Method for detecting a false-positive diagnosis of chromosomes aneuploidia in a fetuus

Abstract

This disclosure provides methods for non-invasive prenatal screening (NIPS) of fetal aneuploidies. These methods are based on the analysis of cell-free fetal DNA (CFF DNA) found in the circulation of a pregnant woman using next-generation sequencing (NGS) technology. Specifically, these methods analyze the relative abundance of different fetal genomic fragments present in the maternal sample, where the fragments can be aligned with particular chromosomal locations in the fetal genome. Relative abundance information is indicative of whether a particular chromosome is over-represented or under-represented in a fetal genome when compared to normal individuals, and thus can be used to detect fetal aneuploidy. Additionally, methods for increasing the positive predictive values ​​(PPV) of NIPS by excluding false-positive detections are also provided.

Description

57 METHOD FOR DETECTING FALSE-POSITIVE DIAGNOSIS OF CHROMOSOMAL ANEUPLOIDY IN A FETUS CROSS-REFERENCE TO RELATED ORDERS

[001] This application claims the benefit and priority of the Application US Provisional No. 62 / 445,196, filed on January 11, 2017, the disclosure of which is incorporated herein by reference in its entirety. TECHNICAL FIELD

[002] This disclosure provides methods for non-invasive prenatal screening (NIPS) of fetal aneuploidies. These methods are based on the analysis of cell-free fetal DNA (cff DNA) found in the circulation of a pregnant woman using next-generation sequencing (NGS) technology. In particular, these methods analyze the relative abundance of different fetal genomic fragments present in the maternal sample, which fragments may be aligned with particular chromosomal locations in the fetal genome. Relative abundance information is an indicator of whether a particular chromosome is overrepresented or underrepresented in a fetal genome compared to normal individuals, and thus can be used to detect fetal aneuploidy. Additionally, methods for increasing the positive predictive values ​​(PPV) of NIPS by excluding false-positive detections are also provided. FUNDAMENTALS

[003] The present invention generally relates to the field of non-invasive prenatal screening (NIPS), particularly NIPS using cell-free fetal DNA (cff DNA) found in maternal plasma. Due to biological and technical problems, present NIPS methods can produce false-negative results, inducing a physician to prescribe another diagnostic test through invasive procedures, such as amniocentesis or chorionic villus sampling (CVS), which Petition 870250110099, dated 12 / 01 / 2025, p. 17 / 140 / 57, implies a risk of procedure-related abortion and other complications. Instead of undergoing such procedures, a significant number of women terminated their pregnancies based on a high-risk NIPS report of fetal aneuploidy without further testing. Thus, there is a need in the field for the development of new NIPS methods, particularly those with improved positive predictive values. SUMMARY OF THE INVENTION

[004] In one aspect, methods are provided here for detecting false-positive diagnosis of chromosomal aneuploidy in a fetus by non-invasive prenatal screening (NIPS). The methods comprise (a) dividing a chromosome of interest diagnosed as aneuploid into a plurality of bins, each bin having a chromosomal location; (b) obtaining a bin-specific test parameter for each bin; (c) plotting the bin-specific test parameters versus the corresponding bin chromosomal locations to produce an ideogram of the chromosome of interest; and (d) detecting the false-positive diagnosis when the ideogram displays matching bin-specific test parameters across less than a substantial portion of the chromosome of interest. In some embodiments, the chromosome of interest is one or more chromosomes of the species under examination.

[005] In some embodiments, the detection step (d) is performed by false-positive diagnostic detection when the ideogram exhibits a large-scale increase in the bin-specific test parameter in at least one bin compared to the remaining bins. In particular, in some embodiments, the large-scale increase is at least 1.2 times, at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 5.5 times, at least 6 times, at least 6.5 times or Petition 870250110099, dated 01 / 12 / 2025, p. 18 / 140 / 57 at least 7 times.

[006] In some embodiments, the methods also comprise repeating steps (a) to (d) for a confirmation chromosome that is not the chromosome of interest. In particular, in some embodiments, the confirmation chromosome is one or more chromosomes of the species under examination.

[007] In some embodiments, the substantial portion of the chromosome of interest represents more than about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the chromosome of interest.

[008] In some embodiments, the bin-specific parameter is reflective of the relative abundance of genetic material corresponding to the bin in a maternal test sample. In particular, in some embodiments, obtaining the bin-specific test parameter involves sequencing cell-free DNA from a maternal test sample from a pregnant woman carrying the fetus to provide sequence reads. In some embodiments, obtaining the bin-specific test parameter involves aligning sequence reads to one or more bins of a reference genome comprising the chromosome of interest. In some embodiments, obtaining the bin-specific test parameter involves calculating the bin-specific test parameter based on a total number of sequence reads aligned for each bin. In some embodiments, the bin-specific test parameter is a normalized bin read count.In some modes, the specific bin test parameter is produced by NIPS.

[009] In some embodiments, the present methods improve a positive predictive value (PPV) of NIPS to at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% for human trisomy 21, human trisomy 18, and / or human trisomy 13. In particular, in some embodiments, the PPV is improved to at least 93% for human trisomy 21, at least 72% for human trisomy 18, and / or by Petition 870250110099, dated 01 / 12 / 2025, page 19 / 140 / 57 less 39% for human trisomy 13. In some modalities, the PPV for trisomy 21 is improved to 98% for human trisomy 21, 92% for human trisomy 18 and / or 69% for human trisomy 13.

[0010] In some embodiments, the present methods improve a positive predictive value (PPV) of NIPS by at least 4%, 10%, 20%, 30%, 40%, and 50% for human trisomy 21, human trisomy 18, and / or human trisomy 13. In particular, in some embodiments, the PPV is improved by at least 4% for human trisomy 21, at least 20% for human trisomy 18, and / or at least 30% for human trisomy 13.

[0011] In another aspect, methods are provided here for detecting false-positive diagnosis of chromosomal aneuploidy in a fetus by non-invasive prenatal screening (NIPS). In particular, the methods comprise (a) dividing a reference chromosome into a plurality of bins, each bin having a chromosomal location; (b) obtaining a bin-specific parameter for each bin; (c) calculating a first sum of bin-specific test parameters for corresponding bins residing on a confirmation chromosome; wherein the confirmation chromosome is different from a chromosome of interest diagnosed as aneuploid; (d) calculating a second sum of bin-specific test parameters for corresponding bins residing on one or more autosomes; (e) calculating a chromosome representation value for the confirmation chromosome by dividing the first sum by the second sum;(f) compare the chromosome representation value to a set of references to generate a chromosome-specific comparison result; (g) detect a false-positive diagnosis when the chromosome-specific comparison result reaches a predetermined threshold. In some embodiments, the confirmation chromosome is one or more chromosomes in the reference genome.

[0012] In some modes, obtaining a specific parameter of Petition 870250110099, dated 01 / 12 / 2025, page 20 / 140 / 57 bin for each bin is performed by sequencing cell-free DNA from a maternal test sample from a pregnant woman carrying the fetus to provide sequence reads; where the fetus has been diagnosed as aneuploid of a chromosome of interest; aligning the sequence reads to one or more bins of the reference genome; and calculating the bin-specific test parameter based on a total number of sequence reads aligned for each bin. In some embodiments, the bin-specific test parameter is a normalized bin read count.

[0013] In some embodiments, the reference set comprises a plurality of chromosome representation values ​​for the confirmation chromosome obtained from a random sample of unaffected pregnancies.

[0014] In some embodiments, step (f) is performed by calculating a Z count of the said test representation value of the chromosome with respect to the reference set. In some embodiments, the threshold is reached when the Z count is greater than 4 or greater than 8.

[0015] Furthermore, in any of the above embodiments, fetal aneuploidy may be a complete or partial chromosome duplication or a chromosomal trisomy, such as trisomy 13, trisomy 18, or trisomy 21 of the human genome. The reference genome may be a human reference genome, and the fetus may be an aneuploid mosaic individual. Additionally, in any of the above embodiments, the method may also comprise first evaluating a cell-free fetal DNA fraction in the maternal test sample before performing step (a). In some embodiments, the maternal test sample is excluded when the fetal fraction is less than 4%. BRIEF DESCRIPTION OF THE FIGURES

[0016] FIG. 1 shows the Z counts from the present NIPS trial for trisomies 21, 18, and 13 before (Raw Data) and after correction by Petition 870250110099, dated 01 / 12 / 2025, page 21 / 140 / 57 GC content (normalized GC) and statistical smoothing using a patented software algorithm (Research Report). As shown in the figure, the assay provided complete discrimination between affected and unaffected pregnancies for trisomy 21, even without adjustments. GC correction and statistical smoothing eliminated substantial overlap between affected and unaffected pregnancies for trisomies 18 and 13, and improved separation for trisomy 21.

[0017] FIG. 2 shows an ideogram for chromosome 21 formed using a prenatal sample positive for trisomy 21. Each point represents a normalized count for a particular bin on a particular chromosome; a euploid value on the Y-axis is 1.0. As shown in the figure, the entire chromosome 21 demonstrated duplicated material. The Z-count for this sample was 36.96.

[0018] FIG. 3 shows an ideogram for chromosome 21 of a patient with a maternal microduplication.

[0019] FIG. 4 shows the microarray data for the maternal DNA for the patient in FIG. 3.

[0020] FIG. 5 shows an ideogram for chromosome 18 of a patient with a maternal microduplication.

[0021] FIG. 6 shows the microarray data for the maternal DNA for the patient in FIG. 5.

[0022] FIG. 7 shows an ideogram for chromosome 22 of a patient with a fetal microdeletion in the DiGeorge region. DETAILED DESCRIPTION

[0023] This disclosure provides methods for non-invasive prenatal screening (NIPS) of fetal aneuploidies. These methods are based on the analysis of cell-free fetal DNA (cff DNA) found in the circulation of a pregnant woman using next-generation sequencing (NGS) technology. In particular, these Petition 870250110099, dated 01 / 12 / 2025, page 22 / 140 / 57 methods analyze the relative abundance of different fetal genomic fragments present in the maternal sample, where the fragments can be aligned to particular chromosomal locations in the fetal genome. Relative abundance information is an indicator of whether a particular chromosome is overrepresented or underrepresented in a fetal genome compared to normal individuals, and thus can be used to detect fetal aneuploidy. Additionally, methods to increase the positive predictive values ​​(PPV) of NIPS by excluding false-positive detections are also provided.

[0024] The term “karyotype” is well recognized in the field and refers to an organized profile of an organism’s chromosomes, indicating the number of copies of each chromosome in the genome. Different species of organisms may have different numbers of chromosomes in their genome, and thus, different karyotypes. For example, normal human karyotypes contain 22 pairs of autosomes (autosomes) and one pair of sex chromosomes (allosomes). Normal karyotypes for human females contain two X allosomes; and normal human males have both X and Y allosomes.

[0025] The term “ploidy” refers to the number of sets of chromosomes contained in the genome of a species. Specifically, a haploid species has a single set of chromosomes, each chromosome not being part of a pair. A diploid species has two homologous copies of each chromosome. By extension, a cell can be called haploid or diploid if its nucleus is haploid or diploid, and an organism can be called haploid or diploid if its somatic cells are haploid or diploid. Almost all mammals, including humans, are diploid organisms.

