PSMA and CA9 Targeted Systems

Description

PSMA and CA9 Targeted Systems: Cross-Reference to Related Requests

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 488,386, filed March 3, 2023; U.S. Provisional Application No. 63 / 489,837, filed March 13, 2023; U.S. Provisional Application No. 63 / 495,869, filed April 13, 2023; U.S. Provisional Application No. 63 / 578,854, filed August 25, 2023; U.S. Provisional Application No. 63 / 601,617, filed November 21, 2023; U.S. Provisional Application No. 63 / 613,712, filed December 21, 2023; and U.S. Provisional Application No. 63 / 618,233, filed January 5, 2024, each of which is incorporated herein by reference in its entirety. SEQUENCE LISTING

[0002] This application contains a Sequence Listing which is incorporated herein by reference in its entirety. The said XML copy, created on February 23, 2024, is named ANB-221WO_SL.XML and is 443,727 bytes in size. FUNDAMENTALS

[0003] Cancer is a disease characterized by the uncontrolled growth of cells. Many approaches to treating cancer have been attempted, including drugs and radiation therapy. Recent cancer treatments have sought to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells a new ability to target a specific protein. The receptors are chimeric because they combine antigen-binding and T-cell activation functions in a single receptor.

[0004] CAR-T cell immunotherapy is promising because the modified T cells have the potential to recognize cancer cells in order to attack and destroy them more effectively. Petition 870250078695, dated 03 / 09 / 2025, page 14 / 387 2 / 291

[0005] After T cells are manipulated with CARs, the resulting CAR-T cells are introduced into patients to attack tumor cells. CAR-T cells can be derived from T cells in the patient's own blood (autologous) or derived from T cells from another healthy donor (allogeneic). After CAR-T cells are infused into a patient, they come into contact with their targeted antigen on a cell. The CAR-T cells bind to the antigen and are activated. Upon antigen engagement, CAR-T cells can proliferate exponentially, initiate the production of antitumor cytokines, and target tumor cell death.

[0006] However, some concerns and limitations remain regarding CAR-T cell-based immunotherapy. Some CAR T cells may interact with normal cells expressing low levels of target antigens, leading to off-target toxicity. For example, both primary and metastatic ccRCC sites are highly vascularized, with most tumor cells expressing elevated levels of carbonic anhydrase IX (CA9). However, CA9 is also expressed in healthy bile ducts and stomach tissue, which has led to both on-target and off-tumor toxicities in patients treated with constitutive CA9 CAR T cells. Therefore, additional therapies that reduce off-target toxicity remain desirable. SUMMARY

[0007] In one aspect, isolated antibodies or antigen-binding fragments thereof that bind to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1) are provided in this document comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally where: I, CDR-H1, comprise the sequence established in SEQ ID NO: 101, Petition 870250078695, dated 03 / 09 / 2025, p. 15 / 387 3 / 291 CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113.

[0008] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 99 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 100.

[0009] In some embodiments, the antibody comprises a scFv.

[0010] In some modes, scFv comprises the sequence established in SEQ ID NO: 98.

[0011] In some embodiments, the VH chain sequence comprises the VH sequence established in SEQ ID NO: 110.

[0012] In one aspect, isolated receptors are provided in this document comprising an extracellular antigen-binding domain that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1), comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequence set forth in SEQ ID NO: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence set forth in SEQ ID NO: 100, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 Petition 870250078695, dated 03 / 09 / 2025, page 16 / 387 4 / 291 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113.

[0013] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 99 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 100.

[0014] In some modalities, the CAR comprises a scFv.

[0015] In some modes, scFv comprises the sequence established in SEQ ID NO: 98.

[0016] In some embodiments, the VH chain sequence comprises the VH sequence established in SEQ ID NO: 110.

[0017] In some embodiments, the receptor is a chimeric antigen receptor (CAR) comprising, from the N-terminus to the C-terminus, i. the extracellular antigen-binding domain; ii. a transmembrane domain; iii. an optional intracellular co-stimulatory domain; and iv. an intracellular activation domain.

[0018] In some embodiments, the CAR additionally comprises a hinge domain.

[0019] In some embodiments, the hinge domain comprises a CD8a hinge domain, a truncated CD8a hinge domain, or a CD28 hinge domain.

[0020] In some embodiments, the transmembrane domain comprises a CD8a transmembrane domain or a CD28 transmembrane domain.

[0021] In some modalities, the intracellular co-stimulatory domain comprises a 4-1BB domain.

[0022] In some modalities, the intracellular activation domain comprises a CD3Z domain.

[0023] In some modalities, the CAR comprises a sequence Petition 870250078695, dated 03 / 09 / 2025, page 17 / 387 5 / 291 as established in SEQ ID Nos: 108, 115, 250 or 251.

[0024] In one aspect, isolated antibodies or antigen-binding fragments thereof that bind to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2) are provided in this document comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally where: i. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO: 137.

[0025] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 118 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 119.

[0026] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 130 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 131.

[0027] In some embodiments, the antibody comprises a scFv.

[0028] In some modalities, scFv comprises the sequence Petition 870250078695, dated 03 / 09 / 2025, p. 18 / 387 6 / 291 established in SEQ ID NO: 117 or 129.

[0029] In one aspect, isolated receptors are provided in this document comprising an extracellular antigen-binding domain that binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2), comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124, and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO: 137.

[0030] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 118 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 119.

[0031] In some embodiments, the VH string sequence comprises the VH sequence established in SEQ ID NO: 130 and the VL string sequence comprises the VL sequence established in SEQ ID NO: 131.

[0032] In some embodiments, the priming receiver comprises an scFv. Petition 870250078695, dated 03 / 09 / 2025, p. 19 / 387 7 / 291

[0033] In some forms, scFv comprises the sequence established in SEQ ID NO: 117 or 129.

[0034] In some embodiments, the receiver is a priming receiver comprising, from the N-terminal to the C-terminal, I. the extracellular antigen-binding domain; ii. a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and iii. an intracellular domain comprising a human or humanized transcriptional effector, wherein the binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

[0035] In some embodiments, the priming receptor additionally comprises a hinge domain positioned between the extracellular antigen-binding domain and the transmembrane domain.

[0036] In some embodiments, the hinge domain comprises a CD8a hinge domain or a truncated CD8a hinge domain.

[0037] In some embodiments, the hinge domain comprises the sequence as set forth in SEQ ID NO: 85.

[0038] In some embodiments, the transmembrane domain comprises a Notch1 transmembrane domain.

[0039] In some embodiments, the transmembrane domain comprises the sequence as set forth in SEQ ID NO: 86.

[0040] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0041] In some embodiments, the intracellular domain comprises the sequence as set forth in SEQ ID NO: 88, 89 or 90.

[0042] In some embodiments, the priming receptor additionally comprises a transfer stop sequence or juxtamembrane domain between the transmembrane domain and the intracellular domain. Petition 870250078695, dated 03 / 09 / 2025, page 20 / 387 8 / 291

[0043] In some embodiments, the transfer stop sequence or juxtamembrane domain comprises the sequence as set forth in SEQ ID NO: 87.

[0044] In some embodiments, the priming receiver comprises a sequence as set forth in SEQ ID NO: 127, 138, 252 or 253.

[0045] In one aspect, systems comprising are provided in this document: i. a first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2); ii. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1); iii. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and iv. at least one or more nucleic acids comprising a nucleic acid sequence with at least 15 nucleotides of length complementary to: 1. a nucleic acid that encodes the Surface Death Receptor Human Cellular Fas (FAS) comprising the sequence established in SEQ ID NO: 3; and 2. a nucleic acid that encodes Factor Receptor 2 Transformative Growth (TGF) - and human (TGFBR2) comprising the sequence established in SEQ ID NO: 4.

[0046] In some embodiments, the first extracellular antigen-binding domain comprises a first variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDRH1, CDR-H2 and CDR-H3, from the VH sequences established in the SEQ ID NOs: 118 Petition 870250078695, dated 03 / 09 / 2025, page 21 / 387 9 / 291 or 130, and a first variable light chain (VL) sequence comprising three CDR light chain sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID Nos: 119 or 131, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124, and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO: 137.

[0047] In some embodiments, the first VH string sequence comprises the sequence established in SEQ ID NO: 118 or 130.

[0048] In some embodiments, the first VL string sequence comprises the sequence established in SEQ ID NO: 119 or 131.

[0049] In some embodiments, the first extracellular antigen-binding domain comprises the sequence established in SEQ ID NO: 117 or 129.

[0050] In some embodiments, the second extracellular domain binding site comprises a second variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDRH1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally in Petition 870250078695, dated 03 / 09 / 2025, page 22 / 387 10 / 291 that: i. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113.

[0051] In some forms, the second VH comprises the sequence as set out in SEQ ID NO: 99 or 110.

[0052] In some modes, the second VL comprises the sequence established in SEQ ID NO: 100.

[0053] In some embodiments, the second extracellular domain comprises the sequence established in SEQ ID NO: 98 or 110.

[0054] In one aspect, systems comprising are provided in this document: i. a first chimeric polypeptide comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2), wherein the first extracellular antigen-binding domain comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: ii. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 Petition 870250078695, dated 03 / 09 / 2025, page 23 / 387 11 / 291 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or iii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO: 137. iv. a second chimeric polypeptide comprises a chimeric antigen receptor (CAR); v. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and vi. at least one or more nucleic acids comprising a nucleic acid sequence with at least 15 nucleotides of length complementary to: 1. a nucleic acid encoding the human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3; and 2. a nucleic acid encoding the Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4.

[0055] In some embodiments, the VH string sequence comprises the sequence established in SEQ ID NO: 118 or 130.

[0056] In some embodiments, the VL string sequence comprises the sequence established in SEQ ID NO: 119 or 131.

[0057] In some embodiments, the first extracellular antigen-binding domain comprises the sequence established in SEQ ID NO: 117 or 129. Petition 870250078695, dated 03 / 09 / 2025, page 24 / 387 12 / 291

[0058] In some embodiments, the CAR comprises a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1).

[0059] In some embodiments, the second extracellular domain binding site comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113.

[0060] In some forms, VH comprises the sequence as set out in SEQ ID NO: 99 or 110.

[0061] In some modes, the VL comprises the sequence established in SEQ ID NO: 100.

[0062] In some embodiments, the second extracellular domain comprises the sequence established in SEQ ID NO: 98 or 110.

[0063] In one aspect, systems comprising are provided in this document: i. a first chimeric polypeptide comprising a priming receptor, and Petition 870250078695, dated 03 / 09 / 2025, page 25 / 387 13 / 291 ii. a second chimeric polypeptide comprises a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1), wherein the extracellular antigen-binding domain comprises a single-domain antibody comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3 of the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3 of the VL sequence established in SEQ ID NOs: 110, optionally wherein: iii. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or iv. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113; v. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and vi. at least one or more nucleic acids comprising a nucleic acid sequence with at least 15 nucleotides of length complementary to: 1. a nucleic acid encoding the human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3; and 2. a nucleic acid encoding the human Transforming Growth Factor (TGF)-E Receptor 2 (TGFBR2) comprising the sequence Petition 870250078695, dated 03 / 09 / 2025, page 26 / 387 14 / 291 established in SEQ ID NO: 4.

[0064] In some embodiments, the VH string sequence comprises the sequence established in SEQ ID NO: 99 or 110.

[0065] In some modes, the VL comprises the sequence established in SEQ ID NO: 100.

[0066] In some embodiments, the second extracellular domain comprises the sequence established in SEQ ID NO: 98 or 110.

[0067] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA).

[0068] In some embodiments, the first extracellular antigen-binding domain comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124, and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO: 137.

[0069] In some modalities, VH comprises the sequence Petition 870250078695, dated 03 / 09 / 2025, page 27 / 387 15 / 291 as established in SEQ ID NO: 118 or 130.

[0070] In some modes, the VL comprises the sequence established in SEQ ID NO: 119 or 131.

[0071] In some embodiments, the first extracellular domain comprises the sequence established in SEQ ID NO: 117 or 129.

[0072] In some embodiments, the priming receiver comprises, from terminal N to terminal C, i. the first extracellular antigen-binding domain; ii. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and iii. an intracellular domain comprising a human or humanized transcriptional effector, wherein the binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

[0073] In some embodiments, the priming receptor additionally comprises a first hinge domain positioned between the first extracellular antigen-binding domain and the first transmembrane domain.

[0074] In some embodiments, the first hinge domain comprises a CD8a hinge domain or a truncated CD8a hinge domain.

[0075] In some embodiments, the first hinge comprises the sequence as set out in SEQ ID NO: 85.

[0076] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain.

[0077] In some embodiments, the transmembrane domain comprises the sequence as set forth in SEQ ID NO: 86.

[0078] In some embodiments, the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain.

[0079] In some embodiments, the intracellular domain comprises the sequence as set forth in SEQ ID NO: 88, 89 or 90. Petition 870250078695, dated 03 / 09 / 2025, page 28 / 387 16 / 291

[0080] In some embodiments, the priming receptor additionally comprises a transfer stop sequence or juxtamembrane domain between the transmembrane domain and the intracellular domain.

[0081] In some embodiments, the transfer stop sequence or juxtamembrane domain comprises the sequence as set forth in SEQ ID NO: 87.

[0082] In some embodiments, the priming receiver comprises a sequence as set forth in SEQ ID NO: 127, 138, 252 or 253.

[0083] In some modes, the CAR comprises, from terminal N to terminal C, i. a second extracellular antigen-binding domain; ii. a second transmembrane domain; iii. an intracellular co-stimulatory domain; and iv. an intracellular activation domain.

[0084] In some forms, the CAR comprises a second hinge domain.

[0085] In some embodiments, the second hinge domain comprises a CD8a hinge domain or a truncated CD8a hinge domain.

[0086] In some embodiments, the second transmembrane domain comprises a CD8a transmembrane domain.

[0087] In some modalities, the intracellular co-stimulatory domain comprises a 4-1BB domain.

[0088] In some modalities, the intracellular activation domain comprises a CD3Z domain.

[0089] In some forms, the CAR comprises a sequence as set out in SEQ ID Nos: 108, 115, 250 or 251.

[0090] In some modalities, the priming receptor and CAR are able to bind to the same target cell if the target cell expresses PSMA and CA9.

[0091] In some modes, at least one or more sequences of Petition 870250078695, dated 03 / 09 / 2025, p. 29 / 387 17 / 291 nucleic acids have at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0092] In some embodiments, at least one or more nucleic acid sequences are a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0093] In some embodiments, at least one or more nucleic acid sequences are shRNA.

[0094] In some embodiments, at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-82.

[0095] In some embodiments, the nucleic acid sequence complementary to human FAS comprises a sequence selected from the group consisting of the sequences established in SEQ ID NOs: 6-20.

[0096] In some embodiments, nucleic acid reduces FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand nucleic acid.

[0097] In some embodiments, the nucleic acid sequence complementary to human TGFBR2 comprises a sequence selected from the group consisting of the sequences established in SEQ ID NOs: 34-82.

[0098] In some embodiments, the nucleic acid reduces the expression of TGFBR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand the nucleic acid.

[0099] In some embodiments, the system comprises at least two nucleic acid sequences complementary to human TGFBR2 selected from the group consisting of sequences established in SEQ ID Nos: 34-82.

[0100] In some modalities, the system comprises at least one Petition 870250078695, dated 03 / 09 / 2025, page 30 / 387 18 / 291 first nucleic acid sequence complementary to a nucleic acid encoding human FAS comprising the sequence established in SEQ ID NO: 3, a second nucleic acid sequence complementary to a nucleic acid encoding human TGF-β Receptor 2 (TGFBR2) comprising the sequence established in SEQ ID NO: 4.

[0101] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence established in SEQ ID NO: 3.

[0102] In some embodiments, the first nucleic acid reduces FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the nucleic acid, and the second nucleic acid reduces TGFBR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell. control that does not include nucleic acid.

[0103] In some embodiments, the system additionally comprises a third nucleic acid sequence complementary to the mRNA encoding Human TGF-β Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4.

[0104] In some embodiments, the third nucleic acid reduces TGFBR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand the nucleic acid.

[0105] In some embodiments, it further comprises at least one nucleic acid sequence complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5.

[0106] In some forms, the nucleic acid sequence is Petition 870250078695, dated 03 / 09 / 2025, page 31 / 387 19 / 291 complementary to nucleotides 518 to 559 of a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence established in SEQ ID NO: 5.

[0107] In some embodiments, the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences established in SEQ ID NOs: 21-33.

[0108] In some embodiments, the nucleic acid reduces PTPN2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand the nucleic acid.

[0109] In some modalities, SPA is an activator of STAT phosphorylation, optionally of STAT1, STAT3 and / or STAT5 phosphorylation.

[0110] In some modalities, the SPA comprises an extracellular domain linked to an intracellular signaling domain.

[0111] In some embodiments, the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

[0112] In some forms, the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

[0113] In some modalities, the cytokine receptor comprises the interleukin-6 signal transducer (IL6ST).

[0114] In some modalities, the SPA comprises the sequence as set out in SEQ ID NO: 141 or 254.

[0115] In some forms, the extracellular domain transmits constitutive activity to the intracellular signaling domain.

[0116] In some modalities, the target cell is a human cell.

[0117] In some modalities, the target cell is a cancerous cell.

[0118] In some forms, the cancer cell is either a solid cancer cell or a liquid cancer cell. Petition 870250078695, dated 03 / 09 / 2025, page 32 / 387 20 / 291

[0119] In some forms, the cancerous cell is a kidney cell, a colon cell, or a lung cell.

[0120] In one aspect, nucleic acids comprising a nucleotide sequence encoding the antibodies disclosed in this document are provided in this document.

[0121] In one aspect, nucleic acids comprising a nucleotide sequence encoding the antibodies disclosed in this document are provided in this document.

[0122] In one aspect, nucleic acids comprising a nucleotide sequence encoding the chimeric antigen receptors disclosed in this document are provided herein.

[0123] In one aspect, nucleic acids comprising a nucleotide sequence encoding the priming receptors disclosed in this document are provided herein.

[0124] In one aspect, one or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the systems disclosed in this document are provided herein.

[0125] In one aspect, one or more nucleic acids are provided in this document, wherein one or more nucleic acids encode: i. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA); ii. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9); iii. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA) and Petition 870250078695, dated 03 / 09 / 2025, page 33 / 387 21 / 291 iv. at least one nucleic acid sequence with at least 15 nucleotides of length complementary to: 1. a nucleic acid encoding the human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 3; and 2. a nucleic acid encoding the Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4.

[0126] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence established in SEQ ID NO: 3.

[0127] In some embodiments, the first extracellular antigen-binding domain comprises a heavy chain comprising a first variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a light chain comprising a first variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: i. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124, and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 Petition 870250078695, dated 03 / 09 / 2025, page 34 / 387 22 / 291 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO: 137.

[0128] In some embodiments, the first VH string sequence comprises the VH sequence established in SEQ ID NO: 118 or 130 and the first VL string sequence comprises the VL sequence established in SEQ ID NO: 119 or 131.

[0129] In some embodiments, the first extracellular antigen-binding domain comprises the sequence established in SEQ ID NO: 117 or 129.

[0130] In some embodiments, the second extracellular domain-binding domain comprises a heavy chain comprising a second variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a light chain comprising a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally wherein i. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113.

[0131] In some forms, the second VH comprises the sequence as set out in SEQ ID NO: 99 or 110.

[0132] In some modalities, the second VL comprises the sequence Petition 870250078695, dated 03 / 09 / 2025, page 35 / 387 23 / 291 established in SEQ ID NO: 100.

[0133] In some embodiments, the second extracellular domain comprises the sequence established in SEQ ID NO: 98 or 110.

[0134] In some embodiments, at least one nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides long.

[0135] In some embodiments, at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0136] In some forms, at least one nucleic acid sequence is shRNA.

[0137] In some embodiments, at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-82.

[0138] In some embodiments, at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-20.

[0139] In some embodiments, at least one or more nucleic acids reduce FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand the nucleic acid.

[0140] In some embodiments, at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 34-82.

[0141] In some embodiments, at least one or more nucleic acids reduce TGFBR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand the nucleic acid. Petition 870250078695, dated 03 / 09 / 2025, page 36 / 387 24 / 291

[0142] In some embodiments, at least one or more nucleic acids additionally comprise at least one nucleic acid sequence complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5.

[0143] In some embodiments, the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence established in SEQ ID NO: 5.

[0144] In some embodiments, the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences established in SEQ ID NOs: 21-33.

[0145] In some embodiments, the nucleic acid reduces PTPN2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand the nucleic acid.

[0146] In some embodiments, at least one or more nucleic acid sequences are encoded in at least one intron region of the nucleic acid.

[0147] In some embodiments, the nucleic acid is selected from the group consisting of the sequences established in SEQ ID NOs: 143-147.

[0148] In one aspect, there are provided in this document one or more nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, a synthetic pathway activator (SPA); and at least one nucleic acid sequence of at least 15 nucleotides in length, in which at least one nucleic acid sequence Petition 870250078695, dated 03 / 09 / 2025, page 37 / 387 25 / 291 nucleic acid comprises one or more of: (1) a first nucleic acid sequence complementary to a nucleic acid encoding human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3, and (2) a second nucleic acid sequence complementary to a nucleic acid encoding human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4.

[0149] In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence established in SEQ ID NO: 3.

[0150] In one aspect, one or more nucleic acids comprising at least one nucleic acid fragment comprising the nucleic acids disclosed in this document are provided herein.

[0151] In some embodiments, the nucleic acid comprises two or more nucleic acid fragments.

[0152] In some embodiments, the nucleic acid additionally comprises an inducible promoter operationally linked to the nucleotide sequence encoding CAR.

[0153] In some embodiments, the nucleic acid additionally comprises a constitutive promoter operationally linked to the nucleotide sequence encoding the priming receptor.

[0154] In some embodiments, the nucleic acid additionally comprises an inducible promoter operationally linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operationally linked to the nucleotide sequence encoding the priming receptor.

[0155] In some modalities, the constituent promoter is EF1a.

[0156] In some embodiments, the EF^ promoter comprises a sequence as set out in SEQ ID NO: 179.

[0157] In some forms, the induceable promoter comprises a Petition 870250078695, dated 03 / 09 / 2025, pp. 38 / 387 26 / 291 or more Hepatocyte Nuclear Factor 1α (HNFIa) enhancing elements.

[0158] In some embodiments, the inducible promoter additionally comprises a YB-TATA promoter sequence.

[0159] In some embodiments, the inducible promoter comprises a sequence as set forth in SEQ ID NO: 256.

[0160] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, I, the constituent promoter; ii. the nucleotide sequence that codes for the priming receptor; iii. the induceable promoter; iv. the nucleotide sequence that codes for the chimeric antigen receptor; and v. the optional nucleotide sequence that encodes SPA.

[0161] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, I, the induceable promoter; ii. the nucleotide sequence that codes for the chimeric antigen receptor; iii. the constitutive promoter; and iv. the nucleotide sequence that encodes the priming receptor; and v. the optional nucleotide sequence that encodes SPA.

[0162] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, I, the first constituent promoter; ii. the nucleotide sequence that codes for the priming receptor; iii. the second constituent promoter; iv. the nucleotide sequence that codes for at least one nucleic acid complementary to human FAS or human TGFBR2; v. the induceable promoter; vi. the optional nucleotide sequence that codes for the antigen receptor Petition 870250078695, dated 03 / 09 / 2025, p. 39 / 387 27 / 291 chimeric; and vii. the nucleotide sequence that encodes the SPA.

[0163] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, i. the first constituent promoter; ii. the nucleotide sequence that codes for the priming receptor; iii. the second constituent promoter; iv. the nucleotide sequence that encodes the first nucleic acid complementary to human FAS or the nucleotide sequence that encodes the second nucleic acid complementary to human TGFBR2; v. the nucleotide sequence that encodes the first nucleic acid complementary to human FAS or the nucleotide sequence that encodes the second nucleic acid complementary to human TGFBR2; vi. the induceable promoter; vii. the nucleotide sequence that encodes the chimeric antigen receptor; and viii. the optional nucleotide sequence that encodes the SPA.

[0164] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, i. the induceable promoter; ii. the nucleotide sequence that codes for the chimeric antigen receptor; iii. the second constituent promoter; iv. the nucleotide sequence that encodes the first nucleic acid complementary to human FAS or the nucleotide sequence that encodes the second nucleic acid complementary to human TGFBR2; v. the nucleotide sequence that encodes the first nucleic acid complementary to human FAS or the nucleotide sequence that encodes the second nucleic acid complementary to human TGFBR2; vi. the first constituent promoter; and Petition 870250078695, dated 03 / 09 / 2025, page 40 / 387 28 / 291 vii. the nucleotide sequence that encodes the priming receptor; and viii. the optional nucleotide sequence that encodes the SPA.

[0165] In some embodiments, the nucleic acid is selected from the group consisting of the sequences established in SEQ ID NOs: 143-147.

[0166] In some embodiments, the nucleic acid additionally comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm complementary to an insertion site on a host cell chromosome.

[0167] In some embodiments, the nucleic acid additionally comprises a nucleotide sequence encoding a self-excising peptide 2A (P2A).

[0168] In some embodiments, P2A is at the 3' end of the nucleotide sequence that encodes the chimeric antigen receptor.

[0169] In some embodiments, P2A is at the 3' end of the nucleotide sequence that encodes the priming receptor.

[0170] In some embodiments, the nucleic acid additionally comprises a post-translational regulatory element of the marmot hepatitis virus (WPRE).

[0171] In some embodiments, the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor, or in which the WPRE is at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor.

[0172] In some embodiments, the nucleic acid additionally comprises an SV40 or a polyA element of human growth hormone (GH1).

[0173] In some embodiments, the nucleic acid is incorporated into an expression cassette or an expression vector.

[0174] In some forms, the expression vector is a non-expression vector. Petition 870250078695, dated 03 / 09 / 2025, page 41 / 387 29 / 291 viral.

[0175] In one aspect, vectors comprising the nucleic acids disclosed in this document are provided.

[0176] In some embodiments, the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a primary cell genome.

[0177] In some embodiments, the insertion site is located at a T-cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.

[0178] In one aspect, cells comprising are provided in this document: i. the systems disclosed in this document; ii. at least one nucleic acid disclosed in this document; and / or iii. the vectors disclosed in this document.

[0179] In some forms, the cell is an immune cell.

[0180] In one aspect, immune cells comprising are provided in this document: i. the systems disclosed in this document; ii. at least one nucleic acid disclosed in this document; and / or iii. the vectors disclosed in this document.

[0181] In primary human.

[0182] In allogeneic therapy.

[0183] In some some some modalities, modalities, modalities, immune cell immune cell immune cell an autologous immune cell cell immune cell.

[0184] In some forms, the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a progenitor T cell. Petition 870250078695, dated 03 / 09 / 2025, page 42 / 387 30 / 291

[0185] In some modalities, the primary immune cell is a primary T cell.

[0186] In some modalities, the primary immune cell is a primary human T cell.

[0187] In some embodiments, the primary immune cell is virus-free. A primary immune cell comprising at least one nucleic acid comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9 and, optionally, a synthetic pathway activator inserted into a target region of the primary immune cell genome, and wherein the primary immune cell does not comprise a viral vector for introducing the nucleic acid into the primary immune cell.

[0188] In one aspect, primary immune cells are provided in this document comprising at least one nucleic acid comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9 and, optionally, a synthetic pathway activator inserted into a target region of the primary immune cell genome, and wherein the primary immune cell does not comprise a viral vector for introducing the nucleic acid into the primary immune cell.

[0189] In one aspect, viable virus-free primary cells are provided in this document comprising a ribonucleoprotein (RNP)-nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the nucleic acid comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, and optionally a synthetic pathway activator and Petition 870250078695, dated 03 / 09 / 2025, page 43 / 387 31 / 291 where the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to the genomic sequences flanking an insertion site in the genome of the primary cell.

[0190] In some embodiments, the cell further comprises at least one nucleic acid sequence of at least 15 nucleotides in length, wherein at least one nucleic acid sequence comprises one or more of a first nucleic acid sequence complementary to a nucleic acid encoding human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3, and a second nucleic acid sequence complementary to a nucleic acid encoding human Transforming Growth Factor (TGF)β Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4.

[0191] In some embodiments, the nucleic acid comprising a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

[0192] In one aspect, cell populations comprising a plurality of immune cells disclosed in this document are provided.

[0193] In one aspect, pharmaceutical compositions comprising the cells or immune cells disclosed herein or the population of cells or immune cells disclosed herein and a pharmaceutically acceptable excipient are provided in this document.

[0194] In one aspect, pharmaceutical compositions comprising the nucleic acid disclosed herein or the vector disclosed herein and a pharmaceutically acceptable excipient are provided herein.

[0195] In one aspect, methods for editing a cell are provided in this document, comprising: inserting the disclosed nucleic acid into this Petition 870250078695, dated 03 / 09 / 2025, page 44 / 387 32 / 291 document in an insertion site in the cell genome.

[0196] In some forms, nucleic acid is introduced into the cell in a non-viral manner.

[0197] In one aspect, methods for editing a cell are provided in this document comprising: i. provide a nuclease domain and a guide RNA, wherein the nucleic acid comprises the nucleic acid disclosed in this document, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to the genomic sequences flanking an insertion site in the cell genome; ii. introduce the nuclease domain and nucleic acid into the cell, wherein the guide RNA hybridizes specifically with a target region of the cell's genome, and wherein the nuclease domain cleaves the target region to create the insertion site in the target cell's genome; and iii. edit the cell by inserting the nucleic acid into the insertion site in the cell's genome.

[0198] In some embodiments, the nuclease domain and nucleic acid are introduced into the cell in a non-viral manner.

[0199] In one aspect, methods for editing an immune cell are provided in this document, comprising: i. provide a ribonucleoprotein (RNP)-nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the nucleic acid comprises the nucleic acids disclosed in this document, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to the genomic sequences flanking an insertion site in the immune cell genome; ii. to introduce the RNP-nucleic acid complex into the immune cell in a non-viral manner, wherein the guide RNA hybridizes specifically with a target region of the primary immune cell genome, and wherein the nuclease domain cleaves the target region to create the insertion site in the immune cell genome; and Petition 870250078695, dated 03 / 09 / 2025, page 45 / 387 33 / 291 iii. edit the immune cell by inserting the nucleic acids disclosed in this document into the insertion site in the immune cell genome.

[0200] In some modalities, nonviral introduction involves electroporation.

[0201] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0202] In some modalities, the target region of the cell genome is a T-cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.

[0203] In some embodiments, the nucleic acid is either a double-stranded nucleic acid or a single-stranded nucleic acid.

[0204] In some embodiments, the nucleic acid is either a linear nucleic acid or a circular nucleic acid, optionally where the circular nucleic acid is a plasmid.

[0205] In some forms, the immune cell is a primary human immune cell.

[0206] In some forms, the immune cell is an autologous immune cell.

