory switches to produce a detectable response. These aptamers are highly modular and robust, observed in a wide spectrum of bacterial species and interfacing with various regulatory domains acting on transcription, translation, alternative intertwining, and mRNA stability. Thus, they are highly flexible with respect to the mechanisms of communication with adjacent domains or sequences that elicit a result (e.g., gene regulation). These aptamers have been successful in synthetic applications and have been used to validate synthetic RNA tools.Although there has been a substantial effort to identify and characterize natural aptamers, they are inherently limited in their diversity and application due to endogenous groups of effector ligands that are difficult to modulate.

[00093] In response to these difficulties, recurrent architectural folds found in natural RNA aptamers and small nucleolytic ribozymes are provided that can be reprogrammed using in vitro selection to host a broad spectrum of small molecule binding sites, preserving the robust and highly stable architectural folding properties of the parent and its methods of use. The use of partially structured RNA libraries in Petition 870250088301, dated 09 / 29 / 2025, page 27 / 175 22 / 107 Selection of small molecule-binding aptamers has been employed previously, but these simple hairpins and helices do not have the potential to form higher-order structures like natural aptamers. Selection of a very modestly active RNA ligase ribozyme by randomization of a terminal loop in the P456 domain of Tetrahymena ribozyme demonstrated that it is possible to obtain ribozymes for a structured library. However, the P456 architecture is large (160 nucleotides) and restricted to the IC1 and IC2 subclasses of group I self-spacing introns. Thus, it may not be well suited as a general platform for creating diverse small molecule-binding aptamers that are active in a wide spectrum of cellular environments.

[00094] Using scaffolds derived from two different riboswitcher aptamer domains and a ribozyme, a diverse cluster of aptamers that selectively bind to was obtained. 5-hydroxytryptophan (5HTP) and / or serotonin (5HT). Although each of the scaffolds provides unique solutions for recognition, they all converge on similar binding affinities and discriminate against the chemically related L-tryptophan. These aptamers are predisposed by the structural scaffold for coupling to fluorogenic and exchange-based reading modules. While screening strategies are met with varying degrees of success, the diversity of aptamers readily achieved using this approach allows for more flexible strategies with less in vitro characterization required to implement practical RNA devices.

[00095] RNA-based devices are increasingly seen as a potentially robust and predictable tool in synthetic biology. RNA possesses a unique set of characteristics when compared to alternatives based on Petition 870250088301, dated 09 / 29 / 2025, page 28 / 175 23 / 107 proteins, including the ability to regulate into a predictable cis, secondary structure and a small genetic footprint. Among the most sought-after abilities of RNA devices are the capacity to sense external stimuli and modulate a genetic or phenotypic response in the absence of additional protein factors. Efforts have focused on creating synthetic riboswitchers, aptazymes, and fluorogenic RNA sensors, but their potential has not yet been fully realized, in part due to the limited availability of RNA detection domains. The compositions and methods provided here surprisingly demonstrate that the use of naturally developed riboswitchers or ribozymes as scaffolds for selection can yield a robust detection domain capable of functioning in vitro and in the cellular context, on par with the best artificial and natural aptamers to date.

[00096] A fundamental strength of the compositions and methods described here is the use of multiple scaffolds in parallel selections to obtain a cluster of aptamers. Although aptamers derived from different structures have similar affinities for 5HTP and selectivity against L-tryptophan, they clearly have distinct characteristics regarding their ability to communicate with a reading frame via the P1 helix, a feature common to all scaffolds. Without being limited by theory, it is speculated that this is due to variation in the spatial relationship between the ligand and the interdomain helix (P1), a feature that cannot be fully controlled in selection. In biological riboswitchers, the ligand is in direct contact with, or induces conformational changes in, the RNA involving the P1 helix that links the aptamer to the downstream regulatory switch.

[00097] With a grouping of aptamers, approaches Petition 870250088301, dated 09 / 29 / 2025, page 29 / 17524 / 107 combinatorial approaches can be employed to rapidly screen sensors with desired properties without extensive aptamer characterization or device optimization. Typically, traditional in vitro screening yields only a single small molecule binding aptamer, and RNA device development requires screening many communication modules and adapter sequences while leaving the sensor aptamer as a fixed node. With the scaffold screening approach, a cluster of distinct aptamers can be combinatorially coupled to a cluster of communication modules and rapidly screened for variants with the desired activity. In this way, this approach should eliminate the main bottleneck in RNA device and sensor development.Notably, while in this study only the most populous clusters were focused on in each selection for characterization and sensor design, within each selection there were many clusters containing alternative sequences that could further enrich the initial aptamer cluster for developing downstream applications.

[00098] A second powerful advantage of this selection strategy is the robust folding in the cellular context provided by the tertiary interaction of the oligonucleotide junction architecture (e.g., the three-way junction). Each of these aptamers possesses a fold that has undergone extensive biological evolution, and in particular, the distal tertiary interactions that organize the three-way junction core are highly stable. Both the L2-L3 interaction of the purine riboswitcher and the tetra-loop-tetra-loop receptor of the cyclic di-GMP riboswitcher main chain are capable of stably forming outside the context of another RNA structure. This Petition 870250088301, dated 09 / 29 / 2025, page 30 / 175 25 / 107 allows these elements to potentially guide the folding of all members of the initial library, such that the vast majority of the population contains the prescribed secondary and tertiary structure. Misfolding is often a significant problem for traditional synthetic aptamers, which can be greatly exacerbated when the RNA element is coupled to another or placed in the context of a larger RNA. Since there is no significant selection pressure for high-fidelity folding in a typical selection protocol, providing this information in the starting library may be a pathway to robust folding RNAs.

[00099] While three-way junction scaffolds are exemplified here, the diversity of natural riboswitchers and ribozymes can provide more raw material for this approach. Within the three-way junction family, there is a wide variety of sequences that vary the orientation of the three helices, the size of the junction regions, and the nature of the distal tertiary interaction, which can provide superior structures for a particular ligand or sensor. Furthermore, other folds may be predisposed to bind a small target molecule based on the nature of the cognate ligand. For example, another choice for a scaffold to bind 5HTP is the lysine riboswitcher aptamer domain, which contains a five-way junction that harbors the ligand binding site and positions it adjacent to the P1 helix.Larger ligands can be more easily accommodated by scaffolds derived from flavin mononucleotides or cobalamin riboswitchers, while dinucleotides, such as NADH, can be easily accommodated by one of the other dicyclic nucleotide aptamers. Thus, the scaffold selection approaches described here have the potential to facilitate the... Petition 870250088301, dated 09 / 29 / 2025, page 31 / 175 26 / 107 Development of powerful, innovative tools to monitor and respond to small molecules in the cellular environment across a wide range of applications using RNA devices. [000100] In general, the nomenclature used in grouping with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art. The methods and techniques provided herein are generally performed in accordance with conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout this descriptive report, unless otherwise indicated. [000101] Enzymatic reactions and purification techniques are performed according to the manufacturer's specifications, as normally performed in the art or as described herein. The nomenclatures used in grouping with, and the laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, and administration and treatment of patients. [000102] Unless defined otherwise, the scientific and technical terms used herein have the meanings that are commonly understood by those skilled in the art. In case of any latent ambiguity, the definitions given herein take precedence over any dictionary or extrinsic definition. Unless required by the context, singular terms should Petition 870250088301, dated 09 / 29 / 2025, p. 32 / 175 27 / 107 include plurals and plural terms include the singular. The use of or means and / or unless otherwise indicated. The use of the term including, as well as other forms such as includes and include, is not limiting. [000103] In order for the invention to be more easily understood, certain terms are first defined. [000104] The terms aptamer and aptamer domain refer to short, single-stranded sequences of DNA, RNA, or peptide that bind specifically to various molecular targets, such as small molecules, proteins, nucleic acids, cells, tissues, and the like, with high specificity and affinity. Aptamers are generally highly specific, relatively small in size, and non-immunogenic. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are therefore also known as chemical antibodies. Unlike protein antibodies, DNA or RNA aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. [000105] The term riboswitcher refers to an element commonly found in the 5' untranslated region of mRNAs that exerts its regulatory control over the transcript in a cis manner by direct binding of a small molecule ligand. The typical riboswitcher contains two distinct functional domains: an aptamer domain, which adopts a compact three-dimensional fold to support the ligand-binding pocket; and an expression platform, which contains a secondary structural key that interfaces with the transcription or translation machinery. The regulation achieved by virtue of an overlapping region between these two domains, known as the Petition 870250088301, dated 09 / 29 / 2025, page 33 / 175 28 / 107 switching sequence, whose pairing directs RNA folding to one of two mutually exclusive structures on the expression platform that represent the on and off states of mRNA. In certain exemplary embodiments, a preferred riboswitcher is the guanine riboswitcher of B. subtilis xpt-pbuX (herein referred to as GR) or the cyclic di-GMP riboswitcher of Vc2 from Vibrio cholerae (herein referred to as CDG). [000106] The term ribozyme refers to an RNA molecule that acts as an enzyme and is capable of catalyzing specific biochemical reactions, similar to the action of protein enzymes. Classes of ribozymes include GIR1 branching ribozyme, glmS ribozyme, Group I self-spacer intron, Group II self-spacer intron, hairpin ribozyme, hammerhead ribozyme, and HDV ribozyme. In certain exemplary embodiments, a preferred ribozyme is the Schistosoma mansoni hammerhead ribozyme (referred to here as HH). [000107] The terms synthetic RNA agent, synthetic DNA agent, biosensor, and scaffold refer to nucleic acid sensor devices described herein comprising secondary and tertiary structural structures derived from naturally occurring aptamers, for example, riboswitchers and ribozymes. A synthetic RNA agent, synthetic DNA agent, biosensor, or structural framework of the invention includes a helix domain, first and second hairpin domains, and an oligonucleotide junction containing a ligand-binding domain. A biosensor of the invention may comprise an N-way junction, wherein N is 2, 3, or 5. [000108] In certain embodiments, a biosensor of the invention comprises a sequence with a series of linked components of Petition 870250088301, dated 09 / 29 / 2025, page 34 / 175 29 / 107 according to Formula I: (I) P1-J1 / 2-P2-L2-P2'-J2 / 3-P3-L3-P3'J3 / 1-, where -” represents a linkage, P1” and P1” form the helix, P2”, L2 and P2 form the first hairpin, P3”, L3” and P3' form the second hairpin, and J1 / 2”, J2 / 3” and J3 / 1” together form the oligonucleotide junction. (See, for example, Figure 1.) [000109] In certain embodiments, a biosensor of the invention comprises a "reading module" by which the specificity and / or affinity of a module for a ligand can be determined. A "reading module" may be visually detectable, for example, a fluorogenic reading, such as, for example, Broccoli, or it may be a riboswitcher-based reading or an oligonucleotide-based reading, as further described herein. [000110] The term “helix domain” refers to two or more polynucleotides that are held together, for example, by hydrogen, Hoogsteen or inverted Hoogsteen bonds, thus forming a double helix or triple helix structure.[000111] The term “hairpin domain” refers to the ability of a polynucleotide to pair with itself in such a way that the 5' end and the 3' end of the polynucleotide are brought close to each other and are linked by a non-hybridizing portion of the polynucleotide that forms a loop structure. [000112] The term “oligonucleotide junction” refers to two, three, four, or five regions of a backbone that form a ligand-binding site, for example, a Gua-binding site. (See, for example, Figure 1.) [000113] The term "oligonucleotide library" refers to a collection of synthetic oligonucleotide sequences, each sequence comprising a structural scaffold of the invention, wherein each structural scaffold includes at least one domain of Petition 870250088301, dated 09 / 29 / 2025, page 35 / 175 30 / 107 helix, first and second hairpin domains and an oligonucleotide junction containing a ligand-binding domain. [000114] In certain exemplary embodiments, assays are provided for screening ligands or test compounds that bind to a biosensor of the invention. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid-phase or solution-phase libraries; synthetic library methods requiring deconvolution; the “one bed, one compound” library method; and synthetic library methods using affinity chromatography selection.The biological library approach is limited to peptide libraries, while the other four approaches are applicable to libraries of peptide compounds, non-peptide oligomers, or small molecules (Lam, KS (1997) Anticancer Drug Des. 12: 145). [000115] The term “nucleoside” refers to a molecule with a purine or pyrimidine base covalently linked to a ribose or deoxyribose sugar. Exemplary nucleosides include adenosine, guanosine, cytidine, uridine, and thymidine. Additional exemplary nucleosides include inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine (also referred to as “rare” nucleosides). The term “nucleotide” refers to a nucleoside that has one or more phosphate groups linked in ester bonds to the sugar moiety. Exemplary nucleotides include nucleoside monophosphates, diphosphates, and triphosphates. The terms “polynucleotide” and “nucleic acid molecule” are used interchangeably herein and refer to a polymer of Petition 870250088301, dated 09 / 29 / 2025, page 36 / 175 31 / 107 nucleotides linked together by a phosphodiester bond between the 5' and 3' carbon atoms. [000116] The term RNA or “RNA molecule” or “ribonucleic acid molecule” refers to a polymer of ribonucleotides (e.g., 2, 3, 4, 5, 10, 15, 20, 25, 30 or more ribonucleotides). The term “DNA” or “DNA molecule” or “deoxyribonucleic acid molecule” refers to a polymer of deoxyribonucleotides. DNA and RNA can be synthesized naturally (e.g., by DNA replication or DNA transcription, respectively). RNA can be modified after transcription. DNA and RNA can also be synthesized chemically. DNA and RNA can be single-stranded (i.e., ssRNA and ssDNA, respectively) or multi-stranded (e.g., double-stranded, i.e., dsRNA and dsDNA, respectively). "mRNA" or "messenger RNA" is single-stranded RNA that specifies the amino acid sequence of one or more polypeptide chains. This information is translated during protein synthesis when ribosomes bind to the mRNA. [000117] The term “nucleotide analog” or “altered nucleotide” or “modified nucleotide” refers to a non-standard nucleotide, including ribonucleotides or deoxyribonucleotides that do not occur naturally. Exemplary nucleotide analogs are modified at any position so as to alter certain chemical properties of the nucleotide, while still maintaining the ability of the nucleotide analog to perform its intended function. Examples of nucleotide positions that can be derived include position 5, for example, 5-(2-amino)propyluridine, 5-bromouridine, 5-propyneuridine, 5-propenyluridine, etc.; position 6, for example, 6-(2-amino)propyluridine; position 8 for adenosine. Petition 870250088301, dated 09 / 29 / 2025, page 37 / 175 32 / 107 and / or guanosines, for example, 8-bromoguanosine, 8-chloroguanosine, 8-fluoroguanosine, etc. Nucleotide analogs also include deaza nucleotides, for example, 7-deazaadenosine; O and N modified nucleotides (for example, alkylated, for example, N6-methyladenosine, or as known in the art); and other heterocyclically modified nucleotide analogs, such as those described in Herdewijn, Antisense Nucleic Acid Drug Dev., 2000, Aug. 10 (4): 297-310. [000118] Nucleotide analogs may also comprise modifications in the sugar portion of nucleotides. For example, the 2'OH group may be substituted by a group selected from H, OR, R, F, Cl, Br, I, SH, SR, NH2, NHR, NR2, COOR, or OR, wherein R is alkyl, alkenyl, alkynyl, aryl, etc., C1-C6 substituted or unsubstituted. Other possible modifications include those described in U.S. Patents 5,858,988 and 6,291,438. [000119] The phosphate group of the nucleotide can also be modified, for example, by replacing one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates) or by making other substitutions that allow the nucleotide to perform its intended function, as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev. April 2000 10 (2): 117-21, Rusckowski et al. Antisense Nucleic Acid Drug Dev. October 2000 10 (5): 333-45, Stein, Nucleic Acid Drug Dev. October 2001 11 (5): 317-25, Vorobjev et al. Antisense Nucleic Acid Drug Dev. April 2001 11 (2): 77-85 and US Patent 5,684,143. Some of the modifications referenced above (e.g., phosphate group modifications) preferably decrease the hydrolysis rate of, for example, polynucleotides. Petition 870250088301, dated 09 / 29 / 2025, page 38 / 175 33 / 107 including said in vivo or in vitro analogues. [000120] In certain exemplary embodiments, a detectable marker may be used to detect one or more oligonucleotides and / or polynucleotides described herein. Examples of detectable markers include various radioactive moieties, enzymes, prosthetic groups, fluorescent markers, luminescent markers, bioluminescent markers, metallic particles, protein-protein binding pairs, protein-antibody binding pairs, and the like. Examples of fluorescent proteins include, but are not limited to, yellow fluorescent protein (YFP), green fluorescent protein (GFP), cyan fluorescent protein (CFP), umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, fluorescein dichlorotriazinylamine, dansyl chloride, phycoerythrin, and the like. Examples of bioluminescent markers include, but are not limited to, luciferase (e.g., bacterial, firefly, click beetle, and the like), luciferin, aequorin, and the like.Examples of enzymatic systems that have visually detectable signals include, but are not limited to, galactosidases, glucuronidases, phosphatases, peroxidases, cholinesterases, and the like. Identifiable markers also include radioactive compounds such as 125I, 35S, 14C, or 3H. Identifiable markers are commercially available from a variety of sources. [000121]