[0026] The terms “aneuploidy” and “aneuploid” are well-recognized terms in the art and refer to the presence of an abnormal number of Petition 870250110099, dated 01 / 12 / 2025, page 23 / 140 / 57 chromosomes in a cell of an organism, which differs from the usual karyotype for that species. For example, because a normal human cell has 46 chromosomes, including 22 pairs of autosomes and 1 pair of sex chromosomes, a human cell having 45 or 47 chromosomes instead of the usual 46 is aneuploid. Aneuploidy can result from an error in the cell division process, where the “daughter” cells formed have the wrong number of chromosomes. In some cases, there is a missing chromosome (monosomy), while in others, an extra one (trisomy). Both monosomy and trisomy are common causes of genetic disorders in humans, including some birth defects and cancers. In humans, in addition to sex chromosome disorders, most cases of aneuploidy result in miscarriage. The most common autosomal trisomy among live births is trisomy of chromosomes 21, 18, or 13.For example, Down syndrome is a genetic disorder caused by the presence of all or part of a third copy of chromosome 21.

[0027] The term “trisomy” refers to a type of aneuploidy in a diploid organism, where there is an extra copy (three copies) of a particular chromosome, instead of the normal two copies in a pair. The term “monosomy” also refers to a form of aneuploidy in a diploid organism, where there is a missing copy (only one copy) of a particular chromosome, instead of the normal two copies in a pair.

[0028] The term “mosaicism” or “mosaic” as used here refers to the presence of two or more cell lineages with different karyotypes in the same individual. For example, in some modalities, a mosaic individual may have some populations of aneuploid somatic cells, while the other cells have the normal karyotype.

[0029] The term “fetal aneuploidy” as used here refers to aneuploidy in a fetus during gestation. Diagnosis of such a disorder can be made through invasive or non-invasive methods. Petition 870250110099, dated 01 / 12 / 2025, p. 24 / 140 / 57

[0030] The terms “non-invasive prenatal testing (NIPT)” and “non-invasive prenatal screening (NIPS)” are used interchangeably herein and refer to testing of maternal samples for fetal aneuploidy, such as selected chromosome trisomies, based on the detection of cell-free fetal DNA presented in a maternal sample, such as a maternal blood sample.

[0031] The term “invasive prenatal examination” as used herein refers to methods for prenatal examination of a fetus by means of a probe or probes placed within the fetal space of a pregnant woman’s body or maternal tissue directly connected to the fetus, such as the uterus, placenta, or umbilical cord. Invasive prenatal examinations considered to be used in connection with this disclosure include, but are not limited to, amniocentesis and chorionic villus sampling.

[0032] The term “chromosome duplication” as used herein refers to the duplication of an entire chromosome or a portion of a chromosome. Depending on the context, the term “complete chromosome duplication” may refer to the duplication of a complete chromosome, and the term “partial chromosome duplication” may refer to the duplication of a portion of a chromosome. For example, in some embodiments, a partial chromosome duplication refers to the existence of duplicated genetic material corresponding to more than 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a particular chromosome in a genome. In other terms, a partial chromosome duplication refers to the duplication of hundreds of kilobase pairs to tens of megabase pairs of genetic material from a particular chromosome in a genome.

[0033] The term “chromosome deletion” as used here refers to the loss of an entire chromosome or a portion of a chromosome. In Petition 870250110099, dated 01 / 12 / 2025, page 25 / 140 / 57 In some modalities, in a case of partial chromosome deletion, the genome may lose more than 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a particular chromosome. In some modalities, partial chromosome deletion refers to the loss of hundreds of kilobase pairs to tens of megabase pairs of genetic material from a particular chromosome in a genome.

[0034] Chromosome duplication or deletion can arise as a product of various types of errors in DNA replication or repair machinery, as well as through the random capture of genetic elements by the chromosome. As used herein, the duplicated or deleted regions of a chromosome may or may not contain any genes.

[0035] “Gene” as used herein refers to a DNA sequence comprising the regulatory and coding sequences necessary for the production of an RNA, which may have a non-coding function (e.g., ribosomal or transfer RNA) or may include a polypeptide or a polypeptide precursor. The RNA or polypeptide may be encoded by a full-length coding sequence or by any portion of the coding sequence so that the desired activity or function is retained. Although a nucleic acid sequence may be shown in the form of a DNA sequence, a person skilled in the art recognizes that the corresponding RNA sequence will have a similar sequence with thymine being replaced by uracil, i.e., “T” is replaced with “U.”

[0036] The term “chromosome variation” as used here refers to the phenomenon that chromosomes vary slightly in composition and size among individuals of a species. For example, copy number variation refers to the observed phenomenon that sections of a species' genome are repeated and the number of repetitions in the genome varies among individuals in the population. Additionally, microduplication and Petition 870250110099, dated 01 / 12 / 2025, page 26 / 140 / 57 microdeletions refer to chromosome variations in which a small amount of genetic material on a chromosome is abnormally copied or deleted in an individual's genome. Furthermore, chromosome duplication or deletion can occur over an extended genomic region. Depending on the context, chromosome variations may or may not produce observable phenotypic abnormalities in individuals. Thus, chromosomes can vary in composition and size among different individuals of a species due to hereditary variations or the introduction of a new chromosome.

[0037] The term “cell-free DNA (cfDNA)” as used herein refers to any free-floating DNA present in a sample, such as the blood plasma of a pregnant patient. Cell-free DNA found in the blood of a pregnant woman may contain DNA originating from both the mother and the fetus. The term “cell-free fetal DNA (cffDNA)” as used herein refers to fetal DNA that circulates freely in the maternal system, such as in the maternal bloodstream. Through various mechanisms, cffDNA can, for example, originate from the trophoblasts that form the placenta. In some cases, fetal DNA may be fragmented and make its way into the maternal bloodstream via the shedding of placental microparticles into the maternal bloodstream. In some cases, cffDNA may first be observed in maternal blood as early as 7 weeks of gestation, and increases in quantity as the pregnancy progresses.Cff DNA can be sampled via venipuncture in the mother and provides the basis for non-invasive prenatal diagnosis and testing.

[0038] The term “fetal fraction (ff)” as used herein refers to the percentage of cell-free DNA found in a test sample from a pregnant woman that originates from the fetus. For example, if 10% of the cell-free DNA found in a maternal blood sample is of fetal origin, the fetal fraction (ff) is determined to be 10%. In some embodiments, the Petition 870250110099, dated 01 / 12 / 2025, p. 27 / 140 / 57 fetal fraction is used as a parameter for sample quality and to determine whether a maternal sample should be included in the analysis. Specifically, in some modalities, when the fetal fraction of a sample is below a predetermined threshold, the maternal sample is excluded. In some modalities, the threshold ranges from approximately 1% to approximately 5%. In some modalities, the threshold is approximately 4%.

[0039] “Next-generation sequencing (NGS)” as used herein refers to any sequencing method that determines the nucleotide sequence of individual nucleic acid molecules (e.g., in single-molecule sequencing) or clonally expanded proxies for individual nucleic acid molecules in a high-throughput parallel manner (e.g., more than 10³, 10⁴, 10⁵ or more molecules are simultaneously sequenced). In one embodiment, the relative abundance of nucleic acid species in the library can be estimated by counting the relative number of occurrences of their cognate sequences in the data generated by the sequencing experiment. Next-generation sequencing methods are known in the art and are described, for example, in Metzker, M. Nature Biotechnology Reviews 11:31-46 (2010).

[0040] As used herein, the term “library” refers to a collection of nucleic acid sequences, for example, a collection of nucleic acids derived from whole genomic fragments, subgenomic fragments, cDNA, cDNA fragments, RNA, RNA fragments, or a combination thereof. In one embodiment, a portion or all of the nucleic acid sequences in the library comprise an adapter sequence. The adapter sequence may be located at one or both ends. The adapter sequence may be useful, for example, for a sequencing method (e.g., an NGS method), for amplification, for reverse transcription, or for cloning into a vector. Petition 870250110099, dated 01 / 12 / 2025, p. 28 / 140 / 57

[0041] The term “sequencing bin” or simply “bin” is well recognized in the field and refers to a chromosome region that has a characteristic DNA sequence known to be unique to that chromosome region. A bin, therefore, has a chromosomal location corresponding to the particular region on a chromosome. In various embodiments, a bin can be 5 kilobase pairs (kbp), 10 kbp, 20 kbp, 30 kbp, 40 kbp, 50 kbp, 70 kbp, 80 kbp, 90 kbp, 100 kbp, 150 kbp, 200 kbp, 300 kbp, 400 kbp, or 500 kbp in length.

[0042] A “sequence read” or simply “read” as used herein refers to the sequence information of a nucleic acid fragment obtained through a sequencing assay, such as a next-generation sequencing (NGS) assay. Thus, if a sequence read aligns with the characteristic sequence of a bin, the sequence read can be unambiguously mapped to the bin and its specific chromosomal location. The term “bin read count” or simply “bin count” refers to the total number of reads mapped to a bin. In some embodiments, a bin read count may be a raw bin read count or a normalized bin read count.

[0043] The term “reference genome” refers to a nucleic acid sequence database, assembled as a representative example of a partial or complete set of species genetic makeup, such as the DNA sequences of particular chromosomes contained in the genome of species. For example, in one embodiment, the human reference genome is maintained and improved by the Genome Reference Consortium (GRC). The GRC continues to improve reference genomes by forming new sequence alignments that contain fewer gaps in the genome. For example, the human reference genome GRCh38 is the twentieth version of the human reference genome. Petition 870250110099, dated 01 / 12 / 2025, p. 29 / 140 / 57 released by the GRC.

[0044] The term “Z-count” refers to a numerical measurement of a relationship between the values ​​in question (the sample value) and the data set to which the data point belongs. Specifically, Z-count measures the difference between the sample value and the centrality of the distribution in terms of the extent of the distribution of the data set. In some embodiments, the centrality of the distribution may be measured as the median or mean value of the data set. In some embodiments, the extent of the distribution may be measured as the standard deviation or mean absolute deviation of the data set. More specifically, in some embodiments, a Z-count indicates how many mean absolute deviations above or below the mean of the sample value there are. Specifically, the Z-count can be calculated by z = (X - μ) / σ, where X represents the sample value; μ represents the mean; and σ represents the mean absolute deviation of the data set.Thus, a z-value equal to zero indicates that the sample value is identical to the mean. A positive z-value indicates that the sample value is greater than the mean, and a negative z-value indicates that the sample value is less than the mean.

[0045] The term “ideogram” as used herein refers to a schematic representation of one or more chromosomes. An ideogram may show, among other things, the relative sizes of chromosomes and their banding patterns, which may appear when a tightly coiled chromosome region is stained and viewed under a microscope. As used herein, an ideogram may also show the mapping of characteristic DNA sequences, including but not limited to known genetic sequences, marker sequences, bin sequences, to a particular chromosomal location. In some embodiments, the mapping of a characteristic DNA sequence to a chromosomal location is associated with a value assigned to that chromosomal location. In Petition 870250110099, dated 01 / 12 / 2025, page 30 / 140 / 57 in some modalities, such value may be a bin read count or a Z count.

[0046] The “positive predictive value (PPV)” of a test for a disorder is proportional to the specificity of the test and the prevalence of the disorder in the population. For example, a test with 100% sensitivity and 99% specificity (false positive rate of 1%) for a disorder with a prevalence of 1:100 (1%) will not have a PPV of only 50%, since for every 100 tests there will be approximately 1 true positive result and 1 false positive result. In some modalities, the prevalence of trisomy 21 is determined to be 1:185, trisomy 18 is 1:470, and trisomy 13 is 1:1500.

[0047] Some invasive procedures for detecting fetal aneuploidies carry a risk of procedure-related miscarriage and other complications. See, for example, Tabor et al. “Update on procedure-related risks for prenatal diagnostic techniques.” Fetal Diagn Ther. 2010;27: 1-7 and Benn et al. “Position statement of the Aneuploidy Screening Committee on behalf of the Council of the International Society for Prenatal Diagnosis.” Prenat Diagn. 2013; 33: 622-629.