[0207] In some forms, the immune cell is an allogeneic immune cell.

[0208] In some forms, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a progenitor T cell.

[0209] In some modalities, the immune cell is a primary T cell.

[0210] In some forms, the immune cell is a primary human T cell.

[0211] In some forms, the immune cell is virus-free.

[0212] In some embodiments, it further involves obtaining a patient's cell and introducing the nucleic acid in vitro. Petition 870250078695, dated 03 / 09 / 2025, page 46 / 387 34 / 291

[0213] In one aspect, methods of treating a disease in a subject are provided in this document comprising administering the immune cells disclosed in this document or the pharmaceutical compositions disclosed in this document to the subject.

[0214] In some forms, the disease is cancer.

[0215] In some forms, the cancer is either solid or liquid.

[0216] In some forms, the cancer is kidney cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0217] In some modalities, the administration of the immune cell enhances an immune response in the subject.

[0218] In some modalities, the enhanced immune response is an adaptive immune response.

[0219] In some modalities, the enhanced immune response is an innate immune response.

[0220] In some modalities, the enhanced immune response is an increased expression of at least one cytokine or chemokine.

[0221] In some modalities, the cytokine is interferon-gamma (IFNy).

[0222] In some modalities, the method additionally involves administering immunotherapy to the subject simultaneously with the immune cell or subsequently to the immune cell.

[0223] In one aspect, methods of inhibiting a target cell in a subject are provided in this document comprising administering the immune cells disclosed in this document to the subject, wherein the immune cell inhibits the target cell.

[0224] In some modalities, the target cell expresses PSMA and CA9.

[0225] In some modalities, the target cell is a cancerous cell.

[0226] In one aspect, methods for inducing expression of a chimeric antigen receptor with a priming receptor in a cell or immune cell comprising: Petition 870250078695, dated 03 / 09 / 2025, page 47 / 387 35 / 291 i. obtain a cell or immune cell comprising: ii. the systems disclosed in this document; iii. the nucleic acids disclosed in this document; and / or iv. the vectors disclosed in this document; and v. placing the immune cell in contact with a target cell that expresses PSMA and CA9, where the binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor.

[0227] In one aspect, this document provides a method for modulating the activity of a cell or immune cell comprising: i. obtain a cell or immune cell comprising: ii. the systems disclosed in this document; iii. the nucleic acids disclosed in this document; and / or iv. the vectors disclosed in this document; and v. placing the cell or immune cell in contact with a target cell that expresses PSMA and CA9, wherein the binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, and wherein the binding of the chimeric antigen receptor to CA9 on the target cell modulates the activity of the immune cell.

[0228] In some modalities, modulating immune cell activity involves enhancing an immune response.

[0229] In some modalities, the enhanced immune response is an adaptive immune response.

[0230] In some modalities, the enhanced immune response is an innate immune response.

[0231] In some modalities, immune cell activity is an increased expression of at least one cytokine or chemokine.

[0232] In some modalities, the cytokine is interferon-gamma (IFNy).

[0233] In one aspect, this document provides methods for treating a disease in a subject comprising: Petition 870250078695, dated 03 / 09 / 2025, page 48 / 387 36 / 291 i. to determine or have determined the presence of PSMA-positive (PSMA+) cells in a cancer sample obtained from the subject; ii. to determine or have determined the presence of CA9-positive (CA+) cells in a cancer sample obtained from the subject; and iii. to administer a cell or immune cell disclosed in this document or a pharmaceutical composition disclosed in this document to the subject.

[0234] In some forms, the disease is cancer.

[0235] In some forms, the cancer is either solid or liquid.

[0236] In some forms, the cancer is kidney cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0237] In some modalities, the administration of the immune cell enhances an immune response in the subject.

[0238] In some modalities, the enhanced immune response is an adaptive immune response.

[0239] In some modalities, the enhanced immune response is an innate immune response.

[0240] In some modalities, the enhanced immune response is an increased expression of at least one cytokine or chemokine.

[0241] In some modalities, the cytokine is interferon-gamma (IFNy).

[0242] In some modalities, the method additionally involves administering immunotherapy to the subject simultaneously with the immune cell or subsequently to the immune cell. BRIEF DESCRIPTION OF THE VARIOUS VIEWS OF THE FIGURES

[0243] These and other features, aspects and advantages of this disclosure will be better understood in relation to the following description and attached figures, in which:

[0244] FIG. 1A provides a diagram of the various ICT transgene cassettes expressing Logic Gate 1-5 Integrated Circuits (ICs), shRNAs, and SPAs. FIG. 1B shows an exemplary insertion cassette encoding Petition 870250078695, dated 03 / 09 / 2025, page 49 / 387 37 / 291 a logic gate (priming receptor (primeR) and CAR) and a shRNA module.

[0245] FIG. 2A shows the binding of the CA9 1 antigen-binding fragment to HEK293T-CA9 cells (expressing human CA9), but not to HEK293T parental cells. FIG. 2B shows that the CA9 1 antigen-binding fragment did not bind to HEK293T-mCA9 cells (expressing mouse CA9). FIG. 2C shows that the CA9 1 antigen-binding fragment did not interact with HEK293T-ASGR1+ cells in a concentration range up to 5 ug / mL. Figure 2D shows that CA9 1 and CA9 2 bound to cells expressing wt CA9 (293T-LP81-CA9), as well as to cells expressing three different isoforms of CA9: 91-96del CA9, R131Q CA9, and Q326R CA9.

[0246] FIG. 3A shows the binding of the PSMA 1 antigen-binding fragment to HEK293T-PSMA cells (which express human PSMA), but not to HEK293T parental cells. FIG. 3B shows that the PSMA 1 antigen-binding fragment did not bind to HEK293T-mPSMA cells (which express mouse PSMA9). FIG. 3C shows that the scFvs of PSMA 1 and PSMA 2 bound to cells expressing the SNP Y75H isoform of PSMA and to cells expressing wt PSMA (293T-LP81-PSMA).

[0247] FIG. 4A shows that all ICT cells constitutively expressed the priming receptor construct (PrimeR). FIG. 4B shows that ICT cells induced CA9 CAR expression when co-cultured with cell lines expressing PSMA.

[0248] FIG. 5 shows that the inclusion of the shRNA module in ICT cells resulted in lower MFI for FAS and TGFBR2 in ICT cells expressing the logic gate of the priming receptor-CAR (PrimeR +) normalized to unedited cells (PrimeR-).

[0249] FIG. 6 shows that ICT cells expressing SPA exhibit approximately two logs higher pSTAT3 expression when compared to PrimeR- cells without SPA (EGFRt).

[0250] FIG. 7A shows cytotoxicity against parental K562 cells Petition 870250078695, dated 03 / 09 / 2025, page 50 / 387 Figure 7B shows cytotoxicity against K562 cells expressing only CA9, Figure 7C shows cytotoxicity against K562 cells expressing only PSMA. Figure 7D shows cytotoxicity against K562 cells expressing both PSMA and CA9.

[0251] FIG. 8 shows the production of IFN-γ from ICTs expressing Logic Gates 1-5 only in supernatants taken from co-cultures where target cells expressed only PSMA (left bar) and target cells with PSMA and CA9 (right bar).

[0252] FIG. 9A shows that ICTs expressing logic gates 1-5 demonstrated in vitro cytotoxicity against the A498-PSMAmed cell line expressing endogenous CA9 antigen. FIG. 9B shows secretion of IFNγ, TNFα, GM-CSF, and IL-2 by ICT cells after co-culture with A498-PSMA cells.

[0253] FIG. 10 shows that co-culture with HUVEC-PSMA induced CAR protein expression in ICT cells and specific CA9+ cell death.

[0254] FIG. 11A shows that the cytotoxicity of ICT was not affected by soluble CA9. FIG. 11B shows that the cytotoxicity of ICT was not affected by soluble PSMA.

[0255] FIG. 12A shows the tumor volume after tumor implantation in mice treated with ICTs expressing Logic Gates 1-5, RNP, or PBS generated from donor 1. FIG. 12B shows the total T cells and ICT expansion on day 12 after inoculation, followed by contraction on day 21. FIG. 12C shows the total T cells expressing the priming receptor on days 12 and 21. FIG. 12D shows the tumor volume after tumor implantation in mice treated with ICTs expressing Logic Gates 1-5, RNP, or PBS generated from donor 2. FIG. 12E shows the total T cells and ICT expansion on day 12 after inoculation, followed by contraction on day 21. Figure 12F shows the total number of T cells expressing the priming receptor on days 12 and 21.

[0256] FIG. 13A shows the inhibition of tumor growth (TGI) in Petition 870250078695, dated 03 / 09 / 2025, page 51 / 387 Figure 13B shows a single positive border for CA9 only. (Figure 13B shows inhibition of tumor growth (TGI) in the double positive PSMA-CA9 flank.)

[0257] FIG. 14 shows that TGFBR knockdown protects ICT cells against TGFe-mediated inhibition.

[0258] FIG. 15 shows an exemplary synthetic pathway activator and that synthetic pathway activators increase the potency and memory phenotype of the T-stem.

[0259] FIG. 16 shows that the ICT was more powerful than a conventional reference CAR-T.

[0260] FIG. 17A shows that ICT cells can be primed during transmigration and can kill CA9+ tumor cells. FIG. 17B shows that T cells can be primed during transmigration and can kill CA9+ tumor cells, while unprimed ICT cells did not demonstrate cytotoxicity.

[0261] FIG. 18 shows coexpression of PSMA and CA9 mRNA in ccRCC with limited overlapping expression in normal tissues.

[0262] FIG. 19 shows representative images of endothelial cells in ccRCC tumor samples stained with anti-PSMA at different staining intensities with 40X magnification and maximum PSMA intensity according to different stages of ccRCC disease.

[0263] FIG. 20 shows representative images of endothelial cells in ccRCC tumor samples stained with anti-CA9 at different staining intensities at 40X magnification and percentage of CA9 positivity in ccRCC tumor samples according to different stages of ccRCC disease.

[0264] FIG. 21A provides representative images of ccRCC tumor samples stained for PSMA and CA9 at 20X magnification. FIG. 21B shows the co-expression of PSMA and CA9 in ccRCC by IHC (n = 416). FIG. 21C provides the measurement of PSMA and CA9 co-expression in metastatic specimens.

[0265] FIG. 22 provides IHC staining images of CA9 and PSMA in Petition 870250078695, dated 03 / 09 / 2025, page 52 / 387 40 / 291 samples of ccRCC versus normal samples from adjacent kidneys.

[0266] FIG. 23 shows the percentage of samples from colorectal cancer patients, based on the CO1922 tissue microarray (TMA), that exhibited PSMA and CA9 expression.

[0267] FIG. 24 shows the percentage of cancer patients, based on the LC819a TMA, who exhibited PSMA and CA9 expression. The number of patient samples exhibiting positivity for PSMA and CA9 is listed as n, with the percentage (%) below.

[0268] FIG. 25 provides an estimated number of patients who may benefit from treatment with a PSMA primeR / CA9 CAR Logic Gate T-cell described in this document. The numbers are calculated based on estimates of new deaths from the indicated cancer types in 2023, from the American Cancer Society.

[0269] FIG. 26 provides a phase 1 study design. DETAILED DESCRIPTION Definitions

[0270] The terms used in the claims and descriptive report are defined as set forth below, unless otherwise specified.

[0271] As used in this document, the term “gene” refers to the basic unit of heredity, which consists of a segment of DNA arranged along a chromosome that codes for a specific protein or protein segment. A gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region. The gene may additionally comprise a terminator, enhancers, and / or silencers.

[0272] As used in this document, the term “locus” refers to a specific and fixed physical location on a chromosome where a gene or genetic marker is located.

[0273] The term “safe harbor locus” refers to a locus in which genes Petition 870250078695, dated 03 / 09 / 2025, p. 53 / 387 41 / 291 or genetic elements can be incorporated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also called safe harbor sites (SHS). As used in this document, a safe harbor locus refers to an “integration site” or “knockin site” into which a sequence encoding a transgene, as defined in this document, can be inserted. In some embodiments, insertion occurs with the substitution of a sequence that is located at the integration site. In some embodiments, insertion occurs without the substitution of a sequence at the integration site. Examples of contemplated integration sites are provided in Table D.

[0274] As used in this document, the term “insert” refers to a nucleotide sequence that is integrated (inserted) into a target locus safe harbor site. The insert may be used to refer to genes or genetic elements that are incorporated into the target locus or safe harbor site using, for example, homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods to insert nucleotide sequences into a genomic region known to those skilled in the art.

[0275] The term “insert” refers to a manipulation of a nucleotide sequence to introduce a non-native sequence. This is done, for example, through the use of restriction enzymes and ligases, whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes to create compatible overlaps and then using a ligase to join the molecules. A person skilled in the art is very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, “Molecular Cloning: A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any drawings, figures, and tables.

[0276] The “CRISPR / Cas” system refers to a generalized class of Petition 870250078695, dated 03 / 09 / 2025, p. 54 / 387 42 / 291 Bacterial systems for defense against foreign nucleic acid. CRISPR / Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR / Cas systems include subtypes I, II, and III. Wild-type II CRISPR / Cas systems use an RNA-mediated nuclease, Cas9, in complex with guide RNA and activator to recognize and cleave foreign nucleic acid. Guide RNAs with the activity of both a guide RNA and an activator RNA are also known in the art. In some cases, these dual-activity guide RNAs are called small guide RNAs (sgRNAs).

[0277] Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae, Verrucomicrobia, Chloroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Cas9 protein of Streptococcus pyogenes. Additional Cas9 proteins and homologs thereof are described in, for example, Chylinski, et al., RNA Biol. May 1, 2013; 10(5): 726-737; Nat. Rev. Microbiol. June 2011; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci US A. September 24, 2013;110(39):15644-9; Sampson et al., Nature. May 9, 2013;497(7448):254-7; and Jinek, et al., Science. August 17, 2012;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.

[0278] As used in this document, the term “Cas9” refers to an RNA-mediated nuclease (e.g., of bacterial or archaeological origin, or derived therefrom). Exemplary RNA-mediated nucleases include former Cas9 proteins and their homologs, and include, but are not limited to, CPF1 (See, for example, Zetsche et al., Cell, Volume 163, Issue 3, pages 759-771, October 22, 2015). Similarly, as used in this document, the term “Cas9 ribonucleoprotein complex” and similar terms refers to a complex between the Cas9 protein and a crRNA (e.g., guide RNA or Petition 870250078695, dated 03 / 09 / 2025, p. 55 / 387 43 / 291 (e.g., a small guide RNA), Cas9 protein and a trans-activating crRNA (tracrRNA), Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0279] As used in this document, the phrase “immune cell” includes all cell types that can generate immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell, or a T progenitor cell or dendritic cell. In some embodiments, the cell is an innate immune cell.

[0280] As used in this document, the term “primary” in the context of a primary cell or primary stem cell refers to a cell that has not been transformed or immortalized. These primary cells may be cultured, subcultured, or passed a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from an organism, system, organ, or tissue, optionally sorted and used, for example, directly, without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culture in the presence of) CD3, CD28, IL-2, IFN-γ agonists, or a combination thereof.

[0281] As used in this document, the terms “T lymphocyte” and “T cell” are used interchangeably and refer to cells that have completed maturation in the thymus and identify certain foreign antigens in the body. The terms also refer to the major types of leukocytes that have various roles in the immune system, including activation and deactivation of other immune cells. A T cell can be any T cell, such as a cultured T cell, for Petition 870250078695, dated 03 / 09 / 2025, page 56 / 387 44 / 291 For example, a primary T cell, or a T cell derived from a cultured T cell line, for example, a Jurkat, SupT1, etc., or a T cell obtained from a mammal. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. A T cell can be a CD3+ cell. T cells can be CD4+, CD8+, or both CD4+ and CD8+.A T cell can be any type of T cell: double-positive CD4+ / CD8+ T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral cells, including but not limited to, PBMCs, peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, γδ T cells, etc. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells).A T cell can also refer to a genetically modified T cell, such as a T cell that has been modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem cells or progenitor cells.

[0282] “CD4+ T cells” refers to a subset of T cells that express CD4 on their surface and are associated with a cellular immune response. CD4+ T cells are characterized by a post-stimulation secretion profile that may include the secretion of cytokines such as IFN-γ, TNF-α, IL2, IL-4, and IL-10. “CD4” is a 55 kDa glycoprotein originally defined as a differentiation antigen in T lymphocytes, but has also been found in other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been implicated as an element of Petition 870250078695, dated 03 / 09 / 2025, page 57 / 387 45 / 291 associative recognition in immune responses restricted to MHC (major histocompatibility complex) class II. In T lymphocytes, the CD4 antigen defines a helper / inducer subset.

[0283] “CD8+ T cells” refers to a subset of T cells that express CD8 on their surface, are restricted to MHC class I, and function as cytotoxic T cells. The “CD8” molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in restriction interactions of the major histocompatibility complex class I.

[0284] As used in this document, the phrase “hematopoietic stem cell” refers to a type of stem cell that can generate a blood cell. Hematopoietic stem cells can generate cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are found predominantly in the bone marrow, although they can be isolated from peripheral blood or a fraction thereof. Several cell surface markers can be used to identify, classify, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells are identified as c-kit+ and lin-. In some cases, human hematopoietic stem cells are identified as CD34+, CD59+, Thy1 / CD90+, CD38lo / -, C-kit / CD117+, lin-. In some cases, human hematopoietic stem cells are identified as CD34-, CD59+, Thy1 / CD90+, CD38lo / -, C-kit / CD117+, lin-.In some cases, human hematopoietic stem cells are identified as CD133+, CD59+, Thy1 / CD90+, CD38lo / -, C-kit / CD117+, lin-. In some cases, mouse hematopoietic stem cells are identified as CD34lo / -, SCA-1+, Thy1+ / lo, CD38+, C-kit+, lin-. In some cases, hematopoietic stem cells are CD150+CD48CD244-.

[0285] As used in this document, the phrase “hematopoietic cell” refers to a cell derived from a hematopoietic stem cell. The cell Petition 870250078695, dated 03 / 09 / 2025, page 58 / 387 46 / 291 Hematopoietic stem cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood or a fraction thereof). Alternatively, a hematopoietic stem cell can be isolated and the hematopoietic stem cell obtained or provided by differentiation of the stem cell. Hematopoietic cells include cells with limited potential to differentiate into other cell types. These hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include cells of the lymphoid and myeloid lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes, and thrombocytes.

[0286] As used in this document, the term “construct” refers to a complex of molecules, including macromolecules or polynucleotides.

[0287] As used in this document, the term “integration” refers to the process of stable insertion of one or more nucleotides of a construct into the cell's genome, that is, covalent linkage to a nucleic acid sequence in the cell's chromosomal DNA. It may also refer to nucleotide deletions at an integration site. When there is a deletion at the insertion site, “integration” may additionally include the replacement of the deleted endogenous sequence or nucleotide with one or more inserted nucleotides.

[0288] As used in this document, the term “exogenous” refers to a molecule or activity that has been introduced into a host cell and is not native to that cell. The molecule may be introduced, for example, by the introduction of the coding nucleic acid into the host genetic material, such as by integration into a host chromosome or as non-chromosomal genetic material, such as a plasmid. Therefore, the term, when used in reference to the expression of a coding nucleic acid, refers to the introduction of the coding nucleic acid into a cell in an expressible form. The term “endogenous” refers to a molecule or activity that Petition 870250078695, dated 03 / 09 / 2025, page 59 / 387 47 / 291 is present in a host cell under unedited natural conditions. Similarly, the term, when used in connection with coding nucleic acid expression, refers to the expression of coding nucleic acid that is contained within the cell and not introduced exogenously.

[0289] The term “heterologous” refers to a nucleic acid or polypeptide sequence or domain that is not native to a flanking sequence, for example, where the heterologous sequence is not found in nature coupled to nucleic acid or polypeptide sequences that occur at one or both ends.

[0290] The term “homologous” refers to a nucleic acid or polypeptide sequence or domain that is native to a flanking sequence, for example, where the homologous sequence is found in nature coupled to nucleic acid or polypeptide sequences that occur at one or both ends.

[0291] As used in this document, a “polynucleotide donor construct” refers to a nucleotide sequence (e.g., DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct may include prokaryotic sequences, eukaryotic mRNA cDNA, genomic DNA sequences from eukaryotic DNA (e.g., mammalian), and synthetic DNA sequences. For example, the polynucleotide donor construct may be a miRNA, shRNA, natural polypeptide (i.e., a naturally occurring polypeptide) or fragment thereof, or a variant polypeptide (e.g., a natural polypeptide with less than 100% sequence identity to the natural polypeptide) or fragments thereof.

[0292] As used in this document, the term “complementary” or “complementarity” refers to the specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described in this document Petition 870250078695, dated 03 / 09 / 2025, page 60 / 387 48 / 291 may comprise sequences, for example, DNA targeting sequences that are perfectly complementary or substantially complementary (e.g., with 1-4 mismatches) to a genomic sequence in a cell.

[0293] As used in this document, the term “transgene” refers to a polynucleotide that has been transferred naturally, or by any of a number of genetic manipulation techniques, from one organism to another. It is optionally translated as a polypeptide. As used, transgene can refer to a polynucleotide that codes for a polypeptide.

[0294] The terms “protein”, “polypeptide” and “peptide” are used interchangeably in this document.

[0295] As used in this document, the term “operationally linked” or “operationally bound” refers to the linking of a nucleic acid sequence to a single nucleic acid fragment such that the function of one is affected by the other. For example, if a promoter is able to affect the expression of a coding sequence or functional RNA (that is, the coding sequence or functional RNA is under transcriptional control by the promoter), the promoter is operationally linked to it. Coding sequences can be operationally linked to control sequences in a sense or antisense orientation.

[0296] As used in this document, the term “cell developmental states” refers, for example, to states in which the cell is inactive, actively expressing, differentiating, senescent, etc. The cell developmental state may also refer to a cell in a precursor state (e.g., a T cell precursor).

[0297] As used, the term “coding” refers to a nucleic acid sequence that codes for a protein or polypeptide of interest. The nucleic acid sequence can be a DNA or RNA molecule. In preferred embodiments, the molecule is a DNA molecule. In other preferred embodiments, the molecule is an RNA molecule. When Petition 870250078695, dated 03 / 09 / 2025, page 61 / 387 49 / 291 present as an RNA molecule, it will comprise sequences that direct the host cell's ribosomes to initiate translation (e.g., an initiation codon, ATG) and direct the ribosomes to terminate translation (e.g., a stop codon). Between the initiation codon and the stop codon there is an open reading frame (ORF). These methods are well known to those skilled in the art.

[0298] As used in this document, the term “subject” refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with a manipulated cell provided in this document or a population thereof. In some embodiments, the disease or condition is cancer.

[0299] As used in this document, the term “promoter” refers to a nucleotide sequence (e.g., DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximal and distal upstream elements, the latter often being called enhancers. A promoter may be derived from natural genes in their entirety, may be composed of different elements from different promoters found in nature, and / or may even comprise segments of synthetic DNA. A promoter, as contemplated in this document, may be endogenous to the cell of interest or exogenous to the cell of interest. It is appreciated by those skilled in the art that different promoters may induce gene expression in different tissues or cell types, or at different stages of development, or in response to different environmental conditions.As is known in the art, a promoter can be selected according to the promoter's strength and / or the conditions under which the promoter is active, for example, constitutive promoter, strong promoter, weak promoter, inducible / repressible promoter, tissue-specific or regulated promoters. Petition 870250078695, dated 03 / 09 / 2025, page 62 / 387 50 / 291 development, cell cycle-dependent promoters and similar.

[0300] A promoter can be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, Hepatocyte Nuclear Factor 1α (HNFIa), etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter, EF1a promoter). In some embodiments, the promoter can be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type-specific promoter, etc.). See, for example, US Publication 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0301] Gene editing, as discussed in this document, can involve a gene (or nucleotide sequence) knock-in or knock-out. As used in this document, the term “knock-in” refers to the addition of a DNA sequence, or fragment thereof, to a genome. Such DNA sequences to be added may include an entire gene or genes, may include regulatory sequences associated with a gene, or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a protein may be inserted into the genome of a cell carrying a mutant gene. In some embodiments, a knock-in strategy involves replacing an existing sequence with the supplied sequence, for example, replacing a mutant allele with a wild-type copy. Conversely, the term “knock-out” refers to the deletion of a gene or the expression of a gene.For example, a gene can be eliminated by a deletion or addition of a nucleotide sequence that leads to a disruption of the reading frame. As another example, a gene can be eliminated by replacing a part of the gene with an irrelevant (e.g., non-coding) sequence.

[0302] As used in this document, the term “non-homologous end joining” or NHEJ refers to a cellular process in which ends Petition 870250078695, dated 03 / 09 / 2025, p. 63 / 387 51 / 291 cut or notched sections of a DNA strand are directly joined without the need for a homologous nucleic acid template. NHEJ can lead to the addition, deletion, substitution, or a combination thereof, of one or more nucleotides at the repair site.

[0303] As used in this document, the term “homology-directed repair” or HDR refers to a cellular process in which cut or nicked ends of a DNA strand are repaired by polymerization of a homologous template nucleic acid. Thus, the original sequence is replaced by the template sequence. The homologous template nucleic acid can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repeated regions on the same chromosome or on different chromosomes). Alternatively, an exogenous template nucleic acid can be introduced to achieve a specific HDR-induced change in the sequence at the target site. In this way, specific mutations can be introduced at the cleavage site.

[0304] As used in this document, a “DNA template,” “DNA template insert,” “single-stranded DNA template,” “single-stranded DNA template insert,” “double-stranded DNA template,” or “double-stranded DNA template insert” refers to a DNA oligonucleotide that can be used by a cell as a template for HDR. Generally, a single-stranded DNA template or a double-stranded DNA template has at least one region of homology with a target site. In some cases, the single-stranded DNA template or the double-stranded DNA template has two homologous regions flanking a region containing a heterologous sequence to be inserted into a target cleavage site. In some embodiments, the DNA template or DNA template insert comprises a cassette or expression cassette comprising one or more modules encoding transgenes and / or RNAi molecules disclosed in this document.

[0305] The terms “expression vector”, “vector” and “plasmid” are used interchangeably and, as used in this document, refer to vehicles. Petition 870250078695, dated 03 / 09 / 2025, page 64 / 387 52 / 291 polynucleotides useful for introducing genetic material into a cell. Vectors can be linear or circular. Vectors can integrate into the target genome of a host cell or replicate independently in a host cell. Vectors may comprise, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically comprises an expression cassette or cassette. Vectors and plasmids include, but are not limited to, integration vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0306] As used in this document, the phrase “introduce” in the context of introducing a nucleic acid or a complex comprising a nucleic acid, for example, an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or the RNP-DNA template complex from outside a cell into the cell. In some cases, introduction refers to the translocation of the nucleic acid or complex from outside the cell into the cell nucleus. Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, and the like.

[0307] As used in this document, the term “expression cassette” or “cassette” is a recombinantly generated or chemically synthesized polynucleotide construct comprising regulatory sequences operationally linked to a selected polynucleotide to facilitate the expression of the selected polynucleotide in a host cell. Such cassettes may include one or more modules comprising the selected polynucleotide, such as transgenes (e.g., a CAR, a priming receptor, and / or a synthetic pathway activator described in this document) and / or RNAi molecules (e.g., an shRNA) disclosed in this document. For example, regulatory sequences may facilitate the transcription of Petition 870250078695, dated 03 / 09 / 2025, page 65 / 387 53 / 291 selected polynucleotide in a host cell, or the transcription and translation of the selected polynucleotide in a host cell. An expression cassette can, for example, be integrated into the genome of a host cell or be present in an expression vector. In some embodiments, the cassette is part of a DNA template insert.

[0308] As used in this document, the phrase “subject in need” refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder as described in this document.

[0309] A “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include “antihormonal agents” or “endocrine therapists” that act to regulate, reduce, block, or inhibit the effects of hormones that may promote cancer growth.

[0310] The term “composition” refers to a mixture containing, for example, a manipulated cell or protein contemplated in this document. In some embodiments, the composition may contain additional components such as adjuvants, stabilizers, excipients and the like. The term “composition” or “pharmaceutical composition” refers to a preparation whose form allows the biological activity of an active ingredient contained therein to be effective in the treatment of a subject, and which does not contain additional components that are unacceptably toxic to the subject in the quantities provided in the pharmaceutical composition.

[0311] The term “in situ” refers to processes that occur in a living cell that grows separately from a living organism, for example, growing in tissue culture.

[0312] The term “in vivo” refers to processes that occur in a living organism.

[0313] As used in this document, the term “ex vivo” generally includes experiments or measurements performed on or in living tissue, Petition 870250078695, dated 03 / 09 / 2025, page 66 / 387 54 / 291 preferably in an artificial environment outside the organism, preferably with minimal differences from natural conditions.

[0314] The term “mammal” as used in this document includes humans and non-humans and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines and porcines.

[0315] The term “percent identity”, in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of identical nucleotides or amino acid residues when compared and aligned for maximum match, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those versed in the field) or by visual inspection. Depending on the application, the “percent identity” may exist in a region of the sequence being compared, for example, in a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0316] For sequence comparison, one sequence typically acts as a reference sequence, to which the test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, subsequence coordinates are assigned if necessary, and the sequence algorithm program parameters are assigned. The sequence comparison algorithm then calculates the sequence identity percentage for the test sequences with respect to the reference sequence, based on the assigned program parameters.

[0317] The ideal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the similarity search method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. EUA Petition 870250078695, dated 03 / 09 / 2025, page 67 / 387 55 / 291 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see, in general, Ausubel et al., below).

[0318] An example of an algorithm that is suitable for determining sequence identity and sequence similarity percentage is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). The software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov / ).

[0319] The term “sufficient quantity” means a quantity sufficient to produce a desired effect, for example, a quantity sufficient to modulate protein aggregation in a cell.

[0320] The term “therapeutically effective quantity” is a quantity that is effective in improving a symptom of a disease.

[0321] The term “improvement” refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a decrease in severity or progression, remission or cure thereof.

[0322] As used in this document, the term “effective amount” refers to the amount of a composition (e.g., a composition described in this document, cells described in this document) sufficient to effect beneficial or desired results. An effective amount may be administered in one or more administrations, applications, or dosages and is not intended to be limited to a particular formulation or route of administration.

[0323] As used in this document, the term “treatment” includes any effect, for example, diminishing, reducing, modulating, improving or eliminating, that results in the improvement of the condition, disease, disorder and the like, or in the improvement of a symptom thereof.

[0324] The terms “modulated” and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing a recited variable. Petition 870250078695, dated 03 / 09 / 2025, p. 68 / 387 56 / 291

[0325] The terms “increase” and “activate” refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, 100 times or more in a recited variable.

[0326] The terms “reduce” and “inhibit” refer to a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 50 times, 100 times or more in a recited variable.