[0045] Fluorescent markers and their binding to nucleotides and / or oligonucleotides are described in many reviews, including Haugland, Handbook of Fluorescent Probes and Research Chemicals, Ninth Edition (Molecular Probes, Inc., Eugene, 2002); Keller and Manak, DNA Probes, 2nd edition (Stockton Press, New York, 1993); Eckstein, editor, Oligonucleotides and Petition 870250088301, dated 09 / 29 / 2025, p. 39 / 175 34 / 107 Analogs: A Practical Approach (IRL Press, Oxford, 1991); and Wetmur, Critical Reviews in Biochemistry and Molecular Biology, 26: 227-259 (1991). Particular methodologies applicable to the invention are disclosed in the following sample of references: US Patents 4,757,141, 5,151,507 and 5,091,519. In one aspect, one or more fluorescent dyes are used as markers for labeled target sequences, for example, as disclosed by U.S. Patent 5,188,934 (4,7-dichlorofluorescein dyes); U.S. Patent 5,366,860 (spectrally resolved rhodamine dyes); U.S. Patent 5,847,162 (4,7-dichlororhodamine dyes); U.S. Patent 4,318,846 (ether-substituted fluorescein dyes); U.S. Patent 5,800,996 (energy transfer dyes); Lee et al.; U.S. Patent 5,066,580 (xanthine dyes); U.S. Patent 5,688,648 (energy transfer dyes); and the like. The marking can also be done with quantum dots, as disclosed in the following US patents and patent applications: US Patents 6,322,901, 6,576,291, 6,423,551, 6,251,303, 6,319,426, 6,426,513, 6,444,143, 5,990,479, 6,207,392, 2002 / 0045045 and 2003 / 0017264. As used herein, the term "fluorescent marker" includes a signaling portion that transmits information through the fluorescent absorption and / or emission properties of one or more molecules. Such fluorescent properties include fluorescence intensity, fluorescence lifetime, emission spectrum characteristics, energy transfer, and the like. [000122] The term “oligonucleotide” refers to a short polymer of nucleotides and / or nucleotide analogs. The term Petition 870250088301, dated 09 / 29 / 2025, page 40 / 175 35 / 107 “RNA analog” or “DNA analog” refers to a polynucleotide (e.g., a chemically synthesized polynucleotide) with at least one nucleotide altered or modified compared to an unaltered or unmodified DNA or RNA, but which retains the same or similar nature or functions as the corresponding unaltered or unmodified DNA or RNA. As discussed earlier, oligonucleotides may be linked with linkages that result in a lower rate of hydrolysis of the RNA or DNA analog compared to an RNA or DNA molecule with phosphodiester linkages. For example, the nucleotides of the analog may comprise methylenediol, ethylenediol, oxymethylthio, oxyethylthio, oxycarbonyloxy, phosphorodiamidate, phosphoramidate, and / or phosphorothioate linkages. Preferred RNA or DNA analogs include ribonucleotides and / or deoxyribonucleotides modified with sugar and / or a backbone.Such alterations or modifications may also include the addition of non-nucleotide material, such as the RNA or DNA terminal(s) or internally (in one or more RNA or DNA nucleotides). [000123] As used herein, the term “isolated RNA” or “isolated DNA” refers to RNA or DNA molecules that are substantially free of other cellular material or culture medium when produced by recombinant techniques or substantially free of chemical precursors or other chemicals when chemically synthesized. [000124] The term “in vitro” has its recognized meaning in the technique, for example, involving pure reagents or extracts, for example, cell extracts. The term “in vivo” also has its recognized meaning in the technique, for example, involving living cells, for example, immortalized cells, cells Petition 870250088301, dated 09 / 29 / 2025, page 41 / 175 36 / 107 primary, cell lines and / or cells in an organism. [000125] As used herein, the term transgene refers to any nucleic acid molecule that is artificially inserted into a cell and becomes part of the genome of the organism that develops from that cell. Such a transgene may include a gene that is partially or wholly heterologous (i.e., foreign) to the transgenic organism or may represent a gene homologous to an endogenous gene of the organism. The term transgene also means a nucleic acid molecule that includes one or more selected nucleic acid sequences, for example, DNAs, that encode one or more RNA precursors, to be expressed in a transgenic organism, for example, an animal, that is partially or wholly heterologous, i.e., foreign, to the transgenic animal, or homologous to an endogenous gene of the transgenic animal, but which is designed to be inserted into the animal's genome at a location that differs from that of the natural gene.A transgene includes one or more promoters and any other DNA, such as introns, necessary for the expression of the selected nucleic acid sequence, all operatively linked to the selected sequence and may include an enhancer sequence. [000126] A gene involved in a disease or disorder includes a gene, the normal or aberrant expression or function which produces or causes the disease or disorder, or at least one symptom of said disease or disorder. [000127] As used herein, the term sample population refers to a population of individuals comprising a statistically significant number of individuals. For example, the sample population may comprise 50, 75, 100, 200, 500, 1000 or more individuals. In particular embodiments, the Petition 870250088301, dated 09 / 29 / 2025, page 42 / 175 37 / 107 The sample population may comprise individuals who share at least one common disease phenotype (e.g., a gain-of-function disorder) or mutation (e.g., a gain-of-function mutation). [000128] As used herein, the term heterozygosity refers to the fraction of individuals within a population that are heterozygous (i.e., contain two or more different alleles) at a particular locus (e.g., at a SNP). Heterozygosity can be calculated for a sample population using methods that are well known to those skilled in the art. [000129] The phrase examining the function of a gene in a cell or organism refers to the examination or study of its expression, activity, function, or resulting phenotype. [000130] As used herein, the term rare nucleotide refers to a naturally occurring nucleotide that occurs infrequently, including deoxyribonucleotides or ribonucleotides that occur infrequently, for example, a naturally occurring ribonucleotide that is not guanosine, adenosine, cytosine, or uridine. Examples of rare nucleotides include, but are not limited to, inosine, 1-methylinosine, pseudouridine, 5,6-dihydrouridine, ribothymidine, 2N-methylguanosine, and 2,2N,N-dimethylguanosine. [000131] The term engineered modified, as in an engineered RNA precursor or an engineered nucleic acid molecule, indicates that the precursor or molecule is not found in nature, where all or a portion of the nucleic acid sequence of the precursor or molecule is created or selected by a human. Once created or selected, the sequence can be replicated, translated, Petition 870250088301, dated 09 / 29 / 2025, page 43 / 175 38 / 107 transcribed or processed by mechanisms within a cell. Thus, an RNA precursor produced within a cell from a transgene that includes a modified nucleic acid molecule is an engineered RNA precursor. [000132] As used herein, the term “bond strength” or “base pair strength” refers to the strength of the interaction between pairs of nucleotides (or nucleotide analogs) on opposite strands of an oligonucleotide duplex, due primarily to H-bonding, van der Waals and similar interactions between said nucleotides (or nucleotide analogs). [000133] As used herein, the term “destabilizing nucleotide” refers to a first nucleotide or nucleotide analog capable of forming a base pair with the second nucleotide or nucleotide analog such that the base pair is of lower binding resistance than a conventional base pair (i.e., Watson-Crick base pair). In certain embodiments, the destabilizing nucleotide is capable of forming a non-matching base pair with the second nucleotide. In other embodiments, the destabilizing nucleotide is capable of forming a wobbly base pair with the second nucleotide. In still other embodiments, the destabilizing nucleotide is capable of forming an ambiguous base pair with the second nucleotide. In yet another embodiment, the destabilizing nucleotide is capable of forming a bulge, wherein the destabilizing nucleotide does not pair with the second nucleotide. [000134] As used herein, the term “base pair” refers to the interaction between pairs of nucleotides (or nucleotide analogs) on opposite strands of an oligonucleotide duplex, primarily due to hydrogen bonding, van der Waals interactions. Petition 870250088301, dated 09 / 29 / 2025, p. 44 / 175 39 / 107 and similar nucleotides (or nucleotide analogs). As used herein, the term “bonding strength” or “base pair strength” refers to the strength of the base pair. [000135] As used herein, the term “non-coincident base pair” refers to a base pair consisting of non-complementary or non-Watson-Crick base pairs, for example, non-normal complementary G:C, A:T, or A:U base pairs. As used herein, the term “ambiguous base pair” (also known as a non-discriminatory base pair) refers to a base pair formed by a universal nucleotide. [000136] As used herein, the term “universal nucleotide” (also known as “neutral nucleotide”) includes nucleotides (e.g., certain destabilizing nucleotides) that possess a base (a “universal base” or “neutral base”) that does not significantly discriminate between bases in a complementary polynucleotide when a base pair is formed. Universal nucleotides are predominantly hydrophobic molecules that can efficiently stack in antiparallel duplex nucleic acids (e.g., double-stranded DNA or RNA) due to stacking interactions. The base moieties of universal nucleotides typically comprise a nitrogen-containing aromatic heterocyclic moiety. [000137] As used herein, the terms “sufficient complementarity” or “sufficient degree of complementarity” mean that an oligonucleotide sequence is sufficiently complementary to bind to a desired target oligonucleotide. [000138] Several methodologies of the present invention include the step involving the comparison of a value, level, feature, characteristic, property, etc., to an “adequate control”, Petition 870250088301, dated 09 / 29 / 2025, page 45 / 175 40 / 107 herein referred to interchangeably as an “appropriate control.” An “appropriate control” is any control or standard known to one skilled in the art to be useful for comparison purposes. In one embodiment, an “appropriate control” is a value, level, feature, characteristic, property, etc., determined prior to performing a methodology as described herein. For example, a transcription rate, mRNA level, translation rate, protein level, biological activity, cellular characteristic or property, genotype, phenotype, etc., may be determined prior to introducing a synthetic RNA or DNA agent of the invention into a cell or organism. In another embodiment, an “appropriate control” is a value, level, feature, characteristic, property, etc., determined in a cell or organism, for example, a control or a normal cell or organism exhibiting, for example, normal traits.In yet another interpretation, "adequate control" or "appropriate control" refers to a predefined value, level, resource, characteristic, property, etc. [000139] The synthetic RNA or DNA agents of the invention can be introduced directly into the cell (i.e., intracellularly) or introduced extracellularly into a cavity, interstitial space, the circulation of an organism, introduced orally, or can be introduced by bathing a cell or organism in a solution containing the nucleic acid. Vascular or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites where the synthetic RNA or DNA agent can be introduced. [000140] The synthetic RNA or DNA agents of the invention can be introduced using acid delivery methods. Petition 870250088301, dated 09 / 29 / 2025, page 46 / 175 41 / 107 nucleic acids known in the art, including injection of a solution containing the nucleic acid, bombardment by particles coated with the RNA agent, soaking the cell or organism in a solution of the RNA agent, or electroporation of cell membranes in the presence of the RNA agent. Other methods known in the art may be used for the introduction of nucleic acids into cells, such as lipid-mediated carrier transport, chemically mediated transport, and transfection of cationic liposomes, such as calcium phosphate and the like. The synthetic RNA or DNA agent may be introduced together with other components that perform one or more of the following activities: increase the uptake of nucleic acid by the cell or otherwise increase the inhibition of the target gene. [000141] Physical methods of nucleic acid delivery include injection of a solution containing the biosensor, bombardment by particles coated with the biosensor, saturation of the cell or organism in a biosensor solution, or electroporation of cell membranes in the presence of the biosensor. A viral construct packaged in a viral particle would achieve both efficient delivery of an expression construct into the cell and transcription of RNA encoded by the expression construct. Other methods known in the art may be used for nucleic acid delivery into cells, such as lipid-mediated carrier transport, chemically mediated transport such as calcium phosphate and the like.Thus, RNA can be introduced along with components that perform one or more of the following activities: increase RNA uptake by the cell, inhibit single-strand pairing, stabilize single strands, or increase inhibition of the target gene. Petition 870250088301, dated 09 / 29 / 2025, p. 47 / 175 42 / 107 [000142] The synthetic RNA or DNA agent can be introduced directly into the cell (i.e., intracellularly) or introduced extracellularly into a cavity, interstitial space, the circulation of an organism, introduced orally, or it can be introduced by bathing a cell or organism in a solution containing the RNA or DNA. Vascular or extravascular circulation, the blood or lymphatic system, and cerebrospinal fluid are sites where RNA or DNA can be introduced. [000143] A target cell can be germline or somatic, totipotent or pluripotent, dividing or non-dividing, parenchymal or epithelial, immortalized or transformed, or similar. The cell can be a stem cell or a differentiated cell. Types of cells that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neutrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of endocrine or exocrine glands. [000144] The synthetic RNA or DNA agent can be introduced in an amount that allows the distribution of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500, or 1,000 copies per cell) of material can produce more effective inhibition; lower doses may also be useful for specific applications. [000145] In an exemplary aspect, the effectiveness of a biosensor of the invention is tested with respect to its ability to specifically modulate the transcription, translation, alternative spacing, and / or mRNA stability of a target in a cell. Cells can be transfected with one or more biosensors. Petition 870250088301, dated 09 / 29 / 2025, page 48 / 175 43 / 107 described herein. Selective reduction in target DNA, target RNA (e.g., mRNA), and / or target protein is measured. The reduction in target DNA, RNA, or protein can be compared to the levels of target DNA, RNA, or protein in the absence of a biosensor or in the presence of a biosensor that does not target DNA, RNA, or protein. Exogenously introduced DNA, RNA, or protein can be analyzed for comparison purposes. When using neuronal cells, which are known to be resistant to conventional transfection techniques, it may be desirable to introduce biosensors by passive uptake. [000146] Treatment or to treat, as used herein, defined as the application or administration of a therapeutic agent (e.g., a synthetic RNA or DNA agent) to a patient or the application or administration of a therapeutic agent to an isolated tissue or cell line of a patient who has the disease or disorder, a symptom of a disease or disorder, or a predisposition to a disease or disorder, for the purpose of curing, healing, relieving, attenuating, altering, remedying, mitigating, improving, or affecting the disease or disorder, the symptoms of the disease or disorder, or the predisposition to the disease. [000147] In one aspect, the invention provides a method for preventing a disease or disorder in an individual by administering to the individual a therapeutic agent (for example, a synthetic RNA or DNA agent or vector or transgene encoding the same). Individuals at risk for the disease can be identified, for example, by any one or a combination of diagnostic or prognostic factors. Administration of a prophylactic agent can occur before the manifestation of the characteristic symptoms of the disease or disorder, such that the disease or disorder is prevented or, alternatively, delayed in Petition 870250088301, dated 09 / 29 / 2025, p. 49 / 175 44 / 107 your progression. [000148] Another aspect of the invention relates to methods that treat individuals therapeutically, that is, alter the onset of symptoms of a disease or disorder. In an exemplary embodiment, the modulating method of the invention involves placing a cell expressing a disorder in contact with a therapeutic agent (for example, a synthetic RNA or DNA agent or vector or transgene encoding the same) that is specific for one or more target sequences, such that specific sequence interaction with the target sequence is achieved. These methods can be performed in vitro (for example, by culturing the cell with the agent) or, alternatively, in vivo (for example, by administering the agent to an individual). [000149] With regard to prophylactic and therapeutic treatment methods, such treatments may be specifically adapted or modified based on knowledge gained in the field of pharmacogenomics. Pharmacogenomics, as used herein, refers to the application of genomic technologies, such as gene sequencing, statistical genetics, and gene expression analysis, to drugs in clinical development and on the market. More specifically, the term refers to the study of how a patient's genes determine their response to a drug (e.g., the patient's drug response phenotype or drug response genotype). Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with the target gene molecules of the present invention or target gene modulators according to the individual's drug response genotype. Pharmacogenomics allows a physician or clinician to target prophylactic treatments. Petition 870250088301, dated 09 / 29 / 2025, p. 50 / 175 45 / 107 or therapeutics for patients who will benefit most from treatment and to avoid treatment of patients who experience toxic side effects related to the drug. [000150] Therapeutic agents may be tested in an appropriate animal model. For example, a synthetic RNA or DNA agent (or expression vector or transgene encoding the same) as described herein may be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with said agent. Alternatively, a therapeutic agent may be used in an animal model to determine the mechanism of action of such agent. For example, an agent may be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such agent. Alternatively, an agent may be used in an animal model to determine the mechanism of action of such agent. [000151] A pharmaceutical composition containing a synthetic RNA or DNA agent of the invention can be administered to any patient diagnosed as having or at risk of developing a disorder. In one embodiment, the patient is diagnosed as having a disorder and the patient is generally in good health. For example, the patient is not terminally ill and the patient is likely to live at least 2, 3, 5 or more years after diagnosis. The patient may be treated immediately after diagnosis or treatment may be delayed until the patient is experiencing more debilitating symptoms. In another embodiment, the patient has not reached an advanced stage of the disease. [000152] A synthetic RNA or DNA agent may be administered at a unit dose of less than about 1.4 mg per kg of body weight or less than 10, 5, 2, 1, 0.5, 0.1, 0.05, 0.01, 0.005, 0.001, 0.0005, 0.0001, 0.00005 or 0.00001 mg per kg of body weight Petition 870250088301, dated 09 / 29 / 2025, p. 51 / 175 46 / 107 body weight and less than 200 nmol of RNA agent (e.g., approximately 4.4 x 10¹⁶ copies) per kg of body weight or less than 1,500, 750, 300, 150, 75, 15, 7.5, 1.5, 0.75, 0.15, 0.075, 0.015, 0.0075, 0.0015, 0.00075, 0.00015 nmol of a synthetic agent of RNA or DNA per kg of body weight. A single dose, for example, can be administered by injection (e.g., intravenous or intramuscular, intrathecal, or directly into the brain), an inhaled dose, or a topical application. Particularly preferred dosages are less than 2, 1, or 0.1 mg / kg of body weight. [000153] The administration of a synthetic RNA or DNA agent directly to an organ may be at a dosage in the order of about 0.00001 mg to about 3 mg per organ, or preferably about 0.0001 to 0.001 mg per organ, about 0.03 to 3.0 mg per organ, 0.1 to 3.0 mg per eye, or about 0.3 to 3.0 mg per organ.Dosage can be an effective amount to treat or prevent a disorder. In one embodiment, the unit dose is administered less frequently than once a day, for example, less than every 2, 4, 8, or 30 days. In another embodiment, the unit dose is not administered with a frequency (e.g., not a regular frequency). For example, the single dose may be administered only once. In one embodiment, the effective dose is administered with other traditional therapeutic modalities. [000154] In one embodiment, an individual is administered an initial dose and one or more maintenance doses of a synthetic RNA or DNA agent. The maintenance dose or doses are generally lower than the initial dose, for example, half the initial dose. A maintenance regimen may include treating the individual with a dose or doses ranging from 0.01 μg to 1.4 mg / kg of body weight per day, for example, 10, 1, 0.1, 0.01, 0.001, or 0.00001 mg per kg of body weight per day. Doses of Petition 870250088301, dated 09 / 29 / 2025, p. 52 / 175 47 / 107 maintenance doses are preferably administered no more than once every 5, 10, or 30 days. Furthermore, the treatment regimen may last for a period of time that will vary depending on the nature of the particular disease, its severity, and the patient's general condition. In preferred modalities, the dosage may be administered no more than once a day, for example, no more than once every 24, 36, 48 or more hours, for example, no more than once every 5 or 8 days. After treatment, the patient may be monitored for changes in their condition and to alleviate symptoms of the disease state. The dosage of the compound may be increased if the patient does not respond significantly to the current dosage levels, or the dose may be decreased if relief of disease state symptoms is observed, if the disease state has been reduced, or if undesirable side effects are observed. [000155] The effective dose can be administered as a single dose or in two or more doses, as desired or considered appropriate in the specific circumstances. If you wish to facilitate repeated or frequent infusions, the implantation of a delivery device, for example, a pump, semi-permanent stent (e.g., intravenous, intraperitoneal, intracisternal, or intracapsular), or reservoir, may be advisable. In one embodiment, a pharmaceutical composition includes a plurality of synthetic RNA or DNA agent species. In another embodiment, the synthetic RNA or DNA agent species has sequences that are not overlapping and not adjacent to another species with respect to a naturally occurring target sequence. In another embodiment, the plurality of a synthetic RNA or DNA agent species is specific to different naturally occurring targets. In another embodiment, the plurality of a Petition 870250088301, dated 09 / 29 / 2025, p. 53 / 175 48 / 107 species of synthetic RNA or DNA agent targets two or more target sequences (e.g., two, three, four, five, six, or more target sequences). [000156] After successful treatment, it may be desirable for the patient to undergo maintenance therapy to prevent recurrence of the disease state, in which the compound of the invention is administered in maintenance doses ranging from 0.01 μg to 100 g per kg of body weight (see U.S. Patent 6,107,094). [000157] The concentration of a synthetic RNA or DNA agent composition is an amount sufficient to be effective in treating or preventing a disorder or regulating a physiological condition in humans. The concentration or amount of a synthetic RNA or DNA agent administered will depend on the parameters determined for the agent and the method of administration, for example, nasal, buccal, or pulmonary. For example, nasal formulations tend to require much lower concentrations of some ingredients to avoid irritation or burning of the nasal passages. Sometimes it is desirable to dilute an oral formulation up to 10 to 100 times in order to provide an adequate nasal formulation. [000158] Certain factors may influence the dosage required to effectively treat an individual, including but not limited to, severity of the disease or disorder, previous treatments, general health status and / or age of the individual, and other present illnesses. Furthermore, treatment of an individual with a therapeutically effective amount of a synthetic RNA or DNA agent may include a single treatment or, preferably, a series of treatments. It will also be understood that the effective dosage of a synthetic RNA or DNA agent for Petition 870250088301, dated 09 / 29 / 2025, page 54 / 175 49 / 107 treatment may increase or decrease over the course of a particular treatment. Dosage changes may result from and become apparent from the results of diagnostic tests, as described herein. For example, the individual may be monitored after administration of a synthetic RNA or DNA agent composition. Based on the monitoring information, an additional amount of the synthetic RNA or DNA agent composition may be administered. [000159] Dosage depends on the severity and responsiveness of the disease state being treated, with the course of treatment lasting from several days to several months or until a cure is secured or a reduction in the disease state is achieved. Ideal dosage regimens can be calculated from measurements of drug accumulation in the patient's body. Experts can easily determine ideal dosages, dosing methodologies, and repetition rates. Ideal dosages may vary depending on the relative potency of the individual compounds and can generally be estimated based on EC50s considered effective in in vitro and in vivo animal models. [000160] The invention relates to the use of the agents described above for prophylactic and / or therapeutic treatments as described above. Consequently, modulators (e.g., synthetic RNA or DNA agents) of the present invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid, protein, antibody or modulating compound and a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersing media, coatings, agents Petition 870250088301, dated 09 / 29 / 2025, p. 55 / 175 50 / 107 antibacterial and antifungal agents, isotonic and absorption-retardant agents and the like, compatible with pharmaceutical administration. The use of such means and agents for pharmaceutically active substances is well known in the art. Except to the extent that any conventional means or agent is incompatible with the active compound, their use in the compositions is contemplated. Supplementary active compounds may also be incorporated into the compositions. [000161] A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral administration, for example, intravenous (IV), intradermal, subcutaneous (SC or SQ), intraperitoneal, intramuscular, oral (e.g., inhalation), transdermal (topical), and transmucosal. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methylparabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; Buffers, such as acetates, citrates or phosphates, and agents for adjusting tonicity, such as sodium chloride or dextrose.The pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be contained in ampoules, disposable syringes, or multi-dose vials made of glass or plastic. [000162] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (when soluble in Petition 870250088301, dated 09 / 29 / 2025, page 56 / 175 51 / 107 water) or sterile dispersions and powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate-buffered saline (PBS). In all cases, the composition must be sterile and fluid enough to allow easy use of the syringe. It must be stable under manufacturing and storage conditions and must be protected against contamination by microorganisms such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol and the like), and appropriate mixtures thereof.Adequate fluidity can be maintained, for example, by the use of a coating, such as lecithin, by maintaining the required particle size in case of dispersion, and by the use of surfactants. Prevention of microbial action can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of injectable compositions can be achieved by including an absorption-retardant agent in the composition, for example, aluminum monostearate and gelatin. [000163] Sterile injectable solutions can be prepared by incorporating the active compound in the required quantity into an appropriate solvent with one or a combination of the ingredients listed above, as required, followed by sterilization by filtration.Generally, the dispersions are... Petition 870250088301, dated 09 / 29 / 2025, page 57 / 175 52 / 107 prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other necessary ingredients from those listed previously. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying, which produce a powder of the active ingredient plus any desired additional ingredient from a previously filtered sterile solution thereof. [000164] Oral compositions generally include an inert diluent or an edible carrier. They may be contained in gelatin capsules or tablets in tablet form. For purposes of oral therapeutic administration, the active compound may be incorporated with excipients and used in the form of tablets, turmeric tablets, or capsules. Oral compositions may also be prepared using a carrier fluid for use as a mouthwash, in which the compound in the carrier fluid is applied orally and rinsed and expectorated or swallowed. Pharmaceutically compatible binding agents and / or adjuvant materials may be included as part of the composition.Tablets, pills, capsules, tablets and the like may contain any of the following ingredients or compounds of a similar nature: a binder, such as microcrystalline cellulose, tragacanth gum or gelatin; an excipient, such as starch or lactose; a disintegrating agent, such as algic acid, Primogel or corn starch; a lubricant, such as magnesium stearate or Estirotes; a glide, such as colloidal silicon dioxide; a sweetening agent, such as sucrose or saccharin; or a flavoring agent, such as peppermint, methyl salicylate or orange flavoring. Petition 870250088301, dated 09 / 29 / 2025, page 58 / 175 53 / 107 [000165] For inhalation administration, the compounds are delivered as an aerosol jet from a pressurized container or dispenser containing a suitable propellant, for example, a gas such as carbon dioxide or a nebulizer. [000166] Systemic administration can also be transmucosal or transdermal. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be performed using nasal sprays or suppositories. For transdermal administration, the active compounds are formulated in ointments, creams, gels, or ointments, as is generally known in the art. [000167] The compounds can also be prepared in the form of suppositories (for example, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal administration. [000168] The synthetic RNA or DNA agent can also be administered by transfection or infection using methods known in the art, including, but not limited to, the methods described in McCaffrey et al. (2002), Nature, 418 (6893), 38-9 (hydrodynamic transfection); Xia et al. (2002), Nature Biotechnol., 20 (10), 1006-10 (viral-mediated delivery); or Putnam (1996), Am. J. Health Syst. Pharm. 53 (2), 151-160, errata in Am. J. Health Syst. Pharm. 53 (3), 325 (1996). [000169] The synthetic RNA or DNA agent may also be administered by any method suitable for administering nucleic acid agents, such as a DNA vaccine. These Petition 870250088301, dated 09 / 29 / 2025, p. 59 / 175 54 / 107 methods include gene guns, bioinjectors and skin patches, as well as needle-free methods, such as the microparticle DNA vaccine technology disclosed in U.S. Patent 6,194,389 and needle-free transdermal mammalian vaccination with powder vaccine as disclosed in U.S. Patent 6,168,587. Additionally, intranasal administration is possible, as described, inter alia, by Hamajima et al. (1998), Clin. Immunol. Immunopathol. 88 (2), 205-10. Liposomes (for example, as described in U.S. Patent 6,472,375) and microencapsulation can also be used. Biodegradable target microparticle delivery systems can also be used (for example, as described in U.S. Patent 6,471,996). [000170] In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid may be used. Methods for preparing such formulations will be evident to those skilled in the art. The materials may also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) may also be used as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent 4,522,811. Petition 870250088301, dated 09 / 29 / 2025, page 60 / 175 55 / 107 [000171] It is especially advantageous to formulate oral or parenteral compositions in dosage unit form to facilitate administration and dosage uniformity. The dosage unit form, as used herein, refers to physically discrete units suitable as unit dosages for the individuals to be treated; each unit contains a predetermined amount of the therapeutic compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention is dictated by and directly dependent on the unique characteristics of the active compound and the specific therapeutic effect to be achieved and the inherent limitations in the composition technique, such as an active compound for the treatment of individuals. [000172] The toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, to determine the LD50 (the lethal dose for 50% of the population) and the ED50 (the therapeutically effective dose in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the LD50 / ED50 ratio. Compounds exhibiting high therapeutic indices are preferred. Although compounds with toxic side effects may be used, care must be taken to design a delivery system that targets such compounds to the affected tissue site in order to minimize potential damage to uninfected cells and thus reduce side effects. [000173] Data obtained from cell culture assays and animal studies can be used in formulating a dosage range for human use. The dosage of such Petition 870250088301, dated 09 / 29 / 2025, page 61 / 175 56 / 107 compounds are preferably found within a range of circulating concentrations that include the ED50 with little or no toxicity. Dosage may vary within this range depending on the dosage form employed and the route of administration used. For any compound used in the method of the invention, the therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test compound that achieves a mid-maximum response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography. [000174] Pharmaceutical compositions may be included in a container, package or dispenser, along with optional instructions for administration. [000175] As defined herein, a therapeutically effective amount of synthetic RNA or DNA agent (i.e., an effective dosage) depends on the synthetic RNA or DNA agent selected. For example, single-dose amounts in the range of approximately 1 pg to 1,000 mg may be administered; in some embodiments, 10, 30, 100, or 1,000 pg may be administered. In some embodiments, 1 to 5 g of the compositions may be administered. The compositions may be administered one or more times daily to one or more times weekly; including once every two days. Those knowledgeable will understand that certain factors may influence the dosage and frequency required to effectively treat an individual, including but not limited to, severity of the disease or disorder, prior treatments, and medical status. Petition 870250088301, dated 09 / 29 / 2025, page 62 / 175 57 / 107 general health and / or age of the individual and other existing diseases. In addition, treatment of an individual with a therapeutically effective amount of a synthetic RNA or DNA agent may include a single treatment or, preferably, may include a series of treatments. [000176] The nucleic acid molecules of the invention can be inserted into expression constructs, for example, viral vectors, retroviral vectors, expression cassettes or plasmid viral vectors, for example, using methods known in the art including, but not limited to, those described in Xia et al., (2002), Supra. The expression constructs can be administered to an individual, for example, by inhalation, orally, intravenous injection, local administration (see U.S. Patent 5,328,470) or by stereotactic injection (see, for example, Chen et al. (1994), Proc. Natl. Acad. Sci. USA, 91, 3054-3057). The pharmaceutical preparation of the delivery vector may include the vector in an acceptable diluent or may comprise a slow-release matrix in which the delivery vehicle is included.Alternatively, when the complete delivery vector can be produced intact from recombinant cells, for example, retroviral vectors, the pharmaceutical preparation may include one or more cells that produce the gene delivery system. [000177] The route of administration may be dependent on the patient's disorder. In certain exemplary embodiments, a synthetic RNA or DNA agent of the invention