[0048] Therefore, in one aspect of the present disclosure, methods are provided for noninvasive prenatal screening using cell-free fetal DNA contained in a maternal test sample. For noninvasive prenatal testing, the maternal test sample can be retained from a pregnant woman without physically invading the fetal-containing space of the body or any maternal tissue directly connected to the fetus. Exemplary forms of a maternal test sample include whole blood samples, plasma samples, tissue samples, urine samples, saliva samples, hair samples, stool samples, and other types of biological samples that can be noninvasively collected from the pregnant woman.

[0049] In particular, the maternal test sample also contains Petition 870250110099, dated 01 / 12 / 2025, p. 31 / 140 / 57 a sufficient quantity of cell-free fetal DNA such that fetal genome information can be analyzed according to the methods provided herein. In some embodiments, the maternal test sample may also contain cell-free DNA originating from the maternal genome. For example, circulating cell-free DNA in the plasma of a pregnant woman may be a mixture of fetal DNA from the placenta and maternal DNA. In some embodiments, cell-free fetal DNA is present in a broad background of DNA of maternal origin. Thus, changes in the amount of genetic material attributable to the fetal genome may be diluted through maternal contributions. Therefore, in some embodiments, the maternal test sample is evaluated for the fetal fraction of cell-free DNA. Preferably, the fetal fraction is sufficient such that the genetic composition of the fetal genome can be analyzed according to the methods provided herein.

[0050] In some embodiments, the fetal fraction of cell-free DNA contained in a maternal sample is measured. Samples having a fetal fraction below a certain threshold may be excluded from analysis. In some embodiments, maternal test samples with less than about 1% fetal fraction are excluded. In some embodiments, maternal test samples with less than about 2% fetal fraction are excluded. In some embodiments, maternal test samples with less than about 3% fetal fraction are excluded. In some embodiments, maternal test samples with less than about 4% fetal fraction are excluded. In some embodiments, maternal test samples with less than about 5% fetal fraction are excluded.

[0051] Several methods can be used to quantify cell-free fetal DNA and to establish the fetal fraction of a sample. For example, in some embodiments, for male pregnancies, the presence of specific sequences for the Y chromosome, such as SRY, can be quantified to establish the fetal fraction of cell-free DNA in a Petition 870250110099, dated 01 / 12 / 2025, p. 32 / 140 17 / 57 maternal sample. In other modalities, for male or female pregnancies, paternally inherited fetal single nucleotide polymorphism (SNP) alleles can be quantified to establish the fetal fraction. In other modalities, for male or female pregnancies, different methylation characteristics of fetal DNA and maternal DNA can be distinguished and respectively quantified to establish the fetal fraction. In several modalities, DNA quantification techniques such as real-time polymerase chain reaction (RT-PCR) can be used.

[0052] In some modalities, establishing the fetal fraction can be based on next-generation sequencing (NGS) data. Specifically, in some modalities, the total cell-free DNA in a maternal test sample is sequenced using next-generation sequencing technology to generate a plurality of DNA sequence reads. Then, the sequence reads are aligned to the various bins residing on one or more chromosomes of a reference genome.

[0053] In some modalities, for male pregnancies, the fetal fraction can be calculated as: 2x(l - N23 / ÃT) where N23 / N is the average bin read count for the X chromosome normalized to the average bin read count for all autosomes.

[0054] In some modalities, the male fetal fraction is estimated based on the underrepresentation of the X chromosome in the sample. Particularly, in some modalities, NGS data are processed by the published Non-invasive Reliable Prenatal Diagnostic R package (RAPIDR). In other modalities, X chromosome underrepresentation is estimated using a non-pregnant female as the two X chromosome copy references, a male as the single X chromosome copy reference, or gestational samples of Petition 870250110099, dated 01 / 12 / 2025, page 33 / 140 / 57 fetal fractions known as standard controls.

[0055] In some embodiments, the fetal male fraction is estimated based on the overrepresentation of the Y chromosome in a sample. In particular, in some embodiments, the overrepresentation of the Y chromosome is estimated using a non-pregnant female as the reference for the absence of the Y chromosome (0% Y), a male as the reference for the presence of the Y chromosome (100% Y), and known gestational samples of fetal fractions as standard controls.

[0056] In some embodiments, for female pregnancies, the fetal fraction is estimated using a regularized regression model. For example, in some embodiments, male fetal fractions are estimated for a training set of multiple male pregnancies. The estimated male fetal fractions are used for the model fetal fraction as a function of the sample bin counts normalized by the total sample read count before GC-bias correction. The model is then used to estimate the fetal fraction for female pregnancies. In some embodiments, bins residing on chromosomes 13, 18, 21, X, or Y are excluded from the modeling process. In some embodiments, the model is a regularized linear regression model. Particularly, in some embodiments, the model is a Regularized Generalized Linear Lasso and Elastic Network (GLMNET) model.In some embodiments, tenfold cross-validation using an alpha parameter of 1 is used to select the lambda parameter having the minimum cross-validation error for use in forming the final model.

[0057] Furthermore, in some modalities, the fetal fraction estimate is based on more than one of the methods described above. For example, in some modalities, the fetal fraction estimates given by two or more different methods are averaged to produce the Petition 870250110099, dated 01 / 12 / 2025, p. 34 / 140 / 57 final estimate of the fetal fraction in a sample.

[0058] In some modalities, cell-free DNA contained in a maternal sample is analyzed for the detection of fetal aneuploidy. Particularly, in some modalities, the maternal test sample is collected non-invasively from a pregnant woman. In some modalities, the pregnant woman has been previously determined to be at high risk of producing aneuploid offspring. In some modalities, the pregnancy has been previously determined to be at high risk of being aneuploid. In some modalities, individuals or pregnancies judged to be at high risk include women aged 35 years or older with ultrasound findings suggesting an increased risk of fetal aneuploidy, having a previous pregnancy affected by balanced parental aneuploidy or Robertsonian translocation associated with trisomy 21, 13, and those screened as positive for high risk of aneuploidy through conventional first- or second-trimester screening tests.In some modalities, the present methods are used to detect fetal aneuploidy in singleton or twin pregnancies.

[0059] In particular, in some embodiments, cell-free DNA from a maternal test sample obtained from a pregnant woman is sequenced using next-generation sequencing techniques. In particular, in some embodiments, massively parallel shotgun (genome-wide) sequencing (s-MPS) is used. In some embodiments, s-MPS relies on the identification and counting of large numbers of DNA fragments in maternal samples. MPS is used to simultaneously sequence millions of genome-wide fetal and maternal fragments, and the informative sequences are mapped to discrete locations on all chromosomes. Thus, for example, if fetal trisomy is present, there will be a relative excess of counts for a given chromosome and a deficit for monosomy. Petition 870250110099, dated 01 / 12 / 2025, page 35 / 140 / 57

[0060] In some embodiments, nucleic acid fragments contained in the maternal test sample are sequenced to produce a plurality of sequence reads. In some embodiments, the plurality of sequence reads is aligned to one or more bins of a reference genome, each bin residing on a chromosome of the reference genome and having a chromosomal location. A raw bin read count is calculated for each bin by counting the total number of sequence reads mapped to the bin.

[0061] In some embodiments, the raw bin read count is normalized to remove artifacts such as individual sample variations, GC sequencing biases, and other artifacts due to high-order chromosome structures, etc. In several embodiments, a normalized bin read count can be obtained by processing a corresponding raw bin read count through one or more normalization steps as described below.

[0062] In particular, in some embodiments, a raw bin read count can be adjusted by dividing the raw bin read count by the sum of the autosomal bin read counts of the sample. In some embodiments, the adjusted bin read count is further corrected by subtracting sequencing biases caused by variant GC content across the genome, and the result is centered in the middle of the adjusted autosomal bin read count. In some embodiments, the corrected bin read count is further adjusted by multiplying the total number of bins in the assay.

[0063] In some embodiments, samples from a reference population of presumably unaffected pregnancies are also obtained and analyzed. In particular, for each reference sample, crude bin counts are obtained and processed as described above. Thus, the Petition 870250110099, dated 01 / 12 / 2025, page 36 / 140 / 57 reference population provides a set of reference bin read counts for each bin that is analyzed for the sample in question. In some embodiments, an average value is calculated based on the set of reference bin read counts for each bin.

[0064] In some embodiments, the bin read count of the sample in question is also adjusted (divided) by the average reference bin read count of the corresponding bin. The result is centered around 1 and also corrected by subtracting the average of the autosomal bin read counts of the sample.

[0065] In some embodiments, higher-order artifacts are corrected as defined by a regression of the sample normalized bin read count versus the first ten principal components among the normalized bin read count determined from a reference population of the presumably unaffected samples.

[0066] In some embodiments, a bin-specific test parameter is calculated for each bin based on the total number of sequence reads aligned to the bin. In some embodiments, the bin-specific test parameter is the raw bin read count. In other embodiments, the bin-specific test parameter is a normalized bin read count that is generated by processing the raw bin read count through one or more of the normalization steps described above.

[0067] In some embodiments, the relative abundance of genetic material originating from individual fetal chromosomes in the sample is determined by detecting fetal aneuploidy. Specifically, in some embodiments, the representation of one or more chromosomes of interest in a sample is calculated. The level of representation of individual chromosomes reflects the relative abundance of individual chromosomes present in the fetal genome sample. Specifically, in some embodiments, the representation of a particular chromosome... Petition 870250110099, dated 01 / 12 / 2025, page 37 / 140 / 57 of interest chrRepi can be calculated as chrTotalRCi chrRepi = —-----— --—— Σ j=i„, 2 2 Γ otalRCj where chrTotalRCi indicates the sum of the bin-specific parameter of the bins residing on a chromosome of interest, and ^=1...22 chrTotalRCi indicates the sum of the bin-specific parameter of the bins residing on all autosomes of the reference genome.

[0068] In some embodiments, to determine whether a particular chromosome of interest is overrepresented or underrepresented in a sample, the chromosome representation value of the sample is compared to a reference indicator of normal representation. Specifically, in some embodiments, the representation of the chromosome of interest is determined for samples collected from a reference population of presumably unaffected pregnancies. The chromosome representation value of the sample in question is then compared to the set of chromosome representation values ​​determined from the reference population. Specifically, in some embodiments, a chromosome-specific Z-count indicative of the relationship between the sample chromosome representation and the fit of the reference chromosome representation values ​​is calculated as: Z = (x - μ) / σ where X is the sample chromosome representation; μ is the mean value of the set of reference chromosome representations; and σ is the mean absolute deviation (MAD) of the set of reference chromosome representations.

[0069] The Z-score indicates how many standard deviations above or below the mean of the sample value there are. Therefore, in some embodiments, a Z-score equal to or close to 0 indicates that the sample chromosome presentation of the chromosome of interest is Petition 870250110099, dated 01 / 12 / 2025, page 38 / 140 / 57 identical or very similar to the average chromosome representation in unaffected pregnancies; a Z-count significantly greater than zero indicates that the chromosome of interest is overrepresented in the sample compared to unaffected pregnancies; and a Z-count significantly less than zero indicates that the chromosome of interest is underrepresented in the sample compared to unaffected pregnancies. Particularly, in some modalities, a Z-count > 4 indicates an overrepresentation of chromosomes. In some modalities, a Z-count > 4 indicates a high risk of fetal chromosomal trisomy. In some modalities, a Z-count > 3 but < 8 suggests that other diagnostic tests for fetal aneuploidy are recommended for the pregnant patient, such as invasive prenatal diagnostic tests. In some modalities, a Z count > 8 indicates overrepresentation of the chromosome.In some modalities, a Z-score >8 indicates a high risk of fetal chromosomal trisomy. In some modalities, a Z-score >8 suggests that other diagnostic tests for fetal aneuploidy are recommended for the pregnant patient, such as invasive prenatal diagnostic tests.