[0327] Regarding the binding of an antibody to a target molecule, the terms “bind,” “specific binding,” “binds specifically to,” “specific for,” “binds selectively,” and “selective for” a particular antigen (e.g., a polypeptide target) or an epitope on a particular antigen means binding that is measurably different from a non-specific or non-selective interaction (e.g., with a non-target molecule). For example, an antibody that “binds selectively” or “binds specifically” to an antigen is an antigen-binding fraction that binds to the antigen with high affinity and does not bind significantly to other unrelated antigens. Specific binding can be measured, for example, by measuring binding to a target molecule and comparing it to binding to a non-target molecule. Specific binding can also be determined by competition with a control molecule that mimics the recognized epitope on the target molecule.In this case, specific binding is indicated if the binding of the antibody to the target molecule is competitively inhibited by the control molecule.

[0328] “Affinity” refers to the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope). Unless otherwise indicated, as used in this document, “affinity” refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen or epitope). The affinity of a molecule X for its partner Y may be Petition 870250078695, dated 03 / 09 / 2025, p. 69 / 387 57 / 291 represented by the dissociation equilibrium constant (Kd). The kinetic components that contribute to the dissociation equilibrium constant are described in more detail below. Affinity can be measured by common methods known in the art, including, but not limited to, surface plasmon resonance (SPR) technology (e.g., BIACORE®) or biolayer interferometry (e.g., FORTEBIO®).

[0329] The term “hypervariable region” or “HVR,” as used in this document, refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops (“hypervariable loops”). Generally, four-chain native antibodies comprise six HVRs; three in the VH (H1, H2, H3), and three in the VL (L1, L2, L3). HVRs generally comprise amino acid residues of the hypervariable loops and / or form the complementarity-determining regions (CDRs), the latter being of greater sequence variability and / or involved in antigen recognition. With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops.Hypervariable regions (HVRs) are also called “complementarity-determining regions” (CDRs), and these terms are used interchangeably in this document in reference to portions of the variable region that form the antigen-binding regions. This particular region was described by Kabat et al., US Dept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and by Chothia et al., J Mol Biol 196:901-917 (1987), where the definitions include overlaps or subsets of amino acid residues when compared to each other. However, the application of any definition to refer to a CDR of an antibody or variants thereof is intended to be within the scope of the term as defined and used in this document. The exact number of residues comprising a particular CDR will vary depending on the sequence and size of the CDR.Those skilled in the art can routinely determine which residues comprise a particular RDF given a. Petition 870250078695, dated 03 / 09 / 2025, page 70 / 387 58 / 291 amino acid sequence of the antibody variable region.

[0330] The term “CDR” denotes a complementarity-determining region, as defined by at least one way of identification for a person skilled in the art.

[0331] The amino acid sequence limits of a CDR can be determined by a person skilled in the art using any of a number of known numbering schemes, including those described by Kabat et al., supra (Kabat numbering scheme); Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (Chothia numbering scheme); Martin (Chothia or enhanced AbM) Abhinandan and Martin, Mol Immunol. 2008 Aug;45(14):3832-9; MacCallum et al., 1996, J. Mol. Biol. 262:732-745 (Contact numbering scheme); Lefranc et al., Dev. Comp. Immunol., 2003, 27:5577 (numbering scheme of “IMGT”); and Honegger and Plückthun, J. Mol. Biol., 2001, 309:657-70 (numbering scheme of “AHo”); each of which is incorporated by reference in its entirety.

[0332] Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat, Chothia, AbM, Contact, and IMGT numbering schemes. For CDR-H1, residue numbering is provided using the Kabat and Chothia numbering schemes.

[0333] CDRs can be assigned, for example, using antibody numbering software, such as Abnum, available at bioinf.org.uk / abs / abnum / and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, incorporated by reference in its entirety, and AbYsis, available at abysis.org / abysis / sequence_input / key_annotation / key_annotation.cgi. Table A. Residues in CDRs according to the Kabat, Chothia, AbM, Contact and IMGT numbering schemes. CDR Kabat Chothia AbM Contact IMGT L1 L24-L34 L24-L34 L24-L34 L30-L36 L27-L32 L2 L50-L56 L50-L56 L50-L56 L46-L55 L50-L51 L3 L89-L97 L89-L97 L89-L97 L89-L96 L89-L97 Petition 870250078695, dated 03 / 09 / 2025, p. 71 / 387 59 / 291 H1 (Kabat numbering) H31-H35B H26-H32 or H34* H26-H35B H30-H35B H26-H35B H1 (Chothia / Martin numbering) H31-H35 H26-H32 H26-H35 H30-H35 H26-H33 H2 H50-H65 H52-H56 H50-H58 H47-H58 H51-H56 H3 H95-H102 H95-H102 H95-H102 H93-H101 H93-H102 * The C terminal of CDR-H1, when numbered using the Kabat numbering convention, varies between H32 and H34, depending on the length of the CDR.

[0334] The “EU numbering system” is generally used when referring to a residue in a constant region of an antibody heavy chain (e.g., as reported in Kabat et al., supra). Unless otherwise indicated, the EU numbering scheme is used to refer to residues in the constant regions of the antibody heavy chain described in this document.

[0335] As used in this document, the term “single chain” refers to a molecule comprising amino acid monomers linearly linked by peptide bonds. In particular, in such an embodiment, the C-terminus of the Fab light chain is connected to the N-terminus of the Fab heavy chain in the single-chain Fab molecule. As described in more detail in this document, a scFv has a variable light chain (VL) domain connected from its C-terminus to the N-terminal end of a variable heavy chain (VH) domain by a polypeptide chain. Alternatively, the scFv is composed of a polypeptide chain where the C-terminal end of the VH is connected to the N-terminal end of the VL by a polypeptide chain.

[0336] The “Fab fragment” (also known as the antigen-binding fragment) contains the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain, along with the variable domains VL and VH in the light and heavy chains, respectively. The variable domains comprise the complementarity-determining loops (CDR, Petition 870250078695, dated 03 / 09 / 2025, page 72 / 387 60 / 291 (also called the hypervariable region) which are involved in antigen binding. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the CH1 heavy chain domain, including one or more cysteines from the antibody hinge region.

[0337] “F(ab')2” fragments contain two Fab' fragments joined, near the hinge region, by disulfide bonds. F(ab')2 fragments can be generated, for example, by recombinant or synthetic methods or by pepsin digestion of an intact antibody. F(ab') fragments can be dissociated, for example, by treatment with β-mercaptoethanol.

[0338] “Fv” fragments comprise a non-covalently linked dimer of a variable heavy chain domain and a variable light chain domain.

[0339] The “single-chain Fv” or “scFv” includes the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. In one embodiment, the Fv polypeptide additionally comprises a polypeptide linker between the VH and VL domains, which allows the scFv to form the desired structure for antigen binding. For a review of scFv, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer-Verlag, New York, pages 269-315 (1994). HER2 antibody scFv fragments are described in WO93 / 16185; U.S. Patent No. 5,571,894; and U.S. Patent No. 5,587,458.

[0340] The term “single-domain antibody” or “sdAb” refers to a molecule in which one variable domain of an antibody binds specifically to an antigen without the presence of the other variable domain. Single-domain antibodies and fragments thereof are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety. Single-domain antibodies are also known as sdAbs or nanobodies. sdAbs are quite stable and easy to express as fusion partners with the Fc chain of an antibody (Harmsen MM, De Haard). Petition 870250078695, dated 03 / 09 / 2025, page 73 / 387 61 / 291 HJ (2007). “Properties, production and applications of camel single-domain antibody fragments”. Appl. Microbiol Biotechnol. 77(1): 13-22). The terms “single-domain antibody” and “sdAb” are used interchangeably in this document to refer to an antibody comprising at least one monomeric domain, such as a VHH domain, or a VNAR domain (from a shark antibody) without a light chain and an Fc region.

[0341] The term “VHH” or “VHH domain” or “VHH antigen-binding domain”, as used in this document, refers to the antigen-binding portion of a single-domain antibody (sdAb), such as a camelid antibody. In some embodiments, a VHH comprises three CDRs and four structural regions, designated FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4.

[0342] It should be noted that, as used in this descriptive report and the accompanying claims, the singular forms “a”, “an” and “the” include plural referents, unless the context clearly indicates otherwise. Antibodies and antigen-binding fragments PSMA antibodies, antigen-binding fragments, CDRs, VH and VL domains

[0343] In some respects, isolated antibodies or antigen-binding fragments that bind to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2) are provided in this document. PSMA is also known as FOLH1 or Folate Hydrolase 1 (HGNC: 3788, NCBI Entrez Gene: 2346, Ensembl: ENSG00000086205, UniProtKB / Swiss-Prot: Q04609). The amino acid sequence of PSMA is provided in SEQ ID NO: 3.

[0344] In some aspects, antibodies or antigen-binding fragments thereof that bind to PSMA are provided in this document. In some aspects, means for binding to PSMA are provided in this document. In some embodiments, the means for binding to PSMA comprises an antibody or antigen-binding fragment provided in this document. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof comprises means for binding a PSMA protein, Petition 870250078695, dated 03 / 09 / 2025, p. 74 / 387 62 / 291 optionally linking a human PSMA protein to the human PSMA regions bound by the PSMA linkers (e.g., as described in the Examples below). In some embodiments, the medium binds to a PSMA protein. In some embodiments, the medium binds to a human PSMA protein. In some embodiments, the medium is a PSMA antibody or antigen-binding fragment or equivalent thereof (e.g., a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) for binding a PSMA protein. In some embodiments, the PSMA-binding medium includes the anti-PSMA antibodies and antigen-binding fragments or equivalents thereof described in this document.

[0345] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document binds to human PSMA. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document does not bind to mouse PSMA. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document binds to human PSMA isoforms, including, but not limited to, a PSMA protein comprising a single nucleotide polymorphism (SNP) Y75H compared to SEQ ID NO: 2.

[0346] In some aspects, the PSMA antibody or antigen-binding fragment or equivalent thereof comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDRs, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131. In some embodiments, CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 Petition 870250078695, dated 03 / 09 / 2025, page 75 / 387 63 / 291 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124, and CDR-L3 comprises the sequence established in SEQ ID NO: 125. In some embodiments, CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO: 137. In some embodiments, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 comprise a sequence as established in Table B. Table B: CDR sequences of the PSMA ligand according to different definitions. SEQ ID NO Name Definition Sequence 120 PSMA 1 CDR-H1 Chothia GYTFTSY— 199 PSMA 1 CDR-H1 AbM GYTFTSYGIT 200 PSMA 1 CDR-H1 Kabat -----SYGIT 201 PSMA 1 CDR-H1 Contact —TSYGIT 202 PSMA 1 CDR-H1 IMGT GYTFFTSYG- 121 PSMA 1 CDR-H2 Chothia -----SEYNGN--------- 203 PSMA 1 CDR-H2 AbM —WISEYNGNTN------- 204 PSMA 1 CDR-H2 Kabat —WISEYNGNTNYAQKFQG 205 PSMA 1 CDR-H2 Contact WMGWISEYNGNTN------- 206 PSMA 1 CDR-H2 IMGT —ISEYNGNT-------- 122 PSMA 1 CDR-H3 Chothia -GGILPYYFFYYMDV 122 PSMA 1 CDR-H3 AbM -GGILPYYFFYYMDV 122 PSMA 1 CDR-H3 Kabat -GGILPYYFFYYMDV Petition 870250078695, 03 / 09 / 2025, pág. 76 / 387 64 / 291 207 PSMA 1 CDR-H3 Contact ARGGILPYYFFYYMD- 208 PSMA 1 CDR-H3 IMGT ARGGILPYYFFYYMDV 123 PSMA 1 CDR-L1 Chothia RASQSVSSSYLA- 123 PSMA 1 CDR-L1 AbM RASQSVSSSYLA- 123 PSMA 1 CDR-L1 Kabat RASQSVSSSYLA- 209 PSMA 1 CDR-L1 Contact ------SSSYLAWY 210 PSMA 1 CDR-L1 IMGT —QSVSSSY— 124 PSMA 1 CDR-L2 Chothia —GASSRAT 124 PSMA 1 CDR-L2 AbM —GASSRAT 124 PSMA 1 CDR-L2 Kabat —GASSRAT 211 PSMA 1 CDR-L2 Contact LLIYGASSRA- PSMA 1 CDR-L2 IMGT —GA----- 125 PSMA 1 CDR-L3 Chothia QQYGSSPYT 125 PSMA 1 CDR-L3 AbM QQYGSSPYT 125 PSMA 1 CDR-L3 Kabat QQYGSSPYT 212 PSMA 1 CDR-L3 Contact QQYGSSPY- 125 PSMA 1 CDR-L3 IMGT QQYGSSPYT 132 PSMA2 CDR-H1 Chothia GYTFSSY— 263 PSMA2 CDR-H1 AbM GYTFSSYGVS 213 PSMA2 CDR-H1 Kabat -----SYGVS 214 PSMA2 CDR-H1 Contact —S SYGVS 215 PSMA2 CDR-H1 IMGT GYTFSSYG- 133 PSMA2 CDR-H2 Chothia -----SKYNGN--------- 216 PSMA2 CDR-H2 AbM —WISKYNGNTN------- 217 PSMA2 CDR-H2 Kabat —WISKYNGNTNYAQKFQG 218 PSMA2 CDR-H2 Contact WMGWISKYNGNTN------- Petition: 870250078695, on September 3, 2025, page. 77 / 387 65 / 291 219 PSMA 2 CDR-H2 IMGT —ISKYNGNT-------- 134 PSMA2 CDR-H3 Chothia -GGIHGDSYYFYYLDV 134 PSMA2 CDR-H3 AbM -GGIHGDSYYFYYLDV 134 PSMA2 CDR-H3 Kabat -GGIHGDSYYFYYLDV 220 PSMA2 CDR-H3 Contact ARGGIHGDSYYFYYLD- 221 PSMA2 CDR-H3 IMGT ARGGIHGDSYYFYYLDV 135 PSMA2 CDR-L1 Chothia GASQSVSSSYLA- 135 PSMA2 CDR-L1 AbM GASQSVSSSYLA- 135 PSMA2 CDR-L1 Kabat GASQSVSSSYLA- 222 PSMA2 CDR-L1 Contact ------SSSYLAWY 223 PSMA2 CDR-L1 IMGT —QSVSSSY— 136 PSMA2 CDR-L2 Chothia —DASSRAT 136 PSMA2 CDR-L2 AbM —DASSRAT 136 PSMA2 CDR-L2 Kabat —DASSRAT 224 PSMA2 CDR-L2 Contact LLIYDASSRA- PSMA2 CDR-L2 IMGT —DA----- 137 PSMA2 CDR-L3 Chothia QQYGSSPYT 137 PSMA2 CDR-L3 AbM QQYGSSPYT 137 PSMA2 CDR-L3 Kabat QQYGSSPYT 225 PSMA2 CDR-L3 Contact QQYGSSPY- 137 PSMA2 CDR-L3 IMGT QQYGSSPYT

[0347] In some embodiments, the VH chain sequence comprises the sequence established in SEQ ID NO: 118. In some embodiments, the VH chain sequence comprises the sequence established in SEQ ID NO: 130. In some embodiments, the VL comprises the sequence established in SEQ ID NO: 119. In some embodiments, the VL comprises the sequence established in SEQ ID NO: 131. In some embodiments, the PSMA antibody Petition 870250078695, dated 03 / 09 / 2025, page 78 / 387 66 / 291 or antigen-binding fragment or equivalent thereof comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 117. In some embodiments, the PSMA antibody or antigen-binding fragment or equivalent thereof comprises an extracellular domain comprising the sequence set forth in SEQ ID NO: 129.

[0348] In some embodiments, the PSMA antibody or antigen-binding fragment or equivalent of these CDR-H3s has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H3 of SEQ ID NO: 122 or 134, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H2 of SEQ ID NO: 121 or 133, the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H1 of SEQ ID NO: 120 or 132, the CDR-L3 has at least about 50%, 75%, 80%, CDR-L3 has at least approximately 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-L2 of SEQ ID NO: 124 or 136, and CDRL1 has at least approximately 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-L1 of SEQ ID NO: 123 or 135.In some embodiments, CDRH3 is a CDR-H3 with SEQ ID NO: 122 or 134, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H2 is a CDR-H2 with SEQ ID NO: 121 or 133, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H1 is a CDR-H1 with SEQ ID NO: 120 or 132, with up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L3 is a CDR-L3 with SEQ ID NO: 125 or 137, with up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L2 is a CDR-L2 of SEQ ID NO: 124 or 136, with up to 1, 2, 3, or 4 amino acid substitutions; and CDRL1 is a CDR-L1 of SEQ ID NO: 123 or 135, with up to 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0349] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent provided herein comprises one to three CDRs of a VH domain as set forth in SEQ ID NO: 118 or 130. In some embodiments, a PSMA antibody or fragment Petition 870250078695, dated 03 / 09 / 2025, page 79 / 387 The antigen-binding antibody or equivalent provided in this document comprises two to three CDRs of an HV domain as set forth in SEQ ID Nos: 118 or 130. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent provided in this document comprises three CDRs of an HV domain as set forth in SEQ ID Nos: 118 or 130. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0350] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VH sequence with at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to a VH sequence established in SEQ ID NO: 118 or 130. In some embodiments, an antigen-binding domain provided in this document comprises a VH sequence provided in SEQ ID NO: 118 or 130, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some respects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to in this document as "variants".In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0351] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof is provided in this document. Petition 870250078695, dated 03 / 09 / 2025, page 80 / 387 68 / 291 comprises one to three CDRs of a VL domain as set forth in SEQ ID NO: 119 or 131. In some embodiments, an antigen-binding domain provided in this document comprises two to three CDRs of a VL domain as set forth in SEQ ID NO: 119 or 131. In some embodiments, an antigen-binding domain provided in this document comprises three CDRs of a VL domain as set forth in SEQ ID NO: 119 or 131. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs. In some aspects, the CDRs are IMGT CDRs.

[0352] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VL sequence with at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity with a VL sequence established in SEQ ID NO: 119 or 131. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VL sequence provided in SEQ ID NO: 119 or 131, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 amino acid substitutions. In some respects, amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to in this document as “variants”.In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0353] In some embodiments, a PSMA antibody or fragment of Petition 870250078695, dated 03 / 09 / 2025, page 81 / 387 69 / 291 antigen-binding or equivalent provided in this document comprises a sequence with at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to a sequence established in SEQ ID NO: 117 or 129. In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent provided in this document comprises an scFv sequence provided in SEQ ID NO: 117 or 129, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some respects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to in this document as “variants”.In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0354] In some embodiments, a PSMA antibody or antigen-binding fragment or equivalent thereof comprises means for binding a PSMA protein, optionally binding a human PSMA protein to the regions of human PSMA bound by PSMA 1 or PSMA 2 ligands (for example, as described in the Examples below). In some embodiments, the medium binds to a human PSMA protein. In some embodiments, the medium is a PSMA antibody or antigen-binding fragment or equivalent thereof (for example, a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv) and a single-domain antibody (sdAb), or a functional fragment thereof) for binding a human PSMA protein. In some embodiments, the PSMA-binding medium includes anti-PSMA antibodies and antigen-binding fragments or equivalents. Petition 870250078695, dated 03 / 09 / 2025, p. 82 / 387 70 / 291 of these are described in this document. CA9 antibodies, antigen-binding fragments, CDRs, VH and VL domains

[0355] In some respects, isolated antibodies or antigen-binding fragments thereof that bind to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1) are provided in this document. The amino acid sequence of CA9 (HGNC: 1383, NCBI Entrez Gene: 768, Ensembl: ENSG00000107159, UniProtKB / Swiss-Prot: Q16790) is provided in SEQ ID NO: 1.

[0356] In some aspects, antibodies or antigen-binding fragments thereof that bind to CA9 are provided in this document. In some aspects, means for binding to CA9 are provided in this document. In some embodiments, the means for binding to CA9 comprises an antibody or antigen-binding fragment provided in this document. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof comprises means for binding a CA9 protein, optionally binding a human CA9 protein to the regions of human CA9 bound by the CA9 ligands (for example, as described in the Examples below). In some embodiments, the means binds to a CA9 protein. In some embodiments, the means binds to a human CA9 protein.In some embodiments, the medium is a CA9 antibody or antigen-binding fragment or equivalent thereof (e.g., a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) for binding a CA9 protein. In some embodiments, the CA9 binding medium includes the anti-CA9 antibodies and antigen-binding fragments or equivalents thereof described in this document.

[0357] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document binds to human CA9. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document does not bind to human CA9. Petition 870250078695, dated 03 / 09 / 2025, p. 83 / 387 71 / 291 bind to mouse CA9. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided herein binds to human CA9 isoforms, including, but not limited to, a CA9 protein comprising a single nucleotide polymorphism (SNP) R131W, a Q326R SNP, or a 91-96 deletion (91-96del) compared to SEQ ID NO: 1.

[0358] In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent thereof comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDRH1, CDR-H2, and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110. In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent thereof comprises a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, from the VL sequence established in SEQ ID NO: 100. In some embodiments, CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 comprise a sequence established in Table C.In some embodiments, CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106. In some embodiments, CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, and CDR-H3 comprises the sequence established in SEQ ID NO: 113. Table C: CDR sequences of the CA9 ligand SEQ ID NO Name Definition Sequence 101 CA9 1 CDR-H1 Chothia GYTFTSY— 226 CA9 1 CDR-H1 AbM GYTFTSYYMH Petition 870250078695, dated 03 / 09 / 2025, page 84 / 387 72 / 291 227 CA9 1 CDR-H1 Kabat -----SYYMH 228 CA9 1 CDR-H1 Contact —TSYYMH 229 CA9 1 CDR-H1 IMGT GYTFTSYY- 102 CA9 1 CDR-H2 Chothia -----NPSRGS--------- 230 CA9 1 CDR-H2 AbM —IINPSRGSAS------- 231 CA9 1 CDR-H2 Kabat —IINPSRGSASYAQKFQG 232 CA9 1 CDR-H2 Contact WMGIINPSRGSAS------- 233 CA9 1 CDR-H2 IMGT —INPSRGSA-------- 103 CA9 1 CDR-H3 Chothia -DRNYYYYMDV 103 CA9 1 CDR-H3 AbM -DRNYYYYMDV 103 CA9 1 CDR-H3 Kabat -DRNYYYYMDV 234 CA9 1 CDR-H3 Contact ARDRNYYYYMD- 235 CA9 1 CDR-H3 IMGT ARDRNYYYYMDV 104 CA9 1 CDR-L1 Chothia RASQNISSNLA- 104 CA9 1 CDR-L1 AbM RASQNISSNLA- 104 CA9 1 CDR-L1 Kabat RASQNISSNLA- 236 CA9 1 CDR-L1 Contact ------SSNLAWY 237 CA9 1 CDR-L1 IMGT —QNISSN— 105 CA9 1 CDR-L2 Chothia —GASTRAT 105 CA9 1 CDR-L2 AbM —GASTRAT 105 CA9 1 CDR-L2 Kabat —GASTRAT 238 CA9 1 CDR-L2 Contact LLIYGASTRA- CA9 1 CDR-L2 IMGT —GA----- 106 CA9 1 CDR-L3 Chothia QQYITWYT 106 CA9 1 CDR-L3 AbM QQYITWYT 106 CA9 1 CDR-L3 Kabat QQYITWYT Petition: 870250078695, on September 3, 2025, page. 85 / 387 73 / 291 239 CA9 1 CDR-L3 Contact QQYITWY- 106 CA9 1 CDR-L3 IMGT QQYITWYT 111 CA9 2 CDR-H1 Chothia GFSFSDYS— 240 CA9 2 CDR-H1 AbM GFSFSDYSGMS 241 CA9 2 CDR-H1 Kabat -----DYSGMS 242 CA9 2 CDR-H1 Contact —SDYSGMS 243 CA9 2 CDR-H1 IMGT GFSFSDYSG- 112 CA9 2 CDR-H2 Chothia -----SPGGGD--------- 244 CA9 2 CDR-H2 AbM —AISPGGGDTY------- 245 CA9 2 CDR-H2 Kabat —AISPGGGDTYYADSVKG 246 CA9 2 CDR-H2 Contact LVSAISPGGGDTY------- 247 CA9 2 CDR-H2 IMGT —ISPGGGDT-------- 113 CA9 2 CDR-H3 Chothia -RWWYYSNHSGDYDYFDY 113 CA9 2 CDR-H3 AbM -RWWYYSNHSGDYDYFDY 113 CA9 2 CDR-H3 Kabat -RWWYYSNHSGDYDYFDY 248 CA9 2 CDR-H3 Contact ARRWWYYSNHSGDYDYFD- 249 CA9 2 CDR-H3 IMGT ARRWWYYSNHSGDYDYFDY

[0359] In some embodiments, the VH chain sequence comprises the sequence established in SEQ ID NO: 99. In some embodiments, the VH chain sequence comprises the sequence established in SEQ ID NO: 110. In some embodiments, the VL comprises the sequence established in SEQ ID NO: 100. In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent thereof comprises an extracellular domain comprising the sequence established in SEQ ID NO: 98. In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent thereof comprises an extracellular domain comprising the sequence established in SEQ ID NO: 110. Petition 870250078695, dated 03 / 09 / 2025, page 86 / 387 74 / 291

[0360] In some embodiments, the CA9 antibody or antigen-binding fragment or equivalent of these CDR-H3s has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H3 of SEQ ID NO: 103 or 113, the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H2 of SEQ ID NO: 102 or 112, the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H1 of SEQ ID NO: 101 or 111, the CDR-L3 has at least about 50%, 75%, 80%, If a CDR-L3 has 85%, 90%, or 95% identity with a CDR-L3 of SEQ ID NO: 106, a CDR-L2 has at least approximately 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-L2 of SEQ ID NO: 105, and a CDR-L1 has at least less approximately 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-L1 of SEQ ID NO: 104.In some embodiments, CDR-H3 is a CDR-H3 of SEQ ID NO: 103 or 113, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H2 is a CDR-H2 of SEQ ID NO: 102 or 112, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions; CDR-H1 is a CDR-H1 of SEQ ID NO: 101 or 111, with up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L3 is a CDR-L3 of SEQ ID NO: 106, with up to 1, 2, 3, 4, or 5 amino acid substitutions; CDR-L2 is a CDR-L2 of SEQ ID NO: 105, with up to 1, 2, 3, or 4 amino acid substitutions; and CDR-L1 is a CDR-L1 of SEQ ID NO: 104, with up to 1, 2, 3, 4, 5, or 6 amino acid substitutions.

[0361] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises one to three CDRs of an HV domain as set forth in SEQ ID NO: 99 or 110. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises two to three CDRs of an HV domain as set forth in SEQ ID Nos: 99 or 110. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises three CDRs of an HV domain as set forth in SEQ ID NO: 99 or 110. In some respects, the CDRs are Kabat CDRs. Petition 870250078695, dated 03 / 09 / 2025, page 87 / 387 75 / 291 In some respects, CDRs are Chothia CDRs. In some respects, CDRs are AbM CDRs. In some respects, CDRs are Contact CDRs. In some respects, CDRs are IMGT CDRs.

[0362] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VH sequence with at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to a VH sequence established in SEQ ID NO: 99 or 110. In some embodiments, an antigen-binding domain provided in this document comprises a VH sequence provided in SEQ ID NO: 99 or 110, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some respects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antigen-binding domains described in this paragraph are referred to in this document as "variants".In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0363] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided herein comprises one to three CDRs of a VL domain as set forth in SEQ ID NO: 100. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of a VL domain as set forth in SEQ ID NO: 100. In some embodiments, an antigen-binding domain provided herein comprises three CDRs of a VL domain as set forth in SEQ ID NO: 100. In some respects, the CDRs are Kabat CDRs. In some respects, the CDRs are Petition 870250078695, dated 03 / 09 / 2025, page 88 / 387 76 / 291 Chothia CDRs. In some respects, the CDRs are AbM CDRs. In some respects, the CDRs are Contact CDRs. In some respects, the CDRs are IMGT CDRs.

[0364] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VL sequence with at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to a VL sequence established in SEQ ID NO: 100. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a VL sequence provided in SEQ ID NO: 100, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions. In some respects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to in this document as “variants”.In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0365] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises a sequence with at least about 50%, 60%, 70%, 80%, 90%, 95% or 99% identity to a sequence established in SEQ ID NO: 98 or 110. In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof provided in this document comprises an scFv sequence provided in SEQ ID NO: 98 or 110, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or Petition 870250078695, dated 03 / 09 / 2025, p. 89 / 387 77 / 291 amino acid substitutions. In some respects, the amino acid substitutions are conservative amino acid substitutions. In some embodiments, the antibodies described in this paragraph are referred to in this document as “variants”. In some embodiments, such variants are derived from a sequence provided in this document, for example, by affinity maturation, site-directed mutagenesis, random mutagenesis, or any other method known in the art or described in this document. In some embodiments, such variants are not derived from a sequence provided in this document and may, for example, be isolated de novo according to the methods provided in this document to obtain antibodies or antigen-binding domains.

[0366] In some embodiments, a CA9 antibody or antigen-binding fragment or equivalent thereof comprises means for binding a CA9 protein, optionally binding a human CA9 protein to the regions of human CA9 bound by CA9 1 or CA9 2 ligands (for example, as described in the Examples below). In some embodiments, the medium binds to human CA9. In some embodiments, the medium is a CA9 antibody or antigen-binding fragment or equivalent thereof (for example, a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH and a single-domain antibody (sdAb), or a functional fragment thereof) for CA9 binding. In some embodiments, the CA9 binding medium includes the anti-CA9 antibodies and antigen-binding fragments or equivalents thereof described in this document. Logic Gate Systems

[0367] As used in this document, a “logic gate”, “circuit”, “circuit receptor”, “system” or “system receptor” refers to a two-part protein expression system comprising a priming receptor and a chimeric antigen receptor. The system may be encoded in at least one nucleic acid inserted into a cell where the priming receptor is expressed in the cell. The intracellular domain of the priming receptor is Petition 870250078695, dated 03 / 09 / 2025, page 90 / 387 78 / 291 cleaved from the transmembrane domain by binding of the priming receptor to its target antigen. The intracellular domain is then able to translocate to a cell nucleus where it induces the expression of the chimeric antigen receptor.

[0368] In one aspect, systems comprising a priming receptor that binds to PSMA and a chimeric antigen receptor that binds to CA9 are provided in this document, wherein the transcription factor of the intracellular domain of the priming receptor is capable of inducing CAR expression. Such systems are alternatively called “logic gates” or “circuits.” In some aspects, the system is encoded by nucleic acid transgenes inserted into an immune cell. The system may be encoded in a single nucleic acid insert or fragment comprising both transgenes, or it may be encoded in two nucleic acids encoding the system transgenes individually. The priming receptor and the CAR of the system may be placed in any order in the single nucleic acid. For example, the priming receptor may be at the 5' end and the CAR may be at the 3' end, or the CAR may be at the 5' end and the priming receptor may be at the 3' end.

