Compositions comprising 15-HEPE and methods of treatment and / or prevention of hematological disorders and related diseases.

Description

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 488,589, filed March 6, 2023, disclosure of which is incorporated by reference as if in its entirety. TECHNICAL AREA

[0002] This application relates generally to compositions comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) and methods of using it, including in the treatment of hematological disorders. SEQUENCE LISTING

[0003] This application contains a Sequence Listing in accordance with ST.26, which is simultaneously submitted in xml format via Patent Center and is incorporated herein by reference in its entirety. The copy.xml, created on February 5, 2024, is named 1243188019US01.xml and is 13,954 kilobytes in size. BACKGROUND

[0004] Blood is the life-sustaining fluid that circulates throughout the body and is composed of liquids and solids. The liquid part, called plasma, is composed of water, salts, and proteins. The solid part contains red blood cells, white blood cells, and platelets. Hematologic disorders are diseases of the blood (e.g., red blood cells) and blood-forming organs. Common hematologic disorders include anemias, bleeding disorders, and blood cancers. A subclass of hematologic disorders, termed red blood cell disorders, are conditions that affect the production, lifespan, and shape of red blood cells (erythrocytes) and their oxygen-carrying molecule, hemoglobin. These conditions inhibit the transport of oxygen from the lungs to the rest of the body. On the other hand, bleeding disorders include hemophilia, a condition characterized by insufficient clotting factor and Petition 870250099883, dated 10 / 31 / 2025, page 9 / 336 2 / 223 excessive bleeding, and thrombophilia, a condition characterized by an increased risk of developing blood clots in the veins and arteries. These clots can break loose from the blood vessel and travel through the bloodstream to an organ, thus preventing blood flow to that organ, resulting in ischemia. Blood clots can increase the risk of stroke and / or pulmonary embolism. SUMMARY

[0005] The application relates to compositions comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) and methods of using these compositions in the treatment of a variety of diseases and disorders, including hematological diseases and disorders.

[0006] In one aspect, a method is provided for the treatment and / or prevention of a hematological disorder in an individual who needs it, comprising administering to the individual a composition comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof. In some embodiments, the hematological disorder is selected from the group consisting of a red blood cell disorder, a hemoglobin disorder, a bleeding disorder and a blood cancer.

[0007] In some forms, the red blood cell disorder is selected from the group consisting of anemia, hemolytic anemia, iron deficiency anemia, hereditary spherocytosis, chronic hemolysis, pyruvate kinase deficiency, and glucose-6-phosphate dehydrogenase (G6PD) deficiency.

[0008] In some forms, the hemoglobin disorder is selected from the group consisting of sickle cell disease, alpha thalassemia, and beta thalassemia.

[0009] In some modalities, the bleeding disorder is selected from the group consisting of hemophilia, thrombophilia, thrombocytopenia, idiopathic thrombocytopenic purpura (ITP), heparin-induced thrombocytopenia (HIT), venous thromboembolism, arterial thrombosis, and embolism. Petition 870250099883, dated 10 / 31 / 2025, p. 10 / 336 3 / 223

[0010] In some modalities, blood cancer is selected from the group consisting of myelodysplastic syndrome (MDS), lymphoma, leukemia, and myeloma.

[0011] In one aspect, a method is provided for treating and / or preventing sickle cell disease and / or its associated symptoms in an individual in need, comprising administering to the individual a composition comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof. In some embodiments, the associated symptoms include inflammatory vasculopathy, vasoconstriction, bronchoconstriction, iron overload, hemoglobinopathy, chromic hemolysis, sickling, anemia, inflammation, pain, acute and / or chronic organ damage (e.g., lung, kidney, liver, spleen) and / or oxidative stress.

[0012] In one aspect, a method is provided for treating and / or preventing heparin-induced thrombocytopenia (HIT) in an individual who needs it, comprising administering to the individual a composition that includes 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof.

[0013] In some modalities, the individual shows no change or a reduction in serum creatine levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0014] In some modalities, the individual shows no change or a reduction in C-reactive protein (CRP) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0015] In some modalities, the individual shows no change or a reduction in pentraxin-2 levels after receiving the composition comprising 15-HEPE in relation to baseline or a Petition 870250099883, dated 10 / 31 / 2025, page 11 / 336 4 / 223 control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0016] In some embodiments, the individual shows no change or a reduction in monocyte chemoattractant protein-1 (MCP-1 / CCL2) levels after receiving the 15-HEPE composition compared to baseline or to a control individual who did not receive the 15-HEPE composition or who received placebo.