may be administered to an individual by IV or SC administration. In addition to a synthetic RNA or DNA agent of the invention, a second therapy may be administered to the patient, for example, palliative therapy and / or disease-specific therapy. The secondary therapy may be, Petition 870250088301, dated 09 / 29 / 2025, p. 63 / 175 58 / 107 for example, symptomatic (e.g., to relieve symptoms), protective (e.g., to slow or stop disease progression) or restorative (e.g., to reverse the disease process). [000178] In general, a synthetic RNA or DNA agent of the invention can be administered by any suitable method. As used herein, topical distribution may refer to the direct application of a synthetic RNA or DNA agent to any body surface, including the eye, a mucous membrane, surfaces of a body cavity, or any internal surface. Formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, sprays, and liquids. Carriers, aqueous, powdered, or oily bases, thickeners, and the like conventional pharmaceuticals may be necessary or desirable. Topical administration may also be used as a means to selectively distribute the synthetic RNA or DNA agent into the epidermis or dermis of an individual or into specific strata thereof, or into an underlying tissue. [000179] Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions that may also contain buffers, diluents and other suitable additives. Compositions for intrathecal or intraventricular administration preferably do not include a transfection reagent or an additional lipophilic fraction other than, for example, the lipophilic fraction bound to the synthetic RNA or DNA agent. [000180] Formulations for parenteral administration may include sterile aqueous solutions that may also contain buffers, diluents, and other suitable additives. Injection Petition 870250088301, dated 09 / 29 / 2025, page 64 / 175 59 / 107 intraventricular administration can be facilitated by an intraventricular catheter, for example, connected to a reservoir. For intravenous use, the total solute concentration must be controlled to make the preparation isotonic. [000181] A synthetic RNA or DNA agent of the invention can be administered to an individual by pulmonary administration. Pulmonary delivery compositions can be administered by inhalation of a dispersion so that the composition within the dispersion can reach the lung where it can be readily absorbed through the alveolar region directly into the bloodstream. Pulmonary delivery can be effective for both systemic and localized delivery to treat lung diseases. [000182] Pulmonary delivery can be achieved by different approaches, including the use of nebulized, aerosolized, microcellular, and powder-based formulations. Delivery can be achieved with liquid nebulizers, aerosol-based inhalers, and dry powder dispensing devices. Metered-dose devices are preferred. One of the benefits of using an atomizer or inhaler is that the potential for contamination is minimized because the devices are self-contained. Dry powder dispensing devices, for example, administer drugs that can be readily formulated as dry powders. A synthetic RNA or DNA agent composition can be stably stored as lyophilized or spray-dried powders on its own or in combination with suitable powder carriers.The administration of an inhalation composition may be mediated by a dosage timing element which may include a timer, a dose counter, a time measuring device or a... Petition 870250088301, dated 09 / 29 / 2025, p. 65 / 175 60 / 107 time indicator that, when incorporated into the device, allows dose tracking, compliance monitoring and / or dose delivery to a patient during aerosol drug administration. [000183] The types of pharmaceutical excipients that are useful as carriers include stabilizers, such as human serum albumin (HSA); bulking agents, such as carbohydrates, amino acids, and polypeptides; pH adjusters or buffers; salts, such as sodium chloride; and the like. These carriers may be in a crystalline or amorphous form, or a mixture of both. [000184] Bulking agents that are particularly valuable include carbohydrates, polypeptides, compatible amino acids, or combinations thereof. Suitable carbohydrates include monosaccharides such as galactose, D-mannose, sorbose, and the like; disaccharides such as lactose, trehalose, and the like; cyclodextrins such as 2-hydroxypropyl-cyclodextrin; and polysaccharides such as raffinose, maltodextrins, dextrans, and the like; alditols such as mannitol, xylitol, and the like. A preferred group of carbohydrates includes lactose, trehalose, raffinose maltodextrins, and mannitol. Suitable polypeptides include aspartame. Amino acids include alanine and glycine, with glycine being preferred. [000185] Suitable pH adjusters or buffers include organic salts prepared from organic acids and bases, such as sodium citrate, sodium ascorbate, and the like; sodium citrate is preferred. [000186] A synthetic RNA or DNA agent of the invention can be delivered by oral and nasal administration. For example, the Petition 870250088301, dated 09 / 29 / 2025, p. 66 / 175 61 / 107 Drugs administered through these membranes have a rapid onset of action, provide therapeutic plasma levels, avoid the first-pass effect of hepatic metabolism, and prevent exposure of the drug to the hostile gastrointestinal (GI) environment. Other advantages include easy access to membrane sites, so that the drug can be easily applied, located, and removed. In one embodiment, a synthetic RNA or DNA agent administered by oral or nasal delivery has been modified to be able to cross the blood-brain barrier. [000187] In one embodiment, unit doses or measured doses of a composition that includes synthetic RNA or DNA agents are dispensed by an implanted device. The device may include a sensor that monitors a parameter within an individual. For example, the device may include a pump, such as an osmotic pump, and optionally associated electronic components. [000188] A synthetic RNA or DNA agent may be packaged into a natural viral capsid or into a chemically or enzymatically produced artificial capsid or structure derived therefrom. [000189] In certain other aspects, the invention provides kits that include a suitable container containing a pharmaceutical formulation of a synthetic RNA or DNA agent. In certain embodiments, the individual components of the pharmaceutical formulation may be provided in one container. Alternatively, it may be desirable to provide the components of the pharmaceutical formulation separately in two or more containers, for example, one container for a synthetic RNA or DNA agent preparation and at least one other for a synthetic RNA or DNA agent. Petition 870250088301, dated 09 / 29 / 2025, page 67 / 175 62 / 107 carrier compound. The kit can be packaged in several different configurations, such as one or more containers in a single box. The different components can be combined, for example, according to the instructions provided with the kit. The components can be combined according to a method described herein, for example, to prepare and administer a pharmaceutical composition. The kit may also include a dispensing device. [000190] It will be evident to those skilled in the art that other suitable modifications and adaptations of the methods described herein may be made using suitable equivalents without departing from the scope of the embodiments disclosed herein. Having now described certain embodiments in detail, the same will be more clearly understood by reference to the following examples, which are included for illustrative purposes only and are not intended to be limiting. [000191] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as commonly understood by one skilled in the art to which this invention pertains. Although methods and materials similar or equivalent to those described in this document may be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this document are incorporated by reference in their entirety. In case of conflict, this descriptive report, including definitions, shall serve as the basis for control. Furthermore, the materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. EXAMPLES Petition 870250088301, dated 09 / 29 / 2025, page 68 / 175 63 / 107 Example 1: Scaffold selection libraries with biological RNA information [000192] Examination of small biological RNAs with multi-helix packaging (i.e., tertiary folding) indicated two recurring architectures that can be considered privileged scaffolds. The first is the H-type pseudo-knot, which is widely found in biological RNAs, including small ribosomal frame displacement elements in viral mRNAs and natural and synthetic aptamers. However, from a design perspective, this fold can be difficult to design. The other is the three-way junction (3WJ) supported by a remote tertiary interaction that organizes the helical arrangement around the junction. This fold is more suitable for the design of RNA devices incorporating aptamers, since it positions a conceivable helical element (designated P1 helix) close to the ligand binding site, typically located at the junction. [000193] Within the three-way junction fold group, there is a large selection of potential candidates that can be used to assemble a scaffold—an initial library of sequences for in vitro selection. Three are exemplified here: the xpt-pbuX guanine ribosome aptamer domain of B. subtilis (referred to here as GR), the Vc2 cyclic di-GMP riboswitcher aptamer domain of Vibrio cholerae (referred to here as CDG), and the hammerhead ribozyme of Schistosoma mansoni (referred to here as HH) (Figure 1). In each of these parental RNA scaffolds, the junction hosts the key biological activity proximal to the P1 helix that can serve as a secondary structural bridge to a reading frame. [000194] The starter libraries were designed to preserve the overall secondary and tertiary structure of the scaffold, Petition 870250088301, dated 09 / 29 / 2025, page 69 / 175 64 / 107 while simultaneously randomizing a sufficient number of nucleotides at the junction to ensure adequate cluster diversity such that winners emerge. All nucleotides in the junction strands were randomized (equal populations of the four nucleotides at each position), as well as at least one base pair in each helix proximal to the junction (Figure 1). For the GR scaffold, this yielded an initial library of 23 randomized nucleotide positions, which equates to a library size of approximately 7x10¹³ sequences (4²³ sequences); the CDG and HH contain similar levels of diversity (21 randomized nucleotide positions, equating to a library size of approximately 4x10¹² sequences; 4²¹ sequences). This number of sequences is theoretically fully represented in the initial RNA cluster with at least five-fold redundancy.Although this diversity is substantially lower than that recommended for typical selection, new aptamers were obtained from starting clusters with even more limited sampling of the sequence space. [000195] The three scaffolds were integrated into a library cassette with specific design features. The P1 helix of each scaffold, containing the initial and terminal bases of the scaffold sequences, was replaced in all libraries by structured amplification cassettes containing helices designed based on those developed for Selective 2'-Hydroxyl Acylation analyzed by Chemical Probe of Primer Extension (SHAPE) of RNA structure (Figure 17). This ensures that the constant regions required for replication are structured and less likely to be incorporated into the selected aptamer. To further minimize the potential Petition 870250088301, dated 09 / 29 / 2025, page 70 / 175 65 / 107 for the constant regions to participate in the formation of the ligand-binding site, the P1 helix was extended to at least ten base pairs. The complete DNA template sequences encoding the initial starter libraries are given in Table 1 and Figure 23. Table 1. Oligonucleotide sequences and templates. Oligonucleotide Sequence In vitro Selection GR / SSIII library template GCGCGCGAATTCTAATACGACTCACTATAGGACTTCG GTCCAAGCTAATGCACTCNNNNNCGCGTGGATATG C (SEQ ID NO: 1) Mold from the GR / GsI library GCGCGCGAATTCTAATACGACTCACTATAGGACTTCG GTCCTTGGATAGGACTCNNNNNNNCGCGTGGATATGG CACGCANNNNNNNNNNGGGCACCGTAAATGTCCNNNN NNGGGTCCTATCCCCAATCGGGGGGCCAATCGG Mold NO: 2 library CDG / GsI GCGCGCGAATTCTAATACGACTCACTATAGGACTTCG GTCCTTGGATAGGACANNNNNNNNNCAAACCATTCGA AAGAGTGGGACGNNNCCTCCGGCCTAAACCGAAAG GTAGGTAGCGGGGNNNNNNNTGTCCTATCCCCAATCG GGTTCGCGAATTCTAATACGACTCACTATAGGACTTCGA AAGAGTGGGACGNNNCCTCCGGCCTAAACCGAAAG GTAGGTAGCGGGGNNNNNNNTGTCCTATCCCCAATCG GGTTCGCGAATTCTAATACGACTCACTATAGGACTTCGA Library ID NO HH / GsI GCGCGCGAATTCTAATACGACTCACTATAGGACTTCG GTCCTTGGATAGGAGCNNNNTGGTATCCAATGAAAAT GTACTACCANNNNNNNNNNCCCAAATAGGNNNNNNNG CTCCTATCCCCAATCGGGCTTCGGTCCGGTTC (SEQ ID NO: 4) Petition 870250088301, of 29 / 09 / 2025, p. 71 / 175 66 / 107 T7 Site Attachment Primer GCGCGCGAATTCTAATACGACTCACTATAGGACTTCG GTCCAAGCTAATGCACTC (SEQ ID NO: 5) RT-PCR Primer GAACCGGACCGAAGCCCG (SEQ ID NO: 6) High-Throughput Sequencing HTS Reverse Sequencing Primer, GR / SSIII CAAGCAGAAGACGGCATACGAGATGTCGTGTAGCCTA GTCAGTCAGCCGAACCGGACCGAAGCCCG (SEQ ID NO: 7) HTS Reverse Sequencing Primer, GR / GsI CAAGCAGAAGACGGCATACGAGATTGGTCAACGATAA GTCAGTCAGCCGAACCGGACCGAAGCCCG (SEQ ID NO: 8) HTS Reverse Sequencing Primer, CDG / GsI CAAGCAGAAGACGGCATACGAGATATCACCAGGTGTA GTCAGTCAGCCGAACCGGACCGAAGCCCG (SEQ ID NO: 9) HTS Reverse Sequencing Primer,HH / GsI CAAGCAGAAGACGGCATACGAGATGCTGTACGGATTA GTCAGTCAGCCGAACCGGACCGAAGCCCG (SEQ ID NO: 10) Advance sequencing primer AATGATACGGCGACCACCGAGATCTACACTATGGTAA TTGTGCGCGCGAATTCTAATACGACTCACTATAG (SEQ ID NO: 11) RT primer AGTCAGTCAGCCGAACCGGACCGAAGCCCG (SEQ ID NO: 12) Indexing primer CGGGCTTCGGTCCGGTTCGGCTGACTGACT (SEQ ID NO: 13) 5HTP-II crystallization GGACACTCTGATGATCGCGTGGATATGGCACGCATTG AATTGTTGGACACCGTAAATGTCCTAACACGTGTCCA (SEQ ID NO: 14), Petition 870250088301, dated 09 / 29 / 2025, p. 72 / 175 67 / 107 Isothermal titration calorimetry of 5HTP-I aptamer GGAGCTAATGCACTCTTAACGCCGCGTGGATATGCAC GCAACCGTGAATCGGGCACCGTAAATTCCGTAAGTGG GTGCATTAGC (SEQ ID NO: 15) Aptamer of 5HTP-II ATTGTTGGACACCGTAAATGTCCTAACACGGGTGCC (SEQ ID NO: 16) AptÂmero de 5HTP-III GGAGCTAATGCACTCCCATTCCGTGGATATGGCAC GCTACCGATGTTGGGACCGTAATGTCCATTACGGGTG CATTAGC (SEQ ID NO: 15HTP-IV) GGATAGGACTCTCTGGTTCGCGTAGATATGGCACCGCA ATTGAAGAATGGGCACCGTAAATGTCTGTAGACGGGT CCTATCC (SEQ ID NO: 18) AptÂmero de 5HTP-V GGATAGGACTCATTCGGCCGCGTGGATATGGCACGCA (SEQ ID NO: 19) Aptamer of 5HTP-VI GGATAGGACTCAACATCTCGCGTGGATATGGCACCGCA GACTTCCAGTGGGCACCGTAAATGTCCGTAGACGGGT CCTATCC (SEQ ID NO: 20) Aptamer of 5HTP-VII GGGACGCTAGACCTCCGGCCTAAACCGAAAGGTAGGT AGCGGGGCTAGGTATGTCCTATCC (SEQ ID NO: 21) Aptamer of 5HTP- VIII GGATAGGAGCTGTTTGGTATCCAATGAAAATGTACTA CCAACTTGAATCTCCCAAATAGGCTAGGTAGCTGCTATCCTA TCCQTA (SEQ ID NO: 21)NO: 22) Chemical probe SHAPE 5HTP-I, SHAPE GGACTTCGGTCCAAGCTAATGCACTCTTAACGCCGCG TGGATATGCACGCAACCGTGAATCGGGCACCGTAAAT TCCGTAAGTGGGTGCATTAGCAATCGATCCGGTTCGC Petition 870250088301, dated 09 / 29 / 2025, p. 73 / 175 68 / 107 CGGATCCAAATCGGGCTTCGGTCCGGTTC (SEQ ID NO: 23) 5HTP-II, SHAPE GGACTTCGGTCCAAGCTAATGCACTCTGATGATCGCG TGGATATGGCACGCATTGAATTGTTGGACACCGTAAA TGTCCTAACACGGGTGCATTAGCAATCGATCCGGTTC GCCGGATCCAAATCGGGCTTCGGTCCGGTTC (SEQ ID NO: 24) 5HTP-III, SHAPE GGACTTCGGTCCAAGCTAATGCACTCCCATTTTCCGT GGATATGGCACGCTACCGATGTTGGGACCGTAATGTC CATTACGGGTGCATTAGCAAAATCGATCCGGTTCGCC GGATCCAAATCGGGCTTCGGTCCGGTTC (SEQ ID NO: 25) 5HTP-IV, SHAPE GGACTTCGGTCCTTGGATAGGACTCTCTGGTTCGCGT AGATATGGCACGCAATTGAAGAATGGGCACCGTAAAT GTCTGTAGACGGGTCCTATCCAATCGGGCTTCGGTCC GGTTC (SEQ ID NO: 26) 5HTP-V, SHAPE GGACTTCGGTCCTTGGATAGGACTCATTCGGCCGCGT GGATATGGCACGCAGGAGATGTGTGGACACCGTAAAT GTCCGTAGGCGGGTCCTATCCAATCGGGCTTCGGTCC GGTTC (SEQ ID NO: 27) 5HTP-VI, SHAPE GGACTTCGGTCCTTGGATAGGACTCAACATCTCGCGT GGATATGGCACGCAGACTTCCAGTGGGCACCGTAAAT GTCCGTAGACGGGTCCTATCCAATCGGGCTTCGGTCC GGTTC (SEQ ID NO: 28) 5HTP-VII,SHAPE GGACTTCGGTCCTTGGATAGGACATGTAATCTCCAAA CCATTCGAAAGAGTGGGACGCTAGACCTCCGGCCTAA ACCGAAAGGTAGGTAGCGGGGCTAGGTATGTCCTATC CAATCGGGCTTCGGTCCGGTTC (SEQ ID NO: 29), Petition 870250088301, of 29 / 09 / 2025, p. 74 / 175 69 / 107 5HTP-VIII, SHAPE GGACTTCGGTCCTTGGATAGGAGCTGTTTGGTATCCA ATGAAAATGTACTACCAACTTGAATCTCCCAAATAGG CTAGGTAGCTCCTATCCAATCGGGCTTCGGTCCGGTT C (SEQ ID NO: 30) Broccoli Sensors 5HTP-II / A-Brócolis GGACGGAGACGGTCGGGTCATATGATGATCGCGTGGA TATGGCACGCATTGAATTGTTGGACACCGTAAATGTC CTAACAATATTCGAGTAGAGTGGGCTCCGTCC (SEQ ID NO: 31) 5HTP-II / U-Brocolis GGACGGAGACGGTCGGGTCCTAGGGGATTGGTC TATGGCACGCATTGAATTGTTGGACACCGTAAATGTC CTAACATATATCGAGTAGAGTGTGGGCTCCGTCC (SEQ ID NO: 32) 5HTP-IV / A-Brocolis GGACGGAGACGGTCGGGTCATATTCTGGTTCGCGTAG CTGTAGACATATTCGAGTAGAGTGTGGGCTCCGTCC (SEQ ID NO: 33) 5HTP-IV / U-Brocolis GGACGGAGACGGTCGGGTCTATATCTGGTTCGCGTAG ATATGGCACGCAATTGAAGAATGGGCACCGTAAATGT CTGTAGACTATATCGAGTAGAGTGGGGQCT NO: GGTGGQCT NO: 33) 5HTP-VII / A-Brocolis GGACGGAGACGGTCGGGTCATATATTCGATGTAAT CTCCAAACCATTCGAAAGAGTGGGACGCTAGACCTCC GGCCTAAACCGAAAGGTAGGTAGCGGGCTAGGTAGT AGAGTGTGGGCTCCGTCC (SEQ ID NO: 35) 5HTP-Brócolis GGACGGAGACGGTCGGGTCTATATGTAATCTCCAAACCATTCGAAAGAGTGGGACGCTAGACCTCCGGCCTAAA CCGAAAGGTAGGTAGCGGGGCTAGGTATATCGAGT AGAGTGTGGGCTCCGTCC (SEQ ID NO: 36) Petition 870250088301, of 29 / 09 / 2025, p. 75 / 175 70 / 107 5HTP-VIII / A-Brocolis GGACGGAGACGGTCGGGTCATATTGTTTGGTATCCAA TGAAAATGTACTACCAACTTGAATCTCCCAAATAGGC TAGGTAATATTCGAGTAGAGTGGGCTCCGTCC (SEQ ID NO: 37) 5HTP-VIII / U-Brócolis GGACGGAGACGGTCGGGTCATATT TGAAAATGTACTACCAACTTGAATCTCCCAAAATAGGC TAGGTATATATCGAGTAGAGTGTGGGCTCCGTCC (SEQ ID NO: 38) Single-pass transcription of the in vitro riboswitcher of 5HTP-IV / pbuE TGGTTCGCGTAGATATGGCACGCAATTGAAGAATGGG CACCGTAAATGTCTGTAGACAAAATCCTGATTACAAA ATTTGTTTATGACATTTTTTGTAATCAGGATTTTTTT ATTTATCAAAACATTTAAGGAGTTTGTTATG (SEQ ID NO: 39) a“n” represents a position at which the composition of A, C, G and T is approximately 25% each. b. Aptamer and RNA sensor sequences are given as their equivalent DNA sequences. [000196] Another problem that complicated scaffold selection was the low fidelity of viral reverse transcriptases (RTs). Engineering MMLV RT to improve thermostability and processability to create the most widely used versions of this enzyme decreased its already low fidelity. Incorrect incorporation or deletion of nucleotides in conserved scaffold sequences readily disrupts tertiary interactions that stabilize the overall fold. RNAs lacking structure are amplified more efficiently by RT, which can introduce significant bias during the replication step. Petition 870250088301, dated 09 / 29 / 2025, page 76 / 175 71 / 107 of each selection round, which in part likely leads to the phenomenon of the “tyranny of small motives” observed in the selection. To address this, a recently characterized RT derived from a mobile group II intron of the thermophile Geobacillus stearothermophilus (GsI-IIC-MRF or “GsI”) that retains activity up to 70 °C (as a function of 55 °C for SSIII) and has inherently higher fidelity than RTs derived from MMLV was adopted. For comparison, GR scaffold selection was performed