[0369] A constitutive promoter can be operationally linked to the nucleotide sequence encoding the priming receptor. An inducible promoter can also be operationally linked to the nucleotide sequence encoding CAR. In some embodiments, when the system is encoded in a single nucleic acid insert or fragment comprising both transgenes, the nucleic acid may comprise, in a 5' to 3' direction, the constitutive promoter; the nucleotide sequence encoding the priming receptor; the inducible promoter; and the nucleotide sequence encoding the chimeric antigen receptor. Alternatively, the nucleic acid may comprise, in a 5' to 3' direction, the inducible promoter; the nucleotide sequence encoding the chimeric antigen receptor; the constitutive promoter; and the nucleotide sequence encoding the priming receptor.

[0370] In some forms, the constituent promoter is a promoter Petition 870250078695, dated 03 / 09 / 2025, p. 91 / 387 79 / 291 of EF1a. In some modalities, the constituent promoter comprises the sequence SEQ ID NO: 179.

[0371] In some embodiments, the inducible promoter comprises one or more Hepatocyte Nuclear Factor 1α (HNFIa) enhancing elements. For example, the inducible promoter may comprise 1, 2, 3, 4, 5, 6, 7 or more HNFW enhancing elements. In some embodiments, the inducible promoter additionally comprises a YBTATA promoter sequence. In some embodiments, the inducible promoter comprises the sequence as set forth in SEQ ID NO: 256.

[0372] In some embodiments, the logic gate is encoded in a nucleic acid. In some embodiments, the nucleic acid is selected from the group consisting of the sequences set forth in SEQ ID NOs: 143-147. In some embodiments, the nucleic acid is a sequence as set forth in SEQ ID NO: 143. In some embodiments, the nucleic acid is a sequence as set forth in SEQ ID NO: 144. In some embodiments, the nucleic acid is a sequence as set forth in SEQ ID NO: 145. In some embodiments, the nucleic acid is a sequence as set forth in SEQ ID NO: 146. In some embodiments, the nucleic acid is a sequence as set forth in SEQ ID NO: 147.

[0373] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 143. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence as set forth in SEQ ID NO: 143.

[0374] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 144. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence as set forth in SEQ ID NO: 144.

[0375] In some embodiments, nucleic acid comprises a Petition 870250078695, dated 03 / 09 / 2025, page 92 / 387 80 / 291 sequence as set forth in SEQ ID NO: 145. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 145.

[0376] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 146. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence as set forth in SEQ ID NO: 146.

[0377] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 147. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 147. Synthetic Receptors

[0378] In one aspect, the synthetic receptors disclosed in this document comprise a domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA). In one aspect, the synthetic receptors disclosed in this document comprise a specifically binding domain (CA9). In some embodiments, the domain is an extracellular domain. In some embodiments, the domain includes the ligand-binding portion of a receptor. In some embodiments, the domain includes an antigen-binding fragment that binds to one or more target antigens. In some embodiments, the antigen-binding fragment includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment or equivalent thereof.In some embodiments, the antigen-binding fraction is selected from a group consisting of an antibody, a nanobody, a diabody, a triabody or a minibody, an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH, and a single-domain antibody (sdAb) or a functional fragment thereof. In some... Petition 870250078695, dated 03 / 09 / 2025, page 93 / 387 In 81 / 291 embodiments, the antigen-binding fraction comprises a scFv. The antigen-binding fraction may include naturally occurring amino acid sequences or may be manipulated, designed, or modified to provide desired and / or enhanced properties, for example, higher binding affinity.

[0379] In some embodiments, the synthetic receptor is a chimeric antigen receptor or a priming receptor. PSMA receptors

[0380] In some embodiments, the antigen-binding domain binds specifically to Prostate-Specific Membrane Antigen. In some embodiments, the antigen-binding domain includes an antigen-binding fragment that binds specifically to Prostate-Specific Membrane Antigen.

[0381] In some embodiments, isolated synthetic receptors comprising an antigen-binding domain that binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2) are provided in this document.

[0382] In some embodiments, the isolated synthetic receptor comprises the PSMA antibody or antigen-binding fragments disclosed in this document. In some embodiments, the isolated synthetic receptor comprises the sequence established in SEQ ID NO: 127. In some embodiments, the isolated synthetic receptor comprises the sequence established in SEQ ID NO: 138. In some embodiments, the isolated synthetic receptor comprises the sequence established in SEQ ID NO: 252. In some embodiments, the isolated synthetic receptor comprises the sequence established in SEQ ID NO: 253.

[0383] In some embodiments, the extracellular antigen-binding domains of the isolated receptor comprise the variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDRH1, CDR-H2 and CDR-H3, and the variable light chain (VL) sequence. Petition 870250078695, dated 03 / 09 / 2025, p. 94 / 387 82 / 291 comprising three CDR light chain sequences, CDR-L1, CDR-L2 and CDR-L3 of the PSMA antibody or antigen-binding fragments disclosed in this document. CA9 receptors

[0384] In some embodiments, the antigen-binding domain binds specifically to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1). In some embodiments, the domain includes an antigen-binding fragment that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1).

[0385] In some embodiments, isolated synthetic receptors comprising an antigen-binding domain that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1) are provided in this document.

[0386] In some embodiments, the isolated synthetic receptor comprises any CA9 antibody or antigen-binding fragments disclosed in this document. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 98. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 108. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 250. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 110. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 115. In some embodiments, the isolated synthetic receptor comprises the sequence as set forth in SEQ ID NO: 251.

[0387] In some embodiments, the extracellular antigen-binding domains of the isolated synthetic receptor comprise the variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, from any CA9 antibody or antigen-binding fragments disclosed in this document. In some embodiments, the extracellular antigen-binding domains of the isolated synthetic receptor comprise the variable light chain (VL) sequence comprising three Petition 870250078695, dated 03 / 09 / 2025, page 95 / 387 83 / 291 CDR light chain sequences, CDR-L1, CDR-L2 and CDR-L3, of any CA9 antibody or antigen-binding fragments disclosed in this document. Priming Receptors

[0388] Priming receptors comprising an extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) are provided in this document. In some embodiments, the priming receptor comprises an extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA). PSMA is also known as FOLH1 or Folate Hydrolase 1 (HGNC: 3788, NCBI Entrez Gene: 2346, Ensembl: ENSG00000086205, UniProtKB / Swiss-Prot: Q04609). The amino acid sequence of PSMA is provided in SEQ ID NO: 2.

[0389] In certain aspects of the present disclosure, the priming receptor is a synthetic receptor based on the Notch protein. The binding of a natural Notch receptor to a cognate ligand, such as those of the Delta protein family, causes intramembrane proteolysis that cleaves an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that only functions when cleaved from Notch. Cleavage can occur by sequential proteolysis by the metalloproteinase ADAM and the gamma-secretase complex. This intracellular fragment enters the nucleus of a cell and activates cell-to-cell signaling genes. In contrast to a natural Notch protein, a synthetic Notch priming receptor replaces the natural intracellular Notch fragment with one that causes a gene encoding a protein of choice, such as a CAR, to be transcribed upon release of the intracellular fragment from the priming receptor.

[0390] Notch receptors have a modular domain organization. The ectodomains of the Notch receptor consist of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding. In synthetic Notch receptors or receptors Petition 870250078695, dated 03 / 09 / 2025, p. 96 / 387 84 / 291 priming, the Notch ligand-binding domain is replaced by a ligand-binding domain that binds to a selected target ligand or antigen. The EGF repeats are followed by three LIN-12 / Notch repeat modules (LNRs), which are unique to Notch receptors and are widely reported to participate in preventing premature receptor activation. The heterodimerization (HD) domain of Notch is split by furin cleavage, so that its N-terminal part terminates the extracellular subunit, and its C-terminal half constitutes the beginning of the transmembrane subunit. Following the extracellular region, the receptor has a transmembrane segment and an intracellular domain (ICD), which includes a transcriptional regulator.

[0391] Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids as described in this document. One type of priming receptor contemplated for use in the methods and cells of this document comprises a heterologous extracellular ligand-binding domain, a binding polypeptide with substantial sequence identity to a Notch receptor including the NRR, a TMD, and an ICD. “Fn Notch” receptors comprise a heterologous extracellular ligand-binding domain, a binding polypeptide with substantial sequence identity to a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin (“Fn”) repeats, a TMD, and an ICD. “Mini Notch” receptors comprise a heterologous extracellular ligand-binding domain, a binding polypeptide with substantial sequence identity to a Notch receptor (without the NRR), a TMD, and an ICD."Minimal ligand Notch" receptors comprise a heterologous extracellular ligand-binding domain, a ligand polypeptide without substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD. "Hinge Notch" receptors comprise a heterologous extracellular ligand-binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes dimerization). Petition 870250078695, dated 03 / 09 / 2025, page 97 / 387 85 / 291 trimerization or higher-order multimerization with a synthetic receptor and / or an existing host receptor), a TMD, and an ICD. All these receptor classes are synthetic, recombinant, and do not occur in nature. In some embodiments, the non-naturally occurring receptors disclosed in this document bind to a ligand displayed on the target cell surface, which triggers proteolytic cleavage of the receptors and the release of a transcriptional regulator that modulates a customized transcriptional program in the cell. In some embodiments, the priming receptor does not include a LIN-12-Notch repeat (LNR) and / or a heterodimerization (HD) domain of a Notch receptor. Extracellular Domain of the Priming Receptor

[0392] The priming receptor disclosed in this document comprises an extracellular domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA). In some embodiments, priming receptors comprising an extracellular antigen-binding domain that binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2) are provided in this document. In some embodiments, the extracellular antigen-binding domains of the priming receptor comprise a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3 of any PSMA antibody or antigen-binding fragments disclosed in this document.

[0393] In some embodiments, the extracellular domain includes the ligand-binding portion of a receptor. In some embodiments, the extracellular domain includes an antigen-binding fragment that binds to one or more target antigens. In some embodiments, the antigen-binding fragment includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment or equivalent thereof. In some embodiments, the antigen-binding fragment is selected from the group that Petition 870250078695, dated 03 / 09 / 2025, p. 98 / 387 86 / 291 consists of an antibody, a nanobody, a diabody, a triabody or a minibody, an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH and a single-domain antibody (sdAb) or a functional fragment thereof. In some embodiments, the antigen-binding fraction comprises an scFv. The antigen-binding fraction may include naturally occurring amino acid sequences or may be manipulated, designed or modified to provide desired and / or enhanced properties, for example, higher binding affinity.

[0394] In some embodiments, the extracellular antigen-binding domain binds specifically to Prostate-Specific Membrane Antigen. In some embodiments, the extracellular domain includes an antigen-binding fragment that binds to Prostate-Specific Membrane Antigen.

[0395] In some embodiments, the priming receptor comprises the PSMA antibody or antigen-binding fragments disclosed in this document. In some embodiments, the isolated receptor comprises the sequence established in SEQ ID NO: 127. In some embodiments, the priming receptor comprises the sequence established in SEQ ID NO: 138. In some embodiments, the isolated receptor comprises the sequence established in SEQ ID NO: 252. In some embodiments, the isolated receptor comprises the sequence established in SEQ ID NO: 253.

[0396] The PSMA priming receptor sequence provided in SEQ ID NO: 127 includes the leader sequence, while the PSMA priming receptor sequence provided in SEQ ID NO: 252 excludes the leader sequence. The PSMA priming receptor sequence provided in SEQ ID NO: 138 includes the leader sequence, while the PSMA priming receptor sequence provided in SEQ ID NO: 253 excludes the leader sequence.

[0397] In several embodiments, a priming receptor comprises means for binding a PSMA protein, optionally binding a human PSMA protein to the regions of human PSMA bound by PSMA ligands (by Petition 870250078695, dated 03 / 09 / 2025, p. 99 / 387 87 / 291 example, as described in the Examples below). In some embodiments, the medium binds to a PSMA protein. In some embodiments, the medium binds to a human PSMA protein. In some embodiments, the medium is a PSMA antibody or antigen-binding fragment or equivalent thereof (for example, a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv) and a single-domain antibody (sdAb), or a functional fragment thereof). In some embodiments, the PSMA-binding medium includes the anti-PSMA antibodies and antigen-binding fragments or equivalents thereof described in this document.

[0398] The extracellular domain of the priming receptor may additionally comprise a signal sequence, such as a CD8a signal sequence. In some embodiments, the priming receptor comprises a CD8α signal sequence as set forth in SEQ ID NO: 91. Transmembrane Domain

[0399] In some embodiments, the priming receiver comprises a hinge domain. In some embodiments, the hinge domain is a CD8 or CD8α hinge. In some embodiments, the priming receiver hinge domain comprises the sequence as set forth in SEQ ID NO: 85.

[0400] As described above, the priming receptor comprises a transmembrane domain (TMD) comprising one or more ligand-inducible proteolytic cleavage sites.

[0401] In some embodiments, the TMD comprises a Notch1 transmembrane domain.

[0402] Generally, the appropriate TMD for chimeric receptors disclosed in this document may be any transmembrane domain of a Type 1 transmembrane receptor including at least one gamma-secretase cleavage site. A detailed description of the structure and function of the gamma-secretase complex, as well as its substrate proteins, including amyloid precursor protein (APP) and Notch, can, for example, be found in Petition 870250078695, dated 03 / 09 / 2025, p. 100 / 387 88 / 291 a recent review by Zhang et al, Frontiers Cell Neurosci (2014). Suitable non-limiting Type 1 transmembrane receptor TMDs include those among CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA-A and IFNAR2, wherein the TMD includes at least one gamma secretase cleavage site. Additional suitable TMDs for the compositions and methods described in this document include, but are not limited to, transmembrane domains of Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTINl, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd and PTPRM.In some embodiments, the TMD of chimeric polypeptides or Notch disclosure receptors is a TMD derived from a member of the calsintenin family, such as alpha alkalinein and gamma alkalinein. In some embodiments, the TMD of chimeric polypeptides or Notch disclosure receptors is a known TMD for Notch receptors. In some embodiments, the TMD of chimeric polypeptides or Notch disclosure receptors is a TMD derived from a different Notch receptor. For example, in a Mini Notch based on human Notch1, the Notch1 TMD can be replaced by a Notch2 TMD, Notch3 TMD, Notch4 TMD, or a Notch TMD from a non-human animal, such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus.

[0403] In some embodiments, the priming receptor comprises a Notch cleavage site, such as S2 or S3. Additional proteolytic cleavage sites suitable for the compositions and methods disclosed in this document include, but are not limited to, ADAM10, a metalloproteinase cleavage site for an MMP selected from collagenase-1, 2 and 3 (MMP-1, 8 and 13), gelatinase A and B (MMP-2 and 9), stromelysin 1, 2 and 3 (MMP-3, 10 and Petition 870250078695, dated 03 / 09 / 2025, p. 101 / 387 89 / 291 11), matrilysin (MMP-7) and membrane metalloproteinases (MT1-MMP and MT2MMP). Another example of a suitable protease cleavage site is a plasminogen activator cleavage site, for example, a urokinase plasminogen activator (uPA) cleavage site or a tissue plasminogen activator (tPA) cleavage site. Another example of a suitable protease cleavage site is a prolactin cleavage site. Specific examples of uPA and tPA cleavage sequences include sequences comprising Yal-Gly-Arg. Another example of a protease cleavage site that can be included in a proteolytically cleavable ligand is a protease cleavage site from tobacco mosaic virus (TEV), for example, Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO: 264), where the protease cleaves between glutamine and serine.Another example of a protease cleavage site that can be included in a proteolytically cleavable ligand is an enterokinase cleavage site, for example, AspAsp-Asp-Asp-Lys (SEQ ID NO: 265), where cleavage occurs after the lysine residue. Another example of a protease cleavage site that can be included in a proteolytically cleavage ligand is a thrombin cleavage site, for example, Leu-Val-Pro-Arg (SEQ ID NO: 266).Additional suitable ligands comprising protease cleavage sites include sequences cleavable by the following proteases: a PreScission™ protease (a fusion protein comprising human rhinovirus protease 3C and glutathione-S-transferase), a thrombin, cathepsin B, Epstein-Barr virus protease, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-type MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; Cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane matrix metalloprotemase type 1 (MT-MMP), stromelysin 3 (or MMP-11), thermolysin, fibroblast collagenase and stromelysin-1, matrix metalloproteinase 13 (collagenase-3), tissue-type plasminogen activator (tPA), human prostate-specific antigen, kallikrein (hK3), neutrophil elastase, and calpain (calcium-activated neutral protease). These proteases are not native to the host cell in which the receptor is located. Petition 870250078695, dated 03 / 09 / 2025, p. 102 / 387 90 / 291 is expressed (e.g., TEV) and can be used as an additional regulatory mechanism, where receptor activation is reduced until the protease is expressed or otherwise supplied. Furthermore, a protease may be associated with tumors or diseases (expressed to a significantly higher degree than in normal tissue) and serve as an independent regulatory mechanism. For example, some matrix metalloproteinases are highly expressed in certain types of cancer.

[0404] In some embodiments, amino acid substitutions within the TMD include one or more substitutions within a “GV” motif of the TMD. In some embodiments, at least one of these substitutions comprises an alanine substitution. Additional sequences and substitutions are described in WO2021061872, incorporated herein by reference in its entirety.

[0405] In some forms, the TMD domain comprises the sequence as set out in SEQ ID NO: 86. Intracellular Domain

[0406] In some embodiments, the priming receptor comprises one or more intracellular domains of or derived from a transcriptional regulator and / or a DNA-binding domain. In some embodiments, the intracellular domain comprises means for modulating the transcription of one or more genes. In some embodiments, the means for modulating the transcription of one or more genes comprise a transcriptional regulator, for example, a transcriptional regulator provided in this document or an equivalent thereof. In some embodiments, the priming receptor comprises one or more intracellular domains of or derived from a transcriptional regulator and / or a DNA-binding domain. In some embodiments, the intracellular domain comprises an HNFWp65 domain or a Gal4 / VP64 domain.

[0407] Transcriptional regulators activate or repress transcription at cognate promoters. Transcriptional activators typically bind close to transcriptional promoters and recruit RNA polymerase to directly initiate transcription. Transcriptional repressors bind to Petition 870250078695, dated 03 / 09 / 2025, page 103 / 387 91 / 291 transcriptional promoters and sterically prevent transcriptional initiation by RNA polymerase. Other transcriptional regulators serve as activators or repressors, depending on where they bind and the cellular conditions. Consequently, as used in this document, a “transcriptional activation domain” or “TAD” refers to the domain of a transcription factor that interacts with transcriptional control elements and / or transcriptional regulatory proteins (i.e., transcription factors, RNA polymerases, etc.) to increase and / or activate the transcription of one or more genes.Non-limiting examples of transcriptional activation domains include: a VP16 activation domain of the herpes simplex virus, VP64 (which is a tetrameric derivative of VP16), HIV TAT, an NFkB p65 activation domain, p53 1 and 2 activation domains, a CREB (cAMP response element-binding protein) activation domain, an E2A activation domain, an NFAT (activated T-cell nuclear factor) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, a LEU3 glucocorticoid receptor transcription activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to one skilled in the art. In some embodiments, the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1VP16. In some embodiments, the transcriptional regulator is Gal4-VP64. In some embodiments, the transcriptional regulator is p65.A transcriptional activation domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutant, or derived version of the original transcriptional activation domain that has the desired ability to enhance and / or activate the transcription of one or more genes. In some embodiments, the transcriptional regulator may additionally include a nuclear localization signal.

[0408] In some embodiments, the priming receptor comprises one or more intracellular “DNA-binding domains” (or “DB domains”). Such “DNA-binding domains” refer to DNA-binding domains Petition 870250078695, dated 03 / 09 / 2025, page 104 / 387 92 / 291 specific sequences that bind to a particular element of the DNA sequence. Consequently, as used in this document, a “sequence-specific DNA-binding domain” refers to a portion of the protein domain that has the ability to selectively bind DNA with a specific, predetermined sequence. A sequence-specific DNA-binding domain may comprise a wild-type or naturally occurring sequence, or it may be a modified, mutant, or derived version of the original domain that has the desired ability to bind to a desired sequence. In some embodiments, the sequence-specific DNA-binding domain is manipulated to bind to a desired sequence.Non-limiting examples of proteins with sequence-specific DNA-binding domains that can be used in synthetic proteins described in this document include HNFW Gal4, GCN4, tetracycline reverse receptor, THY1, SYN1, NSE / RU5', AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR / Cas proteins, such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cas, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csz1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu196, and TALES. In some embodiments, the DNA-binding domain (DBD) is HNFW.

[0409] In those embodiments where a CRISPR / Cas-like protein is used, the CRISPR / Cas-like protein may be a wild-type CRISPR / Cas protein, a modified CRISPR / Cas protein, or a fragment of a wild-type or modified CRISPR / Cas protein. The CRISPR / Cas-like protein may be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or alter another protein property. For example, the nuclease domains (i.e., DNase, RNase) of the CRISPR / Cas-like protein may be modified, deleted, or Petition 870250078695, dated 03 / 09 / 2025, page 105 / 387 93 / 291 inactivated. Alternatively, the CRISPR / Cas-like protein can be truncated to remove domains that are not essential for the functions of the systems described in this document. For example, a CRISPR enzyme that is used as a DNA-binding protein or a domain thereof can be mutated relative to a corresponding wild-type enzyme, so that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing a DNA-binding domain target site. For example, a D10A mutation can be combined with one or more H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially devoid of all DNA cleavage activity.

[0410] In some embodiments, the intracellular domain comprises the sequence as set forth in SEQ ID NOs: 88, 89, or 90. In some embodiments, the intracellular domain comprises an HNF1a DNA-binding domain (DBD) sequence as set forth in SEQ ID NO: 88. In some embodiments, the intracellular domain comprises a p65 transcriptional activation domain (TAD) sequence as set forth in SEQ ID NO: 89. In some embodiments, the intracellular domain comprises an HNF1a / p65 DBD-TAD domain sequence as set forth in SEQ ID NO: 90. Juxtamembrane Domain

[0411] ECD and TMD, or TMD and ICD, can be linked together with a linking polypeptide, such as a juxtamembrane domain. “SynNotch” or synthetic notch receptors comprise a heterologous extracellular ligand-binding domain, a linker polypeptide with substantial sequence identity to a JMD Notch receptor (including the NRR), a TMD, and an ICD. “Fn Notch” receptors comprise a heterologous extracellular ligand-binding domain, a linker polypeptide with substantial sequence identity to a Robo receptor (such as a mammalian Robo1, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin (“Fn”) repeats, a TMD, and an ICD. “Mini Notch” receptors Petition 870250078695, dated 03 / 09 / 2025, p. 106 / 387 94 / 291 comprise a heterologous extracellular ligand-binding domain, a ligand polypeptide with substantial sequence identity to a JMD Notch receptor but lacking the NRR (the LIN-12-Notch repeat (LNR) modules and heterodimerization domain), a TMD, and an ICD. “Minimal ligand Notch” receptors comprise a heterologous extracellular ligand-binding domain, a ligand polypeptide without substantial sequence identity to a Notch receptor (e.g., without limitation, with a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD. “Hinge Notch” receptors comprise a heterologous extracellular ligand-binding domain, a hinge sequence comprising an oligomerization domain (i.e., a domain that promotes higher-order dimerization, trimerization, or multimerization with a synthetic receptor and / or an existing host receptor), a TMD, and an ICD.

[0412] In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the extracellular and transmembrane domains. In some embodiments, the priming receptor comprises a juxtamembrane domain (JMD) peptide between the transmembrane and intracellular domains. In some embodiments, the JMD peptide comprises an LWF motif. The use of LWF motifs in receptor constructs is described in U.S. Patent No. 10,858,443, which is incorporated herein by reference in its entirety. In some embodiments, the JMD peptide has substantial sequence identity with the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide has substantial sequence identity with the JMD of Notch1, Notch2, Notch3, and / or Notch4, but does not include a LIN-12-Notch repeat (LNR) and / or a heterodimerization (HD) domain of a Notch receptor.In some embodiments, the JMD peptide does not have substantial sequence identity with the JMD of Notch1, Notch2, Notch3, and / or Notch4. In some embodiments, the JMD peptide includes an oligomerization domain that promotes the formation of dimers, trimers, or higher-order assemblies of the receptor. Such JMD peptides are... Petition 870250078695, dated 03 / 09 / 2025, p. 107 / 387 95 / 291 described in WO2021061872, incorporated herein by reference in its entirety.

[0413] In the Mini Notch receptor, the binding polypeptide is derived from a Notch JMD sequence after deletion of the NRR and HD domains. The Notch JMD sequence can be Notch1, Notch2, Notch3, or Notch4 and can be derived from a non-human homolog, such as those from Drosophila, Gallus, Danio, and the like. Four to 50 amino acid residues of the remaining Notch sequence can be used as a linker polypeptide. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD to each other to achieve a desired chimeric polypeptide activity, such as the level of signal transduction when the linker is induced or in the absence of a linker.

[0414] In the minimal ligand Notch receptor, the binding polypeptide has no substantial sequence identity with a Notch JMD sequence, including the Notch1, Notch2, Notch3, or Notch4 JMD sequence, or a non-human homolog thereof. Four to 50 amino acid residues may be used as a polypeptide linker. In some embodiments, the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and / or proximity of the ECD and TMD to each other to achieve a desired chimeric disclosure polypeptide activity. The minimal ligand sequence may be designed to include or omit a protease cleavage site and may include or omit a glycosylation site or sites for other types of post-translational modification. In some embodiments, the minimal ligand does not comprise a protease cleavage site or a glycosylation site.

[0415] In some embodiments, the priming receptor additionally comprises a hinge. Hinge ligands that may be used in the priming receptor may include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs. Petition 870250078695, dated 03 / 09 / 2025, page 108 / 387 96 / 291 that promote the formation of oligomers of chimeric polypeptides through intermolecular disulfide bonds. In these cases, within the chimeric receptors disclosed in this document, the hinge domain generally includes a flexible polypeptide connector region located between the ECD and the TMD. Thus, the hinge domain provides flexibility between the ECD and the TMD and also provides sites for intermolecular disulfide bonds between two or more chimeric polypeptide monomers to form an oligomeric complex. In some embodiments, the hinge domain includes motifs that promote the formation of dimers of the chimeric polypeptides disclosed in this document. In some embodiments, the hinge domain includes motifs that promote the formation of trimers of the chimeric polypeptides disclosed in this document (e.g., a hinge domain derived from OX40).Suitable hinge polypeptide sequences for the compositions and methods of disclosure may be naturally occurring hinge polypeptide sequences (e.g., those of naturally occurring immunoglobulins) or may be manipulated, designed, or modified to provide desired and / or enhanced properties, for example, by modulating transcription. Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgG1 hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof. In some embodiments, the hinge polypeptide sequence contains one or more CXXC motifs. In some embodiments, the hinge polypeptide sequence contains one or more CPPC motifs (SEQ ID NO: 267).

[0416] Hinge polypeptide sequences can also be derived from a CD8a hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, and functional variants thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD8a hinge domain or Petition 870250078695, dated 03 / 09 / 2025, page 109 / 387 97 / 291 a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an OX40 hinge domain or a functional variant thereof. In some embodiments, the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.

[0417] The Fn Notch binding polypeptide is derived from the Robo1 JMD, which contains a fibronectin (Fn) repeat domain, with a short polypeptide sequence between the Fn repeats and the TMD. The Fn Notch binding polypeptide does not contain a Notch negative regulatory region (NRR) or the Notch HD domain. The Fn binding polypeptide may contain 1, 2, 3, 4, or 5 Fn repeats. In some embodiments, the chimeric receptor comprises an Fn binding polypeptide with about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats. The short polypeptide sequence between the Fn repeats and the TMD may have from about 2 to about 30 amino acid residues. In some forms, the short polypeptide sequence can have between about 5 and about 20 amino acids, of any sequence.In some embodiments, the short polypeptide sequence may have between about 5 and about 20 naturally occurring amino acids of any sequence. In some embodiments, the short polypeptide sequence may have between about 5 and about 20 amino acids of any sequence, but not having more than one proline. In some embodiments, the short polypeptide sequence may have between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine. In some embodiments, the short polypeptide sequence may have between about 5 and about 20 amino acids, wherein the amino acids are selected from glycine, serine, threonine, and alanine. In some embodiments, the length and amino acid composition of the polypeptide sequence... Petition 870250078695, dated 03 / 09 / 2025, p. 110 / 387 98 / 291 Fn linkages can be varied to alter the orientation and / or proximity of ECD and TMD to each other to achieve a desired chimeric polypeptide disclosure activity. Transfer Stop Sequence

[0418] In some embodiments, the priming receptor additionally comprises a stop transfer sequence (STS) between the transmembrane domain and the intracellular domains. The STS comprises a charged lipophobic sequence. Without being tied to any theory, the STS serves as a membrane anchor and is believed to prevent passage from the intracellular domain to the plasma membrane. The use of STS domains in priming receptors is described in WO2021061872, incorporated herein by reference in its entirety.Non-limiting illustrative STS sequences include STS sequences of APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRP1, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBO1, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTIN1, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PTPRK, BTC, EPHA4, IL1R2, KCNE4, SCN2B, Nradd, PTPRM, Notch1, Notch2, Notch3, and Notch4. In some embodiments, the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. The STS sequences are described in WO2021061872, which is incorporated herein by reference in its entirety.

[0419] In some forms, the STS domain comprises the sequence as set out in SEQ ID NO: 87. Chimeric Antigen Receptors

[0420] In another aspect, chimeric antigen receptors comprising an extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) are provided in this document. The CAR Petition 870250078695, dated 03 / 09 / 2025, page 111 / 387 99 / 291 may be a human CAR, comprising entirely human sequences, for example, natural human sequences. The amino acid sequence of CA9 (HGNC: 1383, NCBI Entrez Gene: 768, Ensembl: ENSG00000107159, UniProtKB / Swiss-Prot: Q16790) is provided in SEQ ID NO: 1.

[0421] In some embodiments, the chimeric antigen receptor includes an extracellular portion comprising an antigen-binding domain. The antigen recognition domain of a receptor, such as a CAR, may be linked to one or more intracellular signaling components, such as signaling components that mimic activation via an antigen-receptor complex, such as a TCR complex in the case of a CAR, and / or signal via another cell surface receptor. Thus, in some embodiments, the extracellular binding component (e.g., ligand-binding or antigen-binding domain) is linked to one or more transmembrane and intracellular signaling domains. In some embodiments, the transmembrane domain is fused to the extracellular domain. In one embodiment, a transmembrane domain that is naturally associated with one of the domains in the receptor, e.g., CAR, is used.In some cases, the transmembrane domain is selected or modified by amino acid substitution to prevent such domains from binding to the transmembrane domains of the same surface membrane proteins or different surface membrane proteins, for example, to minimize interactions with other members of the receptor complex.