[0070] Cell-free DNA in a maternal test sample may contain a mixture of maternal and fetal DNA. Because surviving aneuploid individuals typically have obvious phenotypic abnormalities, in some embodiments, phenotypically normal pregnant women are presumed to be euploid. Thus, the abnormalities in chromosome representation as suggested by the present data can reasonably be attributed to abnormalities in the fetal genome.

[0071] Therefore, in some modalities, the Z count is used as an indicative parameter to detect aneuploidy in the fetal genome. In several modalities, the abnormality may be chromosomal trisomy or monosomy, or a partial chromosome duplication or deletion. In Petition 870250110099, dated 01 / 12 / 2025, p. 39 / 140 / 57 In some forms, the fetus may have chromosomal mosaicism. In some forms, the fetal genome may have one or more chromosomal translocations.

[0072] In particular, in some modalities, a Z-score > 4 indicates the presence of some type of genetic abnormality in the fetal genome. In some modalities, a Z-score > 4 indicates a high risk of fetal chromosomal trisomy. In some modalities, a Z-score > 3 but < 8 suggests that other diagnostic tests for fetal aneuploidy are recommended for the pregnant patient, such as invasive prenatal diagnostic tests. In some modalities, a Z-score > 8 indicates the presence of some type of aneuploidy in the fetal genome. In some modalities, a Z-score > 8 indicates a high risk of fetal chromosomal trisomy. In some modalities, a Z-score > 8 suggests that other diagnostic tests for fetal aneuploidy are recommended for the pregnant patient, such as invasive prenatal diagnostic tests.

[0073] Thus, it can be appreciated that the present methods provide an effective option for detecting fetal aneuploidies, such as trisomy or monosomy, in high-risk pregnancies. In particular, fetal aneuploidies that can be detected with the present methods include, but are not limited to, human trisomy 13, trisomy 18, trisomy 21, and sex chromosome abnormalities.

[0074] In particular, in some modalities, the present NIPS methods provide improved positive predictive values ​​(PPVs) compared to traditional methods, such as maternal serum screening or nuchal translucency testing. More specifically, in several modalities, the PPV of the present method can be at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% for trisomy 21, trisomy 18, and / or trisomy 13. In particular, in some modalities, Petition 870250110099, dated 01 / 12 / 2025, p. 40 / 140 / 57 the PPV of the present method is at least 94% for trisomy 21, at least 72% for trisomy 18 and at least 39% for trisomy 13.

[0075] In some modalities, the present method of NIPS methods also takes into consideration that chromosomes can vary in composition and size from person to person due to the presence of relatively minor variations in the individual's genome. These minor variations may or may not produce any observable phenotype in a pregnant woman, but can affect the diagnosis of fetal aneuploidy through a non-invasive method.

[0076] Therefore, in one aspect, the present methods also provide a mechanism for distinguishing fetal aneuploidies from maternal chromosome variations, such as variations in maternal copy number, microduplications, or microdeletions. Some maternal chromosome variations may be global, affecting multiple or all chromosomes in the maternal genome. Alternatively, some maternal chromosome variations may be local and relate to a particular chromosome in the maternal genome.

[0077] In particular, maternal global copy number abnormalities can affect multiple chromosomes at the same time, while cases of a fetus having multiple chromosomal aneuploidies tend to be rare. Therefore, in some embodiments, the present methods provide a mechanism that serves to examine the karyotype of the fetal genome by examining multiple or all chromosomes in the fetal genome. In particular, in some embodiments, the chromosome representation value is obtained for one or more chromosomes in a sample, and is compared to corresponding reference values, such as the expected normal values ​​as estimated from presumably unaffected pregnancies. In some embodiments, a chromosome-specific Z count is calculated for one or more chromosomes. In particular, in Petition 870250110099, dated 01 / 12 / 2025, page 41 / 140 / 57 In some embodiments, the one or more chromosomes under examination by the present methods include at least one chromosome other than a chromosome of interest that has been previously diagnosed as being affected by aneuploidy. In some embodiments, the one or more chromosomes under examination include all chromosomes in the fetal genome.

[0078] In some embodiments, the present methods can recognize maternal contribution and exclude a false-positive detection when the data suggest that multiple fetal chromosomes, including or in addition to the chromosome of interest, are simultaneously affected by aneuploidy. In particular, in some embodiments, a chromosome-specific Z count is calculated for each of the multiple chromosomes. In particular, in some embodiments, the present methods exclude a false-positive detection when multiple chromosome-specific Z counts are above 4 in a sample. In particular, in some embodiments, the present methods exclude a false-positive detection when multiple chromosome-specific Z counts are not less than 8 in a sample.

[0079] Some variations in the maternal chromosome, such as microduplications or microdeletions, affect only up to a limited region of a chromosome, while fetal aneuploidies generally affect an entire chromosome or a substantial portion thereof. Thus, additionally or alternatively, in some embodiments, the present methods provide a mechanism that serves to distinguish fetal aneuploidies from maternal contribution by precisely identifying the source of the genetic variations observed for a discrete chromosome region or regions.

[0080] In particular, in some embodiments, the present methods can detect aneuploidy of a chromosome of interest when an observed genetic variation is consistent throughout the entire chromosome or a substantial portion thereof. Additionally or alternatively, in other Petition 870250110099, dated 01 / 12 / 2025, p. 42 / 140 / 57 modalities, the present methods can exclude a false-positive detection of aneuploidy of a chromosome of interest, when the observed genetic variation originates only from one or more regions that represent less than a substantial portion of the chromosome of interest.

[0081] In particular, in some embodiments, the present methods analyze whether the bin-specific test parameters of the bins residing on the chromosome of interest are consistent across the entire chromosome or a substantial portion of the chromosome. In some embodiments, an ideogram for the chromosome of interest is generated by plotting the set of bin-specific test parameters versus the chromosomal location of the corresponding bins. In some embodiments, the present methods detect aneuploidy of a chromosome of interest if the ideogram presents compatible bin-specific test parameters across the entire chromosome of interest or a substantial portion thereof.

[0082] In some embodiments, a bin-specific test parameter is calculated for each bin based on the total number of sequence reads aligned to the bin. In some embodiments, the bin-specific test parameter is a normalized bin read count obtained by processing a corresponding raw bin read count through one or more normalization steps as described above.

[0083] In some embodiments, the substantial portion of the chromosome of interest represents more than about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a chromosome of interest. In some embodiments, consistency indicates that the difference, if any, between the bin-specific sets of test parameters is statistically insignificant. In other embodiments, consistency indicates that any difference between the bin-specific sets of test parameters is statistically insignificant. Petition 870250110099, dated 01 / 12 / 2025, page 43 / 140 / 57 bin is less than 5%, 10%, or 20%. In other embodiments, whether a set of bin-specific test parameters is consistent is determined as follows: (a) define a residual as the difference between a bin-specific test parameter for a particular bin and the mean or median of all bin-specific test parameters for a chromosome of interest; and (b) calculate a standard deviation of such residuals. Particularly, in some embodiments, if a standard deviation of such residuals is less than 0.15, then the set of bin-specific test parameters is determined to be consistent. In some embodiments, if all residuals are within 1, 2, or 3 times the standard deviation, the set of bin-specific test parameters is determined to be consistent.In some modalities, if all residuals are within ±0.15, ±0.3, or ±0.45 units away from the mean or median, the set of bin-specific test parameters is determined to be consistent.

[0084] In some modalities, maternal microduplication or microdeletion is detected when the ideogram exhibits a large-scale difference in the bin-specific test parameter in a small chromosome region as compared to the remaining chromosome regions. Particularly, in some modalities, the large-scale difference means at least 1.2 times, at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 5.5 times, at least 6 times, at least 6.5 times, or at least 7 times increase or decrease in the bin-specific test parameters of some regions compared to that of other regions.

[0085] In some embodiments, a large-scale difference is defined as follows: (a) define a residual as the difference between a bin-specific test parameter for a particular bin and the mean or median of all bin-specific test parameters for the Petition 870250110099, dated 01 / 12 / 2025, page 44 / 140 / 57 chromosome of interest; and (b) calculate a standard deviation of such residuals. In particular, in some embodiments, a residual greater than 1, 2, or 3 times the standard deviation is defined as a large-scale difference. In some embodiments, a residual more than ±0.15, ±0.3, or ±0.45 units away from the mean or median is defined as a large-scale difference. In some embodiments, maternal contribution is detected when the ideogram exhibits a large-scale difference of the bin-specific test parameter in at least one bin of the chromosome.

[0086] In some modalities, fetal aneuploidy is confirmed when the ideogram exhibits a small-scale increase in bin-specific test parameters compared to the normal value. Particularly, in some modalities, the normal value is estimated based on a random set of unaffected pregnancies. Specifically, in some modalities, a small-scale increase means that the bin-specific test parameter is increased by less than 1.5 times, less than 1.4 times, less than 1.3 times, less than 1.2 times, less than 1.15 times, or less than 1.1 times compared to the normal value. Furthermore, in some modalities, the observed small-scale increase is consistent across the entire chromosome of interest, or a substantial portion thereof. In particular, in some modalities, the substantial portion of the chromosome of interest represents more than approximately 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a chromosome of interest.In some embodiments, consistency indicates that the difference, if any, between the bin-specific set of test parameters is statistically insignificant. In other embodiments, consistency indicates that any difference between the bin-specific set of test parameters is less than 5%, 10%, or 20%. In still other embodiments, whether a bin-specific set of test parameters is consistent is determined as follows: (a) define a residual as the difference between one. Petition 870250110099, dated 01 / 12 / 2025, page 45 / 140 / 57 specific bin test parameter for a particular bin and the mean or median of all specific bin test parameters for a chromosome of interest; and (b) calculate a standard deviation of such residuals. In particular, in some embodiments, if a standard deviation of such residuals is less than 0.15, then the set of specific bin test parameters is determined to be consistent. In some embodiments, if all residuals are within 1, 2, or 3 times the standard deviation, the fit of the specific bin test parameters is determined to be consistent. In some embodiments, if all residuals are within ±0.15, ±0.3, or ±0.45 units away from the mean or median, the set of specific bin test parameters is determined to be consistent.

[0087] In one aspect, methods are provided here for improving the positive predictive value of a non-invasive prenatal test. In particular, in some embodiments, a maternal test sample is obtained from a pregnant woman carrying a fetus that has been previously diagnosed as aneuploid for one or more chromosomes of interest. In some embodiments, the cell-free DNA contained in the maternal test sample is sequenced to produce sequence reads. In some embodiments, the sequence reads are aligned to multiple bins residing on one or more chromosomes of a reference genome.

[0088] In some embodiments, a bin-specific test parameter is calculated for each bin based on the total number of sequence reads aligned to the bin. In some embodiments, the bin-specific test parameter is a normalized bin read count obtained by processing a corresponding raw bin read count through one or more normalization steps as described above.

[0089] In some embodiments, a chromosome-specific Z count is calculated for at least one confirmation chromosome that is different from the chromosome of interest. In some embodiments, the Petition 870250110099, dated 01 / 12 / 2025, p. 46 / 140 / 57 The method excludes the previous diagnosis as a false positive when the Z count for at least one confirmation chromosome is greater than 4. In some modalities, the method excludes the previous diagnosis as a false positive when the Z count for at least one confirmation chromosome is not less than 8.

[0090] Additionally or alternatively, in some embodiments, the set of bin-specific test parameters for corresponding bins residing on a chromosome of interest is analyzed to determine whether the set of bin-specific test parameters is consistent across the entire chromosome of interest or a substantial portion thereof. Particularly, in some embodiments, an ideogram for the chromosome of interest is constructed by plotting the set of bin-specific test parameters versus the corresponding bin location on the chromosome. In some embodiments, the present methods exclude the previous diagnosis as false-positive if the ideogram shows that the bin-specific test parameters are not consistent across a substantial portion of the chromosome of interest.