with an RT derived from MMLV (SuperScript III or “SSIII”) along with GsI. Example 2: Selection using scaffolds against 5HTP yields many potential aptamers [000197] The target for selection was 5-hydroxy-L-tryptophan (5HTP; Figure 2A), the immediate biosynthetic precursor of serotonin, which was immobilized on a solid matrix via its carboxylate group. Seven rounds of selection with each library were performed, with counter-selections against L-tryptophan and increasingly rigorous washing procedures in subsequent rounds. In the SSIII selection, a conventional SELEX protocol was adopted in which the affinity column was extensively washed in initial cycles before competitive elution to remove non-binding RNAs. Competitive elution was initially observed in the fourth round and peaked at > 50% of the total input RNA in the sixth round. The GsI selections used a less rigorous protocol than generally recommended, in which approximately the final 10% of Total RNA left on the column under competitive elution was collected for amplification in the first four cycles to preserve sequence diversity in the cluster before increasing the severity of the washout. Details of the selections are given in Examples 6 to 8 and Table 2. Petition 870250088301, dated 09 / 29 / 2025, p. 77 / 175 72 / 107 Table 2: Selection conditions per cycle Round [RNA] pmol Washes* Observation SS-III Selection 1 1,000 3 Counterselection against AcO-sepharose 2 400 6 Counterselection against AcO-sepharose 3 400 10 4 400 10 5 100 10 6 100 10 30-second counterselection with 100 mM L-tryptophan 7 100 10 30-second counterselection with 100 mM L-tryptophan Gel Selections 1 1,000 3 Counterselection against AcO-sepharose 2 400 3 Counterselection against AcO-sepharose 3 400 5 4 400 5 5 400 10 6 200 6 30-second counterselection with 100 mM L-tryptophan 7 200 10 Counter-selection of 30 seconds with L-tryptophan 100 mM * Each wash constituted 3 volumes of buffer column [000198] By preserving sequence diversity and minimizing Petition 870250088301, dated 09 / 29 / 2025, page 78 / 175 73 / 107 the initial stochastic events, a combination of next-generation sequencing (NGS) and downstream bioinformatics analysis was used to reveal potential aptamers and elucidate key selection features. For each selection, >200,000 reads were obtained for the final round RNA, and the resulting sequences were clustered and maximum likelihood trees generated. Comparison of SSIII and GsI selections using the GR scaffold revealed several important features. [000199] A distance matrix from the GR / SSIII selection clearly showed only a few isolated clusters, and within each cluster the sequences have a high degree of internal affinity (Figure 2B). Most (>80%) of the sequences cluster into three distinct sequence-related families, referred to as 5HTP-I, -II, and III (Figure 2D), with the remaining clustering into small populations that are difficult to interpret. This is typical of a traditional SELEX, in which single isolates are often identified, and further mutagenesis and selection are needed to obtain covariance information. In contrast, the GR / GsI selection produced more diverse clusters, with greater sampling of sequences populating regions between major clusters (Figures 2C and 2D). The CDG and HH selections with GsI are similarly diverse in their sequence space with many potential aptamers (Figure 7).Although traditional selection approaches often rely on overselection to facilitate the location of an aptamer with limited sequence information, preserving winner diversity and sequence analysis by NGS allowed for a more complete analysis of conservation and covariance patterns, aiding in the determination of consensus aptamer sequences. Similar results were observed. Petition 870250088301, dated 09 / 29 / 2025, page 79 / 175 74 / 107 in the selection of L-DOPA with GR scaffold (Figure 18). A subcluster of 250 sequences from each of the clusters that produced validated 5HTP aptamers is further described in this document. [000200] Unexpectedly, in addition to the limited sequence diversity of the SSIII selection, a heavy accumulation of deletions and point mutations was observed, such that no sequence retaining the complete identity of the constant scaffold regions was recovered in the final loop. Two of the clusters, 5HTP-I and 5HTP-III (Figure 2D), possess deletions in L2 or L3 of the scaffold essential for the formation of the loop-loop interaction of purine riboswitchers. Furthermore, the members of 5HTP-III contain several point deletions acquired during selection, which generates the potential for a drastically alternative secondary structure. Minimum free energy (MFE) and covariance analysis of this sequence suggests a secondary structure consistent with the consensus sequence of the L-tryptophan aptamer (an aptamer comprising a two-pathway junction; Majerfeld & Yarus, Nucleic Acids Research, 2005, 33, 5482-5493), further suggesting that the scaffold was not retained in the 5HTP-III family. 5HTP-II is the only major cluster that maintains the sequence requirements needed for the tertiary structure designed in the library and is the only abundant sequence shared between the SSIII and GsI selections. Unlike the selection that uses SSIII, the GsI selections exhibited low amounts of mutations accumulating in the constant region of the scaffold, indicating robust scaffold maintenance (Figure 8). [000201] To identify sequences with high aptamer potential, the ten most populous clusters from each group were individually aligned, MFE structures predicted, and covariation models generated. This allowed for a rich overview of the main consensus sequences presented by the selections. A Petition 870250088301, dated 09 / 29 / 2025, page 80 / 175 75 / 107 Since the GR / SSIII experiment was highly overselected, the most abundant sequence from each of the three main clusters was chosen for further validation. For the GsI selections, the dominant sequences from one or more clusters whose consensual MFE structure was consistent with the parent scaffold were selected. Example 3: The most populous clusters preserve the scaffold architecture and bind 5HTP with high selectivity [000202] The structural scaffold greatly facilitates the validation of the structural and interaction characteristics of the resulting aptamers. The RNA structure chemical probe using N-methylisatoic anhydride (NMIA), a technique known as SHAPE, reveals whether the secondary and tertiary architecture of the parental scaffolds were preserved, as well as ligand-dependent structural changes in the aptamer. In the selection of GR / SSIII, the 5HTP-I and 5HTP-II aptamers have localized changes in NMIA reactivity patterns in the presence of ligand at the three-way junction elements, consistent with this being the ligand binding site (Figure 3A, Figure 19). However, 5HTP-III shows alterations outside of J2 / 3 in the constant regions, consistent with the predicted structure and the L-Trp binding site of a previously described tryptophan aptamer (Majerfeld & Yarus). The preservation of the GR scaffold was assessed using a single ligand-independent NMIA reactivity signature at L3, which is present only when interacting with L2 (Stoddard et al., RNA, 2008, 14, 675-684). 5HTP-II is the only sequence of the three SSIII selection clusters that exhibits this feature. On the other hand, all tested sequences from the GR / GsI selection possess this tertiary structure signature (Figures 9A and 20). These data strongly indicate that the GR / SSIII selection yielded three distinct aptamers, with only 5HTP-II preserving the structural scaffold, while the GR / GsI selection produced several solutions maintaining the Petition 870250088301, dated 09 / 29 / 2025, page 81 / 175 76 / 107 scaffold. While the 5HTP-dependent signatures for the GR / GsI isolates are weaker than those of 5HTP-II and the parental aptamer, quantification reveals that they are located at the junction in an analogous manner (Figure 3B). SHAPE characterization of the CDG / GsI and HH / GsI selections shows ligand-dependent changes for the new aptamer classes and an overall reactivity pattern similar to that of the parental scaffold (Figures 9B, 9C, 21 and 22). [000203] The affinity and selectivity of these aptamers for 5HTP and a group of chemically similar compounds was evaluated by isothermal titration calorimetry (ITC). Importantly, for all aptamers tested, the 5' and 3' cassette sequences were not required for 5HTP binding, indicating the successful design of neutral sequences (Figure 3C). Several trends emerged from this analysis. First, both aptamers that do not preserve the scaffold origin (5HTP-I, -III) do not discriminate between 5HTP and L-tryptophan (Table 3), a crucial requirement for cell-based applications. Second, most aptamers that preserve the three-way junction scaffold have higher affinities for 5HTP than aptamers with broken scaffolds and all discriminate strongly against L-tryptophan.This indicates that the scaffold architecture is important for creating a selective binding pocket while maintaining affinities comparable to other synthetic and natural amino acid-binding aptamers. 5HTP-I and 5HTP-III show strong discrimination between 5HTP and serotonin, implying that the backbone atoms are directly recognized. In contrast, many of the scaffold-preserving aptamers bind N-methyl-5-hydroxy-L-tryptophanomide with 2 to 4 times greater affinity than 5HTP. Furthermore, they bind serotonin, the decarboxylation product of 5HTP, suggesting a lower requirement for backbone atoms in the binding (Table 3). Thus, some of these aptamers may be... Petition 870250088301, dated 09 / 29 / 2025, page 82 / 175 77 / 107 extraordinary serotonin sensors. The most impressive aspect of the Gsl selections is that the dominant aptamers of each selection, despite possessing different scaffold architectures, converged on highly similar binding affinities and selectivity profiles, revealing that three-way junctions are a robust fold for hosting 5HTP binding compartments. Taken together, these data show that distinct oligonucleotide junctions, such as architectural variants of three-way junctions, are capable of finding robust solutions for 5HTP recognition. Table 3. Affinity of aptamers for 5HTP and related compounds. Sequence selection 5HTP Kd, pMa L-Trp Kd, μΜ Serotonin Kd, μΜ Me-5HTP Kd, μΜ GR / SSIII 5HTP-I 33 ± 1 41 ± 1 >1,000 — 5HTP-II 3.9 ± 0.1 280 ± 30 38 ± 8 26 ± 9 5HTP-III 38 ± 14 20 ± 5 >1,000 — GR / Gsl 5HTP-IV 8.8 ± 1.5 520 ± 90 4.7 ± 0.3 1.3 ± 0.1 5HTP-V 11 ± 1 170 ± 10 16 ± 4 6.6 ± 0.4 5HTP-VI 60 ± 15 NDb 16 ± 2 25 ± 8 CDG / GsI 5HTP-VII 9.3 ± 0.3 ND 1.2 ± 0.1 2.1 ± 0.4 HH / Gsl 5HTP-VIII 7.3 ± 2.8 ND 1.2 ± 0.2 2.5 ± 0.5 All measurements were taken at 25 °C in a buffer containing 10 mM MgCl2. bNot detectable. Example 4: Structural analysis of aptamer 5GR-II reveals that a recurrent RNA motif is used for 5HTP binding [000204] To further demonstrate that the scaffold selection strategy described here preserved the parental RNA fold and for Petition 870250088301, dated 09 / 29 / 2025, p. 83 / 175 78 / 107 To elucidate how RNA can recognize 5HTP, the structure of 5HTPPII complexed with 5HTP was determined at a resolution of 2.0 Å (Figure 3D, representative electrical density maps are shown in Figure 10 and crystallographic statistics are presented in Table 4). This structure globally overlaps the xtp guanine riboswitcher aptamer with an rmsd of 6.5 Å on all atoms of the main chain at residues 19 to 77, with the main sources of deviation produced by a different angle for P1 relative to the binding pocket and the varied junction region (Figures 16A-C). Within the L2-L3 tertiary interaction, the pattern of base-base interactions and main chain geometry is nearly identical between the two RNAs (rmsd 0.96 Å on all atoms at residues 31-39, 61-67). Thus, the GR scaffold remained intact, both globally and locally, during the selection process. Table 4. Crystallographic data and refinement statistics. 5HTP-II / 5HTP RNA Data Collection Space Group C121 Cell Dimensions a, b, c (A) 127.55, 26.59, 63.37 α, β, γ (°) 90, 106.32, 90 Resolution (A) 19.95 - 2.00 (2.07 - 2.00) * R sym or Rmerge 0.084 (0.191) I / σI 11.2 (5.4) Completeness (%) 96.2 (73.8) Redundancy 4.34 (3.65) Petition 870250088301, dated 09 / 29 / 2025, p. 84 / 175 79 / 107 Refinement Resolution (Â) 18.33 - 2.00 (2.07 - 2.00) Number of unique reflections 13.725 eE thRworking / Rfree 21.7 / 25.8 (20.1 / 26.0) No. of RNA atoms 1513 Ligand / ion 16 / 90 Water 112 B factors (average) RNA 29.5 Ligand / ion 16.2 / 35 Water 23.5 rms deviations Bond lengths (Â) 0.007 Bond angles (°) 1.308 * The values ​​in parentheses are for the highest resolution shell. [000205] The 5HTP-II ligand-binding pocket resides at the tri-pathway junction, which has a radically different local structure from the original RNA. Direct ligand contacts are primarily mediated by nucleotides in J2 / 3 using a common RNA structural module, the T-loop (Figure 4A). The first five nucleotides of J2 / 3 form a canonical T-loop structure that almost perfectly overlaps a tRNAPhe(rmsd 0.49 Å) T-loop for chain residues. Petition 870250088301, dated 09 / 29 / 2025, page 85 / 175 80 / 107 main). Stabilization of position 3 in the tRNA T loop by long-range Watson-Crick pairing with the D loop is critical for activity. 5HTP-II has a similar interaction between G47 of the T loop and C75 of J3 / 1. The T loop of 5HTP-II hosts stacked 5HTPs between positions 4 and 5 in a manner orthologous to how the tRNA T loop hosts an intercalating purine of the D loop and is also similar for the recognition of thiamine pyrophosphate (TPP) by its riboswitcher (Figure 4B). While the T loop is directly responsible for ligand recognition, nucleotides from all three random regions are involved in the local structure assisting in the formation of a tight junction that stabilizes the T loop. Given such a complex cluster of interactions supporting the T loop, it is unlikely that the isolated T loop will bind to 5HTP. [000206] The crystal structure of 5HTP-II provides additional information about the recognition of 5HTP by the other scaffold aptamers. The most abundant cluster in the GR / GsI selection, 5HTP-IV, also contains the UUGAA signature of the T-loop. The motif, however, is 3'-displaced by a single nucleotide, likely leading to an alternative orientation within the three-way junction, as suggested by significant sequence differences at J1 / 2 and J3 / 1 between 5HTP-II and 5HTP-IV. In the HH selection, the most abundant sequence of the most populous cluster (5HTP-VIII) also contains the conserved UUGAA sequence of the loop. T in J2 / 3. Sequence variation analysis of this region of the 5HTP-VIII aptamer reveals a conservation pattern consistent with that of biological T-loops with only slight deviations (Figure 11). This suggests that the T-loop motif may be a robust module for the recognition of small compounds. Petition 870250088301, dated 09 / 29 / 2025, page 86 / 175 81 / 107 planar RNAs. Although there is no clearly identifiable T-loop in RNAs from the CDG selection, the binding parameters almost perfectly match those of the other two selections, suggesting a similar recognition mode. Example 5: Scaffold aptamers can be readily incorporated into robust small molecule sensor devices. [000207] With scaffold selection techniques that have proven capable of creating well-folded, highly structured, and specific RNA aptamers, their ability to produce functional synthetic RNA biosensors was tested. To create these devices, a strategy of linking a small molecule binding aptamer to a fluorophore binding module via a short helical element was used. The main candidate aptamer from each library was coupled to the broccoli fluorophore binding aptamer with two helical variants (the communication modules are referred to as A and B). U, Figure 12) ligand the two aptamers. This resulted in a cluster of RNAs capable of detecting 5HTP and / or serotonin by several orders of magnitude in vitro with varying dynamic ranges of output fluorescence (Table 5 and Table 6). Many of these sensors, when in the presence of ligands, are capable of producing fluorescence levels equal to or greater than those of the unconjugated broccoli aptamer alone under identical conditions. Inherent to this system is an apparently reduced F50 (defined as the ligand concentration required to induce a fluorescent response of half the maximum) relative to the Kd of the isolated aptamer, as monitored by broccoli fluorescence. However, several scaffold aptamers show only a ~10-fold difference between their Kd and F50. Overall, Petition 870250088301, dated 09 / 29 / 2025, p. 87 / 175 82 / 107 This compares favorably to examples of natural riboswitcher aptamer domains in the literature, where differences in Kd and F50 can approach 1,000 times, an important characteristic to consider when ligand sensitivity or toxicity is a limiting factor in riboswitcher application. Table 5. In vitro performance of broccoli-based 5HTP / serotonin sensors. linker / ligand A / 5HTPa A / 5HT U / 5HTP U / 5HT aptamer F50, μΜ F50, μΜ F50, μΜ F50, μΜ 5HTP-II 190 ± 30 NDb 180 ± 20 ND 5HTP-IV ND 190 ± 70 240 ± 20 52 ± 4 5HTP-VIII ND 790 ± 190 590 ± 90 260 ± 50 All measurements were taken at 25 °C in a buffer containing 5 mM MgCl2. bNot detectable. Table 6: Performance of the 5HTP-Broccoli sensors Fmax fold Sensor Binder [MgCl2], mM Induction3(% Broccoli)bF50c, μM 5HTP-II / A 5HTP 1 3.5 18.5 3 6.3 71 5 7.3 122 190 ± 30 10 6 168 20 4.1 180 5HT 1 1.3 6.9 Petition 870250088301, dated 09 / 29 / 2025, page 88 / 175 83 / 107 3 3.1 34.6 5 3.7 62.7 na 10 3.9 108 20 3 134 5HTP-II / U 5HTP 1 1.9 21.1 3 3.1 72.2 5 3.3 105 180 ± 20 10 3.3 130 20 3.2 135 5HT 1 0.4 4.7 3 0.8 18.2 5 1.1 33.2 na 10 1.3 52.6 20 1.6 66.4 5HTP-IV / A 5HTP 1 1.2 2.7 3 1.3 2.9 5 1.4 3.1 na 10 1.7 3.8 20 2 4.3 5HT 1 1.0 2.4 3 1.3 2.75 5 1.4 3.2 190 ± 70 10 1.8 4 20 2.2 4.7 5HTP-IV / A 5HTP 1 2.5 8.5 3 6 37.1 5 8.2 71.2 240 ± 20 10 8.2 111 20 6.1 126 5HT 1 5.1 17.2 Petition 870250088301, dated 09 / 29 / 2025, page 89 / 175 84 / 107 3 5 10 20 8.8 9 7.2 5.1 54.1 78.1 98.3 105 52 ± 4 5HTP-VIII / A 5HTP 1 1.1 3.7 3 1.8 7 5 2.4 10.4 10 3.7 18 20 5.1 26.9 5HT 1 1.5 5 3 4.4 17.7 5 7.2 31.4 790 ± 190 10 10.9 53.3 20 13 69.5 5HTP-VIII / U 5HTP 1 1.6 12.3 3 2.5 43.3 5 2.8 69.7 590 ± 90 10 3.1 109 20 3 126 5HT 1 3.8 30 3 5.5 93.4 5 4.8 116 260 ± 50 10 3.7 131 20 3.2 136 a Defined as (fluorescence in the ligand of Saturation / fluorescence in the absence of ligand); gray shading indicates sensors that showed strong performance. Defined as (maximum sensor fluorescence / isolated broccoli aptamer fluorescence) * 100. cDefined as the required ligand concentration Petition 870250088301, dated 09 / 29 / 2025, page 90 / 175 85 / 107 to induce half of the maximum fluorescence response. [000208] Of the previous devices, the 5HTP-II (A) is capable of specifically detecting 5HTP in E. coli. This genetically encoded sensor produced a rapid fluorescence induction after the addition of 2 mM 5HTP to the growth of E. coli in a chemically rich defined medium (10 min), with approximately 80% of bacteria showing an observable response at 20 min (Figure 5). The fluorescence signal was completely dependent on the RNA device binding to 5HTP. No signal gain was observed when L-tryptophan was included in the medium or when the sensor contained a point mutation (A48U) in the T-loop module that reduced ligand binding to the isolated aptamer (data not shown). Furthermore, the increase in relative fluorescence in the presence of 5HTP was comparable to robust cyclic dinucleotide sensors based on natural riboswitcher aptamer domains in living cells.It is important to emphasize that these observations are in contrast to claims that non-natural aptamers reduced intracellular performance compared to natural aptamers in the context of fluorometric sensors (You, PNAS (2015) 112:. 