[0422] In some aspects, the chimeric antigen receptor includes an extracellular portion comprising an antigen-binding domain described in this document and an intracellular signaling domain. In some embodiments, an antibody or fragment includes a scFv, a VH, or a single-domain VH antibody, and the intracellular domain contains an ITAM. In some aspects, the intracellular signaling domain includes a zeta-chain signaling domain of a CD3-zeta chain (CD3). In some embodiments, the chimeric antigen receptor includes a transmembrane domain that binds the Petition 870250078695, dated 03 / 09 / 2025, page 112 / 387 100 / 291 extracellular domain and intracellular signaling domain.

[0423] In some embodiments, the transmembrane domain contains a transmembrane portion of CD8a or CD28. The extracellular and transmembrane domains may be linked directly or indirectly. In some embodiments, the extracellular and transmembrane domains are linked by a spacer, such as any described in this document. In some embodiments, the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule, such as between the transmembrane domain and the intracellular signaling domain. In some embodiments, the T cell costimulatory molecule is CD28 or 41BB. Chimeric Antigen Receptor Extracellular Domain

[0424] The chimeric antigen receptors disclosed in this document comprise an extracellular domain that specifically binds to Carbonic Anhydrase IX (CA9). In some embodiments, chimeric antigen receptors comprising an extracellular antigen-binding domain that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1) are provided in this document. In some embodiments, the extracellular antigen-binding domains of chimeric antigen receptors comprise a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3. In some embodiments, the extracellular antigen-binding domains of chimeric antigen receptors comprise a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, from any CA9 antibody or antigen-binding fragments disclosed in this document.

[0425] In some embodiments, the chimeric antigen receptor comprises the sequence as set forth in SEQ ID NO: 98. In some embodiments, the chimeric antigen receptor comprises the sequence as set forth in SEQ ID NO: 108 or 250. In some embodiments, the chimeric antigen receptor comprises the sequence as set forth Petition 870250078695, dated 03 / 09 / 2025, page 113 / 387 101 / 291 in SEQ ID NO: 110. In some embodiments, the chimeric antigen receptor comprises the sequence as set forth in SEQ ID NO: 115 or 251. The CA9 CAR sequence provided in SEQ ID NO: 108 includes the leader sequence, while the CA9 CAR sequence provided in SEQ ID NO: 250 excludes the leader sequence. The CA9 CAR sequence provided in SEQ ID NO: 115 includes the leader sequence, while the CA9 CAR sequence provided in SEQ ID NO: 251 excludes the leader sequence.

[0426] In some embodiments, the extracellular domain includes the ligand-binding portion of a receptor. In some embodiments, the extracellular domain includes an antigen-binding fraction that binds to one or more target antigens. In some embodiments, the antigen-binding fraction includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment or equivalent thereof. In some embodiments, the antigen-binding fraction is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody or a minibody, an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), a VHH, and a single-domain antibody (sdAb) or a functional fragment thereof. In some embodiments, the antigen-binding fraction comprises an scFv.The antigen-binding fraction may include naturally occurring amino acid sequences or may be manipulated, designed, or modified to provide desired and / or improved properties, for example, higher binding affinity.

[0427] In some embodiments, the extracellular antigen-binding domain binds specifically to Carbonic Anhydrase IX (CA9). In some embodiments, the extracellular domain includes an antigen-binding moiety that binds to Carbonic Anhydrase IX (CA9).

[0428] In several embodiments, a CAR comprises means for binding a CA9 protein, optionally binding a human CA9 protein to regions of human CA9 bound by CA9 ligands (for example, as described in the Examples below). In some embodiments, the medium binds to a Petition 870250078695, dated 03 / 09 / 2025, page 114 / 387 102 / 291 CA9 protein. In some embodiments, the medium binds to a human CA9 protein. In some embodiments, the medium is a CA9 antibody or antigen-binding fragment or equivalent thereof (e.g., a complete antibody or an F(ab')2 fragment, a Fab fragment, a single-chain variable fragment (scFv), and a single-domain antibody (sdAb), or a functional fragment thereof) for binding to a CA9 protein. In some embodiments, the CA9-binding medium includes the anti-CA9 antibodies and antigen-binding fragments or equivalents thereof described in this document.

[0429] The extracellular domain of the CAR may additionally comprise a signal sequence, such as a CD8a signal sequence. In some embodiments, the CAR comprises a CD8α signal sequence as set forth in SEQ ID NO: 91. CAR Transmembrane Domain

[0430] The transmembrane domain in some embodiments is derived from a natural or synthetic source. When the source is natural, the domain in some respects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (i.e., comprising at least the transmembrane regions) the alpha, beta, or zeta chain of the T-cell receptor CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and / or CD154. Alternatively, the transmembrane domain in some embodiments is synthetic. In some respects, the synthetic transmembrane domain predominantly comprises hydrophobic residues, such as leucine and valine. In some respects, a triplet of phenylalanine, tryptophan, and valine will be found at each end of a synthetic transmembrane domain. In some forms, the linkage is made by ligands, spacers, and / or transmembrane domains.

[0431] In some embodiments, the receptor transmembrane domain (TMD), for example, CAR, is a human CD28 transmembrane domain or variant thereof, for example, a 27-amino acid transmembrane domain. Petition 870250078695, dated 03 / 09 / 2025, p. 115 / 387 103 / 291 of a human CD28 (UniProt Access Number: P10747).

[0432] In some embodiments, the receptor transmembrane domain (TMD), for example, the CAR, is a human CD8α transmembrane domain or variant thereof, for example, a 24-amino acid transmembrane domain of a human CD8α (UniProt Accession No.: P01732).

[0433] In some embodiments, the CAR comprises a CD8a or CD28 TMD. In some embodiments, the CD8a TMD comprises the sequence established in SEQ ID NO: 93. In some embodiments, the CD28 TMD comprises the sequence established in SEQ ID NO: 95. CAR hinge

[0434] In some embodiments, the CAR additionally includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or a variant or modified version thereof, such as a hinge region, for example, a CD8a hinge, a CD28 hinge, an IgG4 hinge region, and / or a CH1 / CL and / or Fc region. In some embodiments, the constant region or portion is from a human IgG, such as IgG4 or IgG1. In some respects, the constant region portion serves as a spacer region between the antigen recognition component, for example, scFv, and the transmembrane domain. The spacer may have a length that provides increased cell responsiveness after antigen binding, compared to the absence of the spacer. In some examples, the spacer is about 12 amino acids long or no more than 12 amino acids long.Exemplary spacers include those that have at least approximately 10 to 229 amino acids, approximately 10 to 200 amino acids, approximately 10 to 175 amino acids, approximately 10 to 150 amino acids, approximately 10 to 125 amino acids, approximately 10 to 100 amino acids, approximately 10 to 75 amino acids, approximately 10 to 50 amino acids, approximately 10 to 40 amino acids, approximately 10 to 30 amino acids, approximately 10 to 20 amino acids, or approximately 10 to 15 amino acids, and including any whole number between the outcomes of any of the listed ranges. In some. Petition 870250078695, dated 03 / 09 / 2025, p. 116 / 387 In embodiments 104 / 291, a spacer region is about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less. Exemplary spacers include CD8α hinge, CD2α hinge, IgG4 hinge alone, IgG4 hinge linked to CH2 and CH3 domains, or IgG4 hinge linked to the CH3 domain. Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or publication of international patent application number WO2014031687. In some embodiments, the CAR hinge comprises a CD8α hinge domain, a truncated CD8α hinge domain, or a CD2α hinge domain. In some embodiments, the hinge domain comprises a CD8α hinge comprising the sequence as set forth in SEQ ID NO: 92. In some embodiments, the hinge domain comprises a CD28 hinge comprising the sequence as set forth in SEQ ID NO: 94.

[0435] Among the intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a co-stimulatory receptor, and / or a signal through a co-stimulatory receptor alone. In some embodiments, a short oligo- or polypeptide ligand, for example, a ligand between 2 and 10 amino acids in length, such as one containing glycines and serines, for example, a glycine-serine doublet, is present and forms a link between the transmembrane domain and the cytoplasmic signaling domain of the receptor. Intracellular domain of CAR

[0436] In some embodiments, by binding the CAR, the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of the immune cell, for example, T cells engineered to express the receptor. In some embodiments, the CAR comprises means to activate at least one of the normal effector functions or responses of the immune cell, for example, T cells engineered to express the receptor. For example, in some contexts, the Petition 870250078695, dated 03 / 09 / 2025, page 117 / 387 105 / 291 receptor induces a T cell function, such as cytolytic activity or T helper activity, such as secretion of cytokines or other factors. In some embodiments, a truncated portion of an intracellular signaling domain of an antigen receptor component or co-stimulatory molecule is used in place of an intact immunostimulatory chain, for example, if it transduces the effector function signal. In some embodiments, the intracellular signaling domain or domains include the cytoplasmic sequences of the T cell receptor (TCR) and, in some respects, also those of co-receptors that in the natural context act in conjunction with such receptor to initiate signal transduction after antigen receptor engagement, and / or any derivative or variant of such molecules, and / or any synthetic sequence that has the same functional capacity.In some embodiments, the means for at least one of the normal effector functions or responses of the immune cell comprises an intracellular CAR activation domain, for example, an intracellular activation domain provided in this document or an equivalent thereof. In some embodiments, the means for at least one of the normal effector functions or responses of the immune cell comprise an intracellular CAR activation domain and a CAR co-stimulatory domain, for example, a co-stimulatory domain provided in this document or an equivalent thereof.

[0437] In some respects, the receptor includes a primary cytoplasmic signaling sequence that regulates the primary activation of the TCR complex. Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs that are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAMs containing primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d.

[0438] The receptor, for example, CAR, may include at least one intracellular signaling component or components. In some Petition 870250078695, dated 03 / 09 / 2025, p. 118 / 387 In some embodiments, the receptor includes an intracellular component of a TCR complex, such as a CD3 chain of TCR that mediates T cell activation and cytotoxicity, for example, the zeta chain of CD3. Thus, in some aspects, the extracellular domain is linked to one or more cell signaling modules. In some embodiments, the cell signaling modules include CD3 transmembrane domains, CD3 intracellular signaling domains, and / or other CD transmembrane domains. In some embodiments, the receptor, for example, CAR, additionally includes a portion of one or more additional molecules, such as Fc-gamma receptor, CD8, CD4, CD25, or CD16. For example, in some aspects, CAR includes a chimeric molecule between CD3-zeta or Fc-gamma receptor and CD8, CD4, CD25, or CD16.

[0439] In some embodiments, the intracellular signaling domain comprises a human CD3 zeta-stimulating signaling domain or a functional variant thereof, such as a cytoplasmic 112 AA domain of the human CD3 zeta isoform 3 (UniProt Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Patent No. 7,446,190 or U.S. Patent No. 8,911,993.

[0440] . In some embodiments, the cytoplasmic signaling molecules in the CAR contain a cytoplasmic signaling domain, a portion thereof, or a CD3 zeta-derived sequence. In some embodiments, the intracellular activation domain comprises a CD3Z domain. In some embodiments, the intracellular activation domain comprises a CD3Z domain established in SEQ ID NO: 97.

[0441] In some embodiments, the intracellular domain comprises an intracellular costimulatory signaling domain of 41BB or a functional variant or portion thereof, such as a cytoplasmic domain of 42 amino acids of a human 4-1BB (UniProt Accession No. Q07011.1) or a functional variant or portion thereof.

[0442] In some modalities, the receptor encompasses one or more, for example, two or more co-stimulatory domains and an activation domain, by Petition 870250078695, dated 03 / 09 / 2025, page 119 / 387 107 / 291 example, primary activation domain, in the cytoplasmic portion. Exemplary receptors include intracellular components of CD3-zeta, CD28, and 41BB. In some embodiments, the chimeric antigen receptor contains an intracellular domain of a T-cell co-stimulatory molecule. In some respects, the T-cell co-stimulatory molecule is 4-1BB.

[0443] In some embodiments, the receptor includes a signaling domain and / or transmembrane portion of a co-stimulatory receptor, such as CD28, 4-1BB, OX40, DAP10 and ICOS. In some respects, the same receptor includes both activating and co-stimulatory components.

[0444] In certain embodiments, the intracellular signaling domain comprises a transmembrane and CD8a signaling domain linked to an intracellular CD3 domain (e.g., CD3-zeta). In some embodiments, the intracellular signaling domain comprises 4-1BB co-stimulatory domains (CD137, TNFRSF9) linked to an intracellular zeta CD3 domain. In some embodiments, the CAR comprises a 4-1BB co-stimulatory domain. In some embodiments, the 4-1BB co-stimulatory domain comprises the sequence as set forth in SEQ ID NO: 96.

[0445] In some embodiments, the CAR or other antigen receptor additionally includes a marker, such as a cell surface marker, which can be used to confirm transduction or manipulation of the cell to express the receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR). In some aspects, the marker includes all or part (e.g., truncated form) of CD34, a nerve growth factor receptor (NGFR), or an epidermal growth factor receptor (e.g., tEGFR). In some embodiments, the nucleic acid encoding the marker is operationally linked to a polynucleotide encoding a linker sequence, such as a cleavable linker sequence or a ribosomal jump sequence, e.g., T2A. See WO2014031687. In some embodiments, the introduction of a construct encoding CAR and EGFRt separated by a T2A ribosome exchange can express two proteins of Petition 870250078695, dated 03 / 09 / 2025, p. 120 / 387 108 / 291 same construct, so that EGFRt can be used as a marker to detect cells expressing such a construct. In some embodiments, a marker and, optionally, a linker sequence, can be any as disclosed in published patent application No. WO2014031687. For example, the marker can be a truncated EGFR (tEGFR) that is optionally linked to a linker sequence, such as a T2A ribosomal jump sequence.

[0446] In some modalities, the marker is a molecule, for example, a cell surface protein, not found naturally in T cells or not found naturally on the surface of T cells, or a portion thereof.

[0447] In some embodiments, the molecule is a non-self molecule, for example, a non-self protein, that is, one that is not recognized as “self” by the immune system of the host to which the cells will be adoptively transferred.

[0448] In some modalities, the marker has no therapeutic function and / or produces no effect other than being used as a marker for genetic manipulation, for example, to select successfully manipulated cells. In other modalities, the marker may be a therapeutic molecule or a molecule that otherwise exerts some desired effect, such as a ligand for a cell to be encountered in vivo, such as a co-stimulatory or immune checkpoint molecule to enhance and / or attenuate cell responses through adoptive transfer and encounter with the ligand.

[0449] The CAR may comprise one or more synthetic amino acids modified in place of one or more naturally occurring amino acids. Exemplary modified amino acids include, but are not limited to, aminocyclohexanecarboxylic acid, norleucine, α-amino n-decanoic acid, homoserine, S-acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylphalanine, 4-carboxyphenylalanine, Petition 870250078695, dated 03 / 09 / 2025, page 121 / 387 109 / 291 (3-phenylserine (3-hydroxyphenylalanine, phenylglycine, α-naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N'-benzyl-N'-methyl-lysine, N',N'-dibenzyl-lysine, 6-hydroxylysine, ornithine, α-aminocyclopentanecarboxylic acid, α-aminocyclohexanecarboxylic acid, α-aminocycloheptanecarboxylic acid, α-(2-amino-2-norbomano)carboxylic acid, α,γ-diaminobutyric acid, α,γ-diaminopropionic acid, homophenylalanine and α-tert-butylglycine.

[0450] For example, in some embodiments, the CAR includes an antibody or fragment thereof, including single-chain antibodies (sdAbs, for example, containing only the VH region, also called a VHH), VH and scFvs domains, described in this document, a spacer, such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain. In some embodiments, the CAR includes an antibody or fragment, including sdAbs and scFvs described in this document, a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.

[0451] Transgenes expressing the priming receptor and the CAR system can be introduced into cells, such as a T cell, using, for example, a site-specific technique. With site-specific integration of transgenes (e.g., priming receptor and CAR), the transgenes can be targeted to a safe harbor or TRAC locus. Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homology-independent targeted insertion using Cas9.

[0452] Manipulated cells have applications in immuno-oncology. The priming receptor and CAR, for example, can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells are cancers Petition 870250078695, dated 03 / 09 / 2025, page 122 / 387 110 / 291 of the blood or solid cancers. In some modalities, immune cell therapy can be used to treat solid tumors. Synthetic pathway activators

[0453] In several respects, the systems disclosed in this document employ one or more “synthetic pathway activators” (SPAs). Immune cells expressing CARs may be limited by the need for in vivo expansion after infusion. To achieve robust expansion, T cells require three signals: antigen stimulation, co-stimulation, and cytokine-induced stimulation. CAR activation is sufficient to induce the first two signals, but cannot recapitulate cytokine signaling. Furthermore, the tumor microenvironment is often immunosuppressive and devoid of pro-inflammatory cytokines. SPAs can therefore be used to stimulate robust in vivo expansion and enhance the desirable properties (i.e., increased survival, persistence, and potency) of T cells expressing priming receptors and / or CARs, as described in this document. SPA structure

[0454] In several modalities, SPAs mimic the activation of interleukin signaling. Interleukin receptors are cytokine receptors that signal through Signal Transducer and Activator of Transcription (STAT) transcription factors (e.g., STAT3 and STAT5). Interleukin receptors typically function by dimerization in response to ligand binding. Once dimerized, the receptors can bind to Janus-associated kinases (JAKs) to induce JAK cross-phosphorylation and downstream “JAK / STAT” signaling. Consequently, induced receptor agonism or ligand-independent dimerization of the receptors can be used to induce constitutive receptor activity and therefore constitutive cytokine signaling.

[0455] In several modalities, SPAs comprise interleukin receptors or functional fragments thereof. In some modalities, SPAs comprise or are derived from intracellular signaling domains. Petition 870250078695, dated 03 / 09 / 2025, page 123 / 387 111 / 291 of the interleukin receptor or functional fragments thereof. In some modalities, SPAs comprise or are derived from interleukin-6 signal transducing polypeptides (IL6ST) or functional fragments thereof. The interleukin-6 signal transducer (IL6ST) is also known as glycoprotein 130 (gp130).

[0456] In several embodiments, one or more structural changes can be made to confer constitutive activity to a SPA or functional fragment thereof. In some embodiments, structures or mutations can be added to induce SPA multimerization. In some embodiments, one or more amino acids can be mutated to a cysteine ​​to allow the formation of one or more disulfide bonds, for example, between two receptor monomers. In some embodiments, one or more amino acids can be inserted into a wild-type receptor polypeptide to promote dimerization, for example, through the formation of one or more disulfide bonds.

[0457] In some embodiments, an exogenous polypeptide is operationally linked to a cytokine receptor or a functional fragment thereof to cause its multimerization. In some embodiments, a leucine zipper polypeptide is operationally linked to a cytokine receptor or a functional fragment thereof. In some embodiments, the leucine zipper polypeptide is a c-Jun leucine zipper. In some embodiments, an exogenous scaffold is operationally linked to a cytokine receptor or a functional fragment thereof (e.g., IL6ST or gp130).

[0458] In some embodiments, SPAs may comprise a ligand agonist (e.g., a cytokine, e.g., an interleukin) that enables constitutive activation of the SPA. In some embodiments, the cytokine receptor and a soluble agonist are expressed simultaneously. In some embodiments, the cytokine receptor and a membrane-bound agonist are expressed simultaneously.

[0459] In several modalities, SPAs are anchored to the membrane Petition 870250078695, dated 03 / 09 / 2025, page 124 / 387 112 / 291 cellular. In some embodiments, SPAs comprise an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, SPAs comprise a transmembrane domain of an interleukin receptor. Example SPAs

[0460] In some embodiments, the SPA comprises a leucine-gp130 zipper (referred to in this document as “L-gp130”) or an L-gp130 intracellular signaling domain. L-gp130 comprises a homodimer, with each monomer comprising (a) an extracellular domain comprising an inserted cysteine ​​residue that forms a disulfide bond with another monomer and a c-Jun leucine zipper; and (b) an IL6ST transmembrane domain and an intracellular signaling domain. The cysteine ​​residue and the leucine zipper in each polypeptide can induce the formation of stable homodimers that mimic the constitutive activation of IL-6R. Further details on the L-gp130 construction are described in Stuhlmann-Laeisz et al. Mol Biol Cell. 2006 Jul;17(7):2986-95 and in WO2020200325, which are incorporated herein by reference in their entirety. The sequence number for L-gp130 is provided in SEQ ID NO: 259.In some modalities, the SPA comprises L-gp130 comprising a sequence as set forth in SEQ ID NO: 259.

[0461] In some embodiments, the SPA comprises an extracellular domain comprising a CD34 epitope or CD34 extracellular domain or fragment thereof. In some embodiments, the SPA comprises an extracellular domain comprising a CD34 epitope, an unpaired cysteine ​​residue for multimerization, an IL6ST transmembrane domain (gp130), and an IL6ST intracellular domain (gp130). In some embodiments, the SPA comprises a sequence as set forth in SEQ ID NO: 141 or 254. The IL6ST transmembrane domain (gp130) sequence is provided in SEQ ID NO: 258. In some embodiments, the SPA comprises an IL6ST transmembrane domain (gp130) sequence as set forth in SEQ ID NO: 258. The signaling domain sequence Petition 870250078695, dated 03 / 09 / 2025, page 125 / 387 The intracellular IL6ST (gp130) 113 / 291 sequence is provided in SEQ ID NO: 257. In some embodiments, the SPA comprises an intracellular IL6ST (gp130) signaling domain sequence as set forth in SEQ ID NO: 257. In some embodiments, the SPA comprises an extracellular domain comprising the sequence as set forth in SEQ ID NO: 260. A nucleotide sequence encoding an exemplary SPA is provided in SEQ ID NO: 261. A nucleotide sequence encoding the exemplary SPA protein with an N-terminal leader sequence is provided in SEQ ID NO: 262. In some embodiments, one or more nucleic acids encoding the system disclosed herein comprise SPAs comprising a nucleic acid as set forth in SEQ ID NOs: 261 or 262. Nucleic Acids and Vectors

[0462] In another aspect, one or more nucleic acids are provided in this document, wherein one or more nucleic acids encode: a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA); a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9); an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to: a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3;and a nucleic acid encoding the Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid sequence of at least 15 nucleotides in length is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding; Petition 870250078695, dated 03 / 09 / 2025, page 126 / 387 114 / 291 the human FAS comprising the sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides long complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of a nucleic acid encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 5. RNA Interference Molecules

[0463] Transforming Growth Factor Receptor Beta 1 (TGFpR1 or TGFBR1; HGNC: 11772, NCBI Entrez gene: 7046, UniProtKB / SwissProt: P36897) is a transmembrane serine / threonine protein kinase and forms a heteromeric complex with the TGF-beta type II receptor (TGFRB2) when bound to TGF-beta, transducing the TGF-beta signal from the cell surface to the cytoplasm.

[0464] Transforming Growth Factor Receptor Beta 2 (TGFeR2 or TGFBR2; HGNC: 11773, NCBI Entrez gene: 7048, UniProtKB / SwissProt: P37173) is a transmembrane serine / threonine protein kinase that forms a heterodimeric complex with TGF-beta receptor type-1 (TGFBR1) when bound to TGF-beta, resulting in the transduction of the TGF-beta signal from the cell surface to the cytoplasm.

[0465] The Fas Cell Surface Death Receptor (or Fas Receptor, FAS, CD95 or TNFRSF6; HGNC: 11920, NCBI Entrez Gene: 355; UniProtKB / Swiss-Prot: P25445) is a member of the TNF receptor superfamily that induces apoptosis.

[0466] Protein Tyrase Phosphatase Non-Receptor Type 2 (PTPN2; HGNC: 9650, NCBI Entrez Gene: 5771; UniProtKB / Swiss-Prot: P17706) is a phosphatase that regulates interferon and many other signaling pathways.

[0467] As used in this document, “target gene” refers to a nucleic acid sequence in a cell, in which the expression of the sequence Petition 870250078695, dated 03 / 09 / 2025, p. 127 / 387 115 / 291 can be specifically and effectively modulated using the nucleic acid molecules and methods described in this document. In certain embodiments, the target gene may be implicated in the growth (proliferation), maintenance (survival), and / or immune behavior of an individual's immune cells. In some embodiments, the target gene is FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is Transforming Growth Factor Receptor Beta 2 (TGFBR2). In some embodiments, two or more nucleic acid molecules target the TFGBR2 gene. In some embodiments, the target gene is Transforming Growth Factor Receptor Beta 1 (TGFBR1). In some embodiments, more than one target gene is modulated using a nucleic acid molecule and methods described in this document. In some embodiments, at least two target genes are modulated using the nucleic acid molecules and methods described in this document.In some embodiments, the nucleic acid molecules are shRNA. In some embodiments, the target genes are at least TGFBR1 and TGFBR2. In some embodiments, the target genes are at least FAS and TGFBR2. In some embodiments, the target genes are at least FAS, TGFBR1, and TGFBR2. In some embodiments, the target genes are at least FAS, TGFBR2, and PTPN2. In some embodiments, the target genes are at least FAS, PTPN2, TGFBR1, and TGFBR2.

[0468] In one aspect, nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) (SEQ ID NO: 4) are provided in this document. In some embodiments, the nucleic acid comprises a nucleic acid sequence of at least 15 nucleotides in length complementary to nucleotides 2215-2236, 4430-4451, or 3761-3782 of a nucleic acid encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 4. In some embodiments, the nucleic acid comprises a sequence Petition 870250078695, dated 03 / 09 / 2025, page 128 / 387 116 / 291 selected from the group consisting of the sequences established in SEQ ID NOs: 34-82. In some embodiments, the nucleic acid comprises at least two sequences selected from the group consisting of the sequences established in SEQ ID NOs: 34-82.

[0469] In one aspect, nucleic acids are provided in this document comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding human Transforming Growth Factor Receptor Beta (TGFBR2) (SEQ ID NO: 4), wherein the nucleic acid sequence of at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a nucleic acid encoding human Transforming Growth Factor Receptor Beta (TGFBR2) (SEQ ID NO: 4). In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of the sequences established in SEQ ID Nos: 34-82.In some embodiments, the nucleic acid comprises at least two sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of sequences established in SEQ ID Nos: 34-82.

[0470] In one aspect, nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding the Human Transforming Growth Factor Beta Receptor 1 (TGFBR1) (SEQ ID NO: 148) are provided in this document. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 149-178.

[0471] In one aspect, nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding the are provided in this document. Petition 870250078695, dated 03 / 09 / 2025, page 129 / 387 117 / 291 Human Transforming Growth Factor Receptor Beta (TGFBR1) (SEQ ID NO: 148), wherein the nucleic acid sequence with at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a nucleic acid encoding human Transforming Growth Factor Receptor Beta (TGFBR1) (SEQ ID NO: 148). In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of sequences established in SEQ ID Nos: 149-178. In some embodiments, the nucleic acid comprises at least two sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of sequences established in SEQ ID Nos: 149-178.

[0472] In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides long complementary to a nucleic acid encoding the human FAS (Fas) Cell Surface Death Receptor comprising the sequence set forth in SEQ ID NO: 3. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-20. In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 3.

[0473] In one aspect, nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 3 are provided in this document, wherein the nucleic acid sequence of at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 3. In Petition 870250078695, dated 03 / 09 / 2025, page 130 / 387 118 / 291 In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of the sequences established in SEQ ID Nos: 6-20. In some embodiments, the nucleic acid comprises at least two sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of the sequences established in SEQ ID Nos: 6-20.

[0474] In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides long complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of a nucleic acid encoding human PTPN2 comprising the sequence set forth in SEQ ID NO: 5.

[0475] In one aspect, nucleic acids are provided in this document comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5, wherein the nucleic acid sequence of at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO: 5. In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a selected sequence of Petition 870250078695, dated 03 / 09 / 2025, page 131 / 387 119 / 291 group consisting of the sequences established in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid comprises at least two sequences with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with a sequence selected from the group consisting of the sequences established in SEQ ID NOs: 21-33. In some embodiments, the nucleic acid sequence is complementary to nucleotides 518-559 of a nucleic acid encoding human PTPN2 comprising the sequence established in SEQ ID NO: 5.

[0476] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 13. In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 49. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 49. In some In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 79. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 79.In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 83. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 83. In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 84. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a conforming sequence. Petition 870250078695, dated 03 / 09 / 2025, page 132 / 387 120 / 291 established in SEQ ID NO: 84.

[0477] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 182. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence as set forth in SEQ ID NO: 182.

[0478] In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 181, 183, 193, 194 or 195. In some embodiments, the nucleic acid comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a sequence as set forth in SEQ ID NO: 181, 183, 193, 194 or 195.

[0479] In some embodiments, nucleic acid is able to reduce FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand nucleic acid.

[0480] In some embodiments, nucleic acid is able to reduce TGFBR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand nucleic acid.

[0481] In some embodiments, the nucleic acid is able to reduce PTPN2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not understand the nucleic acid.

[0482] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides long.

[0483] In some embodiments, the nucleic acid is an interfering RNA (RNAi) molecule. Examples of RNAi molecules include RNA Petition 870250078695, dated 03 / 09 / 2025, page 133 / 387 121 / 291 in short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide. In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide. In some embodiments, the nucleic acid is a shRNA.

[0484] Single-stranded hairpin ribonucleic acids (shRNAs) are short duplexes where the sense and antisense strands are linked by a hairpin loop. They consist of a stem-loop structure that can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter into a plasmid construct. Once expressed, shRNAs are processed into RNAi species. The expression of shRNA from a plasmid is known to be relatively stable, thus providing strong advantages over, for example, the use of synthetic siRNAs. shRNA expression units can be incorporated into a variety of plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into a target cell. The expression of shRNA from a plasmid can be stably integrated for constitutive expression.ShRNAs are synthesized in the cell nucleus, subsequently processed and transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. ShRNAs are converted into active siRNA molecules (which are capable of binding to, sequestering, and / or preventing the translation of mRNA transcripts encoded by target genes).

[0485] The Argonaut family of proteins is the main component of RISC. Within the Argonaut family of proteins, only Ago2 contains endonuclease activity capable of cleaving and releasing the passenger strand from the stem portion of the shRNA molecule. The three remaining members of the Argonaut family, Ago1, Ago3, and Ago4, which do not have identifiable endonuclease activity, are also assembled into RISC and are believed to function in a cleavage-independent manner. Thus, RISC can be characterized with both cleavage-dependent and cleavage-independent pathways. Petition 870250078695, dated 03 / 09 / 2025, p. 134 / 387 122 / 291

[0486] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) are described in International Publications No. WO2018232356A1, WO2019084552A1, WO2019226998A1, WO2020014235A1, WO2020123871A1 and WO2020186219A1, each of which is incorporated herein by reference for all purposes.

[0487] The structure of the antisense oligonucleotide and the chemical modifications are described in International PCT Publication No. WO20 / 132521, which is incorporated herein by reference.

[0488] dsRNA and shRNA molecules and methods of use and production are described in U.S. Patent No. 8,829,264; U.S. Patent No. 9,556,431; and U.S. Patent No. 8,252,526, each of which is incorporated herein by reference.