[0091] In particular, in some embodiments, the substantial portion of the chromosome of interest represents more than about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of a chromosome of interest. In some embodiments, consistency indicates that the difference, if any, between the set of bin-specific test parameters is statistically insignificant. In other embodiments, consistency indicates that any difference between the set of bin-specific test parameters is less than 5%, 10%, or 20%.

[0092] In other modalities, whether a set of bin-specific test parameters is consistent is determined as follows: (a) define a residual as the difference between a bin-specific test parameter for a particular bin and the mean or median of all test parameters. Petition 870250110099, dated 01 / 12 / 2025, page 47 / 140 / 57 specific to bin for a chromosome of interest; and (b) calculate a standard deviation of such residuals. In particular, in some embodiments, if a standard deviation of such residuals is less than 0.15, then the set of bin-specific test parameters is determined to be consistent. In some embodiments, if all residuals are within 1, 2, or 3 times the standard deviation, the set of bin-specific test parameters is determined to be consistent. In some embodiments, if all residuals are within ±0.15, ±0.3, or ±0.45 units away from the mean or median, the set of bin-specific test parameters is determined to be consistent.

[0093] Thus, it can now be appreciated that the present disclosure provides methods for excluding a previously diagnosed fetal aneuploidy as a false-positive, thereby improving the positive predictive value (PPV) of the prior test. In particular, in some embodiments, prior testing for fetal aneuploidy can be performed using the methods currently disclosed. In other embodiments, prior testing for fetal aneuploidy may be through other methods currently available in the field or developed in the future. Exemplary methods for detecting fetal aneuploidy that can be used in connection with the present methods include, but are not limited to, ultrasound diagnosis, amniocentesis, and conventional screenings in the first or second trimester using biomarkers contained in maternal serum.In some embodiments, the present method can improve the positive predictive value of a NIPS method by at least 4%, 10%, 20%, 30%, 40%, and 50% for trisomy 21, trisomy 18, and / or trisomy 13. In some embodiments, the present method can improve the positive predictive value of a NIPS method by at least 4% for trisomy 21, and particularly by at least 5% for trisomy 21. In some embodiments, the present method can improve the positive predictive value of a NIPS method by at least... Petition 870250110099, dated 01 / 12 / 2025, page 48 / 140 / 57 20%, and particularly at least 28% for trisomy 18. In some modalities, the present method can improve the positive predictive value of a NIPS method by at least 25%, and particularly at least 30% for trisomy 13.

[0094] In some modalities, next-generation sequencing (NGS) methods are used, including several different modern high-throughput sequencing technologies. In some modalities, sequencing methods capable of generating large numbers of bin counts are preferred, since the cell-free fetal DNA fraction is generally low, and the excess or deficit in specified DNA fragments is low. In some modalities, massively parallel shotgun (s-MPS) sequencing (genome-wide) is used. In some modalities, s-MPS relies on the identification and counting of large numbers of DNA fragments in maternal samples. Particularly, in some modalities, millions of genome-wide fetal and maternal fragments are simultaneously sequenced and the informative sequences are mapped to discrete locations on all chromosomes.Thus, for example, if fetal trisomy is present, there will be a relative excess of counts for a given chromosome and a deficit of monosomy.

[0095] In some modalities, massively parallel high-throughput sequencing utilizes sequencing-by-synthesis with reversible dye terminators. In other modalities, sequencing is performed via ligation-by-sequencing. Still in other modalities, sequencing is single-molecule sequencing. Examples of next-generation sequencing techniques include, but are not limited to, pyrosequencing, reversible dye terminator sequencing, SOLiD sequencing, ion-semiconductor sequencing, single-molecule Helioscope sequencing, etc. Petition 870250110099, dated 01 / 12 / 2025, p. 49 / 140 / 57

[0096] The Ion Torrent® amplicon sequencing system (Life Technologies, Carlsbad, CA) uses a flow-based method that detects pH changes caused by the release of hydrogen ions during the incorporation of unmodified nucleotides in DNA replication. For use with this system, a sequencing library is initially produced by generating DNA fragments flanked by sequencing adapters. In some embodiments, these fragments can be clonally amplified into particles by emulsion PCR. The particles with the amplified template are then placed on a silicon semiconductor sequencing chip. During replication, the chip is flooded with one nucleotide after another, and if a nucleotide complements the DNA molecule in a particular microwell of the chip, then it will be incorporated.A proton is naturally released when a nucleotide is incorporated by polymerase into the DNA molecule, resulting in a detectable local pH change. The pH of the solution then changes at that well and is detected by the ion sensor. If homopolymeric repeats are present in the template sequence, multiple nucleotides will be incorporated into a single circle. This leads to a corresponding number of hydrogens released and a proportionally higher electronic signal.

[0097] The 454™ GS FLX® sequencing system (Roche, Germany) uses a light-based detection methodology in a high-scale parallel pyrosequencing system. Pyrosequencing uses DNA polymerization, adding one nucleotide species at a time and detecting and quantifying the number of nucleotides added to a given location through the light emitted by the release of attached pyrophosphates. For use with the 454® system, adapter-bound DNA fragments are fixed to small DNA capture beads in a water-in-oil emulsion and amplified by PCR. Petition 870250110099, dated 01 / 12 / 2025, page 50 / 140 / 57 (Emulsion PCR). Each DNA-bound bead is placed in a well in a picotitrator plate, and sequencing reagents are released through the wells of the plates. The four DNA nucleotides are added sequentially in a fixed order through the picotitrator plate device during a sequencing operation. During the nucleotide flow, millions of copies of DNA bound to each bead are sequenced in parallel. When a nucleotide complementary to the template strand is added to a well, the nucleotide is incorporated into the existing DNA strain, generating a light signal that is recorded by a CCD camera in the instrument.

[0098] Reversible dye terminator-based sequencing technology: DNA molecules are first ligated to primers on a slide and amplified so that clonal colonies are formed. Four types of reversible terminator bases (RT bases) are added, and unincorporated nucleotides are washed away. Unlike pyrosequencing, DNA can only be extended one nucleotide at a time. A camera captures images of the fluorescence-labeled nucleotides, and then the dye along with the 3' terminal blocker are chemically removed from the DNA, allowing the next cycle.

[0099] Helicos single-molecule sequencing uses DNA fragments with added poly-A tail adapters, which are attached to the surface of the flow cell. In each cycle, DNA polymerase and a single nucleotide species labeled by fluorescence are added, resulting in template-dependent extension of the surface-immobilized template primer duplexes. Reads are performed by the Helioscope sequencer. After image acquisition covering the entire array, chemical cleavage and release of the fluorescent label allow for subsequent cycles of extension and visualization.

[00100] Sequencing by synthesis (SBS), like sequencing Petition 870250110099, dated 01 / 12 / 2025, page 51 / 140 / 57 The “old-style” dye-termination electrophoresis relies on the incorporation of nucleotides by a DNA polymerase to determine the base sequence. A DNA library with attached adapters is denatured into single strands and grafted onto a flow cell, followed by bridging amplification to form a high-density array of dots on a glass chip. Reversible terminator methods use reversible versions of dye-terminators, adding one nucleotide at a time, detecting fluorescence at each position through repeated removal of the blocking group to allow polymerization of another nucleotide. The nucleotide incorporation signal can vary with the nucleotides labeled by fluorescence, phosphate-driven light reactions, and hydrogen ion detection, all of which have been used. Examples of SBS platforms include Illumina GA and HiSeq 2000.The MiSeq® personal sequencing systems (Illumina, Inc.) also utilize sequencing through synthesis with reversible terminator chemistry.

[00101] Unlike sequencing by synthesis, sequencing by ligation uses a DNA ligase to determine the target sequence. This sequencing method relies on the enzymatic ligation of oligonucleotides that are adjacent through local complementarity in a template DNA strand. This technology uses a partition of all possible oligonucleotides of a fixed length, labeled according to the sequenced positions. The oligonucleotides are annealed and ligated, and the preferential ligation by DNA ligase to pair the sequences results in a dinucleotide-coded color space signal at the position (through the release of a fluorescently labeled probe that corresponds to a known nucleotide at a position along the oligo). This method is primarily used by Life Technologies' SOLiD® sequencers. Before sequencing, the DNA is amplified by emulsion PCR. The resulting beds, each one Petition 870250110099, dated 01 / 12 / 2025, page 52 / 140 / 57 containing only copies of the same DNA molecule, are deposited on a solid planar substrate.

[00102] SMRT® sequencing is based on sequencing via the synthesis method. DNA is synthesized in small-well, zero-mode waveguide (ZMW) receptacles with capture tools located at the bottom of the well. Sequencing is performed using unmodified polymerase (attached to the bottom of the ZMW) and fluorescence-labeled nucleotides flowing freely in the solution. The wells are constructed in such a way that only the fluorescence occurring at the bottom of the well is detected. The fluorescent label is detached from the nucleotide upon its incorporation into the DNA strand, leaving an unmodified DNA strain.

[00103] Some sequencing methods produce a result that is biased by the guanine-cytosine (GC) base content variant of the sequence. Therefore, in some embodiments, GC sequencing biases are corrected during data processing. According to the present disclosure, several methods for correcting GC sequencing biases can be used in connection with the present methods. An exemplary procedure is provided in the example section below. A skilled technician would be able to identify other suitable methods readily available in the field or developed in the future. Examples Example 1: Essay Development

[00104] The following sections describe the materials and methods used to perform the present NIPS test. 1. Patient Sample Collection

[00105] In one example, for the development of the assay, verification and validation studies, the applicant obtained samples of Petition 870250110099, dated 12 / 01 / 2025, pp. 53 / 140 / 57 pregnant women from Sequenom (San Diego, CA), Precision Medicine, and volunteers who provided their consent. For singleton pregnancies, the applicants obtained 3,750 samples from Sequenom, 165 from Precision Medicine, and 10 from volunteers; Sequenom also provided samples from 115 twin pregnancies. The Sequenom samples were programmed and discarded and had their identifying information removed before being sent to the Applicants. The Precision Medicine samples were consented to using their protocols. The volunteers provided written informed consent via signed forms approved by the Western Institutional Review Board, which specifically reviewed and approved this study. The study was conducted in accordance with the principles of the Declaration of Helsinki. 2: Next-Generation Sequencing

[00106] In one example, whole blood was collected in two 10 mL cell-free DNA BCT blood collection tubes (Streck, Omaha, NE) and transported at room temperature. The blood tubes were processed within 4 days of collection. Plasma was isolated from each of these samples using a Tecan EVO 200 liquid handler (Tecan, Mannedorf, Switzerland). The Tecan EVO 200 liquid handler performs the following activities: centrifuges the Streck blood tubes at 22 °C for 10 minutes at 2,500 xg, transfers the plasma to a 15 mL conical tube, centrifuges the 15 mL conical tube at 22 °C for 20 minutes at 3,200 xg, transfers the plasma to a final 15 mL conical tube. Cell-free DNA (cfDNA) is then extracted from 4 mL of plasma using DynaMax chemistry (Thermo Fisher Scientific, Waltham, MA), following the manufacturers' recommendations, with the aid of a Kingfisher Flex Purification System (Thermo Fisher Scientific).The DNA sequence (cf) was performed in pre-sequencing libraries using the NEBNext® Ultra® DNA Library Prep Kit for Illumina® (New England BioLabs Inc, Ipswich, MA) following the... Petition 870250110099, dated 01 / 12 / 2025, p. 54 / 140 / 57, manufacturers' recommendations. During PCR, a 10-base-pair barcode is amplified in each sample using the reverse-phase PCR primer; all reactions shared a common advanced primer. The universal advanced primer sequence was: AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACGACGCTCTTCCGATCT; The reverse initiator was: CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXG TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, where X indicates the location of the 10 base barcodes. PCR was performed on a SimpliAmp Thermal Cycler (Thermo Fisher Scientific). PCR conditions were as follows: initial denaturation at 98 °C for 30 seconds, 10 cycles of denaturation at 98 °C for 10 seconds, annealing at 65 °C for 30 seconds and extension at 72 °C for 30 seconds, final extension at 72 °C for 5 minutes, and terminations with a hold at 4 °C. After PCR, the products were purified using Agencourt AMPure XP PCR purification beads (Beckman Coulter, Brea, CA) following the manufacturers' recommendations. The ratio of AMPure beads to PCR product was 1:1. Clean PCR products were quantified using the Quant-It PicoGreen dsNDA Assay Kit (Thermo Fisher Scientific), following the manufacturers' recommendations, and read on an Infinite 200 PRO Microplate Reader (Tecan).The samples were normalized to 2 nM and pooled with 12 samples in each library. The library pools were denatured and further diluted to 15 pM. A 5% PhiX Control (Illumina, San Diego, CA) was boosted at each pool. The pooled libraries were clonally amplified and ligated onto high-throughput flow cells (Illumina) using the Illumina cBot system. Sequencing was performed on a HiSeq2500 system via 36 single-read cycles followed by 10 cycles to sequence an index. A minimum of 9 million reads were required. Petition 870250110099, dated 01 / 12 / 2025, page 55 / 140 40 / 57 bioinformatics processes. The data were transmitted from the HiSeq2500 system to an Isilon server (EMC Isilon, Seattle, WA), where the data analysis route was automatically initiated.