21, E2756-2765). [000209] Selected 5HTP aptamers on scaffolds were also coupled to engineered modular secondary switches derived from natural riboswitcher expression platforms to generate gene regulatory elements. Using a coupling strategy in which the P1 helix of the aptamer and expression platform is directly coupled, a proficient ligand-dependent transcription regulator was designed by fusing the 5HTP-IV sensor and the pbuE LIGADO switch platform (Figure 6A). The resulting RNA element is Petition 870250088301, dated 09 / 29 / 2025, page 91 / 175 86 / 107 capable of activating transcriptional reading in vitro with a specificity profile identical to the isolated aptamer domain and possesses a dynamic range consistent with natural riboswitchers (Figure 6B); surprisingly, L-Trp is completely incapable of enabling direct reading transcription. Again, the discrepancy between Kd and T50 was not insignificant (6 times for serotonin, 22 times for 5HTP), but reflected trends observed for natural riboswitchers where thermodynamic properties of the aptamer do not always dictate its ability to communicate with an adapter sequence. Example 6: Scaffold aptamers according to exemplary embodiments [000210] Broccoli aptamer was coupled to a tRNA scaffold to stabilize the biosensor for cell-based applications. Four different 5HTP GR scaffold aptamers were coupled to four communication modules of different lengths (two to five base pairs AU and UA; Figure 14A), and each resulting biosensor was tested for its ability to fluoresce in a ligand-dependent manner. Each sensor was evaluated for its ligand-dependent fold alteration in fluorescence and peak brightness relative to the isolated broccoli aptamer both in vitro (Figure 14B; Tables 7 and 8) and in E. coli (Figure 14D; Tables 9 and 10). To allow for rapid screening of in vitro candidates, the biosensors were transcribed and used directly in the fluorometric assay without further purification.These data reveal that three aptamers (5GR-II, -IV and -V) produced sensors that can detect 5HTP and / or serotonin both in vitro and in the cellular context, with 5GR-II demonstrating the best performance in terms of combined fold increase in fluorescence and peak brightness. Petition 870250088301, dated 09 / 29 / 2025, p. 92 / 175 87 / 107 [000211] To further demonstrate the potential of scaffold aptamers, live-cell imaging was used to visualize 5HTP uptake by E. coli using the 5GR-II / CM-4 biosensor. Fluorescence imaging of single cells revealed a rapid induction of fluorescence after the addition of 2 mM 5HTP in E. coli growing in a chemically rich defined medium, with approximately 80% of bacteria showing an observable response within 20 minutes (Figures 15A, D). The fluorescence signal was completely dependent on 5HTP binding to the RNA device; no detectable signal gain was observed when L-tryptophan was included in the medium (Figures 15B, E) or when the sensor contained a point mutation (A48U) in the T-loop module that reduced ligand binding to the isolated aptamer (Figures 15C, F).The observed increase in relative fluorescence in the presence of 5HTP was comparable to robust cyclic dinucleotide sensors based on natural riboswitcher aptamer domains in living cells. These results contrast with previous claims that synthetic aptamers reduced intracellular performance compared to natural aptamers, and it is shown here that multiple synthetic aptamers are capable of functioning within E. coli in the context of an allosteric fluorogenic RNA. [000212] Previous 5HTP biosensors were designed with knowledge of biochemical and biophysical analysis of selected aptamers. However, an ideal workflow for the rapid development of biosensors would be able to use information derived solely from computational analysis of selection to design candidate RNAs. To demonstrate that scaffold aptamers incorporate design principles that allow the Petition 870250088301, dated 09 / 29 / 2025, page 93 / 175 88 / 107 biosensor engineering in the absence of experimental characterization, the previous biosensor strategy was employed for four aptamers derived from L-DOPA selection. None of these aptamers were validated in any way prior to their incorporation into allosteric fluorogenic sensors. Screening of the resulting biosensors with L-DOPA and dopamine in vitro (Figure 14C; Tables 7 and 8) and in E. coli (Figure 14E; Tables 9 and 10) revealed two aptamers (DG-I and DG-II) that function in both contexts. Table 7. Induction of in vitro folding of aptamers with fluorogenic GR scaffolds. aptâmero ligand CM-2 CM-3 CM-4 CM-5 5GR-II 5HTPa 3.5 ± 0.1c 5.1 ±0.2 2.5 ±0.1 1.2 ± 0.1 5GR-IV 5HTP 14 ± 1 3.5 ±0.7 4.1 ±0.2 2.7 ± 0.2 5GR-V 5HTP 13± 1 11 ± 1 7.4 ± 0.4 1.8± 0.1 5GR-VI 5HTP 0.9 ±0.1 1.2 ±0.1 0.9 ±0.1 1.1 ± 0.1 5GR-II Serotonin 1.5 ±0.1 3.7 ±0.1 1.8 ±0.1 1.1 ± 0.1 5GR-IV Serotonin 16± 1 5.5 ± 1.1 4.2 ± 0.2 3.2 ± 0.2 5GR-V Serotonin 11 ± 1 8.9 ±0.8 7.3 ±0.6 1.3± 0.2 5GR-VI Serotonin 0.7 ±0.1 1.4 ±0.2 0.8 ±0.1 1.1 ± 0.1 DGR-I 3,4-DHF 2.4 ±0.2 6.4 ±0.6 2.3 ± 0.2 1.5± 0.1 DGR-II 3,4-DHF 2.3 ±0.4 3.8 ±0.8 1.2 ±0.1 1.1 ± 0.1 DGR-III 3,4-DHF 1.3 ±0.1 1.4 ±0.1 1.6 ±0.1 1.1 ± 0.2 DGR-IV 3,4-DHF 1.9 ±0.1 1.7 ±0.1 4.3 ± 0.2 1.3± 0.1 DGR-I Dopamine 3.5 ±0.6 7.9 ±0.9 2.5 ± 0.2 1.5± 0.1 DGR-II Dopamine 4.6 ± 0.8 4.2 ± 1.1 1.3 ±0.1 1.1 ± 0.1 DGR-III Dopamine 1.2 ±0.1 1.4 ±0.1 1.7 ±0.1 1.0 ± 0.1 DGR-IV Dopamine 2.6 ±0.1 2.0 ±0.1 8.0 ±0.3 1.3 ± 0.1 Concentration of binder is 2 mM. The bending induction (BI) is calculated as (total fluorescence, + ligand) / (total fluorescence, - ligand). The error is reported as the standard error of the mean for three independent experiments. Petition 870250088301, dated 09 / 29 / 2025, page 94 / 175 89 / 107 Table 8. In vitro brightness of scaffolded aptamers Fluorogenic GRs in relation to parental Brdcolis aptamer binder CM-2 CM-3 CM-4 CM-5 5GR-II 5HTPd 54 ± 10 75 ± 14 89 ± 16 97 ± 20 5GR-IV 5HTP 5.9 ± 1.4 0.4 ±0.1 10 ± 5 HTP 3 GR-V 3V ±0.5 5.7 ± 1.3 5.5± 1.0 5GR-VI 5HTP 1.0 ± 0.1 12±2 14 ± 3 43 ±8 5GR-II Serotonin Serotonin Serotonin 22 ± 5 ± 3 54 ±9 6-1 IV. 11 ±3 23 ±5 5GR-V 11 ±2 2.7 ±0.2 6.2 ± 1.3 3.8 ± 0.5 5GR-VI 0.8 ±0.1 13± 1 12 ± 3 45 ±9 DGR-I 3,4 ±0.1 S.7.16 ±0.1 S. DGR-II 3,4-DHF 1.3 ±0.7 11 ±4 4.7 ± 1.1 17± 1 DGR-III 3,4-DHF 3.3 ±0.2 25 ±4 15 ± 2 61 ± 11 DGR-IV 3,4 ±DHF ±1pa ±57 Dmina 8 ± 3-5 47 Dopamine Dopamine Dopamine 0.8 ±0.1 12± 1 7.7 ± 1.6 25 ±6 DGR-II 2.6 ± 1.3 12 ± 4 5.1 ± 1.0 19 ± 2 DGR-III 3.1 ± 0.2 25 ±4 16 ± 1 2 5 66 ± 11 76 ±9 aThe binder concentration of the aptamer is 2 mM. The percentage of brightness is calculated as (total fluorescence sensor + ligand) / (total broccoli fluorescence + ligand). The error is reported as the standard error of the mean for three independent experiments. Petition 870250088301, dated 09 / 29 / 2025, page 95 / 175 90 / 107 Table 9. In vivo folding induction of aptamers with fluorogenic GR scaffolds. ligand aptamer CM-2 CM-3 CM-4 CM-5 5GR-II 5HTPa 0.9 ±0.1 2.6 ± 0.3 5.3 ± 0.2 3.1 ± 0.45 5GR-IV 5HTP 1.0 ±0.2 1.7 ± 0.7 1.4 ± 0.15 1.9 ± 0.55 5GR-V 5HTP 1.2 + 0.2 1.4 ±0.2 1.6 ±0.2 0.9± 0.1 5GR-VI 5HTP 0.9 ±0.1 1.1 ±0.1 1.1 ±0.1 1.4± 0.1 5GR-II Serotonin 1.0 ± 0.1 1.8± .1 3.0 ± 0.4 2.5 ± 0.3 5GR-IV Serotonin 1.0 ± 0.1 0.9 ±0.1 2.6 ±0.7 6.9 ± 1.2 5GR-V Serotonin 1.1 ±0.1 1.7 ±0.4 1.8 ±0.2 0.7 ± 0.1 5GR-VI Serotonin 1.0 ±0.2 1.6 ±0.1 1.6 ±0.1 1.9± 0.2 DGR-I Dopamine 0.7 ±0.1 0.9 ±0.3 1.6 ±0.6 2.7 ± 0.5 DGR-II Dopamine 0.6 ±0.1 1.0 ±0.4 3.1 ±0.8 2.9 ± 0.5 DGR-III Dopamine 0.6 ±0.1 0.4 ±0.2 0.7 ±0.1 0.8± 0.1 DGR-IV 1.7 ±0.9 0.7 ±0.2 1.3 ±0.1 0.9± 0.5 The ligand concentration is 2 mM. The bending induction (FI) is calculated as (total fluorescence, + ligand) / (total fluorescence, - ligand). The error is reported as the standard error of the mean for three independent experiments. Table 10. In vivo brightness of aptamers with fluorogenic GR scaffold compared to parent broccoli. aptamer ligand CM-2 CM-3 CM-4 CM-5 5GR-II 5HTPd 0.4 ± 0.1 2 ± 0.3 20 ±2 27 ± 2 5GR-IV 5HTP 0.4 ±0.1 0.7 ±0.4 0.7 ±0.2 0.9 ± 0.3 5GR-V 5HTP 0.5 ±0.1 0.4 ±0.1 0.8 ±0.1 0.8 ±0.1 5GR-VI 5HTP 0.4 ±0.1 0.7 ±0.1 0.6 ±0.1 7± 0.4 5GR-II Serotonin 0.4 ±0.1 2.2 ±0.1 15 ± 2 25 ±6 5GR-IV Serotonin 0.5 ±0.1 0.4 ±0.1 1.5 ±0.3 4.8 ± 0.8 5GR-V Serotonin 0.7 ± 0.1 0.6 ±0.1 1.0 ± 0.2 0.8 ± 0.1 5GR-VI ' Serotonin 0.4 ±0.1 1.3 ±0.1 1.1 ±0.3 9.7 ± 0.3 DGR-I Dopamin ±0.1 0.3 ±0.1 0.8 ±0.5 2± 1 DGR-II Dopamine 0.4 ±0.1 0.7 ±0.3 3± 1 3±2 DGR-III Dopamine 0.5 ±0.1 0.2 ±0.1 0.6 ± 0.1 3± 1 DGR-IV Dopamine 0.4 ±0.1 0.4 ±0.2 1 ±0.3 3±2 Petition 870250088301, dated 09 / 29 / 2025, p. 96 / 175 91 / 107a The ligand concentration is 2 mM. The percentage of brightness is calculated as (total fluorescence sensor + ligand) / (total broccoli fluorescence + ligand). The error is reported as the standard error of the mean for three independent experiments. Example 7: Discussion [000213] RNA-based devices are progressing toward becoming a robust tool in synthetic biology, driven by a unique set of characteristics compared to protein-based alternatives, including the ability to self-regulate in predictable secondary structure and a small genetic footprint. Efforts have focused on creating synthetic riboswitchers, aptazides, and fluorogenic RNA sensors, but their potential has not yet been fully developed, in significant part due to the limited availability of small molecule receptors that function in the context of such devices. In the work presented here, a strategy was designed that exploits the secondary and tertiary structural architecture of naturally developed riboswitchers and ribozymes for small molecule binding pockets of scaffolds created by in vitro selection.Importantly, using no information beyond that obtained from high-throughput sequencing in the final round of selection, aptamers selected for L-DOPA using this approach were coupled to a fluorogenic aptamer module to produce genetically encoded biosensors that function in the cellular context. [000214] A fundamental strength of the methods and compositions described here is the use of multiple scaffolds in parallel selections to obtain an aptamer grouping. This differs Petition 870250088301, dated 09 / 29 / 2025, page 97 / 175 92 / 107 significantly differs from traditional selections known in the art where the same subgrouping of solutions is reproducibly generated from a simple random grouping, significantly limiting the diversity and development of sensors. Although aptamers derived from different structures have similar affinities for 5HTP and selectivity against L-tryptophan, they clearly have distinct characteristics regarding their ability to communicate with a reading domain via the P1 helix, a feature common to all scaffolds. In biological riboswitchers, the ligand is in direct contact with, or induces conformational changes in, RNA involving the P1 helix that links the aptamer to the downstream regulatory switch.Without intending to be limited by scientific theory, there is a hypothesis that differences in sensor performance across different aptamers are, in part, due to variation in the spatial relationship between the ligand and the inter-domain helix (P1), a characteristic that cannot be fully controlled in selection. However, unlike deep selections, the scaffold selection approach presented here strongly biases selections toward a favorable ligand / P1 orientation by restricting the possible ligand position. [000215] With a grouping of aptamers, combinatorial approaches can be employed to rapidly screen sensors without extensive aptamer characterization or device optimization, as typified by the development of the dopamine sensor (Figure 19). The development of an RNA device from aptamers derived from deep selections requires complete characterization, along with extensive screening of the communication modules, leaving the Petition 870250088301, dated 09 / 29 / 2025, page 98 / 175 93 / 107 sensory aptamers as a fixed and unalterable node, due to a lack of diversity. With the selection methods and scaffold structure compositions described here, a cluster of distinct aptamers can be combinatorially coupled to a cluster of communication modules and rapidly screened for variants with the desired activity, as demonstrated with the L-DOPA selection. Thus, the methods and compositions provided here should facilitate the practical development of RNA devices and sensors, addressing a fundamental bottleneck in their development. Notably, while in this study only the most populous clusters were focused on in each selection for characterization and / or sensor design, within each selection there are many clusters containing alternative sequences that could further enrich the initial aptamer cluster for developing downstream applications. [000216] A second powerful advantage of the selection methods and compositions described here is the potential for robust folding in the cellular context provided by the tertiary interaction of the three-way junction architecture. Each of these aptamers possesses a fold that has undergone extensive biological evolution. Furthermore, the distal tertiary interactions that organize the three-way junction core can be highly stable. Both the L2-L3 interaction of the purine riboswitcher and the tetra-loop receptor of the cyclic di-GMP riboswitcher main chain are capable of stably forming outside the context of another RNA structure. Conversely, the long-range interaction that organizes the S. mansoni hammerhead ribozyme is dynamic, which is another aspect of the diversity in relation to the chosen scaffolds. The presence of robust secondary and tertiary structure in the scaffold allows these elements to guide Petition 870250088301, dated 09 / 29 / 2025, page 99 / 175 94 / 107 potentially folds all members of the initial library. Conversely, incorrect RNA folding during selection and / or the presence of multiple MFE structures in the final aptamers is often a significant problem for traditional deep selection. Since there is no significant selection pressure for high-fidelity folding in a typical selection protocol, providing this information in the starting library may be a way to achieve robustly folded RNAs. [000217] While three-way junction scaffolds were chosen as the focus of this study, the diversity of natural riboswitchers and ribozymes can provide more raw material for this approach. Within the three-way junction family, there is a wide variety of sequences that vary the orientation of the three helices, the size of the junction regions, and the nature of the distal tertiary interaction, which can provide superior structures for a particular ligand or sensor. Furthermore, other folds may be predisposed to bind a small target molecule based on the nature of the cognate ligand. For example, another logical choice for a scaffold to bind 5HTP is the lysine riboswitcher aptamer domain. Larger ligands may be more easily recognized by flavin mononucleotide-derived scaffolds or cobalamin riboswitchers, while dinucleotides, such as NADH, can be easily accommodated by one of the dicyclic nucleotide aptamers.Since it has been discovered that natural RNA aptamers recognize chemically diverse small molecules, exploring their architectures for the selection of new aptamers has the potential to facilitate the development of powerful, innovative tools for monitoring and responding. Petition 870250088301, dated 09 / 29 / 2025, pages 100 / 175 95 / 107 to small molecules in the cellular environment in a wide range of applications. Example 8: Building the library [000218] For each scaffold, the nucleotides within an 8 Å shell surrounding the ligand binding site or active site of the parent RNA were identified from their crystal structure (GR, PDB ID 4FE5; CDG, PDB ID 3IWN; HH, PDB ID 3ZD5). ​​The corresponding positions were randomized on a DNA ultramer spanning the entire aptamer domain with conserved flanking sequences for transcription and reverse amplification (Integrated DNA Technologies; the sequences of all nucleic acids used in this study are presented in Table 1). The ssDNA were converted into dsDNA templates for transcription using standard Taq PCR conditions in which ~2x10-12 mol of DNA (corresponding to ~1012 individual sequences) was used in each 100 pL PCR reaction and amplified for 15 cycles with the T7 site attached and RT-PCR primers.Approximately 1x10¹⁴ sequences were transcribed into 12.5 mL of transcription reaction containing 40 mM Tris-HCl, pH 8.0, 25 mM DTT, 2 mM spermidine, 0.01% Triton X100, 4 mM each rNTP, pH 8.0, 0.08 units of inorganic phosphatase (Sigma-Aldrich, lyophilized powder), and 0.25 mg / mL of T7 RNA polymerase and incubated at 37 °C for 4 hours. The transcript samples were then precipitated in 75% ethanol at -20 °C, sedimented, and reconstituted in a solution of 300 µL formamide, 3 mL 8 M urea, and 300 µL 0.5 M EDTA, pH 8.0. Full-length RNA was purified with an 8% acrylamide:bisacrylamide 29:1 gel denaturant. The RNA product was excised from the gel after visualization by UV shading and eluted in 0.3 M NaOAc at pH 5.0 before exchange and storage in Petition 870250088301, dated 09 / 29 / 2025, pp. 101 / 175 96 / 107 0.5 x TE . Example 9: Synthesis of the 5HTP Affinity Column Matrix [000219] For the derivatized columns, 3 mL of EAH Sepharose 4B bed volume (GE Healthcare) was dehydrated with dimethylformamide (DMF). 