[0017] In some modalities, the individual shows no change or a reduction in circulating neutrophils after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0018] In some embodiments, the individual shows no change or a reduction in vascular cell adhesion molecule 1 (VCAM-1) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0019] In some embodiments, the individual shows no change or a reduction in levels of intercellular adhesion molecule 1 (ICAM-1) after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0020] In some modalities, the individual shows no change or a reduction in endothelin-1 (ET-1) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0021] In some modalities, the individual shows no changes or shows an increase in hematocrit levels after receiving the composition that includes 15-HEPE in relation to baseline or Petition 870250099883, dated 10 / 31 / 2025, page 12 / 336 5 / 223 a control individual who did not receive the composition comprising 15-HEPE or who received a placebo.

[0022] In some modalities, the individual shows no change or shows an increase in hemoglobin levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0023] In some modalities, the individual shows no change or a reduction in the number of sickle-shaped red blood cells after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0024] In some modalities, the individual shows no change or a reduction in CD68 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0025] In some modalities, the individual shows no change or a reduction in CD80 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0026] In some modalities, the individual shows no change or a reduction in NF-kB p65 activation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0027] In some modalities, the individual shows no alteration or shows a reduction in NLRP3 inflammasome activation after receiving the composition comprising 15-HEPE in Petition 870250099883, dated 10 / 31 / 2025, page 13 / 336 6 / 223 in relation to the baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0028] In some embodiments, the individual shows no change or a reduction in vascular endothelial activation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0029] In some embodiments, the individual shows no change or shows a reduction in vascular recruitment of neutrophils after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0030] In some modalities, the individual shows no changes or a reduction in inflammatory cell infiltration after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0031] In some modalities, the individual shows no change or a reduction in thrombus formation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0032] In some embodiments, the individual shows no change or a reduction in iron overload and / or iron accumulation in the liver after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0033] In some modalities, the individual shows no change or a reduction in oxidative stress after receiving the composition comprising 15-HEPE in relation to baseline or Petition 870250099883, dated 10 / 31 / 2025, page 14 / 336 7 / 223 a control individual who did not receive the composition comprising 15-HEPE or who received a placebo.

[0034] In some modalities, the individual shows no changes or a reduction in levels of nuclear factor erythroid 2-related factor 2 (Nrf2) after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0035] In some modalities, the individual shows no change or a reduction in oxidation and / or heme oxygenase-1 (HO-1) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0036] In some embodiments, the individual shows no change or a reduction in selectin E levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0037] In some modalities, the individual shows no change or a reduction in red blood cell adhesion after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

[0038] In some embodiments, 15-HEPE is in the form of free acid, in the form of a salt, or in esterified form, for example, a C1-C5 alkyl ester (e.g., an ethyl ester) or a triglyceride.

[0039] In some embodiments, 15-HEPE is in the enantiomeric form of 15(S)-HEPE and / or in the enantiomeric form of 15(R)-HEPE.

[0040] In some embodiments, the composition comprises one or more additional active agents selected from the group consisting of eicosapentaenoic acid (EPA), 5-hydroxy-eicosapentaenoic acid (5 Petition 870250099883, dated 10 / 31 / 2025, p. 15 / 336 8 / 223 HEPE), 12-hydroxy-eicosapentaenoic acid (12-HEPE), 18-hydroxyeicosapentaenoic acid (18-HEPE), 15-hydroxy-eicosatrienoic acid (15-HETrE), 15-hydroxy-eicosatetraenoic acid (15-HETE), 14-hydroxy-docosahexaenoic acid (14HDoHE), 17-hydroxy-docosahexaenoic acid (17-HDoHE), resolvin D1 (RvD1 or 17(S)-RvD1) and aspirin-activated resolvin D1 (AT-RvD1 or 17(R)-RvD1).

[0041] In some embodiments, 15-HEPE represents at least 80% by weight of the composition, or at least 80% by weight of all fatty acids present in the composition. In some embodiments, the composition comprises no more than 10% by weight of omega-3 fatty acids other than 15-HEPE. In some embodiments, omega-3 fatty acids other than 15-HEPE do not represent more than 10% by weight of all fatty acids present in the composition.