[0489] siRNA molecules and methods of use and production are described in U.S. Patent No. 7,361,752 and U.S. Patent Application No. US20050048647, both incorporated herein by reference.

[0490] Additional methods and compositions for RNA interference, such as shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Patent No. 7,361,752; U.S. Patent No. 8,829,264; U.S. Patent No. 9,556,431; U.S. Patent No. 8,252,526; International Publication PCT No. WO00 / 44895; International Publication PCT No. WO01 / 36646; International Publication PCT No. WO99 / 32619; International Publication PCT No. WO00 / 01846; International Publication PCT No. WO01 / 29058; and International Publication PCT No. WO00 / 44914; International Publication PCT No. WO04 / 030634; each of which is incorporated herein by reference.

[0491] Nucleic acid sequences (or constructs) that can be used to encode RNAi molecules, such as an shRNA described in this document, may comprise a promoter, which is operationally linked (or connected), directly or indirectly, to a sequence encoding RNAi molecules. Such promoters may be selected based on the Petition 870250078695, dated 03 / 09 / 2025, p. 135 / 387 123 / 291 host cell and the intended effect. Non-limiting examples of suitable promoters include constitutive and inducible promoters such as EF1a or inducible promoters based on Hepatocyte Nuclear Factor 1α (HNFIa)YB TATA or RNA polymerase II (pol II). In some embodiments, the constitutive promoter is EFW. In some embodiments, the EF^ promoter comprises a sequence as set forth in SEQ ID NO: 179. Non-limiting examples of suitable promoters additionally include the tetracycline-inducible or repressible promoter, RNA polymerase I or III-based promoters, pol II-dependent viral promoters such as the CMV-IE promoter, and pol III U6 and H1 promoters, as well as the Hepatocyte Nuclear Factor 1α (HNF^)-YB TATA promoter provided in SEQ ID NO: 256. The bacteriophage T7 promoter may also be used (in which case it will be appreciated that T7 polymerase is also present).Nucleic acid sequences need not be restricted to the use of any single promoter, especially since nucleic acid sequences can comprise two or more shRNAs (i.e., a combination of effectors), including, but not limited to, embedded shRNA molecules. Each embedded promoter can control one or any combination of the shRNA molecule components.

[0492] In certain embodiments, the promoter may be preferentially active in target cells, for example, it may be desirable to preferentially express at least one nucleic acid in immune cells using an immune cell-specific promoter. The introduction of such constructs into host cells can be effected under conditions where the two or more nucleic acids contained in the nucleic acid precursor transcript initially reside within a single primary transcript, so that the separate RNA molecules (e.g., shRNAs each comprising its own stem-loop structure) are subsequently excised from this precursor transcript by an endogenous ribonuclease. The resulting mature nucleic acids (e.g., shRNAs) can then induce degradation and / or Petition 870250078695, dated 03 / 09 / 2025, page 136 / 387 124 / 291 repression of the translation of target gene mRNA transcripts produced in the cell. Alternatively, each of the stem-loop precursor structures can be produced as part of a separate transcript, in which case each nucleic acid sequence will preferentially include its own promoter and terminator sequences. Furthermore, multiple nucleic acid precursor transcripts can reside in a single primary transcript.

[0493] The stem-loop structures of the shRNA nucleic acids described in this document may be about 40 to 100 nucleotides long or, preferably, about 50 to 75 nucleotides long. The stem region may be about 15-45 nucleotides long (or more) or about 20-30 nucleotides long. In some embodiments, the stem region is 22 nucleotides long. In some forms, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides long.

[0494] The stem may comprise a perfectly complementary duplex (but for any 3' tail), however, internal protrusions or loops may be present in either of the stem arms. The number of these asymmetric internal protrusions and loops is preferably small in number (e.g., 1, 2, or 3) and is about 3 nucleotides or less in size. The terminal loop portion may comprise about 4 or more nucleotides, but preferably not more than about 25. The loop portion will preferably be 6-15 nucleotides in size.

[0495] As described in this document, the stem regions of shRNAs comprise passenger strands and guide strands, with the guide strands containing sequences complementary to the target mRNA transcript encoded by the target genes. Preferably, the GC content and matching of the guide and passenger strands are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage. Furthermore, the specificity of the guide strand is preferentially Petition 870250078695, dated 03 / 09 / 2025, page 137 / 387 125 / 291 confirmed through a BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0496] The disclosure in this document indicates that the expression level of multiple target genes can be modulated using the methods and nucleic acids described in this document. For example, the disclosure in this document indicates that a first set of nucleic acids can be designed to include a sequence (a guide strand) that is designed to reduce the expression level of a first target gene, while a second set of nucleic acids can be designed to include a sequence (a guide strand) that is designed to reduce the expression level of a second target gene. The different sets of nucleic acids can be expressed and reside in the same primary transcripts or separately. In certain embodiments, such a multiplex approach, i.e., the use of the nucleic acids described in this document to modulate the expression level of two or more target genes, may have a potentiated therapeutic effect in a patient.For example, if a patient is provided with cells expressing the nucleic acid molecules described in this document to treat, prevent, or improve the effects of cancer, it may be desirable to provide the patient with two or more types of nucleic acid molecules that are designed to reduce the expression level of multiple genes that are implicated in the activation or repression of immune cells.

[0497] The nucleic acid molecules described in this document may be able to reduce the expression of the target gene in a cell by at least more than about 50% compared to a control cell that does not contain the nucleic acid molecules. For example, nucleic acid molecules (e.g., shRNA) may be able to reduce the expression of a selected target gene from the group consisting of FAS and TGBFR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to a control cell that does not contain the nucleic acid molecules. Nucleic acid molecules may be able to reduce the expression of a selected target gene from the group consisting of FAS and Petition 870250078695, dated 03 / 09 / 2025, p. 138 / 387 126 / 291 TGBFR2 in the immune cell is present in at least 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, or 50-55% of cases, or in comparison with a control cell that does not understand nucleic acid molecules. In some modalities, nucleic acid molecules are able to reduce FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand nucleic acid molecules. In some modalities, nucleic acid molecules are able to reduce FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand nucleic acid molecules.In some modalities, nucleic acid molecules are able to reduce TGBFR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand nucleic acid molecules.

[0498] Nucleic acid molecules can be synthesized chemically or transcribed in vitro and may additionally include one or more modifications to the sugar-phosphate or nucleoside residue backbone.

[0499] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transport, chemical-mediated transport, such as calcium phosphate and the like. Thus, the nucleic acid molecule construct can be introduced together with components that perform one or more of the following activities: enhance RNA uptake by the cell, promote annealing of duplex strands to shRNA, stabilize annealed shRNA strands, or otherwise increase inhibition of the target gene. Additional Elements Petition 870250078695, dated 03 / 09 / 2025, page 139 / 387 127 / 291

[0500] In some embodiments, one or more nucleic acids additionally comprise a 5' homology-directed repair arm and / or a 3' homology-directed repair arm complementary to an insertion site on a host cell chromosome. In some embodiments, one or more nucleic acids comprise a 5' homology-directed repair arm and a 3' homology-directed repair arm. In some embodiments, one or more nucleic acids are incorporated into an expression cassette or an expression vector. In some embodiments, the expression cassette or expression vector additionally comprises a constitutive promoter upstream of one or more nucleic acids.

[0501] In some embodiments, the priming receptor, CAR, the first nucleic acid, and the second nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the priming receptor, CAR, the first nucleic acid, and the second nucleic acid are incorporated into two or more expression cassettes or expression vectors. In some embodiments, the expression vectors are a non-viral vector.

[0502] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 184. In some embodiments, the expression cassette comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 184. The expression cassette or expression vector comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence as set forth in SEQ ID NO: 184 may additionally comprise one or more transgenes encoding any priming receptor or CAR. as disclosed in this document. In some embodiments, the expression cassette or expression vector comprises the sequences as set forth in SEQ ID NO: 185 and 186. In some embodiments, the expression cassette or expression vector Petition 870250078695, dated 03 / 09 / 2025, page 140 / 387 128 / 291 comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ IDs NO: 185 and 186. The expression cassette or expression vector comprising the sequence as set forth in SEQ IDs NO: 185 and 186 may additionally comprise one or more transgenes encoding any priming receptor or CAR as disclosed herein.

[0503] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 187. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 187. The expression cassette or expression vector comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence as set forth in SEQ ID NO: 187 may additionally comprise one or more transgenes encoding any receptor of Priming or CAR as disclosed in this document. In some embodiments, the expression cassette or expression vector comprises the sequences as set forth in SEQ ID NO: 188 and 189.In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ IDs NO: 188 and 189. The expression cassette or expression vector comprising the sequence as set forth in SEQ IDs NO: 188 and 189 may additionally comprise one or more transgenes encoding any priming receptor or CAR as disclosed herein.

[0504] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 190. In some embodiments, the expression cassette or expression vector Petition 870250078695, dated 03 / 09 / 2025, page 141 / 387 129 / 291 comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 190. The expression cassette or expression vector comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence as set forth in SEQ ID NO: 190 may additionally comprise one or more transgenes encoding any priming receptor or CAR as disclosed herein. In some embodiments, the expression cassette or expression vector comprises sequences as set forth in SEQ ID NO: 191 and 192. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 191 and 192.The expression cassette or expression vector comprising the sequence as set forth in SEQ ID NO: 191 and 192 may additionally comprise one or more transgenes encoding any priming receptor or CAR as disclosed herein.

[0505] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 196. In some embodiments, the expression cassette comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 196. The expression cassette or expression vector comprising a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence as set forth in SEQ ID NO: 196 may additionally comprise one or more transgenes encoding any priming receptor or CAR. as disclosed in this document. In some embodiments, the expression cassette or expression vector comprises the sequences as set forth in SEQ ID NO: 197 and 198. In some embodiments, the expression cassette or expression vector Petition 870250078695, dated 03 / 09 / 2025, page 142 / 387 130 / 291 comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ IDs NO: 197 and 198. The expression cassette or expression vector comprising the sequence as set forth in SEQ IDs NO: 197 and 198 may additionally comprise one or more transgenes encoding any priming receptor or CAR as disclosed herein.

[0506] For example, the transgene included in any of the cassettes, as provided in any of the sequences set forth in SEQ ID Nos: 184, 187, 190, or 196, may comprise an extracellular domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) and / or a chimeric antigen receptor (CAR) that specifically binds to Carbonic Anhydrase IX (CA9). For example, a transgene comprising a priming receptor may comprise a first antigen-binding extracellular domain comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3 of any PSMA antibody or antigen-binding fragments disclosed herein.Similarly, a transgene comprising a chimeric antigen receptor (CAR) may comprise an extracellular antigen-binding domain comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, from any CA9 antibody or antigen-binding fragments disclosed herein.

[0507] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 143. In some embodiments, the expression cassette or expression vector Petition 870250078695, dated 03 / 09 / 2025, page 143 / 387 131 / 291 comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set out in SEQ ID NO: 143.

[0508] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 144. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 144.

[0509] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 145. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 145.

[0510] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 146. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 146.

[0511] In some embodiments, the expression cassette or expression vector comprises a sequence as set forth in SEQ ID NO: 147. In some embodiments, the expression cassette or expression vector comprises a sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 147.

[0512] One or more interfering nucleic acid sequences (e.g., one or more shRNAs) may be encoded in the intron regions of the nucleic acid insert, DNA template, module, cassette, cassette of Petition 870250078695, dated 03 / 09 / 2025, page 144 / 387 132 / 291 unique expression or a unique expression vector that also encodes the priming receptor and / or the CAR. For example, if the DNA template includes promoters, such as EF1a or inducible promoters, such as the HNF1a-YB TATA promoter, described in this document, to drive the expression of the CAR or priming receptor, one or more nucleic acid sequences (e.g., shRNA sequences) may be encoded in the intron region of the promoter. In some embodiments, one or more nucleic acid sequences are encoded in at least one intron region of the nucleic acid insert, module, cassette, or DNA template. In some embodiments, one or more nucleic acid sequences are encoded in at least one EF1a intron region of the nucleic acid insert, module, cassette, or DNA template.

[0513] In some embodiments, the present disclosure includes nucleic acids, modules, cassettes, or DNA template inserts comprising one or more transgenes encoding priming receptors and / or CARs as described herein. In some embodiments, the DNA template insert or cassette encodes a priming receptor transgene. In some embodiments, the DNA template insert or cassette encodes a chimeric antigen receptor transgene. In some embodiments, the DNA template insert or cassette encodes a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence and a second nucleic acid complementary to at least 15 nucleotides of a human TGBFR2 mRNA sequence. In some embodiments, the DNA template insert or cassette comprises a priming receptor transgene and a chimeric antigen receptor transgene.In some embodiments, the DNA template insertion comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence, and a second nucleic acid complementary to at least 15 nucleotides of a human TGBFR2 mRNA sequence. In some embodiments, the template insertion... Petition 870250078695, dated 03 / 09 / 2025, p. 145 / 387 133 / 291 The DNA comprises a priming receptor transgene, a chimeric antigen receptor transgene, a first nucleic acid complementary to at least 15 nucleotides of a human FAS mRNA sequence, and a second nucleic acid complementary to at least 15 nucleotides of a human TGBFR2 mRNA sequence.

[0514] In some embodiments, one or more nucleic acids are encoded in a single DNA template insert or cassette. In some embodiments, one or more nucleic acids are encoded in multiple DNA template inserts or cassettes. For example, one or more nucleic acids may be encoded in two, three, or four DNA template inserts.

[0515] DNA template insertion may also comprise a self-cleaving peptide. Examples of self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, for example, a porcine teschovirus-1 peptide (P2A), a Thata asigna virus peptide (T2A), an equine rhinitis A virus peptide (E2A), or a foot-and-mouth disease virus peptide (F2A). Self-cleaving 2A peptides allow the expression of multiple gene products from a single construct. (See, for example, Chang et al. Cleavage efficiency 2A peptides for high level monoclonal antibody expression in CHO cells, MAbs 7(2): 403-412 (2015)).

[0516] The DNA template insertion may also comprise a WPRE element. WPRE elements are generally described in Higashimoto, T., et al. Gene Ther 14, 1298-1304 (2007); and Zufferey, R., et al. J Virol. April 1999; 73(4): 2886-92., both incorporated herein by reference.

[0517] The DNA template insertion may also comprise an SV40 or a polyA tail of human growth hormone (GH1). Cells

[0518] Also provided in this document are cells or immune cells comprising at least one DNA template inserted in a non- Petition 870250078695, dated 03 / 09 / 2025, page 146 / 387 134 / 291 viral in a target region of the cell genome, wherein the DNA template encodes the priming receptor and the CAR system as described in this document. Also provided here are immune cells comprising the priming receptor that specifically binds to Prostate-Specific Membrane Antigen (PSMA) and the chimeric antigen receptor that specifically binds to CA9.

[0519] A cell comprising a DNA template insertion at a target locus or safe harbor site, as described in this disclosure, may be referred to as a manipulated cell. In some embodiments, the cell or immune cell is any cell that can give rise to a pluripotent immune cell. In some embodiments, the immune cell is a primary immune cell. In some embodiments, the immune cell may be an induced pluripotent stem cell (iPSC) or a human pluripotent stem cell (HSPC). In some embodiments, the immune cell comprises primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the manipulated cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, a hematopoietic stem cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell progenitor.In some modalities, immune cells are T cells. In some modalities, T cells are regulatory T cells, effector T cells, or naive T cells. In some modalities, T cells are CD8+ T cells. In some modalities, T cells are CD4+ T cells. In some modalities, T cells are CD4+CD8+ T cells.

[0520] In some embodiments, the manipulated cell is a stem cell, a human cell, a primary cell, a hematopoietic cell, a hematopoietic stem cell, an adaptive immune cell, an innate immune cell, a T cell, or a T cell progenitor. Non-limiting examples of immune cells contemplated in this disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, Petition 870250078695, dated 03 / 09 / 2025, page 147 / 387 135 / 291 macrophages, myeloid cells and dendritic cells. Non-limiting examples of stem cells contemplated in this disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryonic stem cells derived from nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic / progenitor stem cells (HSPCs), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and stem cells from other cells (including osteocytes, chondrocytes, myocytes, cardiac myocytes, neurons, tendon cells, adipocytes, pancreocytes, hepatocytes, nephrocytes, and follicular cells, and so forth). In some modalities, the manipulated cells are T cells, NK cells, iPSCs, and HSPCs.In some embodiments, the manipulated cells used in this disclosure are human cell lines cultured in vitro (e.g., deliberately immortalized cell lines, cancerous cell lines, etc.).

[0521] Cell populations comprising a plurality of cells or immune cells are also provided in this document. In some embodiments, the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the cells comprises the priming receptor and CAR system, as described in this document. A method for treating conditions related to the immune system.

[0522] In another aspect, the disclosure in this document provides methods of treating an immune system-related condition (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, such as Petition 870250078695, dated 03 / 09 / 2025, pp. 148 / 387 136 / 291 a cellular composition comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In another aspect, the disclosure in this document provides methods of enhancing an immune response comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, such as a cellular composition comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0523] In some modalities, the target cell is a cell that expresses both PSMA and CA9. In some modalities, the target cell is a cancerous cell that expresses both PSMA and CA9. In some modalities, the cancerous or diseased cell expresses both PSMA and CA9.

[0524] In some embodiments, the methods provided in this document are useful for treating a condition related to the immune system in an individual. In one embodiment, the individual is a human being.

[0525] In some embodiments, the methods provided in this document (such as methods for enhancing an immune response) are useful for the treatment of cancer and, as such, an individual receiving the system described in this document has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is immune-evasive. In some embodiments, the cancer is immune-responsive. In particular embodiments, the cancer is renal cancer, renal cell carcinoma, clear cell renal cell carcinoma (ccRcc), colorectal cancer, or lung cancer.

[0526] In some modalities, treatment results in a decrease in the volume or size of the cancer. In some modalities, treatment is effective in reducing the volume of the cancer compared to the cancer's volume. Petition 870250078695, dated 03 / 09 / 2025, page 149 / 387 137 / 291 before antibody administration. In some modalities, treatment results in a decrease in the cancer growth rate. In some modalities, treatment is effective in reducing the cancer growth rate compared to the cancer growth rate before antibody administration. In some modalities, treatment is effective in eliminating the cancer.

[0527] In some modalities, CA9 and PSMA are expressed at a higher level in cancer compared to a non-cancerous cell. CA9 and PSMA levels can be assessed by any known technique in the field, including, but not limited to, protein assays or nucleic acid assays, such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometry, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY and FISH techniques, and combinations thereof. In some respects, methods for inhibiting a target cell in a subject are provided in this document, comprising administering the immune cell or population of immune cells disclosed in this document to the subject, wherein the immune cell inhibits the target cell. Inhibition of a target cell includes eliminating the cancer cell or preventing or reducing the growth, proliferation, or metastasis of the cancer cell.

[0528] In some embodiments, the subject is conditioned with 30 mg / m2 of fludarabine and 300 mg / m2 of cyclophosphamide prior to administration of the immune cell or immune cell population disclosed in this document. Administration of the immune cell or immune cell population disclosed in this document to a subject without conditioning may also be performed. In some embodiments, subjects are conditioned on one or more of Days 3, 4, and / or 5 prior to administration of the immune cell or immune cell population disclosed in this document. Petition 870250078695, dated 03 / 09 / 2025, page 150 / 387 138 / 291

[0529] In some modalities, subjects receive 100x106, 300x106, or 1000x106 of the immune cell or immune cell population disclosed in this document. Immune modulation method

[0530] Methods of administering a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, as described in this document, may result in modulation of an immune response. Modulation may be an increase or decrease in the immune response. In some modalities, modulation is an increase in an immune response.

[0531] In one aspect, administration of a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, as described in this document, may result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. Generally, the induced pro-inflammatory molecules are present at levels higher than those achieved with isotype control. Such pro-inflammatory molecules, in turn, result in the activation of antitumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation.Thus, the delivery of a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9 can induce multiple antitumor immunological mechanisms leading to tumor destruction.

[0532] In some modalities, the target cell is a cell that expresses both PSMA and CA9. In some modalities, the diseased cell expresses both PSMA and CA9.

[0533] In another aspect, methods for increasing an immune response in an individual are provided in this document, comprising the administration Petition 870250078695, dated 03 / 09 / 2025, p. 151 / 387 139 / 291 to the individual of an effective quantity of a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9. In some embodiments, the method for increasing an immune response in a subject comprises administering to the subject a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0534] In some embodiments, the cell is present in a pharmaceutical composition further comprising a pharmaceutically acceptable excipient.

[0535] In any and all aspects of increasing an immune response as described in this document, any increase or decrease or alteration of an aspect of characteristics or functions is compared to a cell that does not comprise a composition comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0536] Enhancing an immune response can either potentiate an immune response or induce an immune response. For example, enhancing an immune response encompasses both the initiation or start of an immune response, and the intensification or amplification of an existing or ongoing immune response. In some modalities, treatment induces an immune response. In some modalities, the induced immune response is an adaptive immune response. In some modalities, the induced immune response is an innate immune response. In some modalities, treatment potentiates an immune response. In some modalities, the potentiated immune response is an adaptive immune response. In some modalities, the potentiated immune response is an innate immune response. In some modalities, treatment enhances an immune response. In some modalities, the increased immune response is an adaptive immune response. In some modalities, the enhanced immune response is an innate immune response.In some cases. Petition 870250078695, dated 03 / 09 / 2025, p. 152 / 387 In some embodiments, the immune response is initiated or initialized by the administration of a cell comprising a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9.

[0537] In another aspect, the present application provides methods for genetically editing a cell with a system comprising a priming receptor that specifically binds to PSMA and a chimeric antigen receptor that specifically binds to CA9, resulting in modulation of the cell's immune function. Modulation can enhance an immune response. In some embodiments, modulation is an increase in immune function. In some embodiments, modulation of function leads to the expression of a CA9 CAR. In some embodiments, modulation of function leads to the activation of a cell comprising the system.

[0538] In some forms, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.

[0539] In some embodiments, modulation of cell function comprising the priming receptor and CAR system, as described in this document, leads to an increase in the cells’ capabilities to stimulate native and activated T cells, for example, by increasing the secretion of cytokines or chemokines by cells expressing the priming receptor and CAR system. In some embodiments, modulation of function potentiates or increases the ability of cells to produce cytokines, chemokines, CARs, or co-stimulatory or activating receptors. In some embodiments, modulation increases the T cell-stimulating function of cells expressing the priming receptor and CAR system, including, for example, the cells’ capabilities to trigger T cell receptor signaling. Petition 870250078695, dated 03 / 09 / 2025, p. 153 / 387 141 / 291 T cell replication (TCR), T cell proliferation, or T cell cytokine production.

[0540] In some modalities, the increased immune response is the secretion of cytokines and chemokines. In some modalities, the priming receptor and the CAR system induce increased expression of at least one cytokine or chemokine in a cell compared to an isotype control cell. In some modalities, at least one cytokine or chemokine is selected from the group consisting of: IL-2 and IFNγ. In some modalities, the cytokine or chemokine is IL-2. In some modalities, the cytokine or chemokine is IFNγ. In some modalities, the secretion of cytokines or chemokines is increased between approximately 1-100 times 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90 or 90-100 times compared to an untreated cell or a cell treated with an isotype control antibody.In some modalities, the chemokine is IL-2 and secretion is increased between approximately 1-100 times, 1-10 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 1-10 times, 10-20 times, 20-30 times, 30-40 times, 40-50 times, 50-60 times, 60-70 times, 70-80 times, 80-90 times or 90-100 times compared to an untreated cell or a cell treated with an isotype control antibody. In some modalities, the cytokine is IFNγ and secretion is increased between approximately 1-100 times, 1-10 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 1-10 times, 10-20 times, 20-30 times, 30-40 times, 40-50 times, 50-60 times, 60-70 times, 70-80 times, 80-90 times, or 90-100 times compared to an untreated cell or a cell treated with an isotype control antibody.

[0541] In some modalities, the enhanced immune response is the recruitment and activation of antitumor immune cells.

[0542] In some modalities, the cell expressing the priming receptor and the CAR system induces a memory immune response compared to an isotype control cell. In general, an immune response of Petition 870250078695, dated 03 / 09 / 2025, page 154 / 387 142 / 291 Memory is a protective immune response following subsequent exposure to pathogens or antigens that the immune system has previously encountered. Examples of memory immune responses include the immune response after infection or vaccination with an antigen. In general, memory immune responses are mediated by lymphocytes, such as T cells or B cells. In some forms, the memory immune response is a protective immune response against cancer, including the growth, proliferation, or metastasis of cancerous cells. In some forms, the memory immune response inhibits, prevents, or reduces the growth, proliferation, or metastasis of cancerous cells. Cell editing methods

[0543] In some respects, a method of editing a cell is provided in this document, comprising: providing a nuclease domain and a guide RNA, wherein the nucleic acid comprises a nucleic acid disclosed in this document, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the cell genome; introducing the nuclease domain and nucleic acid into the cell, wherein the guide RNA specifically hybridizes with a target region of the cell genome, and wherein the nuclease domain cleaves the target region to create the insertion site in the cell genome; and editing the immune cell by inserting the nucleic acid into the insertion site in the cell genome.

[0544] The terms gene editing or genome editing, as used in this document, refer to a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using artificially manipulated nucleases or molecular scissors. It is a useful tool for elucidating the function and effect of specific gene or protein sequences or for altering cellular behavior (e.g., for therapeutic purposes).

[0545] Currently available genome editing tools include zinc finger nucleases (ZFNs) and effector nucleases of the type Petition 870250078695, dated 03 / 09 / 2025, page 155 / 387 143 / 291 transcription activators (TALENs) are used to incorporate genes into safe harbor loci (e.g., the safe harbor locus of the adeno-associated virus 1 (AAVS1) integration site). The DICE (double integrase cassette exchange) system, which utilizes integrase phiC31 and integrase Bxb1, is a tool for target integration. Additionally, regularly interspaced clustered short palindromic repeat / Cas9 (CRISPR / Cas9) techniques can be used for targeted gene insertion.

[0546] Site-specific gene editing approaches may include homology-dependent mechanisms or homology-independent mechanisms.

[0547] All known methods in the art for targeted insertion of genetic sequences are contemplated in the methods described in this document for inserting constructs into genetic targets or safe harbor loci.

[0548] Methods for producing an immune cell comprising the introduction of a nucleic acid comprising the priming receptor and the CAR system, as described in this document, into a primary immune cell are also provided in this document. In some embodiments, the immune cell is a single cell. In some embodiments, the immune cell is a mammalian cell (e.g., a human cell).

[0549] This document provides methods for inserting nucleotide sequences longer than about 5 kilobases into the genome of a cell in the absence of a viral vector. In some embodiments, nucleotide sequences longer than about 5 kilobases can be inserted into the genome of a primary immune cell in the absence of a viral vector.

[0550] The integration of large nucleic acids, for example nucleic acids larger than 5 kilobases, into cells can be limited by low integration efficiency, off-target effects, and / or loss of cell viability. Methods and compositions to achieve this are described in this document. Petition 870250078695, dated 03 / 09 / 2025, pp. 156 / 387 144 / 291 Integration of a nucleotide sequence, for example, a nucleotide sequence larger than about 5 kilobases in size, into the genome of a cell. In some methods, the efficiency of integration is increased, off-target effects are reduced, and / or the loss of cell viability is reduced.

[0551] The plasmid can be introduced into an immune cell with a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced in a ribonucleoprotein format with a guide RNA (gRNA) that targets a specific site in the immune cell genome. The nuclease cuts the genomic DNA at this specific site. The specific site can be a portion of the genome that codes for an endogenous immune cell receptor. Thus, cutting the genome at this site will cause the immune cell to no longer express an endogenous immune cell receptor.

[0552] The plasmid may include repair arms targeted by 5' and 3' homology complementary to sequences at a specific site in the immune cell genome. The complementary sequences are on either side of the nuclease-cut site, allowing the plasmid to be incorporated into a specified insertion site in the immune cell genome. Once incorporated, the plasmid will express the priming receptor. However, as explained, the transgene cassette design ensures that non-virus-distributed circuit system receptors do not express CAR until the priming receptor binds to its cognate ligand and releases the cleavable transcription factor.

[0553] Initially, a T cell is isolated and optionally activated. The T cell can be obtained from a patient. Thus, the present disclosure provides methods in which immune cells, such as T cells, are harvested from a patient. Then, the plasmid encoding the CAR and the priming receptor are introduced into a T cell. Advantageously, the plasmids of the present disclosure can be introduced using electroporation. By introducing the plasmid via electroporation, the nuclease can also be introduced. By using electroporation, the methods of the present disclosure avoid the use of Petition 870250078695, dated 03 / 09 / 2025, page 157 / 387 145 / 291 viral vectors are used for the introduction of transgenes, which is a known bottleneck in immune cell engineering. T cells are then expanded and co-cultured to create a sufficient quantity of engineered immune cells to be used as a therapeutic treatment.

[0554] Methods for editing a cell's genome may include a) providing a Cas9 ribonucleoprotein (RNP) and nucleic acid complex comprising: (i) the RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes with a target region of the cell's genome and wherein the Cas9 nuclease domain cleaves the target region to create an insertion site in the cell's genome; and (ii) a double-stranded or single-stranded nucleic acid, such as a DNA template, wherein the size of the nucleic acid (e.g., DNA template) is greater than about 200 nucleotides, wherein the 5' and 3' ends of the nucleic acid (e.g., DNA template) comprise nucleotide sequences that are homologous to the genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to nucleic acid (e.g., DNA template) in the complex is from about 3:1 to about 100:1;(b) introduction of the RNP-nucleic acid complex (e.g., DNA template) into the cell.

[0555] In some embodiments, the methods described in this document provide a delivery efficiency of the RNP complex and nucleic acid (e.g., DNA template) of at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher. In some cases, efficiency is determined in relation to the cells that are viable after the introduction of the RNP complex and nucleic acid (e.g., DNA template) into the cell. In some cases, efficiency is determined in relation to the total number of cells (viable or non-viable) into which the RNP complex and nucleic acid (e.g., DNA template) is introduced.

[0556] As another example, distribution efficiency can be determined by quantifying the number of genome-edited cells in a Petition 870250078695, dated 03 / 09 / 2025, pp. 158 / 387 146 / 291 cell population (compared to the total number of cells or the total number of viable cells obtained after the introduction step). Several methods for quantifying genome editing can be used. These methods include, but are not limited to, the use of a specific mismatch nuclease, such as endonuclease I T7; sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplification fragments); and high-throughput deep sequencing.

[0557] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after the introduction of naked DNA into a cell or the introduction of DNA into a cell using a viral vector. The reduction may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage in between. In some embodiments, the off-target integration effects are reduced compared to off-target integration after the introduction of naked DNA into a cell or the introduction of DNA into a cell using a viral vector. The reduction may be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage in between.