10 pmols of Fmoc-5-hydroxy-L-tryptophan and 10 pmols of benzotriazol-l-yloxytripyrrolidinophosphonium hexafluorophosphate (PyBOP) were dissolved in 1 mL of DMF and added to the dehydrated column with 20 pmols of N,N-diisopropylethylamine (DIPEA) and incubated with shaking for 2 hours at room temperature. The column matrix was then drained and washed extensively with DMF. Unreacted sepharose amines were acetylated by adding 1 mmole of acetic anhydride and 1 mmole of DIPEA to approximately 1 mL of DMF and mixing at room temperature for 1 hour. The column was drained of the acetylation mixture and washed with DMF before deprotecting Fmoc using 20% ​​v / v piperidine / DMF.The amino acid concentration in the column was determined by measuring the Fmoc concentration in the deprotection fractions (A301 nm = 8,000 M-1cm-1). This method yielded approximately 0.5 to 1 mM of deprotected amino acid per mL of resin. For counter selection, EAH Sepharose was prepared in exactly the same way, except for omitting the ligand coupling step, resulting in acetylated Sepharose. Example 10: In vitro selection [000220] For GR scaffold selection using Superscript III reverse transcriptase (GR / SSIII), 350 pL of acetylated sepharose were equilibrated in selection buffer (NaHEPES 10 mM, pH 7.0, NaCl 250 mM, KCl 50 mM, MgCl2 10 mM, 0.1 Petition 870250088301, dated 09 / 29 / 2025, page 102 / 175 97 / 107 mg / mL of tRNA) and 1 nmol of RNA from the library in 350 pL of selection buffer were incubated at room temperature for 30 minutes with shaking. The applied solution was removed and the column matrix washed once with 350 pL of selection buffer. The pooled flow and wash (total of 750 pL) were added to the pre-equilibrated 5HTP-derivatized Sepharose 4B column and incubated for 45 minutes. The column was then drained and washed three times with selection buffer before elution with 10 mM 5HTP in selection buffer (two 1-hour incubations in 350 pL; for a total eluted volume of 700 pL). The eluted fractions were then concentrated to 50 pL on a 0.5 mL Ultracel 10kD MWCO filter (Millipore) and precipitated with ethanol in 0.3 M sodium acetate (pH 5.0), 5 pg of glycogen, and brought to a final concentration of 75% ethanol before storage at -70 °C for 30 minutes. Details of the conditions for each cycle are provided in Table 2. [000221] To convert the eluted competitive RNA into a new RNA population, the elution fractions were precipitated with ethanol, pelleted at 13,000 xga 4 °C, decanted, and dried under vacuum. The dried pellet was reconstituted with 0.7 mM each dNTP, 7 μM RT-PCR primer, and brought to a total volume of 14 pL before heating at 65 °C for 5 minutes and incubating on ice for 10 minutes. The solution was then brought to 1x SuperScript III first-strand buffer (5x: 250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2) with 5 mM DTT and 200 SuperScript III units (Life Technologies) to a total volume of 20 pL before a 15-minute extension at 54 °C. The entire 20 pL reverse transcription solution was amplified by PCR in a total volume of 500 pL using standard Taq DNA polymerase conditions. The amplified cluster was then transcribed by the addition of 100 Petition 870250088301, dated 09 / 29 / 2025, page 103 / 175 98 / 107 pL of the PCR reaction to a 1 mL transcription reaction containing 40 mM Tris-HCl, pH 8.0, 25 mM DTT, 2 mM spermidine, 0.01% Triton X-100, 4 mM each rNTP pH 8.0, 0.08 units of inorganic phosphatase, and 0.25 mg / mL of T7 RNA polymerase and incubated at 37°C for 2 hours. A 100 pL transcription reaction to 32P-labeled RNA was performed under similar conditions except that the rNTPs were reduced to 2 mM for UTP, CTP, and GTP while ATP was reduced to 200 μM and ~100 pCi of 32P-ATP. The transcription samples were purified on gel as previously described, with gel loading conditions scaled accordingly. [000222] Selections using Gsl reverse transcriptase were performed as previously described with the following modifications. The selection buffer contained a reduced concentration of magnesium and more physiologically relevant monovalent cations: Na-HEPES 25 mM, pH 7.0, KCl 150 mM, NaCl 50 mM, MgCl2 3 mM). GslI-IIC-MRF reverse transcriptase was used in place of Superscript III. GslIIC MRF reverse transcriptase was expressed in E. coll and purified as described (Mohr et al., RNA, 2013, 19, 958-970). The precipitated RNA pellet was placed in 1.25 mM dNTPs and 20 μM RT-PCR primer before denaturation at 65°C, annealing at 4°C, and equilibration at 60°C. The solution was then brought to 1x GsI-IICMRF buffer conditions (10 mM NaCl, 1 mM MgCl2, 20 mM TrisCl2, pH 7.5, 1 mM DTT) in a total volume of 20 µL, and sufficient enzyme was added for extension at 60 °C. PCR was performed as previously described. Example 11: High-throughput sequencing and bioinformatics analysis [000223] Standard PCR was conducted to attach the Illumina hybridization sequences required for cell annealing. Petition 870250088301, dated 09 / 29 / 2025, pp. 104 / 175 99 / 107 flow. Each library was amplified with the forward sequencing primer and a single reverse primer containing a 12-nucleotide differentiating barcode (sequences are presented in Table 1). Samples were sequenced using a v3 reagent kit for 150 cycles on a MiSeq (Illumina) with custom read and index primers. [000224] The resulting sequences were demultiplexed, clipped, and quality-filtered using QIIME transcripts (Caporaso et al., Nat. Methods, 2010, 7, 335-336). All sequence information outside the P1 trunk was clipped, and only sequences containing a Phred score > 20 for each nucleotide were used in the analysis. The resulting fasta format files for each library were then subjected to clustering by USEARCH (Edgar, Bioinformatics, 26, 2460-2461), which generated seed sequences that were clustered at 90% identity; any clusters containing a single sequence were discarded. The ten most populous clusters were then mapped back to their original sequence file, and 250 individual sequences were randomly taken as a representative sample from each cluster for further analysis.The sequences in each cluster were aligned using MUSCLE (Edgar, NAR, 2004, 32, 1792-1797) and the resulting alignment was analyzed using CMfinder (Yao et al., Bioinformatics, 2006, 22, 445-452). R2R (Weinberg & Breaker,. (BMC Bioinformatics, 2011, 12, 3) was run in its default settings to generate conservation figures of sequences mapped to the minimum free energy (MFE) secondary structure. Example 12: NMIA chemical probe Petition 870250088301, dated 09 / 29 / 2025, pages 105 / 175 100 / 107 [000225] The RNA was prepared as previously described (Edwards et al., Methods Mol. Biol., 2009, 535, 135-163). The structural cassettes flanking the 5' and 3' ends of RNA molecules were added to facilitate reverse transcription, and NMIA modification was performed using established protocols (Wilkinson et al., Nat. Protoc., 2006, 1, 16101616) at 25 °C. RNA was probed at 100 nM in 100 mM Na-HEPES, pH 8.0, NaCl 100 mM and MgCl2 6 mM. The ligand concentration was 500 pM where indicated. Gel images were analyzed by SAFA (Das et al., RNA, 2005, 11, 344-354) and ImageJ (NIH). Example 13: Isothermal Titration Calorimetry (ITC) [000226] All RNAs tested were exchanged to SSIII selection buffer (10 mM Na-HEPES, pH 7.0, 250 mM NaCl; 50 mM KCl; 10 mM MgCl2) and washed three times through a 10 kD MWCO filter (EMD Millipore). The ligand was brought from a dry solid directly into the ligand buffer and the concentration was set in a NanoDrop 2000 (Thermo Scientific) using an extinction coefficient at 275 nm of 8,000 mol-1cm-1 for the 5-hydroxyindole moiety. The RNA was diluted to between 50 and 100 pM and the ligand was titrated at approximately 10 times the RNA concentration. Titrations were performed at 25 °C using a microcalorimeter. MicroCal iTC200 (GE Healthcare) using established protocols (Gilbert and Batey, Methods Mol. Biol., 2009, 540, 97-114). The data were analyzed and the adjustment was performed using the Origin 5.0 software package (Origin Laboratories). Example 14: Determining the structure of the complex 5HTP-II / 5HTP [000227] The RNA for crystallization was prepared as previously described (Edwards et al., Methods Mol. Biol., 2009, Petition 870250088301, dated 09 / 29 / 2025, pp. 106 / 175 101 / 107 535, 135-163). The RNA was concentrated on an Amicon Ultra filter. 10k MWCO (EMD Millipore, Inc.) and replaced with a 0.5x plug. Diffraction-quality crystals were obtained by mixing 2 pL of RNA:ligand complex (1:1) and 3.5 pL of mother liquor (8 to 14% 2-methyl-2,4-pentanediol, 40 mM sodium cacodylate pH 5.5, 4 mM MgCl2, 12 mM NaCl, 80 mM KCl, and 4 to 9 mM cobalt hexamine), microseeding, and incubating at 22 °C for 1 to 3 days. The crystals did not require additional cryoprotection and were frozen in liquid nitrogen before data collection. The data were collected with a Rigaku R-Axis IV imaging plate system using CuKa (1.5418 Å) radiation at 100 K, and were indexed and scaled using D*TREK (Pflugrath, Acta Crystallogr. D Biol. Crystallogr., 1999, 55, 1718-1725). Data on a heavy atom derivative generated by replacing cobalt hexamine with 1 mM iridium hexamine were also collected at the original x-ray source. Phases were determined using the single isomorphic substitution with anomalous scattering (SIRAS) method. AutoSol (Adams et al.(Acta Crystallogr. D Biol. Crystallogr., 2010, 66, 213221) was used to find 12 iridium atoms which were then used to calculate the phases. The resulting experimental density map showed unambiguous features of the RNA main chain and helices and was used to build the model. [000228] The initial model was iteratively constructed without the ligand in Coot (Emsley & Cowtan, Acta Crystallogr. D Biol. Crystallogr., 2004, 60, 2126-2132) between rounds of refinement in PHENIX (Adams et al., Acta Crystallogr. D Biol. Crystallogr., 2010, 66, 213-221). The RNA model was brought through several rounds of refinement and simulated annealing before 5HTP was Petition 870250088301, dated 09 / 29 / 2025, pp. 107 / 175 102 / 107 built in the model. At this point in the construction, there was a clear density of the ligand in the binding pocket that allowed for safe placement and orientation of the ligand. The placement of the ligand and bases was validated by a compound omission map (Figure 10B). Water placement was automated in the final refinement rounds after ligand placement based on the peak size in the Fo-Fc difference map. The resulting model had good geometry as judged using MolProbity (Chen et al., 2010, Acta Crystallogr. D Biol. Crystallogr., 2010, 66, 213-221) and final model statistics (Rwork and Riivre are 21.9% and 26.2%, respectively). All crystallographic data and model statistics are presented in Table 4. Example 15: In vitro broccoli sensor assays [000229] RNA was prepared as previously described, with additional washes with 0.5x TE buffer in an ArnCO Ultra (Millipore) 10k MWCO to minimize metal ion transport. All RNA sensors were assayed at concentrations of 0.5μM RNA and 10μM (Z)-4-(3,5-difluoro-4-hydroxybenzylidene)-1,2-dimethyl-1H-imidazo-5(4H)-one (DFHBI) in a buffer containing 80 mM Tris-HCl, pH 7.4, 150 mM KCl and 50 mM NaCl. The buffer, ligand, magnesium (concentrations given in Table 6), and DFHBI were mixed before the addition of RNA, and all reactions were incubated naturally for 30 minutes at room temperature. The fluorescence of DFHBI was measured by placing 200 pL of reaction volume on a 96-well Greiner flat-bottom black fluorescence plate (Thermo Scientific) and reading it on a Tecan Infinite M200 PRO plate reader.The samples were excited at 460 nm and the fluorescence emission was measured as the average signal between 506 and 510 nm. Petition 870250088301, dated 09 / 29 / 2025, pp. 108 / 175 103 / 107 The ligand concentration required to induce a maximal fluorescence response in the medium was determined by fitting the observed fluorescence as a function of ligand concentration to a two-state model. [000230] The engineered sensors were synthesized as G blocks (sensor sequences given in Figure 23; Integrated DNA Technologies) and cloned between the XbaI and BlpI sites on pET30b using standard molecular cloning techniques. All resulting plasmids were sequence verified. For T7 RNA polymerase transcription reactions, a DNA template was generated by PCR using external primers 1 μM (5': GGCCGTAATACGACTCACTATAGGAGCCCGGATAGCTCGGTAGAGCAG (SEQ ID NO: 40), 3': TGGCGCCCGAACAGGGACTTGAACCCTGGA (SEQ ID NO: 41)) using a standard PCR reaction. The templates were added directly to an in vitro transcription reaction (see above) and RNA synthesis proceeded naturally for 2 hours at 37 °C. The RNA from the previous transcription reaction was used directly in assays without further purification.[000231] The activity of each sensor was monitored in a 100 μL reaction containing 50 μL of in vitro transcription reaction, 10 μL of 10x study buffer (1x: 50 mM K-HEPES, pH 7.5, 10 mM. MgCl2, 150 mM KCl, 50 mM NaCl), 30 μM DFHBI-1T and 2 mM ligand (for positive reactions with ligand). The reactions were incubated at room temperature for 30 minutes and DFHBI fluorescence was measured by placing 90 μE of reaction volume on a 96-well Greiner flat-bottom black fluorescence plate (Thermo (Scientific) and reading on a Tecan Infinite M200 PRO plate reader. Samples were excited at 460 nm and fluorescence emission was measured as the average signal between 506 and 510 nm. A positive control was performed for all experiments. Petition 870250088301, dated 09 / 29 / 2025, pp. 109 / 175 104 / 107 of a broccoli aptamer with tRNA scaffold in the presence and absence of ligand, which was also used as a reference for relative brightness. Folding induction was calculated by dividing the fluorescence values ​​for the DFHBI-1T plus ligand reaction by the fluorescence value for the DFHBI1T only condition. All experiments were performed in triplicate and quantified data were reported with the standard error of the mean (sem). Example 16: In vitro broccoli sensor assays [000232] E. coli One Shot® BL21 Star (DE3) (Thermo Fisher) cells were transformed with a pET30b-derived plasmid containing a sensor under inducible control, plated on LB agar supplemented with 50 μg / mL kanamycin and incubated at 37 °C for approximately 16 hours. Individual colonies were harvested and cultured overnight (approximately 16 hours) in 5 mL of LB supplemented with 50 μg / mL kanamycin to allow the culture to reach saturation. For screening experiments, 5 μL of the overnight-saturated culture were added to 5 mL of LB supplemented with 50 μg / mL kanamycin and grown to the mid-log phase (OD600 approximately 0.4 to 0.6) at 37 °C. To induce expression of broccoli aptamer alone or broccoli aptamer / riboswitcher fusion constructs, IPTG was added at a final concentration of 1 mM to each culture, which were then grown for a further 2 hours at 37 °C.The cells were then pelleted by centrifugation and washed once with 5 mL of 1X M9 salts supplemented with MgSO4 to a final concentration of 5 mM and kanamycin to a final concentration of 50 μg / mL. After washing, the cells were pelleted by centrifugation, resuspended in 250 μL of the previous M9 medium, and divided into two 100 μL aliquots. In half of the aliquots... Petition 870250088301, dated 09 / 29 / 2025, pages 110 / 175 In the 105 / 107 aliquots, DFHBI-1T was added at a final concentration of 50 μM to a final volume of 110 pL. In the other half of the aliquots, DFHBI-1T was added at a final concentration of 50 μM and the ligand (5HTP, 5HP, or dopamine) was added at a final concentration of 1 mM to a final volume of 110 pL. The cells were then incubated at 37 °C for 30 minutes to allow uptake of each compound. After the 30-minute incubation, 100 pL of each aliquot were pipetted into a 96-well Greiner microplate and frozen on ice for 30 minutes. For fluorescence measurements, DFHBI-1T was monitored at an excitation wavelength of 472 nm and an emission wavelength of 520 nm. The quantified data represent the mean fluorescence values ​​± standard error of the mean (sem) of three biological replicates, which were background corrected using an empty pET30b vector control.Folding induction was calculated by dividing the average fluorescence values ​​of cells exposed to the ligand by the average fluorescence of cells without ligand. Example 17: Intracellular fluorescence imaging of 5HTP [000233] DNA and cultures were prepared as described (Paige et al., Science, 2012, 335, 1194). Briefly, the tRNA / Broccoli fusion sequence was cloned into pET30b between the Xbal and BlpI sites downstream of an inducible T7 promoter. The sequence-verified plasmid was transformed into cells. STAR BL21 (DE3) (Invitrogen) and individual colonies were grown overnight in Luria broth (LB) supplemented with 50 pg / mL kanamycin. The overnight culture was used to inoculate fresh LB / kanamycin medium at a 1:1000 dilution. Petition 870250088301, dated 09 / 29 / 2025, pp. 111 / 175 106 / 107 and the culture grew at 37 °C to an ODgqq = 0.4 to 0.6 before induction with 1 mM IPTG and growth at 37 °C for 2 to 4 hours. 200 μL of the resulting culture were centrifuged, decanted, and resuspended in 2 mL of M9 minimum salt medium supplemented with 50 pg / mL kanamycin, 5 mM MgSO4, and 1 mM IPTG. 200 μL of the resuspended culture were transferred to 96-well poly-D-lysine coated glass bottom plates (MatTek) and incubated at 37 °C for one hour. The medium was then removed and the wells washed with 1 mM M9 / kanamycin / IPTG medium before the addition of 200 μL of 1 mM M9, IPTG, and DFHBI-1T 400 μL (Lucerna) medium. Live fluorescence images were taken with an Andor iXon3 897 EMCCD using a 60x oil objective, a 472 / 30 excitation filter, a 490 dichroic mirror (long passage), and a 520 / 40 emission filter on a Nikon Ti-E microscope and analyzed with FIJI (Schindelin et al., Nat. Methods, 2012, 9, 676-682). Example 18: Single-pass in vitro transcription assays [000234] The dsDNA templates were transcribed as previously described (Trausch et al., Structure, 2011, 19, 1413-1423). Briefly, 50 ng of DNA template were incubated at 37 °C for 10 minutes in 12.5 pL of 2x transcription buffer (TrisHCl 140 mM, pH 8.0, NaCl 140 mM, EDTA 0.2 mM, β-Mercaptoethanol 28 mM and 70 mg / mL BSA), 2.5 pL of MgCl2 50 mM, 100 to 200 pCi of 32P-ATP and 0.25 units of σ70 holoenzyme of E. coli RNA polymerase (Epicenter Biotechnologies) by reaction were brought to 23 pL. Equilibrated reactions were then initiated by adding 7.5 pL of reaction buffer (165 pM of each rNTP, 0.2 mg / mL heparin, and the desired ligand concentration) and incubated for 15 minutes at 37 °C before being flushed with 8 M urea. The reactions were then separated on a PAGE Petition 870250088301, dated 09 / 29 / 2025, pp. 112 / 175 107 / 107 denaturant at 8%, dried and exposed on a phosphor image screen. Quantification of the gels was then performed in ImageJ (NIH) and the data fit a two-state model. Membership codes [000235] Coordinates and structure factors were deposited in the RSCB Protein Data Bank under the accession code 4ZAQ. Incorporation by reference [000236] The contents of all references (including bibliographic references, published patents, published patent applications and copending patent applications) cited throughout this application are hereby expressly incorporated by reference in their entirety. Unless otherwise defined, all technical and scientific terms used herein are given to the meaning commonly known by those skilled in the art. Equivalents [000237] Those skilled in the art will recognize, or will be able to determine using no more than routine experimentation, many equivalents of the embodiments provided herein. Such equivalents are covered by the following claims. Petition 870250088301, dated 09 / 29 / 2025, pp. 113 / 175