[00107] The applicants used a read length of 36 base pairs in one direction at an average sequencing depth of 0.6X. All quality counts “Q counts” were > 30. 3: Estimates of the Fetal Fraction

[00108] In some modalities, fetal fractions (FF) were calculated based on X chromosome over representation or Y chromosome over representation using the following methods.

[00109] a) The fetal fraction was estimated as 2 x (1 - N23 / N where ^23 / ^ is the average per bin read count for the X chromosome normalized to the average of the bin autosome. b) The applicant used the RAPIDR R package based on the X chromosome under representation to estimate the male FF based on the X chromosome under representation. c) FF was estimated based on the X chromosome under representation with the non-pregnant female as a two-copy X chromosome reference, the non-pregnant male as a single-copy X chromosome reference, and the FF samples known as standard controls. d) FF was estimated based on the Y chromosome under representation with the non-pregnant female as a reference for the absence of the Y chromosome (0% Y), the non-pregnant male as a reference for the presence of the Y chromosome (100% Y), and the FF samples known as standard controls.For a better estimate of male FF, the average value of these four calculations was used as our final male FF, and this average of the four FF correlates very well with a known set of FF samples by scraping the square of R = 0.9752 with y-intercept = 0.

[00110] For female fetuses, the fetal fraction was estimated using a regularized regression model. In summary, a training set Petition 870250110099, dated 01 / 12 / 2025, page 56 / 140 / 57 of 3281 samples of known male fetuses were used for the model fetal fraction (estimated as described above) as a function of the sample bin counts normalized by the total sample read count, but not corrected for GC content. Bins residing on chromosomes 13, 18, 21, X or Y chromosomes were excluded from the modeling process. The model was a regularized linear regression model implemented with the R package “glmnet” (version 1.9-8). A tenfold cross-validation using an alpha parameter of 1 was used to select the lambda parameter having the minimum cross-validation error for use in forming the final model that is subsequently used to estimate the fetal fraction for female fetuses.

[00111] Fetal fractions were calculated for male fetuses using specific sequences for the Y chromosome. For female fetuses, the applicants developed a proprietary bioinformatics method. 4: GC Correction

[00112] Some genomic regions (e.g., chromosomes 13 and 18) are rich in GC relative to others, causing sequencing biases that can distort the percentage of counts mapped to those chromosomes. Therefore, in some modalities, GC correction is performed to reduce variability due to sample differences in the magnitude of the relationship between GC content and observed read counts.

[00113] Specifically, the GC content for the regions corresponding to the genomic locations of the sequenced bins was obtained from the HG19 reference genome materials in the UCSC Genome Browser (https: / / genoma.ucsc.edu / ). Then the GC content was discretized by rounding the GC content values ​​to 3 decimal places such that multiple bins correspond to each unique GC content value. The average of the counts of Petition 870250110099, dated 01 / 12 / 2025, page 57 / 140 42 / 57 adjusted autosomal bin counts (by total autosome read count) were determined at each single GC content level. Then, local polynomial (Loesse) regression is performed to estimate the bin count as a smooth function of GC content. Finally, the normalized GC count is calculated as the average of the adjusted autosomal read count plus the (residual) difference between the observed read count and the read count predicted by the Loesse regression model. 5: Calculation of chromosome-specific counts

[00114] In some embodiments, a Z count is calculated for each chromosome of interest. In particular, bin read count (RC) data were first adjusted (divided) by their own total autosomal sample read counts. After GC correction was performed using local polynomial regression fitting the Loess function R and hgl9 data (see Example 3). A PCA model was applied to such normalized data to remove higher-order artifacts. In particular, higher-order artifacts were subtracted as defined by a regression of the normalized bin counts of the sample vs. the 1–10 principal components between the normalized bin read count determined from a reference population of presumably infected samples.

[00115] Then, a chromosome representation was calculated as the sum of the normalized individual bin read count residing on the chromosome of interest adjusted (divided) by the sum of all normalized autosomal individual bin read counts, and particularly dirTotalRQ chrRep. = —------———--—— Σ / =ι.„2 2 chrTotalRCj chrTotalRCç, sum of the normalized individual bin read counts residing on the chromosome of interest; and Σ;=ι.„22 chrTotalRCj.somaje t0(jas ascontagens de leitura Petition 870250110099, dated 01 / 12 / 2025, page 58 / 140 43 / 57 of normalized individual autosomal bins (chromosomes 1 to 22).

[00116] Then, each chromosome-specific Z count was calculated as Z: chromosome representation of the sample (ChrRePty, μ: plate mean of chromosome representation (i.e., the average chromosome representation value among all samples on the plate where the sample of interest was operated on); and σ: mean absolute deviation (MAD) of chromosome representation, as calculated using a reference set of 5406 samples from the presumably infected samples. 6: Generation of chromosomal ideograms

[00117] In some embodiments, an ideogram is generated for a chromosome of interest. In particular, the raw bin read count (RC) data were first adjusted (divided) by their own total autosomal read counts from the sample. Then GC correction was performed using local polynomial regression fitting the Loess function R and hgl9 data (see Example 3). Then the data were centered around the mean of the adjusted autosomal bin read count. Then the data were again adjusted (multiplied) by the total number of bins. Each bin count was then adjusted (divided) by the mean of the corresponding normalized bin count from a reference population of presumably infected samples. The data were then centered around 1 and corrected (subtracted) by the mean of the normalized autosomal bin counts from the sample.Higher-order artifacts were subtracted as defined by a regression of normalized bin counts from the sample versus the 1–10 principal components between the normalized bin read count determined from a reference population of presumably infected samples. Finally, the bin read count... Petition 870250110099, dated 01 / 12 / 2025, page 59 / 140 / 57 normalized result was graphically represented versus the chromosomal location of the corresponding bins to obtain the chromosome ideogram. 7: Clinical Confirmation of NIPS Results

[00118] Continuity information was obtained for each positive NIPS result obtained through clinical testing at a reference laboratory. A genetic counseling team contacts the referring physician to determine the pregnancy outcome. Example 2: Test Verification and Validation

[00119] Once the assay performance parameters were established, a series of verification samples including known unaffected and known aneuploid pregnancies was tested. This series of 2,085 samples included trisomy 21 (n = 69), trisomy 18 (n = 20), and trisomy 13 (n = 17). No unaffected pregnancy had a Z-score > 4 and no affected pregnancy had a Z-score < 8. Following the verification assay, a validation set comprising 552 samples was analyzed, including samples known to be positive for trisomy 21 (n=21), trisomy 18 (n=10), trisomy 13 (n=1), and XO (n=1). Again, no unaffected pregnancy had a Z-score > 4 and no affected pregnancy had a Z-score < 8.

[00120] Since there was no difference in performance between the verification and validation studies, the results were combined for analysis. The effects of GC correction were smaller for chromosome 21, which has a normal GC content, intermediate for chromosome 18, known to have an intermediate increase and GC content, and larger for chromosome 13, which has the highest GC content (FIG. 1). Using the raw data, a Z-count threshold of 4 produced absolute discrimination between the 2,498 unaffected pregnancies and the 90 trisomy 21 samples; no unaffected pregnancy had a Z-count > 4, and no Petition 870250110099, dated 01 / 12 / 2025, page 60 / 140 / 57. An affected pregnancy had a Z-score < 8. However, GC correction improved discrimination for chromosomes 13 and 18: without GC correction, most trisomy 13 samples had Z-scores less than 4; after GC correction, all trisomy 13 samples had Z-scores well above 8. GC correction also allowed complete discrimination of trisomy 18 from unaffected pregnancies. Therefore, after GC correction and biostatistical smoothing, the assay provided 100% discrimination between affected and unaffected pregnancies (FIG. 1, right panel) and demonstrates the combination of GC correction with statistical smoothing, which also improves assay performance.

[00121] A series of 115 samples from twin pregnancies with known aneuploidy status was also analyzed as part of the assay validation, including samples of 10 trisomies 21, 4 trisomies 18, and 13 trisomies 13. After GC correction and smoothing, all samples with autosomal trisomies had Z scores > 11 and all unaffected pregnancies had Z scores < 4. Overall, discrimination was higher in twin samples than in singleton samples (data not shown), even though most twins were expected to be discordant with respect to autosomal trisomies.

[00122] As a final validation for the detection of trisomy, samples were obtained from 100 pregnant women volunteers with consent and splitting the samples between our laboratory and Sequenom. The results were concordant in all cases. This series had 99 unaffected and 1 sample predicted to be from a woman carrying a fetus with trisomy 21 in both laboratories.

[00123] To evaluate the accuracy of the NIPS assay in determining fetal sex, 372 samples (188 males) were tested during the course of 6 different assay settings. Fetal sex was previously determined using the Sequenom Maternity21 Plus assay. Petition 870250110099, dated 01 / 12 / 2025, page 61 / 140 46 / 57 but was not phenotypically confirmed. The current NIPS assay produced concordant results in all but 1 sample, in which the results indicated a male fetus when a female fetus was expected. Thus, the overall accuracy was 99.7% (371 / 372). However, the fetal fraction for this sample (2.75%) was below the 5% threshold for reporting (not shown) and would have prompted a request for a new sample in the clinical trial.

[00124] The data above indicate that the present NIPS trial is verified and validated for clinical implementation. Example 3: Clinical Implementations

[00125] The following sections describe results from the present NIPS trial in exemplary clinical implementations. In particular, samples beginning at 10 weeks of gestation were accepted. More than 90% of the samples received were between 10 and 15 weeks of gestation.