[0558] In some cases, the methods described in this document provide high cell viability of cells into which RNP and nucleic acid (e.g., DNA template) have been introduced. In some cases, the viability of the cells into which RNP and nucleic acid (e.g., DNA template) have been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99% or higher. In some cases, the viability of the cells into which the RNP and nucleic acid (e.g., DNA template) have been introduced is from about 20% to about 99%, from about 30% to about 90%, from about 35% to about 85% or 90% or more, from about 40% to about 85% or 90% or more, from about 50% to about 85% or 90% or more, from about 50% to about 85% or 90% or more, from about 60% to about 85% or 90% or more, or from about 70% to about 85% or 90% or higher. Petition 870250078695, dated 03 / 09 / 2025, p. 159 / 387 147 / 291

[0559] In the methods provided in this document, the molar ratio of RNP to nucleic acid (e.g., DNA template) can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 3:1 to 10:1, from about 3:1 to about 15:1, 3:1 to about 20:1; 3:1 to about 25:1; from about 3:1 to 50:1, from about 3:1 to 75:1, from about 3:1 to 100:1; from about 5:1 to 10:1, from about 5:1 to about 15:1, 5:1 to about 20:1; 5:1 to about 25:1; from about 5:1 to 50:1, from about 5:1 to 75:1, from about 5:1 to 100:1; from about 8:1 to about 12:1; from about 8:1 to about 15:1, from about 8:1 to about 20:1, from about 8:1 to about 25:1, from about 8:1 to 50:1, from about 8:1 to 75:1, from about 8:1 to 100:1; from about 10:1 to about 15:1, 10:1 to about 20:1, 10:1 to about 25:1; from about 10:1 to 50:1, from about 10:1 to 75:1, or from about 10:1 to 100:1.

[0560] In some embodiments, the nucleic acid (e.g., DNA template) is at a concentration of about 2.5 pM to about 25 pM. For example, the concentration of the nucleic acid (e.g., DNA template) can be approximately 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM or any concentration between these concentrations.

[0561] In some embodiments, the size or length of the nucleic acid (e.g., DNA template) is greater than approximately 4.5 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb, 7.5 kb, 7.6 kb, 7.7 kb, 7.8 kb, 7.9 kb, 8.0 kb, 8.1 kb, 8.2 kb, 8.3 kb, 8.4 kb, 8.5 kb, 8.6 kb, 8.7 kb, 8.8 kb, 8.9 kb, 9.0 kb, 9.1 kb, 9.2 kb, 9.3 kb, 9.4 kb, 9.5 kb, 9.6 kb, 9.7 kb, 9.8 kb, 9.9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or 16 kb, or any nucleic acid size (e.g., DNA template) between these sizes. For example, the size of the DNA template can be from about 4.5 kb to about 15 kb, about 4.5 kb to about 14 kb, about 4.5 kb to about 10 kb, about 5 kb to about 15 kb, about 5 kb to about 14 kb, Petition 870250078695, dated 03 / 09 / 2025, p. 160 / 387 148 / 291 from approximately 5 kb to approximately 10 kb, from approximately 5 kb to approximately 9 kb, from approximately 5 kb to approximately 8 kb, from approximately 5 kb to approximately 7 kb, from approximately 5 kb to approximately 6 kb, from approximately 6 kb to approximately 15 kb, from approximately 6 kb to approximately 14 kb, from approximately 6 kb to approximately 10 kb, from approximately 6 kb to approximately 9 kb, from approximately 6 kb to approximately 8 kb, from approximately 6 kb to approximately 7 kb, from approximately 7 kb to approximately 15 kb, from approximately 7 kb to approximately 14 kb, from approximately 7 kb to approximately 10 kb, from approximately 7 kb to approximately 9 kb, from approximately 7 kb to approximately 8 kb, from approximately 8 kb to about 15 kb, about 8 kb to about 14 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, about 9 kb to about 15 kb, about 9 kb to about 14 kb, about 9 kb to about 13 kb, about 9 kb to about 12 kb, about 9 kb to about 11 kb, about 9 kb to about 10 kb, about 10 kb to about 15 kb, about 10 kb to about 14 kb, about 10 kb to about 13 kb, about 10 kb to about 12 kb or about 10 kb to about 11 kb.

[0562] In some embodiments, the amount of nucleic acid (e.g., DNA template) is from about 1 pg to about 10 pg. For example, the amount of nucleic acid (e.g., DNA template) may be from about 1 pg to about 2 pg, about 1 pg to about 3 pg, about 1 pg to about 4 pg, about 1 pg to about 5 pg, about 1 pg to about 6 pg, about 1 pg to about 7 pg, about 1 pg to about 8 pg, about 1 pg to about 9 pg, about 1 pg to about 10 pg. In some modalities, the amount of DNA template is approximately 2 pg to approximately 3 pg, approximately 2 pg to approximately 4 pg, approximately 2 pg to approximately 5 pg, approximately 2 pg to approximately 6 pg, approximately 2 pg to approximately 7 pg, approximately 2 pg to approximately 8 pg, approximately 2 pg to approximately 9 pg, or 2 pg to approximately 10 pg.In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 3 pg to about 4 pg, about 3 pg to about 5 pg, about 3 pg to about 6 pg, about 3 pg to about 7 pg, about 3 pg to about 8 pg, about 3 pg to about 9 pg, or about 3 pg to about 10 pg. In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 4 pg to about 5 pg, about 4 pg to about 6 pg, about 4 pg to about 7 pg, about 4 pg to about... Petition 870250078695, dated 03 / 09 / 2025, page 161 / 387 149 / 291 of 8 pg, about 4 pg to about 9 pg, or about 4 pg to about 10 pg. In some embodiments, the amount of template DNA is about 5 pg to about 6 pg, about 5 pg to about 7 pg, about 5 pg to about 8 pg, about 5 pg to about 9 pg, or about 5 pg to about 10 pg. In some embodiments, the amount of template DNA is about 6 pg to about 7 pg, about 6 pg to about 8 pg, about 6 pg to about 9 pg, or about 6 pg to about 10 pg. In some embodiments, the amount of nucleic acid (e.g., DNA template) is about 7 pg to about 8 pg, about 7 pg to about 9 pg, or about 7 pg to about 10 pg. In some embodiments, the amount of DNA template is about 8 pg to about 9 pg, or about 8 pg to about 10 pg. In some embodiments, the amount of DNA template is about 9 pg to about 10 pg.

[0563] In some cases, the size of the nucleic acid (e.g., DNA template) is large enough and in sufficient quantity to be as lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the nucleic acid (e.g., DNA template) encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the nucleic acid (e.g., DNA template) encodes one, two, three, four, five, six, seven, eight, nine, ten, or more genes.

[0564] In some embodiments, the nucleic acid (e.g., DNA template) includes regulatory sequences, for example, a promoter sequence and / or an enhancer sequence to regulate the expression of the heterologous protein or fragment thereof after insertion into the genome of a cell. In some embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter comprises one or more HNFIa enhancer elements. In some embodiments, the inducible promoter is a YB-TATA promoter element. In some embodiments, the inducible promoter comprises a sequence as set out in SEQ ID NO: 256. In some embodiments, the promoter is a constitutive promoter. In Petition 870250078695, dated 03 / 09 / 2025, p. 162 / 387 150 / 291 In some modalities, the constituent promoter is a promoter of EF1a. In some modalities, the constituent promoter comprises the sequence SEQ ID NO: 179.

[0565] In some cases, the nucleic acid (e.g., DNA template) is a linear DNA template. In some cases, the nucleic acid (e.g., DNA template) is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used in this document, “pure single-stranded DNA” means single-stranded DNA that substantially lacks the other DNA strand or the opposite strand. By “substantially lacks” means that the pure single-stranded DNA does not possess at least 100 times more of one strand than of the other DNA strand.

[0566] In some cases, an RNP-nucleic acid complex (e.g., DNA template) is formed by incubating the RNP with the nucleic acid (e.g., DNA template) for less than about one minute to about thirty minutes, at a temperature of about 20 °C to about 25 °C. For example, RNP can be incubated with the DNA template for approximately 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, or 30 minutes, or any period of time between these times, at a temperature of approximately 20°C, 21°C, 22°C, 23 °C, 24 °C or 25 °C.In another example, RNP can be incubated with nucleic acid (e.g., DNA template) for less than about one minute to about one minute, for less than about one minute to about 5 minutes, for less than about 1 minute to about 10 minutes, for about 5 minutes to 10 minutes, for about 5 minutes to 15 minutes, for about 10 to about 15 minutes, for about 10 minutes to about 20 minutes, or for about 10 minutes to about. Petition 870250078695, dated 03 / 09 / 2025, p. 163 / 387 151 / 291 for 30 minutes, at a temperature of about 20 °C to about 25 °C. In some embodiments, the RNP-DNA template complex and the cell are mixed before the introduction of the RNP-DNA template complex into the cell. In some embodiments, the RNP and nucleic acid (e.g., DNA template) and the cell are mixed before the introduction of the RNP and nucleic acid (e.g., DNA template) into the cell.

[0567] In some embodiments, the introduction of the RNP complex and nucleic acid (e.g., DNA template) comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce an RNP and nucleic acid (e.g., DNA template) may include those described in the examples in this document. Additional or alternative methods, compositions, and devices for electroporating cells to introduce an RNP and nucleic acid (e.g., DNA template) may include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce an RNP and nucleic acid (e.g., DNA template) may include those described in U.S. Patent Applications Nos. 2006 / 0094095; 2005 / 0064596; or 2006 / 0087522. Additional or alternative methods, compositions and devices for electroporation of cells to introduce an RNP-DNA template complex may include those described in Li, LH et al. Cancer Res. Treat. 1,341350 (2002); U.S. Patents Nos.: 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Application Publ. Nos.: 2014 / 0017213; and 2012 / 0088842, all of which are hereby incorporated by reference. Additional or alternative methods, compositions, and devices for cell electroporation to introduce an RNP and nucleic acid (e.g., DNA template) may include those described in Geng, T. et al. J. Release Control 144, 91-100 (2010); and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are hereby incorporated by reference. Petition 870250078695, dated 03 / 09 / 2025, p. 164 / 387 152 / 291

[0568] In some embodiments, the Cas9 protein may be in an active endonuclease form, such that when bound to the target nucleic acid as part of a complex with a guide RNA or part of a complex with a nucleic acid (e.g., DNA template), a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or HDR to introduce specific mutations. Several Cas9 nucleases can be used in the methods described in this document. For example, a Cas9 nuclease requiring a protospacer (PAM) motif adjacent to the NGG motif immediately 3' from the target region of the guide RNA can be used. Such Cas9 nucleases can be targeted to any region of a genome that contains an NGG sequence. As another example, Cas9 proteins with orthogonal PAM motif requirements can be used for targeting sequences that do not have an adjacent NGG PAM sequence.Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, October 22, 2015, both of which are hereby incorporated by reference.

[0569] In some cases, the Cas9 protein is a nickase, so that when bound to the target nucleic acid as part of a complex with a guide RNA, a single-strand break or cut is introduced into the target nucleic acid. A pair of Cas9 nickases, each bound to a structurally different guide RNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single-strand breaks into the target genomic region. Pairs of nickases can provide enhanced specificity because off-target effects are likely to result in single cuts, which are usually repaired without injury by base excision repair mechanisms. Exemplary Cas9 nickases include Cas9 nucleases with a D10A or H840A mutation.

[0570] In some embodiments, RNP comprises a nuclease Petition 870250078695, dated 03 / 09 / 2025, p. 165 / 387 153 / 291 Cas9. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally different RNP complexes. In some embodiments, the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains. In some embodiments, the at least two structurally different RNP complexes contain structurally different guide RNAs. In some embodiments, where the at least two structurally different RNP complexes contain structurally different guide RNAs, each of the structurally different RNP complexes comprises a Cas9 nickase and the structurally different guide RNAs hybridize to opposite strands of the target region.

[0571] In some cases, a plurality of RNPs and nucleic acids (e.g., DNA templates) comprising structurally different ribonucleoprotein complexes is introduced into the cell. For example, a Cas9 protein may be complexed with a plurality (e.g., 2, 3, 4, 5 or more, e.g., 2-10, 5-100, 20-100) of structurally different guide RNAs to direct the insertion of a nucleic acid (e.g., DNA template) into a plurality of structurally different target genomic regions.

[0572] In the methods and compositions provided in this document, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, and the like. Optionally, the cell is a mammalian cell, for example, a human cell. The cell may be in vitro, ex vivo, or in vivo. The cell may also be a primary cell, a germ cell, a stem cell, or a precursor cell. The precursor cell may be, for example, a pluripotent stem cell or a hematopoietic stem cell. In some embodiments, the cell is a primary hematopoietic cell or a primary hematopoietic stem cell. In some embodiments, the primary hematopoietic cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, a Petition 870250078695, dated 03 / 09 / 2025, page 166 / 387 154 / 291 effector T cell or a naive T cell. In some embodiments, the T cell is a CD4+ T cell. In some embodiments, the T cell is a CD8+ T cell. In some embodiments, the T cell is a CD4+CD8+ T cell. In some embodiments, the T cell is a CD4CD8' T cell. Populations of any cells modified by any of the methods described in this document are also provided. In some embodiments, the methods further comprise expanding the population of modified cells.

[0573] In some cases, cells are removed from a subject, modified using any of the methods described in this document, and administered to the patient. In other cases, any of the constructs described in this document is delivered to the patient in vivo. See, for example, U.S. Patent No. 9737604 and Zhang et al. “Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy”, NPG Asia Materials Volume 9, page e441 (2017), both of which are incorporated herein by reference.

[0574] In some embodiments, the RNP and nucleic acid (e.g., DNA template) is introduced into about 1 x 10⁵ to about 2 x 10⁶ cells. For example, the RNP-DNA template complex can be introduced into about 1 x 10⁵ to about 5 x 10⁵ cells, about 1 x 10⁵ to about 1 x 10⁶, 1 x 10⁵ to about 1.5 x 10⁶, 1 x 10⁵ to about 2 x 10⁶, about 1 x 10⁶ to about 1.5 x 10⁶ cells, or about 1 x 10⁶ to about 2 x 10⁶.

[0575] In some cases, the methods and compositions described in this document may be used for the generation, modification, use, or control of recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells may be used to treat or prevent cancer, an infectious disease, or an autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into a T cell to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor). Petition 870250078695, dated 03 / 09 / 2025, page 167 / 387 155 / 291 Insertion Sites

[0576] Methods for editing the genome of a T cell specifically include a method for editing the genome of a human T cell that comprises inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit gene (TRAC) in the human T cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the transmembrane domain of TCR-α.

[0577] Methods for editing the genome of a T cell also include a method of editing the genome of a human T cell that comprises inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit gene (TRBC) in the human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0578] Methods for editing the genome of a T cell, specifically, include a method of editing the genome of a human T cell that comprises inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0579] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random viral vector integration, as it mitigates the risks of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23: 399-406; Porteus et al. Nat Biotechnol. 2005 23: 967-973; Paques et al. Curr Gen Ther. 2007 7: 49-66). However, site-specific integration continues to face challenges such as low knock-in efficiency, risk of insertional oncogenesis, unstable and / or anomalous expression of adjacent genes or the transgene, low accessibility (e.g., within 20 kB of adjacent genes), etc. These challenges can be addressed, in part, through the identification and use of safe harbor loci or safe harbor sites (SHS), which are sites where genes or genetic elements can... Petition 870250078695, dated 03 / 09 / 2025, pp. 168 / 387 156 / 291 to be incorporated without disturbing the expression or regulation of adjacent genes.

[0580] The most widely used human safe harbor site is the AAVS1 site on chromosome 19q, which was initially identified as a site for recurrent insertion of adeno-associated viruses. Other potential SHS have been identified based on homology, with sites first identified in other species (e.g., the human homolog of the permissive murine locus Rosa26) or among the growing number of human genes that appear non-essential under some circumstances. One possible such SHS is the chemokine receptor gene CCR5, which, when disrupted, confers resistance to human immunodeficiency virus infection. Additional potential genomic SHS have been identified in human cells and other cell types based on viral integration site mapping or gene trap analyses, as well as the original murine locus Rosa26.The three main SHS, AAVS1, CCR5, and Rosa26, are close to many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for integration of new DNA into the human genome. Nature Reviews Cancer, 12(1), 51-58, relevant disclosures of which are incorporated herein by full reference).

[0581] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS site for hosting transgenes (e.g., DNA transgenes) with expected function. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19: 55625241-55629351. See Pellenz et al. “Novel Human Chromosomal Sites with Potential Safe Harbor for Target Transgene Insertion.” Human Gene Therapy vol. 30,7 (2019): 814-828, relevant disclosures of which are incorporated herein by reference. An exemplary AAVS1 target gRNA and target sequence are provided below: • AAVS1-gRNA sequence: Petition 870250078695, dated 03 / 09 / 2025, p. 169 / 387 157 / 291 ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCT AGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 268) • AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 269)

[0582] CCR5, located on chromosome 3 at position 3p21.31, encodes the main coreceptor of HIV-1. Disruption at this site in the CCR5 gene has been beneficial in HIV / AIDS therapy and has stimulated the development of zinc finger nucleases that target its third exon. The canonical SHS locus for CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. “New Human Chromosomal Sites with Safe Harbor Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, relevant disclosures of which are incorporated herein by reference.

[0583] The mouse Rosa26 locus is particularly useful for gene modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (Identification and targeting of the ROSA26 locus in human embryonic stem cells. Nature biotechnology 25.12 (2007): 1477-1482, relevant disclosure of which is incorporated herein by reference) identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3: 9415082-9414043. See Pellenz et al. “New Human Chromosomal Sites with Safe Harbor Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, whose relevant disclosures are incorporated herein by reference.

[0584] Additional examples of safe harbor sites are provided in Pellenz et al. “Novel Human Chromosomal Sites with Potential Safe Harbor for Target Transgene Insertion.” Human Gene Therapy vol. 30,7 (2019): 814-828, relevant disclosures of which are incorporated herein by reference. Examples of additional integration sites are provided in Table D.

[0585] In some modalities, safe harbor locations allow high Petition 870250078695, dated 03 / 09 / 2025, p. 170 / 387 158 / 291 Transgene expression (sufficient to allow transgene functionality or treatment of a disease of interest) and stable transgene expression over several days, weeks, or months. In some embodiments, gene knockout at the safe harbor locus confers a benefit to cell function, or the gene at the safe harbor locus has no known function within the cell.In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible dysregulation or silencing of genes near and positioned outside of a cancer-related gene.

[0586] As used, a nearby gene may refer to a gene that is within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, about 550 kB away from the safe harbor locus (integration site).

[0587] In some embodiments, the present disclosure includes insertions comprising one or more transgenes. The transgene may encode a therapeutic protein, an antibody, a peptide, or any other gene of interest. The integration of the transgene may result, for example, in enhanced therapeutic properties. These enhanced therapeutic properties, as used in this document, refer to an enhanced therapeutic property of a cell when compared to a typical immune cell of the same normal cell type. For example, a T cell with enhanced therapeutic properties has an enhanced, improved, and / or increased treatment outcome when compared to Petition 870250078695, dated 03 / 09 / 2025, page 171 / 387 159 / 291 a typical, unmodified and / or naturally occurring T cell. The therapeutic properties of immune cells may include, but are not limited to, cell transplantation, transport, localization, viability, self-renewal, persistence, control and regulation of the immune response, survival, and cytotoxicity. The therapeutic properties of immune cells are also manifested by: expression of the antigen-directed receptor; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction of bystander immune cells and immune regulation; enhanced target specificity with reduction; resistance to treatments such as chemotherapy.

[0588] As used in this document, the term insertion size refers to the length of the nucleotide sequence being integrated (inserted) into the target locus or safe harbor site. In some embodiments, the insertion size comprises at least about 4.5 kilobase pairs (kb) to about 10 kilobase pairs (kb). In some embodiments, the insertion size comprises about 5000 nucleotides or more base pairs. In some embodiments, the insertion size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilobase pairs) or intermediate sizes. In so...

Claims

CLAIMS 1. Isolated antibody or antigen-binding fragment thereof that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1), characterized in that it comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDRH3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

2. Isolated antibody, according to claim 1, characterized in that the VH chain sequence comprises the VH sequence established in SEQ ID NO: 99 and the VL chain sequence comprises the VL sequence established in SEQ ID NO:

100.

3. Isolated antibody, according to claim 1, characterized in that the antibody comprises a scFv.

4. Isolated antibody, according to claim 3, characterized in that the scFv comprises the sequence established in SEQ ID NO:

98.

5. Isolated antibody, according to claim 1, characterized in that the VH chain sequence comprises the VH sequence established in SEQ ID NO:

110. Petition 870250078695, dated 03 / 09 / 2025, pp. 305 / 387 2 / 45 6. Isolated receptor characterized in that it comprises an extracellular antigen-binding domain that binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1), comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDRH1, CDR-H2 and CDR-H3, of the VH sequence established in SEQ ID NO: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, of the VL sequence established in SEQ ID NO: 100, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDRH3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

7. Receiver, according to claim 6, characterized in that the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 99 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

100.

8. Receiver, according to claim 6 or 7, characterized in that the receiver comprises a scFv.

9. Receiver, according to claim 6, characterized in that the scFv comprises the sequence set forth in SEQ ID NO:

98.

10. Receiver, according to claim 6, characterized in that the VH chain sequence comprises the VH sequence set forth in SEQ ID NO:

110.

11. Receptor, according to any one of claims 6-10, Petition 870250078695, dated 03 / 09 / 2025, pp. 306 / 387 3 / 45, characterized in that the receptor is a chimeric antigen receptor (CAR) comprising, from the N-terminus to the C-terminus, a. the extracellular antigen-binding domain; b. a transmembrane domain; c. an optional intracellular co-stimulatory domain; and d. an intracellular activation domain.

12. Receiver, according to claim 11, characterized in that the CAR additionally comprises a hinge domain.

13. Receiver, according to claim 12, characterized in that the hinge domain comprises a CD8a, truncated CD8a or CD28 hinge domain.

14. Receiver, according to any one of claims 11-13, characterized in that the transmembrane domain comprises a CD8a transmembrane domain or a CD28 transmembrane domain.

15. Receptor, according to any one of claims 11-14, characterized in that the intracellular costimulatory domain comprises a 4-1BB domain.

16. Receptor, according to any one of claims 11-15, characterized in that the intracellular activation domain comprises a CD3Z domain.

17. Receiver, according to any one of claims 11-16, characterized in that the CAR comprises a sequence as set forth in SEQ ID Nos: 108, 115, 250 or 251.

18. Isolated antibody or antigen-binding fragment thereof that binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2), characterized in that it comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally where: a.a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

19. Isolated antibody, according to claim 18, characterized in that the VH chain sequence comprises the VH sequence established in SEQ ID NO: 118 and the VL chain sequence comprises the VL sequence established in SEQ ID NO:

119.

20. Isolated antibody, according to claim 18, characterized in that the VH chain sequence comprises the VH sequence established in SEQ ID NO: 130 and the VL chain sequence comprises the VL sequence established in SEQ ID NO:

131.

21. Isolated antibody, according to claim 18, characterized in that the antibody comprises a scFv.

22. Isolated antibody, according to claim 21, characterized in that the scFv comprises the sequence set forth in SEQ ID NO: 117 or 129.

23. Isolated receptor characterized in that it comprises an extracellular antigen-binding domain that binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2), comprising a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: a.a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

24. Receiver, according to claim 23, characterized in that the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 118 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

119.

25. Receiver, according to claim 23, characterized in that the VH chain sequence comprises the VH sequence set forth in SEQ ID NO: 130 and the VL chain sequence comprises the VL sequence set forth in SEQ ID NO:

131.

26. Receiver according to claim 23-25, characterized in that the priming receiver comprises an scFv.

27. Receiver, according to claim 26, characterized in that the scFv comprises the sequence set forth in SEQ ID NO: 117 Petition 870250078695, dated 03 / 09 / 2025, page 309 / 387 6 / 45 or 129.

28. A receptor, according to any one of claims 23-27, characterized in that the receptor is a priming receptor comprising, from the N-terminus to the C-terminus, a. an extracellular antigen-binding domain; b. a transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain comprising a human or humanized transcriptional effector, wherein the binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

29. Receptor according to claim 28, characterized in that the priming receptor further comprises a hinge domain positioned between the extracellular antigen-binding domain and the transmembrane domain.

30. Receiver, according to claim 29, characterized in that the hinge domain comprises a CD8a or truncated CD8a hinge domain.

31. Receiver, according to claim 30, characterized in that the hinge domain comprises the sequence as set forth in SEQ ID NO:

85.

32. Receiver, according to any one of claims 28-31, characterized in that the transmembrane domain comprises a Notch1 transmembrane domain.

33. Receiver, according to any one of claims 28-32, characterized in that the transmembrane domain comprises the sequence as set forth in SEQ ID NO:

86.

34. G receptor, according to any one of claims 2833, characterized in that the intracellular domain comprises an HNF1a / p65 domain or a Gal4 / VP64 domain. Petition 870250078695, dated 03 / 09 / 2025, pp. 310 / 387 7 / 45 35. Receptor according to claim 34, characterized in that the intracellular domain comprises the sequence as set forth in SEQ ID NO: 88, 89 or 90.

36. Receptor, according to any one of claims 28-35, characterized in that the priming receptor further comprises a transfer stop sequence or juxtamembrane domain between the transmembrane domain and the intracellular domain.

37. Receiver, according to claim 36, characterized in that the transfer stop sequence or juxtamembrane domain comprises the sequence as set forth in SEQ ID NO:

87.

38. Receiver, according to any one of claims 28-37, characterized in that the priming receiver comprises a sequence as set forth in SEQ ID NO: 127, 138, 252 or 253.

39. System, characterized in that it comprises: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2); and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1).

40. System according to claim 39, characterized in that the first extracellular antigen-binding domain comprises a first variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID Nos: 118 or 130, and a first variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID Nos: 119 or 131, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

41. System according to claim 39 or 40, characterized in that the first VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

42. System according to claims 39-41, characterized in that the first VL string sequence comprises the sequence established in SEQ ID NO: 119 or 131.

43. System according to claims 39-42, characterized in that the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

44. System according to claims 39-43, characterized in that the second extracellular domain-binding domain comprises a second variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally in Petition 870250078695, dated 03 / 09 / 2025, pp. 312 / 387 9 / 45 that: a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDRH3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

45. System according to claim 44, characterized in that the second VH comprises the sequence as set forth in SEQ ID NO: 99 or 110.

46. ​​System according to claim 44 or 45, characterized in that the second VL comprises the sequence set forth in SEQ ID NO:

100.

47. System, according to any one of claims 44-46, characterized in that the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

48. System according to any one of claims 39-47, characterized in that it further comprises an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA).

49. System, according to any one of claims 39-48, characterized in that it further comprises at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to: a. a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3; and Petition 870250078695, dated 03 / 09 / 2025, p. 313 / 387 10 / 45 b. a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

50. System according to any one of claims 39-49, characterized in that the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

51. System, according to any one of claims 39-50, characterized in that the system is encoded by a nucleic acid comprising a sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

52. System according to claim 50 or 51, characterized in that the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

53. System characterized in that it comprises: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1); c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. at least one or more nucleic acids comprising a nucleic acid sequence of at least 15 nucleotides in length complementary to: Petition 870250078695, dated 03 / 09 / 2025, page 314 / 387 11 / 45 i. a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3; and ii.a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

54. System according to claim 53, characterized in that the first extracellular antigen-binding domain comprises a first variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a first variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136, and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

55. System according to claim 53 or 54, characterized in that the first VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

56. System, according to claims 53-55, characterized in Petition 870250078695, dated 03 / 09 / 2025, page 315 / 387 12 / 45 by the fact that the first VL string sequence comprises the sequence established in SEQ ID NO: 119 or 131.

57. System according to claims 53-56, characterized in that the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

58. System according to claims 53-57, characterized in that the second extracellular domain-binding domain comprises a second variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID NO: 100, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDRH3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

59. System according to claim 58, characterized in that the second VH comprises the sequence as set forth in SEQ ID NO: 99 or 110.

60. System according to claim 58 or 59, characterized in that the second VL comprises the sequence set forth in SEQ ID NO:

100.

61. System, according to any of claims 58-60, Petition 870250078695, dated 03 / 09 / 2025, pp. 316 / 387 13 / 45 characterized in that the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

62. System characterized in that it comprises: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA) (SEQ ID NO: 2), wherein the first extracellular antigen-binding domain comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: i.CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDR-H3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDR-H3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO:

137. b. a second chimeric polypeptide comprises a chimeric antigen receptor (CAR); c. an optional third chimeric polypeptide comprises a synthetic pathway activator (SPA); and d.at least one or more nucleic acids comprising a Petition 870250078695, dated 03 / 09 / 2025, page 317 / 387 14 / 45 nucleic acid sequence with at least 15 nucleotides of length complementary to: i. a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3; and ii. a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

63. System according to claim 62, characterized in that the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

64. System according to claims 62 or 63, characterized in that the VH chain sequence comprises the sequence set forth in SEQ ID NO: 118 or 130.

65. System according to claims 62-64, characterized in that the VL string sequence comprises the sequence set forth in SEQ ID NO: 119 or 131.

66. System according to claims 62-65, characterized in that the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

67. System according to claims 62-66, characterized in that the CAR comprises a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1).

68. System according to claim 67, characterized in that the second extracellular antigen-binding domain comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID Nos: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence established in SEQ ID No: 100, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDRH3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

69. System according to claim 68, characterized in that the VH comprises the sequence as set forth in SEQ ID NO: 99 or 110.

70. System according to claim 68 or 69, characterized in that the VL comprises the sequence set forth in SEQ ID NO:

100.

71. System, according to any one of claims 62-70, characterized in that the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

72. System characterized in that it comprises: a. a first chimeric polypeptide comprising a priming receptor, and b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9) (SEQ ID NO: 1), wherein the extracellular antigen-binding domain comprises a single-domain antibody comprising a variable heavy chain (VH) sequence comprising three CDR sequences. Petition 870250078695, dated 03 / 09 / 2025, page 1. 319 / 387 16 / 45 heavy, CDR-H1, CDR-H2 and CDR-H3 of the VH sequences established in SEQ ID NOs: 99 or 110, and optionally a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3 of the VL sequence established in SEQ ID NOs: 110, optionally wherein: i.CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105, and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or ii. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDR-H3 comprises the sequence established in SEQ ID NO: 113; c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. at least one or more nucleic acids comprising a nucleic acid sequence with at least 15 nucleotides of length complementary to: i. a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3; and ii.a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

73. System according to claim 72, characterized in that the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 3 74. System, according to claim 72 or 73, characterized in Petition 870250078695, dated 03 / 09 / 2025, page 320 / 387 17 / 45 by the fact that the VH chain sequence comprises the sequence set forth in SEQ ID NO: 99 or 110.