Claims

1 / 7 - CLAIMS - 1. RNA OLIGONUCLEOTIDE LIBRARY, characterized in that it comprises a plurality of non-identical oligonucleotides, wherein the individual oligonucleotides comprise a structural scaffold comprising: a) a first sequence comprising a helix domain; b) a second sequence comprising a first hairpin domain; c) a third sequence comprising a second hairpin domain; d) an oligonucleotide junction, wherein the oligonucleotide junction is a three-way junction; wherein the oligonucleotide junction comprises (i) a sequence linking the helix domain, the first hairpin domain and the second hairpin domain and (ii) a ligand-binding domain, wherein the library comprises a plurality of non-identical ligand-binding domains,and wherein the individual oligonucleotides comprise a sequence with a series of linked sequences according to Formula I: (I) P1-J1 / 2-P2-L2-P2'-J2 / 3-P3-L3-P3'-J3 / 1-P1' wherein - represents a linkage; P1 and P1' form the helix; P2, L2 and P2' form the first hairpin; P3, L3 and P3' form the second hairpin; and J1 / 2, J2 / 3 and J3 / 1 together form the oligonucleotide junction; and Petition 870260051375, dated 05 / 28 / 2026, p. 15 / 21 2 / 7 wherein the scaffold is derived from the aptamer domain of a guanine ribosome xpt-pbuX sequence from Bacillus subtilis, from the aptamer domain of a cyclic di-GMP ribosome Vc2 sequence from Vibrio cholerae, or from a hammerhead ribozyme sequence from Schistosoma mansoni.

2. RNA OLIGONUCLEOTIDE LIBRARY, characterized in that it comprises a plurality of non-identical oligonucleotides, wherein the individual oligonucleotides comprise a structural scaffold,comprising: a) a first sequence comprising a helix domain; b) a second sequence comprising a first hairpin domain; c) a third sequence comprising a second hairpin domain; d) an oligonucleotide junction, wherein the oligonucleotide junction is a three-way junction; wherein the oligonucleotide junction comprises (i) a sequence linking the helix domain, the first hairpin domain and the second hairpin domain and (ii) a pre-selected ligand-binding domain, wherein the library comprises a plurality of non-identical ligand-binding domains and wherein the individual oligonucleotides comprise a sequence with a series of linked sequences according to Formula I: (I) P1-J1 / 2-P2-L2-P2'-J2 / 3-P3-L3-P3'-J3 / 1-P1' wherein - represents a linkage; P1 and P1' form the helix; Petition 870260051375, dated 05 / 28 / 2026, page 16 / 21 3 / 7 P2, L2 and P2' form the first hairpin; P3, L3 and P3' form the second hairpin; and J1 / 2,J2 / 3 and J3 / 1 together form the oligonucleotide junction; and wherein the backbone is derived from the aptamer domain of a guanine ribosome sequence xpt-pbuX from Bacillus subtilis, from the aptamer domain of a cyclic di-GMP ribosome sequence Vc2 from Vibrio cholerae, or from a hammerhead ribozyme sequence from Schistosoma mansoni.

3. RNA oligonucleotide library, according to claims 1 or 2, characterized in that each helix domain is independently a fully complementary helix comprising, optionally, one or more destabilizing nucleotides selected from the group consisting of a mismatched base pair, a wobble base pair G*U, and a bulge.

4. RNA oligonucleotide library, according to claims 1 or 2, characterized in that each helix domain is a fully complementary helix.

5. RNA oligonucleotide library, according to claims 1 and 2,characterized in that each first hairpin domain independently comprises one or more destabilizing nucleotides selected from the group consisting of a mismatched base pair, a wobble base pair G*U, and a bulge.

6. RNA oligonucleotide library according to claims 1 and 2, characterized in that each second hairpin domain independently comprises one or more destabilizing nucleotides selected from the group consisting of a mismatched base pair, a wobble base pair G*U, and a bulge.

7. RNA oligonucleotide library according to claims 1 and 2, characterized in that the helix domain is at least 4 to 10 base pairs in length.

8. RNA oligonucleotide library according to claim 7,characterized in that the helix domain is at least 10 base pairs in length.

9. RNA oligonucleotide library according to any one of claims 1 and 2, characterized in that J2 / 3 comprises a T-loop motif.

10. RNA oligonucleotide library according to claim 9, characterized in that the T-loop motif comprises the sequence UUGAA.

11. RNA oligonucleotide library according to claim 10, characterized in that the guanosine of the T-loop forms a Watson-Crick base pair with a cytidine at J3 / 1.

12. RNA oligonucleotide library according to claims 1 and 2, characterized in that the helix domain has a first end and a second end, and the first end is proximal to the oligonucleotide junction and the second end is attached to an oligonucleotide base reading frame.

13. RNA oligonucleotide library,According to claim 12, characterized in that the oligonucleotide-based reading module is a switch-based or fluorogenic reading module.

14. RNA oligonucleotide library, according to claim 13, characterized in that the fluorogenic module is a Broccoli fluorophore-binding aptamer.

15. RNA oligonucleotide library, according to claim 13, characterized in that the switch-based module is a pbuE switch.

16. RNA oligonucleotide library, according to claim 12, characterized in that the oligonucleotide-based reading module is an oligoribonucleotide-based reading module.

17. RNA oligonucleotide library, according to claims 1 and 2, characterized in that the library comprises 421 to 423 non-identical members.

18. RNA oligonucleotide library,According to claim 2, characterized in that the pre-selected ligand binding site comprises a binding site for a compound selected from the group consisting of an amino acid, a peptide, a nucleobase, a nucleoside, a nucleotide, a metal ion, a neurotransmitter, a hormone, an active pharmaceutical ingredient, and derivatives thereof.

19. RNA oligonucleotide library, according to claim 18, characterized in that the pre-selected ligand binding site comprises a binding site for a ligand selected from the group consisting of an amino acid, a nucleobase, a nucleoside, a nucleotide, a neurotransmitter, a hormone, and derivatives thereof.

20. RNA oligonucleotide library, according to claim 19, characterized in that the pre-selected ligand binding site comprises a binding site for a ligand selected from the group consisting of a nucleotide,A neurotransmitter, a hormone, and derivatives thereof. Petition 870260051375, dated 05 / 28 / 2026, pp. 19 / 21 6 / 7 21. RNA oligonucleotide library, according to claim 2, characterized in that the pre-selected ligand binding site comprises a binding site for at least one ligand selected from the group consisting of 5-hydroxy-L-tryptophan, L-tryptophan, serotonin, and 5-hydroxy-L-tryptophan-methylamide.

22. RNA oligonucleotide library, according to claim 21, characterized in that the ligand is at least one of 5-hydroxy-L-tryptophan or serotonin.

23. METHOD FOR SELECTING A PLURALITY OF NON-IDENTICAL LIGAND-BINDING OLIGONUCLEOTIDES, characterized in that it comprises the steps of: 1) contacting an RNA oligonucleotide library comprising a plurality of RNA oligonucleotides with a ligand under suitable conditions for ligand binding,wherein the individual RNA oligonucleotides comprise a structural scaffold comprising: a) a first sequence comprising a helix domain; b) a second sequence comprising a first hairpin domain; c) a third sequence comprising a second hairpin domain; d) an oligonucleotide junction, wherein the oligonucleotide junction is a three-way junction; wherein the oligonucleotide junction comprises (i) a sequence linking the helix domain, first hairpin domain and second hairpin domain; wherein the individual oligonucleotides comprise a sequence with a series of linked sequences in accordance with Petition 870260051375, dated 28 / 05 / 2026, page 20 / 21 7 / 7 Formula I: (I) P1-J1 / 2-P2-L2-P2'-J2 / 3-P3-L3-P3'-J3 / 1-P1' where - represents a linkage; P1 and P1' form the helix; P2, L2, and P2' form the first hairpin; P3, L3, and P3' form the second hairpin; and J1 / 2, J2 / 3, and J3 / 1 together form the oligonucleotide junction.and wherein the scaffold is derived from the aptamer domain of a guanine ribosome xpt-pbuX sequence from Bacillus subtilis, from the aptamer domain of a cyclic di-GMP ribosome Vc2 sequence from Vibrio cholerae, or from a hammerhead ribozyme sequence from Schistosoma mansoni, and, 2) Partitioning the RNA oligonucleotide library into a spatially addressable one, such that a plurality of non-identical ligand-binding RNA oligonucleotides is selected, wherein the RNA oligonucleotides having the oligonucleotide splicing further comprise a ligand-binding domain and wherein the ligand-binding domains of the oligonucleotide library comprise variable nucleotide residues.

24. Method according to claim 23, characterized in that the method further comprises a step 1a) between step 1) and step 2), step 1a) comprising competitively partitioning the RNA oligonucleotide library with a ligand-free solution. Petition 870260051375, dated 05 / 28 / 2026, p. 21 / 21

Images