[0042] In some embodiments, the composition is formulated in one or more oral dosage units, for example, one or more capsules. In some embodiments, approximately 500 mg to approximately 1,000 mg of 15HEPE are present in each capsule. In some embodiments, the composition further comprises a pharmaceutically acceptable excipient.

[0043] In some embodiments, the composition is administered to the individual to provide a daily dose of approximately 1 g to approximately 8 g, or approximately 8 g, of 15-HEPE, for example, in 1 to 8 capsules per day. BRIEF DESCRIPTION OF THE FIGURES

[0044] Figure 1 is a schematic diagram of the study described in Example 1 and its duration.

[0045] Figure 2 shows the changes in body weight of the animals according to the study described in Example 1.

[0046] Figure 3 shows the body weight on the day of animal sacrifice according to the study described in Example 1.

[0047] Figures 4A to 4D show the weight of the kidneys and the kidney / body weight ratio of the animals on the day of sacrifice, according to the study described in Example 1. Petition 870250099883, dated 10 / 31 / 2025, page 16 / 336 9 / 223

[0048] Figure 5 shows the hydroxyproline content in the kidneys of the animals according to the study described in Example 1.

[0049] Figures 6A to 6G show the Sirius red staining of the animals according to the study described in Example 1.

[0050] Figure 7 shows a graph representing the positive area for red Sirius (%) of the animals according to the study described in Example 1.

[0051] Figures 8A to 8D show gene expression analyses for α-SMA, TIMP-1, TGF-β, and type 1 collagen from the animals according to the study described in Example 1, respectively.

[0052] Figure 9 is a schematic diagram of the study described in Example 2 and its duration.

[0053] Figure 10 shows the changes in body weight of the animals according to the study described in Example 2.

[0054] Figure 11 shows the body weight on the day of animal sacrifice according to the study described in Example 2.

[0055] Figures 12A and 12B show the liver weight and liver / body weight ratio of the animals on the day of sacrifice, according to the study described in Example 2, respectively.

[0056] Figure 13 shows the changes in serum ALT levels of the animals according to the study described in Example 2.

[0057] Figure 14 shows the changes in total serum bilirubin levels in the animals according to the study described in Example 2.

[0058] Figures 15A to 15E show the Sirius red staining and the area of ​​fibrosis of the animals according to the study described in Example 2.

[0059] Figure 16 shows a graph representing the positive area for red Sirius (%) of the animals according to the study described in Example 2.

[0060] Figures 17A to 17D show the analyses of Petition 870250099883, dated 10 / 31 / 2025, page 17 / 336 10 / 223 gene expression for α-SMA, TIMP-1, TGF-β and type 1 collagen in animals according to the study described in Example 2, respectively.

[0061] Figures 18A and 18B show the DS102 (15-HEPE)-induced inhibition of TGF-β according to the study described in Example 3.

[0062] Figures 18C to 18G show the effects of DS102 on the translocation and membrane degradation of TGF-β receptor type I, TGF-β receptor type II, TGF-β receptor type III, EGFR and caveolin-1 according to the study described in Example 3, respectively.

[0063] Figure 19 is a schematic diagram of the study described in Example 4 and its duration.

[0064] Figure 20 shows the baseline lipidomic profile of the patients according to the study described in Example 4.

[0065] Figures 21A to 21C are graphs that describe the changes in insulin, glucose, and free fatty acid levels in patients who received Epeleuton (15-HEPE) and placebo, respectively.

[0066] Figures 22A and 22B are graphs that describe the changes in HOMA-IR and apido-IR levels in patients who received Epeleuton and placebo, respectively.

[0067] Figures 23A and 23B are graphs depicting changes in mean HbA1C levels in patients and the proportion of patients with HbA1C levels > 6.5% at week 16 who received Epeleuton and placebo, respectively.

[0068] Figures 24A and 24B are graphs showing the mean and median change (%) in the lipid profile of patients who received Epeleuton and placebo, respectively.

[0069] Figures 25A to 25C are graphs that describe the changes in cholesterol, triglyceride, and VLDL-C levels in patients who received Epeleuton and placebo, respectively.