75. System according to claims 72-74, characterized in that the VL comprises the sequence set forth in SEQ ID NO:

100.

76. System according to any one of claims 72-75, characterized in that the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

77. System according to any one of claims 72-76, characterized in that the priming receptor comprises a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA).

78. System according to claim 77, characterized in that the first extracellular antigen-binding domain comprises a variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences established in SEQ ID NOs: 118 or 130, and a variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequences established in SEQ ID NOs: 119 or 131, optionally wherein: a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b.CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 Petition 870250078695, dated 03 / 09 / 2025, page 321 / 387 18 / 45 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

79. System according to claim 78, characterized in that the VH comprises the sequence as set forth in SEQ ID NO: 118 or 130.

80. System according to claim 78 or 79, characterized in that the VL comprises the sequence set forth in SEQ ID NO: 119 or 131.

81. System, according to any one of claims 77-80, characterized in that the first extracellular domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

82. A system according to any one of claims 39-81, characterized in that the priming receptor comprises, from the N-terminus to the C-terminus, a. the first extracellular antigen-binding domain; b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain comprising a human or humanized transcriptional effector, wherein the binding of PSMA by the first extracellular antigen-binding domain results in cleavage at one or more ligand-inducible proteolytic cleavage sites.

83. System according to claim 82, characterized in that the priming receptor further comprises a first hinge domain positioned between the first extracellular antigen-binding domain and the first transmembrane domain.

84. System according to claim 83, characterized in that the first hinge domain comprises a CD8a hinge domain or a truncated CD8a hinge domain.

85. System according to claim 84, characterized in that the first hinge comprises the sequence as set forth in Petition 870250078695, dated 03 / 09 / 2025, pp. 322 / 387 19 / 45 SEQ ID NO:

85.

86. System, according to any one of claims 82-85, characterized in that the first transmembrane domain comprises a Notch1 transmembrane domain.

87. System according to any one of claims 82-86, characterized in that the transmembrane domain comprises the sequence as set forth in SEQ ID NO:

86.

88. System according to any one of claims 82-86, characterized in that the intracellular domain comprises either an HNF1a / p65 domain or a Gal4 / VP64 domain.

89. System according to claim 88, characterized in that the intracellular domain comprises the sequence as set forth in SEQ ID NO: 88, 89 or 90.

90. System according to any one of claims 82-88, characterized in that the priming receptor additionally comprises a transfer stop sequence or juxtamembrane domain between the first transmembrane domain and the intracellular domain.

91. System according to claim 90, characterized in that the transfer stop sequence or juxtamembrane domain comprises the sequence as set forth in SEQ ID NO:

87.

92. System according to any one of claims 39-91, characterized in that the priming receiver comprises a sequence as set forth in SEQ ID NO: 127, 138, 252 or 253.

93. System according to any one of claims 39 to 90, characterized in that the CAR comprises, from the N-terminus to the C-terminus, a. a second extracellular antigen-binding domain; b. a second transmembrane domain; c. an intracellular co-stimulatory domain; and d. an intracellular activation domain. Petition 870250078695, dated 03 / 09 / 2025, pp. 323 / 387 20 / 45 94. System, according to any one of claims 39-93, characterized in that the CAR comprises a second hinge domain.

95. System according to claim 94, characterized in that the second hinge domain comprises a CD8a hinge domain or a truncated CD8a hinge domain.

96. System according to any one of claims 93-95, characterized in that the second transmembrane domain comprises a CD8a transmembrane domain.

97. System according to any one of claims 93-96, characterized in that the intracellular co-stimulatory domain comprises a 4-1BB domain.

98. System according to any one of claims 93-97, characterized in that the intracellular activation domain comprises a CD3Z domain.

99. System, according to any one of claims 39-98, characterized in that the CAR comprises a sequence established in the SEQ ID Nos: 108, 115, 250 or 251.

100. System according to any one of claims 39-99, characterized in that the priming receptor and the CAR are capable of binding to the same target cell if the target cell expresses PSMA and CA9.

101. System, according to any one of claims 39-100, characterized in that the system is encoded by a nucleic acid comprising a sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

102. System according to claim 101, characterized in that the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147. Petition 870250078695, dated 03 / 09 / 2025, pp. 324 / 387 21 / 45 103. A system according to any one of claims 39-100, characterized in that at least one or more nucleic acid sequences have at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

104. System according to any one of claims 49-103, characterized in that at least one or more nucleic acid sequences are a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA) or an antisense oligonucleotide.

105. System according to claim 104, characterized in that at least one or more nucleic acid sequences are shRNA.

106. System according to any one of claims 49-105, characterized in that at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-82.

107. System, according to any one of claims 49-106, characterized in that the nucleic acid sequence complementary to human FAS comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-20.

108. System, according to any one of claims 49-107, characterized in that the nucleic acid reduces FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

109. System according to any one of claims 49-108, characterized in that the nucleic acid sequence complementary to human TGFBR2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 34-82.

110. System, according to any one of claims 49-109, characterized in that the nucleic acid reduces the expression of TGFBR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, Petition 870250078695, dated 03 / 09 / 2025, p. 325 / 387 22 / 45 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

111. System, according to any one of claims 49-110, characterized in that the system comprises at least two nucleic acid sequences complementary to human TGFBR2 selected from the group consisting of the sequences set forth in SEQ ID Nos: 34-82.

112. System according to any one of claims 49-108, characterized in that the system comprises at least one first nucleic acid sequence complementary to a nucleic acid encoding human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3, and a second nucleic acid sequence complementary to a nucleic acid encoding human TGF-β Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

113. System according to claim 112, characterized in that the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

114. System according to claim 112 or 113, characterized in that the first nucleic acid reduces the expression of FAS in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid and the second nucleic acid reduces the expression of TGFBR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not understand nucleic acid.

115. System, according to any one of claims 112-109, characterized in that it further comprises a third nucleic acid sequence complementary to a nucleic acid encoding Human TGF-β Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

116. System according to claim 115, characterized in that the third nucleic acid reduces the expression of TGFBR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

117. System, according to any one of claims 49-116, characterized in that it further comprises at least one nucleic acid sequence complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

118. System according to claim 117, characterized in that the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

119. System according to claim 117 or 118, characterized in that the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 21-33.

120. System, according to claims 117 or 119, characterized in that the nucleic acid reduces the expression of PTPN2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

121. System, according to any one of claims 48-120, characterized in that SPA is a STAT phosphorylation activator, optionally phosphorylation of STAT1, STAT3 and / or STAT5.

122. System, according to any of claims 48-121, Petition 870250078695, dated 03 / 09 / 2025, pp. 327 / 387 24 / 45 characterized in that the SPA comprises an extracellular domain linked to an intracellular signaling domain.

123. System according to claim 122, characterized in that the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.

124. System according to claim 122 or 123, characterized in that the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.

125. System according to claim 122 or 123, characterized in that the cytokine receptor comprises an interleukin-6 signal transducer (IL6ST).

126. System, according to any one of claims 48-125, characterized in that the SPA comprises the sequence as set forth in SEQ ID NO: 141 or 254.

127. A system according to any one of claims 122-125, characterized in that the extracellular domain transmits constitutive activity to the intracellular signaling domain.

128. System according to claim 100, characterized in that the target cell is a human cell.

129. System according to claim 100 or 128, characterized in that the target cell is a cancerous cell.

130. System, according to any one of claim 129, characterized in that the cancer cell is either a solid cancer cell or a liquid cancer cell.

131. System according to any one of claims 129-130, characterized in that the cancerous cell is a kidney cell, a colon cell, or a lung cell.

132. Nucleic acid characterized in that it comprises a nucleotide sequence encoding the antibody, as defined in claims 1-5. Petition 870250078695, dated 03 / 09 / 2025, pp. 328 / 387 25 / 45 133. Nucleic acid characterized in that it comprises a nucleotide sequence encoding the antibody, as defined in claims 18-22.

134. Nucleic acid characterized in that it comprises a nucleotide sequence encoding the chimeric antigen receptor, as defined in claims 6-17.

135. Nucleic acid characterized in that it comprises a nucleotide sequence encoding the priming receptor, as defined in claims 23-38.

136. One or more nucleic acids characterized in that they comprise at least one nucleic acid fragment comprising a nucleotide sequence encoding the system as defined in one of claims 39-131.

137. Nucleic acids according to claim 136 characterized in that the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

138. Nucleic acids, according to claim 136 or 137, characterized in that the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

139. One or more nucleic acids characterized in that one or more nucleic acids encode: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9).

140. Nucleic acids according to claim 139, characterized in that they further comprise a third chimeric polypeptide comprising a synthetic pathway activator (SPA).

141. Nucleic acids according to claim 139 or 140, characterized in that they further comprise at least one nucleic acid sequence of at least 15 nucleotides in length complementary to: i. a nucleic acid encoding the human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3; and ii. a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

142. One or more nucleic acids characterized in that one or more nucleic acids encode: a. a first chimeric polypeptide comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to Prostate-Specific Membrane Antigen (PSMA); b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to Carbonic Anhydrase IX (CA9); c. an optional third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. at least one nucleic acid sequence of at least 15 nucleotides in length complementary to: i. a nucleic acid encoding the Surface Death Receptor Petition 870250078695, dated 03 / 09 / 2025, p. 330 / 387 27 / 45 Human FAS Cellular (FAS) comprising the sequence set forth in SEQ ID NO: 3; and ii.a nucleic acid encoding the human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

143. Nucleic acids, according to any one of claims 139-142, characterized in that the first extracellular antigen-binding domain comprises a heavy chain comprising a first variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, of the VH sequences set forth in SEQ ID NOs: 118 or 130, and a light chain comprising a first variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, of the VL sequences set forth in SEQ ID NOs: 119 or 131, optionally wherein: a.a. CDR-H1 comprises the sequence established in SEQ ID NO: 120, CDR-H2 comprises the sequence established in SEQ ID NO: 121, CDRH3 comprises the sequence established in SEQ ID NO: 122, CDR-L1 comprises the sequence established in SEQ ID NO: 123, CDR-L2 comprises the sequence established in SEQ ID NO: 124 and CDR-L3 comprises the sequence established in SEQ ID NO: 125; or b. CDR-H1 comprises the sequence established in SEQ ID NO: 132, CDR-H2 comprises the sequence established in SEQ ID NO: 133, CDRH3 comprises the sequence established in SEQ ID NO: 134, CDR-L1 comprises the sequence established in SEQ ID NO: 135, CDR-L2 comprises the sequence established in SEQ ID NO: 136 and CDR-L3 comprises the sequence established in SEQ ID NO:

137.

144. Nucleic acids, according to any one of claims 139-143, characterized in that the first VH strand sequence comprises the VH sequence set forth in SEQ ID NO: 118 or 130, and the first VL strand sequence comprises the VL sequence set forth in SEQ ID NO: 119 or 131.

145. Nucleic acids, according to any one of claims 139-144, characterized in that the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 117 or 129.

146. Nucleic acids, according to any one of claims 139-145, characterized in that the second extracellular antigen-binding domain comprises a heavy chain comprising a second variable heavy chain (VH) sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2 and CDR-H3, from the VH sequences set forth in SEQ ID NOS: 99 or 110, and optionally a light chain comprising a second variable light chain (VL) sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2 and CDR-L3, from the VL sequence set forth in SEQ ID NOS: 100, optionally wherein a.a. CDR-H1 comprises the sequence established in SEQ ID NO: 101, CDR-H2 comprises the sequence established in SEQ ID NO: 102, CDR-H3 comprises the sequence established in SEQ ID NO: 103, CDR-L1 comprises the sequence established in SEQ ID NO: 104, CDR-L2 comprises the sequence established in SEQ ID NO: 105 and CDR-L3 comprises the sequence established in SEQ ID NO: 106; or b. CDR-H1 comprises the sequence established in SEQ ID NO: 111, CDR-H2 comprises the sequence established in SEQ ID NO: 112, CDRH3 comprises the sequence established in SEQ ID NO:

113.

147. Nucleic acids, according to any one of claims 139-146, characterized in that the second VH comprises the sequence as set forth in SEQ ID NO: 99 or 110.

148. Nucleic acids, according to any one of claims 139-147, characterized in that the second VL comprises the sequence Petition 870250078695, dated 03 / 09 / 2025, page 332 / 387 29 / 45 established in SEQ ID NO:

100.

149. Nucleic acids, according to any one of claims 139-148, characterized in that the second extracellular domain comprises the sequence set forth in SEQ ID NO: 98 or 110.

150. Nucleic acids according to any one of claims 139-142, characterized in that at least one nucleic acid sequence has at least 16, 17, 18, 19, 20, 21 or 22 nucleotides in length.

151. Nucleic acids according to any one of claims 139-143, characterized in that at least one nucleic acid sequence is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA) or an antisense oligonucleotide.

152. Nucleic acids according to claim 151, characterized in that at least one nucleic acid sequence is shRNA.

153. Nucleic acids, according to any one of claims 139-152, characterized in that at least one or more nucleic acids comprise a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-82.

154. Nucleic acids, according to any one of claims 139-153, characterized in that at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-82.

155. Nucleic acids, according to any one of claims 139-154, characterized in that at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 6-20.

156. Nucleic acids, according to any of the claims Petition 870250078695, dated 09 / 03 / 2025, pp. 333 / 387 30 / 45 139-155, characterized in that at least one or more nucleic acids reduce FAS expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

157. Nucleic acids, according to any one of claims 139-154, characterized in that at least one or more nucleic acids comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 34-82.

158. Nucleic acids, according to any one of claims 139-154 or 157, characterized in that at least one or more nucleic acids reduce the expression of TGFBR2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared with a control cell that does not understand the nucleic acid.

159. Nucleic acids, according to any one of claims 139-158, characterized in that they further comprise at least one nucleic acid sequence complementary to a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

160. Nucleic acids according to claim 159, characterized in that the nucleic acid sequence is complementary to nucleotides 518 to 559 of a nucleic acid encoding human Non-Receptor Protein Tyrosine Phosphatase Type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:

5.

161. Nucleic acids, according to claim 159 or 160, characterized in that the nucleic acid sequence complementary to human PTPN2 comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 21-33.

162. Nucleic acids, according to claims 159 or 161, Petition 870250078695, dated 03 / 09 / 2025, pp. 334 / 387 31 / 45, characterized in that the nucleic acid reduces the expression of PTPN2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95% or 99% compared to a control cell that does not contain the nucleic acid.

163. Nucleic acids, according to any one of claims 139-162, characterized in that at least one or more nucleic acid sequences are encoded in at least one intron region of the nucleic acid.

164. Nucleic acids, according to any one of claims 139-163, characterized in that the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

165. Nucleic acids, according to any one of claims 139-164, characterized in that the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

166. Nucleic acids, according to any one of claims 139-163, characterized in that the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 182-198.

167. One or more nucleic acids characterized in that they comprise at least one nucleic acid fragment comprising a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, a synthetic pathway activator (SPA); and at least one nucleic acid sequence with at least 15 Petition 870250078695, dated 03 / 09 / 2025, page.335 / 387 32 / 45 nucleotides in length, wherein at least one nucleic acid sequence comprises one or more of: (1) a first nucleic acid sequence complementary to a nucleic acid encoding human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3, and (2) a second nucleic acid sequence complementary to a nucleic acid encoding human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

168. One or more nucleic acids characterized in that they comprise at least one nucleic acid fragment comprising the nucleic acids as defined in any one of claims 139-166.

169. Nucleic acids, according to any one of claims 136-167, characterized in that the nucleic acid comprises two or more nucleic acid fragments.

170. Nucleic acids, according to any one of claims 136-169, characterized in that the nucleic acid further comprises an inducible promoter operationally linked to the nucleotide sequence encoding the CAR.

171. Nucleic acids, according to any one of claims 136-170, characterized in that the nucleic acid further comprises a constitutive promoter operationally linked to the nucleotide sequence encoding the priming receptor.

172. Nucleic acid, according to any one of claims 136-171, characterized in that the nucleic acid further comprises an inducible promoter operationally linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operationally linked to the nucleotide sequence encoding the priming receptor.

173. Nucleic acid, according to any of the claims Petition 870250078695, dated 03 / 09 / 2025, pp. 336 / 387 33 / 45 136-172, characterized in that the constitutive promoter is an EF1a promoter.

174. Nucleic acid, according to claim 173, characterized in that the EF1a promoter comprises a sequence as set forth in SEQ ID NO:

179.

175. Nucleic acid, according to any one of claims 136-174, characterized in that the inducible promoter comprises one or more Hepatocyte Nuclear Factor 1α (HNFIa) enhancing elements.

176. Nucleic acid, according to any one of claims 136-175, characterized in that the inducible promoter additionally comprises a YB-TATA promoter sequence.

177. Nucleic acid, according to any one of claims 136-176, characterized in that the inducible promoter comprises a sequence as set forth in SEQ ID NO:

256.

178. Nucleic acid, according to any one of claims 140-177, characterized in that the nucleic acid comprises, in a 5' to 3' direction, a. the constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the inducible promoter; d. the nucleotide sequence encoding the chimeric antigen receptor; and e. the optional nucleotide sequence encoding the SPA.

179. Nucleic acid, according to any one of claims 140-177, characterized in that the nucleic acid comprises, in a 5' to 3' direction, a. the inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the constitutive promoter; and Petition 870250078695, dated 03 / 09 / 2025, p. 337 / 387 34 / 45 d. the nucleotide sequence encoding the priming receptor; and e. the optional nucleotide sequence encoding SPA.

180. Nucleic acid, according to any one of claims 141-177, characterized in that the nucleic acid comprises, in a 5' to 3' direction, a. the first constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the second constitutive promoter; d. the nucleotide sequence encoding at least one nucleic acid complementary to human FAS or human TGFBR2; e. the inducible promoter; f. the optional nucleotide sequence encoding the chimeric antigen receptor; and g. the nucleotide sequence encoding the SPA.

181. Nucleic acid, according to any one of claims 141-177, characterized in that the nucleic acid comprises, in a 5' to 3' direction, a. the first constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the second constitutive promoter; d. the nucleotide sequence encoding the first nucleic acid complementary to human FAS or the nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; e. the nucleotide sequence encoding the first nucleic acid complementary to human FAS or the nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; f. the inducible promoter; g. the nucleotide sequence encoding the chimeric antigen receptor; and h. the optional nucleotide sequence encoding the SPA. Petition 870250078695, dated 03 / 09 / 2025, pages 338 / 387 35 / 45 182. Nucleic acid, according to any one of claims 141-177, characterized in that the nucleic acid comprises, in a 5' to 3' direction, a. the inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the second constitutive promoter; d. the nucleotide sequence encoding the first nucleic acid complementary to human FAS or the nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; e. the nucleotide sequence encoding the first nucleic acid complementary to human FAS or the nucleotide sequence encoding the second nucleic acid complementary to human TGFBR2; f. the first constitutive promoter; and g. the nucleotide sequence encoding the priming receptor; and h. the optional nucleotide sequence encoding the SPA.

183. Nucleic acid, according to any one of claims 132-182, characterized in that the nucleic acid further comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm complementary to an insertion site on a host cell chromosome.

184. Nucleic acid, according to any one of claims 132-183, characterized in that the nucleic acid further comprises a nucleotide sequence encoding a self-excising peptide 2A (P2A).

185. Nucleic acid, according to any one of claims 132-184, characterized in that P2A is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor.

186. Nucleic acid, according to any one of claims 132-184, characterized in that P2A is at the 3' end of the nucleotide sequence encoding the priming receptor.

187. Nucleic acid, according to any one of claims 132-186, characterized in that the nucleic acid additionally comprises a post-translational regulatory element of the marmot hepatitis virus (WPRE).

188. Nucleic acid, according to claim 187, characterized in that the WPRE is at the 3' end of the nucleotide sequence encoding the chimeric antigen receptor and at the 5' end of the nucleotide sequence encoding the priming receptor or in that the WPRE is at the 3' end of the nucleotide sequence encoding the priming receptor and at the 5' end of the nucleotide sequence encoding the chimeric antigen receptor.

189. Nucleic acid, according to any one of claims 132-187, characterized in that the nucleic acid additionally comprises an SV40 or a polyA element of human growth hormone (GH1).

190. Nucleic acid, according to any one of claims 136 to 189, characterized in that the nucleic acid is incorporated into an expression cassette or an expression vector.

191. Nucleic acid, according to claim 190, characterized in that the expression vector is a non-viral vector.

192. Vector characterized in that it comprises nucleic acid, as defined in any one of claims 132-191.

193. Vector according to claim 192, characterized in that the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a primary cell genome.

194. Vector according to claim 193, characterized in that the insertion site is located at a T-cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus. Petition 870250078695, dated 03 / 09 / 2025, pp. 340 / 387 37 / 45 195. A cell characterized in that it comprises: a. the system, as defined in any one of claims 39 to 131; b. at least one nucleic acid, as defined in any one of claims 132 to 191; and / or c. the vector, as defined in any one of claims 192-194.

196. Cell according to claim 195, characterized in that the cell is an immune cell.

197. Immune cell characterized in that it comprises: a. the system, as defined in any one of claims 39 to 131; b. at least one nucleic acid, as defined in any one of claims 132 to 191; and / or c. the vector, as defined in any one of claims 192-194.

198. Cell according to claim 196 or 197, characterized in that the immune cell is a primary human immune cell.

199. A cell, according to any one of claims 196-198, characterized in that the immune cell is an allogeneic immune cell.

200. A cell, according to any one of claims 196-198, characterized in that the immune cell is an autologous immune cell.

201. A cell, according to any one of claims 196-200, characterized in that the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a progenitor T cell.

202. A cell, according to any one of claims 196-201, characterized in that the primary immune cell is a primary T cell.

203. Cell, according to any of claims 196-202, characterized in that the primary immune cell is a primary human T cell. Petition 870250078695, dated 03 / 09 / 2025, pp. 341 / 387 38 / 45 204. A cell, according to any one of claims 196-203, characterized in that the primary immune cell is virus-free.

205. A primary immune cell characterized in that it comprises at least one nucleic acid comprising a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA, a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, and optionally a synthetic pathway activator inserted into a target region of the primary immune cell genome, and wherein the primary immune cell does not comprise a viral vector for introducing the nucleic acid into the primary immune cell.

206. A viable, virus-free primary cell characterized in that it comprises a ribonucleoprotein (RNP) and nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the nucleic acid comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to PSMA and a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to CA9, and optionally a synthetic pathway activator, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the primary cell genome.

207. Primary cell, according to claim 205 or 206, characterized in that it further comprises at least one nucleic acid sequence of at least 15 nucleotides in length, wherein at least one nucleic acid sequence comprises one or more of a first nucleic acid sequence complementary to a nucleic acid encoding human Cell Surface Death Receptor Fas (FAS) comprising the sequence set forth in SEQ ID NO: 3, and a second nucleic acid sequence complementary to a nucleic acid encoding human Transforming Growth Factor (TGF)-e Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

4.

208. Primary cell, according to any one of claims 205-207, characterized in that the nucleic acid comprises a sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with a sequence selected from the group consisting of the sequences set forth in SEQ ID Nos: 143-147.

209. A population of cells characterized in that it comprises a plurality of immune cells, as defined in any one of claims 195–208.

210. A pharmaceutical composition characterized in that it comprises the cells or immune cell, as defined in any one of claims 195 to 208, or the cell population, as defined in claim 209, and a pharmaceutically acceptable excipient.

211. Pharmaceutical composition characterized in that it comprises the nucleic acid, as defined in any one of claims 136-191, or the vector, as defined in any one of claims 192-194, and a pharmaceutically acceptable excipient.

212. A method for editing a cell, characterized in that it comprises: a. inserting nucleic acid, as defined in any one of claims 132 to 191, into an insertion site in the cell genome.

213. Method according to claim 212, characterized in that the nucleic acid is introduced into the cell in a non-viral manner.

214. A method for editing a cell, characterized in that it comprises: a. providing a nuclease domain and a guide RNA, wherein the nucleic acid comprises the nucleic acid as defined in any one of claims 132 to 191, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the cell genome; b. introducing the nuclease domain and nucleic acid into the cell, wherein the guide RNA specifically hybridizes with a target region of the cell genome, and wherein the nuclease domain cleaves the target region to create the insertion site in the target cell genome; and c. editing the cell by inserting the nucleic acid into the insertion site in the cell genome.

215. Method according to claim 214, characterized in that the nuclease domain and nucleic acid are introduced into the cell in a non-viral manner.

216. A method for editing an immune cell, characterized in that it comprises: a. providing a ribonucleoprotein (RNP) and nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the nucleic acid comprises the nucleic acid as defined in any one of claims 132 to 191, and wherein the 5' and 3' ends of the nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the immune cell genome; b. non-virally introducing the RNP and nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes with a target region of the primary immune cell genome, and wherein the nuclease domain cleaves the target region to create the insertion site in the immune cell genome; and c.to edit the immune cell by inserting nucleic acid, as defined in any one of claims 132 to 191, into the insertion site in the immune cell genome.

217. Method according to claims 213, 215 or 216, characterized in that the introduction in a non-viral manner comprises electroporation. Petition 870250078695, dated 03 / 09 / 2025, pp. 344 / 387 41 / 45 218. Method, according to any one of claims 214-217, characterized in that the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

219. A method according to any one of claims 214 to 218, characterized in that the target region of the cell genome is a T-cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.

220. A method according to any one of claims 212 to 219, characterized in that the nucleic acid is either a double-stranded nucleic acid or a single-stranded nucleic acid.

221. A method according to any one of claims 212 to 220, characterized in that the nucleic acid is either a linear nucleic acid or a circular nucleic acid, optionally wherein the circular nucleic acid is a plasmid.

222. Method, according to any one of claims 212 to 221, characterized in that the cell is an immune cell, optionally a primary human immune cell.

223. A method according to any one of claims 216 to 222, characterized in that the immune cell is an autologous immune cell.

224. Method according to any one of claims 216 to 222, characterized in that the immune cell is an allogeneic immune cell.

225. A method according to any one of claims 216 to 224, characterized in that the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a progenitor T cell.

226. Method, according to any one of claims 216 to 225, characterized in that the immune cell is a primary T cell.

227. Method, according to any one of claims 216 to 226, characterized in that the immune cell is a primary human T cell. Petition 870250078695, dated 03 / 09 / 2025, pp. 345 / 387 42 / 45 228. Method, according to any one of claims 212 to 227, characterized in that the cell is virus-free.

229. A method according to any one of claims 212 to 228, characterized in that it further comprises obtaining a cell from a patient and introducing the nucleic acid in vitro.

230. A method for treating a disease in a subject, characterized in that it comprises administering the cells or immune cell or cell population, as defined in any one of claims 195-209, or the pharmaceutical composition, as defined in any one of claims 210 or 211, to the subject.

231. Method according to claim 230, characterized in that the disease is cancer.

232. Method according to claim 231, characterized in that the cancer is either a solid cancer or a liquid cancer.

233. Method according to claim 231 or 232, characterized in that the cancer is renal cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer or lung cancer.

234. A method, according to any one of claims 231-233, characterized in that administration of the immune cell potentiates an immune response in the subject.

235. Method according to claim 234, characterized in that the enhanced immune response is an adaptive immune response.

236. Method according to claim 234, characterized in that the enhanced immune response is an innate immune response.

237. A method, according to any one of claims 231-236, characterized in that the enhanced immune response is an increased expression of at least one cytokine or chemokine.

238. Method according to claim 237, characterized in that the cytokine is interferon-gamma (IFNy).

239. Method, according to any of the claims 230 Petition 870250078695, dated 03 / 09 / 2025, pp. 346 / 387 43 / 45 233, characterized in that it further comprises administering immunotherapy to the subject simultaneously with or subsequently to the immune cell.

240. A method for inhibiting a target cell in a subject, characterized in that it comprises administering the immune cell or population of immune cells, as defined in any of claims 197-209, to the subject, wherein the immune cell inhibits the target cell.

241. Method according to claim 240, characterized in that the target cell expresses PSMA and CA9.

242. Method according to claim 240 or 241, characterized in that the target cell is a cancerous cell.

243. A method for inducing expression of a chimeric antigen receptor with a priming receptor in a cell, characterized in that it comprises: a. obtaining a cell or immune cell comprising b. the system, as defined in any one of claims 39-131; c. the nucleic acid, as defined in any one of claims 132-191; and / or d. the vector, as defined in any one of claims 192-194; and e. placing the cell or immune cell in contact with a target cell expressing PSMA and CA9, wherein the binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor.

244. Method for modulating the activity of a cell or immune cell characterized in that it comprises: a. obtaining a cell or immune cell comprising b. the system, as defined in any one of claims 39-131; Petition 870250078695, dated 03 / 09 / 2025, pp. 347 / 387 44 / 45 c. the nucleic acid, as defined in any one of claims 132-191; and / or d. the vector, as defined in any one of claims 192-194; and e. placing the cell or immune cell in contact with a target cell expressing PSMA and CA9, wherein binding of the priming receptor to PSMA on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor and wherein binding of the chimeric antigen receptor to CA9 on the target cell modulates the activity of the immune cell.

245. Method according to claim 244, characterized in that modulating immune cell activity comprises potentiating an immune response.

246. Method according to claim 245, characterized in that the enhanced immune response is an adaptive immune response.

247. Method according to claim 245, characterized in that the enhanced immune response is an innate immune response.

248. A method, according to any one of claims 244-247, characterized in that the immune cell activity is an increased expression of at least one cytokine or chemokine.

249. Method according to claim 248, characterized in that the cytokine is interferon-gamma (IFNy).

250. A method for treating a disease in a subject, characterized in that it comprises: a. determining or having determined the presence of PSMA-positive (PSMA+) cells in a cancer sample obtained from the subject; b. determining or having determined the presence of CA9-positive (CA+) cells in a cancer sample obtained from the subject; and c. administering the cell or immune cell, as defined in any of claims 197-209, or the pharmaceutical composition, as defined in claims 210 or 211, to the subject. Petition 870250078695, dated 03 / 09 / 2025, pp. 348 / 387 45 / 45 251. Method according to claim 250, characterized in that the disease is cancer.

252. Method according to claim 251, characterized in that the cancer is either a solid cancer or a liquid cancer.

253. Method according to claim 251 or 252, characterized in that the cancer is renal cancer, clear cell renal cell carcinoma (ccRcc), colorectal cancer or lung cancer.

254. A method, according to any one of claims 250-253, characterized in that administration of the cell or immune cell potentiates an immune response in the subject.

255. Method according to claim 254, characterized in that the enhanced immune response is an adaptive immune response.

256. Method according to claim 254, characterized in that the enhanced immune response is an innate immune response.

257. A method, according to any one of claims 250-256, characterized in that the enhanced immune response is an increased expression of at least one cytokine or chemokine.

258. Method according to claim 257, characterized in that the cytokine is interferon-gamma (IFNy).

259. A method according to any one of claims 250-258, characterized in that it further comprises administering immunotherapy to the subject simultaneously with or subsequently to the immune cell.

Images