[00126] Based on the validation and verification results above, for clinical implementation a Z-score cutoff of < 4 was used for unaffected pregnancies and >8 for affected pregnancies. Z-scores >3 but < 8 prompted further testing. Reviews of the first 10,000 clinical samples revealed abnormal NIPS results in 180 (1.8%) (Table 1). Overall positive rates were 1.0% for trisomy 21, 0.36% for trisomy 18, 0.21% for trisomy 13, and 0.17% for sex aneuploidies. One sample was positive for DiGeorge microexclusion and 2 cases had 2 abnormalities. Of the first 10,713 samples tested, results could not be reported in 94 (0.88%); The cause was low fetal fraction in 63 cases (0.59%) and non-informative DNA patterns, failure to meet quality metrics, or other technical problems in 31 samples (0.29%). Table 1: Continuity of Positive Clinical Samples for Fetal Aneuploidies in Prenatal Screening _______________________________________Non-Invasive_______________________________________ Results Number Confirmation of ,, , , Pending Loss PPV of NIPS of child Result ~ · ·, , False + ia of PPV,% adjusted „ , · „ · · , Continuity . . .a Single positives NIPS positive contmui conti,% Petition 870250110099, dated 01 / 12 / 2025, page 62 / 140 47 / 57 (Twins) Karyotype 0 U / S or physical examination SAB (Twins) Continuity ongoing Pregnancy terminated ancestry T21 99 (4) 37 (3) 1 7(1) 26 11 lb 10 6 98 100 T18 35(1) 14 9 1 4 0 2C 4 2 92 96 T13 20(1) 7 2 2 2 0 4d 3 1 69 NA 45,X 9 3 3 0 0 0 le 2 0 86 100 47,XXX 5 2 0 0 1 0 1 1 0 67 NA 47,XXY 2 1 0 0 1 0 0 0 0 100 NA 47,XYY 1 0 0 0 1 0 0 0 0 NA NA 22q I gave 1 1 0 0 0 0 0 0 0 100 NA T21 & 1 0 0 1 0 0 0 0 0 NA NA 45.X T21 &T13 1 0 0 0 0 0 0 1 0 NA NA aPVV excluding false positives reclassified as true negatives based on changes in reporting rules. Re-evaluation of data showed multiple chromosome variations. Twin pregnancy with one twin having a mass felt to be a teratoma; patient with significant fibroids. e45,X / 46,XX Maternal. 1: Maternal microduplication

[00127] NIPS was performed using shotgun whole-genome sequencing (a method that involves sequencing DNA fragments that, in aggregate, represent almost the entire genome). This allows the generation of a karyogram that graphically represents Z counts across the entire genome. Snyder et al. described two cases of false-positive NIPS results for trisomy 18 that were later found to be the result of maternal microduplications of chromosome 18. Copy number variation and false-positive results of prenatal aneuploidy screening. N. Engl. J. Med. 2015; 372(17): 1639-1645. Thus, a process was instituted in which, for each positive result obtained by NIPS, the karyogram of the affected chromosome was generated and examined. For a true positive result, sequence reads are augmented across the entire chromosome.When a maternal microduplication is present, only a small region (i.e., the region that is duplicated) of the chromosome is represented by an increased number of sequence reads. The process was able to identify, in a series of 31,278 pregnant women screened, 61 women in whom maternal microduplications occurring on chromosomes 13, 18, and 21 produced false-positive results. Petition 870250110099, dated 01 / 12 / 2025, page 63 / 140 / 57

[00128] Until the Applicant was confident that the karyograms correctly predicted maternal microduplications, the suspected microduplications were confirmed by microarray analysis (Affymetrix CytoScan® HD). Subsequently, maternal microarray analysis was performed at the discretion of the requesting physician. A genetic counselor was contacted by the physician with the report, which included a description of the suspected maternal microduplication and an offer of confirmatory microarray analysis (at no cost to underinsured patients).

[00129] For example, early during the clinical trial, 2 cases with intermediate Z counts between 3 and 8 were found. One had a Z count of 5.11 for trisomy 21 and another had a Z count of 6.93 for trisomy 18. The “false-positive” NIPS results may be due to maternal microduplications, and thus chromosomal ideograms were used to investigate whether these intermediate Z counts represented maternal microduplications. FIG. 2 shows the ideogram for a typical NIPS result of a fetus confirmed to have trisomy 21. In both cases, the ideograms clearly showed that the duplications were in a small portion of the affected chromosomes (FIG. 3). With the permission of the requesting physicians, microarray analysis was performed on maternal leukocyte-platelet cells, which confirmed maternal microduplication on chromosomes 21 (FIG. 4) and 18 (FIG. 5 and FIG. 6).Henceforth, the ideogram was examined for each chromosome with a high Z count before reporting an abnormal result, to ensure that the entire chromosome is duplicated and the result is not due to maternal microduplication.

[00130] Microarray analysis showed the presence of a maternal microduplication in all confirmatory tests performed. The identification of maternal microduplications as a source of results Petition 870250110099, dated 01 / 12 / 2025, page 64 / 140 / 57 false-positives improved the PPV of our screening to 98%, 92%, and 69% for Trisomies 21, 18, and 13, respectively (Table 2). True positives for Trisomy 21 were confirmed by karyotype and / or amniocyte microarray analysis. Some true positives for Trisomies 13 and 18 were confirmed by the presence of characteristic sonographic abnormalities.

[00131] If there was no contact from the obstetrician or neonatologist, it was assumed that the delivery was not influenced. None of the births of maternal duplication were Trisomies. There were no reports of births affected with Trisomy 13 or 18, leading to an NPV of 100%. There was a single newborn with Trisomy 21, leading to an NPV of >99.9999%. Table 2: Continuity of Positive Clinical Samples for Fetal Aneuploidies in Non-Invasive Prenatal Screening______________________________ Positive Trisomy Chromosome Maternal Microduplication Tested and Confirmed by Microarray Improvement in PPV 21 313 12 9 +4% (94% -> 98%) 18 106 21 3 +20% (72% -> 92%) 13 93 28 2 +30% (39% -> 69%)

[00132] These results suggest that the present NIPS assay can distinguish maternal microduplications from true fetal trisomy, thus avoiding false-negative results caused by maternal duplications. 2: Abnormalities of the Maternal Global Copy Number

[00133] In one case, NIPS produced a positive result for trisomy 21 with a Z count of 21, but amniocentesis revealed a euploid fetus. The NIPS data for the whole genome were then examined and revealed copy number changes in multiple chromosomes, reflected by elevated Z counts for chromosomes 3, 9, and 21, and negative Z counts (< -8) for chromosomes 4, 6, and 11. The mother had large fibroids. Uterine fibroids can spread DNA into the circulation, causing artificial copy number changes in NIPS analysis. Following Petition 870250110099, dated 01 / 12 / 2025, page 65 / 140 / 57 In this case, a procedure was instituted to examine the entire genome of positive NIPS cases to avoid reporting false-negative results due to circulating global aneuploidy. There were a total of 6 samples with elevated Z counts for chromosomes 13, 18, or 21 that also had multiple copy number abnormalities in several other chromosomes. All raw microarray data were updated on: http: / / www.ncbi.nlm.nih.gov / geo / query / acc.cgi?acc=GSE84810, Accessed: GSE84810.

[00134] These results suggest that the present NIPS assay can distinguish maternal global copy number abnormalities from true fetal trisomy, thus avoiding false-negative results caused by variations in maternal global copy number. 3: Mosaicism and translocations

[00135] There was a single case of Down syndrome with a 14:21 Robertsonian translocation. This case had a highly elevated Z-count of 30.78, which was not unexpected, given that most of the chromosome 21 material was duplicated. Another patient had an intermediate Z-count (3.57) for chromosome 21. A second sample, submitted after consulting the physician, had a Z-count of 4.22, and a third had a Z-count of 5.57. G-banding analysis of amniocytes following amniocentesis revealed mosaic trisomy 21 with 7 trisomic cells and 29 euploid cells counted. One case with a highly elevated chromosome 21 Z-count (24.43) had amniocentesis demonstrating 15 trisomic cells and 5 euploid cells. One final mosaic case had a Z-count of 8.41 for chromosome 21, and fetal mosaicism for Down syndrome was diagnosed by amniocentesis.The amniocytic karyotype was performed by another laboratory, and we did not obtain the ratio. The present NIPS assay detected a single one. Petition 870250110099, dated 01 / 12 / 2025, page 66 / 140 / 57 mosaic fetus for trisomy 13 following a Z count of 10.79. This sample had a trisomy:euploid cell ratio of 16:4.

[00136] In all mosaic cases, the present NIPS analysis did not predict mosaicism. Mosaicism was reported when continuity information on high-risk cases was obtained.

[00137] Because the percentage of trisomy mosaicism in amniocytes cannot reflect the percentage in the chorion, it is difficult to estimate the analytical sensitivity of our assays for mosaic Down syndrome. However, these results suggest that the present NIPS assay can detect fetuses with as few trisomic cells as 25%. 4: Sex chromosome aneuploidies

[00138] Maternal genetic variations can also affect screening for sex chromosome aneuploidy. In one case positive for 45,X (Turner syndrome), the estimated fetal fraction was >50%, and amniocentesis revealed a euploid fetus. Maternal DNA analysis revealed maternal mosaicism for 45,X. Three other cases showed a negative fetal fraction on NIPS; all 3 women were non-mosaic for 47,XXX. Other than the single case of maternal mosaicism for Turner syndrome, all confirmed sex chromosome aneuploidies were correctly identified.

[00139] These results suggest that the present NIPS assay is capable of detecting fetal sex chromosome aneuploidy at least when the mother is not mosaic. 5: Cases of Twins

[00140] Four sets of twins had elevated Z counts for trisomy 21. One pregnancy resulted in fetal death of one of the twins without genetic testing. In 2 pregnancies, the diagnosis of Down syndrome was confirmed in 1 twin. In a third case, 1 twin had a teratoma and both had normal karyotypes. There was one twin pregnancy positive for trisomy 18, which miscarried without genetic testing. Petition 870250110099, dated 01 / 12 / 2025, page 67 / 140 / 57

[00141] Information on whether these twin pregnancies were monochorionic or dichorionic was not obtained in this study. Since 80% of twin pregnancies are dichorionic, it was assumed that this was also the case with the present case. It would be expected that the Z-scores for discordant twins with trisomies would be lower than those for singletons, but this does not appear to be the case. More data will be needed before any conclusions can be drawn regarding the mechanism of circulating fetal DNA in twin pregnancies.

[00142] These results suggest that the present NIPS assay may produce similar results in cases of twin pregnancies as in cases of single births. 6: Positive predictive values ​​(PPVs) of previously available methods.

[00143] A study is conducted to evaluate positive predictive values ​​for previously available NIPS methods. Specifically, 211 consecutive specimens were analyzed, along with combined data from more recent publications, for a total of 1,547 samples in the combined dataset (Table 3). The cumulative PPVs were 91% for trisomy 21, 73% for trisomy 18, 39% for trisomy 13, and 49% for sex chromosome aneuploidies. These numbers suggest that the PPV is not improving over the years for previously available first-generation NIPS tests. Meck and colleagues recently reported similar PPV results in a series of 216 samples referred for invasive testing following NIPS (See Meck et al. Noninvasive prenatal screening for aneuploidy: positive predictive values ​​based on cytogenetic findings. Am J Obstet Gynecol. 2015; 213: 214.e1-5).These data suggest that to improve the PPV of NIPS for aneuploidies, the false-positive rate must be further reduced. Table 3. Positive predictive values ​​for non-invasive prenatal screening performed in third-party laboratories. NIPS results (prevalence) Current Study, Current Study + Literature Number of Cases (PPV) [20,23,25-28] Number of Cases (PPV) Petition 870250110099, dated 01 / 12 / 2025, page 68 / 140 / 57 Trisomy 21 (1:185) 84 (85%) 1174 (91%) Trisomy 18 (1:470) 53 (57%) 350 (73%) Trisomy 13 (1:1500) 28 (36%) 136 (39%) Sex Aneuploidy (1:1000) 39 (38%) 115 (49%) Microexclusions (3:000) 13 (38%) Not Determined Based on results from invasive continuity testing performed at Quest Diagnostics; NIPS performed elsewhere. The performing laboratory was known in 86 samples and included Natera (43 samples), Sequenom (20), Ariosa (16), and Verinata (7). 7: Positive predictive values ​​(PPV) of the present methods.