[0070] Figure 26 is a graph that describes the changes in the hepatotoxic lipid profile of patients who received DS102. Petition 870250099883, dated 10 / 31 / 2025, page 18 / 336 11 / 223

[0071] Figure 27 shows graphs that validate that DS102 administration resolves NASH using the OWL liver care test.

[0072] Figure 28 shows graphs that describe the changes in liver fat content by CAP in patients who received DS102 and placebo.

[0073] Figures 29A to 29C are a graph depicting changes in the levels of inflammatory and pro-fibrotic proteins in patients who received DS102 and placebo.

[0074] Figure 30 shows graphs that describe changes in protein expression, including targets for NASH development in patients who received DS102 and placebo.

[0075] Figure 31 is a volcano graph showing a reduction in inflammatory and pro-fibrotic proteins in patients who received DS102 and placebo.

[0076] Figure 32 shows graphs that describe the changes in vascular adhesion molecules in patients who received DS102 and placebo.

[0077] Figure 33 shows graphs that describe the changes in cardiovascular risk proteins in patients who received DS102 and placebo.

[0078] Figure 34 shows graphs that describe the changes in chemokines in patients who received DS102 and placebo.

[0079] Figure 35 graphs depict changes in tumor necrosis factor receptor superfamily members in patients who received DS102 and placebo.

[0080] Figures 36A and 36B are graphs that describe the reduction in ALP levels in patients who received DS102 and placebo.

[0081] Figure 37 is a boxplot of the minimum relative plasma concentrations of 15-HEPE ethyl ester.

[0082] Figures 38A to 38C are bar graphs that Petition 870250099883, dated 10 / 31 / 2025, p. 19 / 336 Figures 12 / 223 show the mean change and standard deviation of red blood cell count, red blood cell distribution width, and reticulocyte count in rats that received 15(S)-HEPE EE and placebo, respectively.

[0083] Figures 39A and 39C are bar graphs showing the mean change and standard deviation of prothrombin time, activated partial thromboplastin time, and fibrinogen concentration in rats that received 15(S)-HEPE EE and placebo, respectively.

[0084] Figures 40A to 40H. In mice with SCD, the Epeleuton reduces circulating neutrophils and modulates the inflammatory response by downregulating markers of inflammatory vasculopathy. Figure 40A. Circulating neutrophils identified by flow cytometry analysis as CD45+Ly6G+ cells in AA and SS mice treated with vehicle or Epeleuton (1,000 mg / kg / d for six weeks). Data are presented as mean ± SEM (n = 49); * p< 0.05 compared to healthy mice; P<0.05 compared to SS animals treated with vehicle by one-way ANOVA. Figures 40B to 40D. Immunotransfer analysis using specific antibodies against phosphorylated (p-)NF-κB p65 and NF-κB p65 in the lung (Figure 40B), kidney (Figure 40C), and liver (Figure 40D) of AA and SS mice treated as in Figure 40A. 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown.Densitometric analysis of immunoblots is shown in Figure 49A. Figures 40E and 40F. Immunotransfer analysis using specific antibodies against VCAM-1, ICAM-1, and ET-1 in the lung (Figure 40E) and kidney (Figure 40F) of AA and SS mice treated as in Figure 40A. 75 pgr of protein loaded onto an 11% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel with similar results is shown. Densitometric analysis of immunoblots is shown in Figures 49B and 50A, respectively. Figure 40G. Top panel. Immunotransfer analysis using specific antibodies against VCAM-1 and ET-1 in the liver of AA and SS mice treated as in Figure 40A. 50 pgr / pl of protein loaded onto a gel. Petition 870250099883, dated 10 / 31 / 2025, page 20 / 336 13 / 223 polyacrylamide 8% T, 2.5% C. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Bottom panel. Densitometric analysis of immunoblots is shown in the bottom panel. Data are presented as means ± SEM(n=4); * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit). Figure 40H. OxyBlot analysis of soluble liver fractions from AA and SS mice treated as in Figure 40B. Carbonylated proteins (1 mg) were detected by treatment with 2,4-dinitrophenylhydrazine and blotted with anti-DNP antibody. GAPDH serves as a protein loading control. Band area quantification is shown in Figure 50B.