[00144] Confirmation of positive NIPS results for trisomy 21 was based on invasive testing. Sonographic findings for confirmation of trisomy 21 were excluded because most “soft” findings lack specificity. Invasive testing and ultrasound evidence of abnormalities were accepted as confirmation of trisomy 18 and 13, since there were evident sonographic findings in both disorders to confirm the NIPS results.

[00145] In total, 103 pregnancy samples were positive for trisomy 21, including 99 singleton pregnancies and 4 twin pregnancies. Of these, 87 had successful continuation; continuation is pending in 10 patients; and 6 lost continuity. Forty-two (48%) of the cases with continuity had confirmation available by invasive testing or physical examination at delivery, including 3 twin pregnancies (Table 1). The positive NIPS result was confirmed in all but 1 case of trisomy 21, and all twin pregnancies had 1 affected and 1 unaffected fetus. Thus, the PPV for trisomy 21 was 98%. The single false-positive NIPS result for trisomy 21 was associated with multiple maternal genetic abnormalities (described above) and would not have been reported positive using the new reporting criteria. Therefore, with current practices in place, the PPV for trisomy 21 would have been 100%.Because many pregnancies lack available confirmation, these data should be considered preliminarily. In addition to the confirmed cases, 8 pregnancies (7 single births, 1 twin birth) positive for trisomy 21 in the NIPS database resulted in spontaneous abortion (Table 1), consistent with an increased spontaneous abortion rate for these pregnancies. Petition 870250110099, dated 01 / 12 / 2025, page 69 / 140 / 57 aneuploids. Eleven women (13%) with positive NIPS results for trisomy 21 were chosen to terminate their pregnancies without confirmation by invasive testing, while 26 (30%) continued their pregnancies without invasive testing.

[00146] Of the 35 singleton pregnancies and 1 twin pregnancy positive for trisomy 18, 30 had successful continuation. Direct (invasive test) or indirect (suspected based on ultrasound findings) confirmation of positive results was available for 25 cases (83%). All but 2 were confirmed to have trisomy 18, yielding a PPV of 92% (Table 1). One false-positive result involved a twin pregnancy in which 1 of the twins had a coccygeal mass thought to be a teratoma (described above). This case should have been excluded from NIPS given the frequent chromosomal abnormalities associated with neoplasms. Without this case, the PPV for trisomy 18 would have been 96%. Four (13%) women with positive NIPS results for trisomy 18 declined further testing and are continuing their pregnancies. There was only 1 miscarriage among pregnancies that tested positive for trisomy 18.

[00147] Twenty-one samples were positive for trisomy 13, including 17 (81%) with complete continuity: 9 were confirmed positive based on invasive testing or suspected positive based on ultrasound findings, and 4 were false-positives. Thus, the PPV for trisomy 13 was 69%. Of the 4 false-positive cases, 1 involved uterine fibroids (described above); the others remained unexplained. Placental material could be obtained to investigate the possibility of confined placental mosaicism. These cases would represent vanishing twins or confined placental mosaicism, as they had high Z counts and none of the global abnormalities.

[00148] These results suggest that the positive predictive values ​​of the present NIPS assay are at least 98% for trisomy 21, 92% Petition 870250110099, dated 01 / 12 / 2025, page 70 / 140 / 57 for trisomy 18 and 69% for trisomy 13, which are significantly improved when compared with conventional methods. 8: Sex chromosome aneuploidies and microdeletions

[00149] Of 9 samples positive for Turner syndrome (45,X) (Table 1), 7 had continuity data available; 1 was a false-positive (PPV= 86%). This was the case of maternal mosaicism for Turner syndrome described above. Using the present reporting rules, this case would have been reported as suspected of maternal variation because the fetal fraction was >50%. Excluding this would lead to a theoretical PPV of 100% for Turner syndrome.

[00150] Of 5 cases positive for 47,XXX, 2 had continuity information; both were confirmed to have this karyotype. Two cases were positive for Klinefelter syndrome, and the only fetal genotype obtained confirmed the 47,XXY karyotype. Only one sample was positive for 47,XYY, but continuity information was not available. Only one case involved a microdeletion in the DiGeorge region of chromosome 22 (Fig 7). The specific DiGeorge count of Z was -7. Amniocentesis confirmed the abnormality. Two samples had 2 abnormalities: 1 with trisomy 21 and Turner syndrome that aborted, and the other with a high risk for both trisomy 21 and 18, for which no continuity data was received.

[00151] These results suggested that the present NIPS assay is capable of detecting sex chromosome aneuploidies and microdeletions, with a theoretical PPV of 100% for Turner syndrome. Equivalents

[00152] The present technology should not be limited in terms of the particular embodiments described in this application, which are intended only as illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without Petition 870250110099, dated 01 / 12 / 2025, page 71 / 140 / 57, may diverge from its spirit and scope, as will be evident to those skilled in the art. Functionally equivalent methods and apparatus within the scope of the present technology, in addition to those enumerated herein, will be evident to those skilled in the art from the preceding descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It should be understood that this present technology is not limited to particular methods, reagents, compounds, compositions, or biological systems, which may, of course, vary. It should also be understood that the terminology used herein is only for the purpose of describing particular embodiments and is not intended to be limiting.

[00153] Furthermore, where features or aspects of disclosure are described in terms of Markush groups, those skilled in the art will recognize that disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[00154] As will be understood by a person skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range may be readily recognized as sufficiently describing and enabling the same range to be decomposed into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein may be readily decomposed into a lower third, middle third, and upper third, etc. As will also be understood by a person skilled in the art, all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the cited number and refer to ranges that may be subsequently decomposed into subranges as discussed above.Finally, as someone versed in the technique will understand, a band includes each individual member. Thus, for example, a group having 1 a. Petition 870250110099, dated 01 / 12 / 2025, page 72 / 140 / 57 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1 to 5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so on.

[00155] All patents, patent applications, provisional applications, and publications mentioned or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent that they are not inconsistent with the explicit disclosures in this descriptive report. Petition 870250110099, dated 01 / 12 / 2025, page 73 / 140

Claims

1 / 5 CLAIMS 1. A method for detecting false-positive diagnosis of chromosomal aneuploidy in a fetus by non-invasive prenatal screening (NIPS), characterized in that it comprises (a) sequencing cell-free DNA from a maternal test sample from a pregnant woman carrying the fetus to provide sequence reads; wherein the fetus was diagnosed as aneuploid of a chromosome of interest by NIPS; (b) splitting the chromosome of interest into a plurality of bins, each bin having a chromosomal location; (c) aligning the sequence reads for one or more bins; (d) generating a raw bin read count; (e) calculating a bin-specific test parameter for each bin, adjusting the bin's raw read count with a total autosomal read count and performing a GC correction of the bin's adjusted read count;(f) plot bin-specific test parameters versus the chromosomal locations of corresponding bins to produce an ideogram of the chromosome of interest; and (g) detect a false-positive diagnosis when the ideogram displays an increase in a bin-specific test parameter by at least 1.2 times compared to the remaining bin.

2. Method according to claim 1, characterized in that the increase is at least 1.5 times, at least 2 times, at least 2.5 times, at least 3 times, at least 3.5 times, at least 4 times, at least 4.5 times, at least 5 times, at least 5.5 times, at least 6 times, at least 6.5 times or at least 7 times.

3. Method according to any of the preceding claims, characterized in that it further comprises repeating Petition 870250110099, dated 12 / 01 / 2025, page 74 / 140 2 / 5 steps (a) to (g) for a confirmation chromosome other than the chromosome of interest.

4. A method according to any of the preceding claims, characterized in that the specific bin parameter is reflective of the relative abundance of genetic material corresponding to the bin in a maternal test sample.

5. Method according to any of the preceding claims, characterized in that the bin-specific test parameter is a normalized bin read count obtained by calculation of step (e).

6. A method according to any of the preceding claims, characterized in that the bin-specific test parameter is produced by NIPS.

7. A method according to any of the preceding claims, characterized in that the method improves a positive predictive value (PPV) of NIPS by at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% for human trisomy 21, human trisomy 18, and / or human trisomy 13.

8. Method according to claim 7, characterized in that the PPV is improved by at least 93% for human trisomy 21, at least 72% for human trisomy 18, and / or at least 39% for human trisomy 13.

9. Method according to claim 7, characterized in that the PPV for trisomy 21 is improved by 98% for human trisomy 21, 92% for human trisomy 18, and / or 69% for human trisomy 13.

10. Method according to any of the preceding claims, characterized in that the method improves a positive predictive value (PPV) of NIPS by at least 4%, 10%, 20%, 30%, 40% and 50% for human trisomy 21, human trisomy 18 and / or human trisomy 13.

11. Method according to claim 10, characterized in that the PPV is improved by at least 4% for human trisomy 21, at least 20% for human trisomy 18, and / or at least 30% for human trisomy 13.

12. A method according to any of the preceding claims, characterized in that each bin is 50 kb in length.

13. A method according to any of the preceding claims, characterized in that the chromosome of interest is one or more chromosomes.

14. Method according to claim 3, characterized in that the confirmation chromosome is one or more chromosomes.

15. Method according to claim 1, characterized in that it further comprises: (a) dividing a confirmation chromosome into a plurality of bins, each bin having a chromosomal location; (b) calculating the bin-specific parameter for each bin of the reference chromosome; (c) calculating a first sum of bin-specific test parameters for corresponding bins residing on a confirmation chromosome; wherein the confirmation chromosome is different from a chromosome of interest diagnosed as aneuploid; (d) calculating a second sum of bin-specific test parameters for corresponding bins residing on one or more autosomes; (e) calculating a chromosome representation value for the confirmation chromosome by dividing the first sum by the second sum; Petition 870250110099, dated 12 / 01 / 2025, p.76 / 140 4 / 5 (f) compare the chromosome representation value with a set of references to generate a chromosome-specific comparison result; (g) detect false-positive diagnosis when the chromosome-specific comparison result reaches a predetermined threshold.

16. Method according to claim 15, characterized in that the confirmation chromosome is one or more chromosomes in a reference genome.

17. Method according to claim 16, characterized in that the reference set comprises a plurality of chromosome representation values ​​for the confirmation chromosome obtained from a random sample of unaffected pregnancies.

18. Method according to any one of claims 15 to 17, characterized in that step (f) is performed by calculating a Z count of said test chromosome representation value with respect to the reference set.

19. Method according to any one of claims 15 to 18, characterized in that the threshold is reached when the Z count is greater than 4 or greater than 8.

20. Method according to any one of claims 15 to 19, characterized in that the method further comprises evaluating a cell-free fetal DNA fraction in the maternal test sample before performing step (a), wherein the evaluation of the fetal fraction comprises quantifying specific Y chromosome sequences, determining fetal single nucleotide polymorphism (SNP) alleles inherited from the father, or analyzing methylation characteristics.

21. Method according to claim 20, characterized in that it further comprises excluding the maternal test sample when the fetal fraction is less than 4%. Petition 870250110099, dated 12 / 01 / 2025, p. 77 / 140 5 / 5 22. A method according to any of the preceding claims, characterized in that the chromosomal aneuploidy is a complete or partial chromosomal duplication or a chromosomal trisomy.

23. A method according to any of the preceding claims, characterized in that the chromosomal aneuploidy is human trisomy 13, human trisomy 18, or human trisomy 21.

24. Method according to any of the preceding claims, characterized in that the fetus is aneuploid mosaic. Petition 870250110099, dated 01 / 12 / 2025, pp. 78 / 140

Images