[0085] Figures 41A to 41E. In SCD mice exposed to H / R stress, Epeleuton reduces H / R-induced hemolysis and the inflammatory response. Figure 41A. Hematocrit (Hct, left panel) and hemoglobin (Hb, right panel) in AA and SS mice exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours) treated with vehicle or Epeleuton (1,000 mg / kg / day for 6 weeks). Data are presented as mean ± SEM (n = 4-9). * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle-treated mice by paired t-test with Bonferroni correction. Figure 41B. Erythrocyte morphology from blood smears of SS mice treated as in Figure 41A. A representative image is shown. Original magnification of 100*. Data are mean ± SEM (n=6). Λp< 0.05 compared to normoxia, ° p<0.05 compared to vehicle-treated mice by paired t-test with Bonferroni correction.Figure 41C. Immunotransfer analysis using specific antiphosphotyrosine antibody of red blood cell membrane proteins from mice treated as in Figure 41A. 75 pg of proteins loaded onto an 8% T, 2.5% C polyacrylamide gel. Coomassie staining was used as a loading control. Densitometric analysis of band-3 phosphorylation is shown on the right. Data are presented as means ± SEM (n=3), * p<0.05 compared to AA mice; ° p<0.05 compared to mice treated with. Petition 870250099883, dated 10 / 31 / 2025, page 21 / 336 14 / 223 vehicle by paired t-test with Bonferroni correction. Figure 41D. Plasma lactate dehydrogenase (LDH) values ​​in AA and SS mice under normoxia or H / R exposure and treated as in Figure 41A. Data are mean ± SEM (n = 5), * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle-treated mice, one-way ANOVA. Figure 41E. Circulating neutrophils identified by flow cytometry analysis as CD45+Ly6G+ cells in mice treated as in Figure 41A. Data are mean ± SEM (n = 4-7), * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle-treated mice by one-way ANOVA.

[0086] Figures 42A to 42C. Epeleuton reprograms splenic macrophages to a pro-resolution pattern. Figures 42A and 42B. Flow cytometry gating strategy (Figure 42A) and representative graphs of splenic macrophages from vehicle- or vehicle- or Epeleuton-treated AA or SS mice (Figure 42B). Figure 42C. M1 marker expression in splenic macrophages and red blood cell clearance from Epeleuton-fed AA or SS mice determined by flow cytometry in F4 / 80+ cells. Erythrocyte phagocytosis was assessed as the percentage of double-positive F4 / 80+ / Ter-119+ cells. MFI, Mean fluorescence intensities. Results are means ± SD (n= 4 mice / group); *p < 0.05 (one-way ANOVA).

[0087] Figures 43A to 43C. In mice with SCD, the Epeleuton reduces lung injury by preventing NF-κB hyperactivation and hypoxia-induced pulmonary inflammatory vasculopathy. Figure 43A. Representative microimage of hematoxylin and eosin (H&E) stained lung sections at 200x magnification from SS mice under normoxia and exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours) treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks), (scale bar: 50 pm) (see also Table 38). Figure 43B. Immunotransfer analysis using specific antibodies against phosphorylated (p-)NF-κB p65 and NF-κB p65 in lungs of AA and SS mice under normoxia or exposed to H / R: hypoxia (8% oxygen); 10 hours), followed by reoxygenation (21% oxygen; 3 hours), treated Petition 870250099883, dated 10 / 31 / 2025, page 22 / 336 15 / 223 with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Right panel. Densitometric analysis of immunoblots is shown on the right. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; Λp<0.05 compared to normoxia; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit). Figure 43C. Immunoblot analysis using specific antibodies against NLRP3, VCAM-1, E-selectin, and TBXS (thromboxane synthase) in the lung of AA and SS mice treated as in Figure 43B. 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of the immunoblots is shown on the right.Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; λ p<0.05 compared to normoxia; ° p<0.05 compared to the vehicle by one-way ANOVA (DU: Densitometric Unit).

[0088] Figures 44A to 44E. In mice with SCD, the Epeleuton reduces H / R-induced renal damage and markers of vascular dysfunction. Figure 44A. Representative microimage of hematoxylin and eosin (H&E) stained kidney sections at 200x magnification from SS mice exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours) treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks) (scale bar: 50 pm) (see also Table 38). Figure 44B. Renal leukocyte infiltrates determined by flow cytometry gating analysis (the gating strategy is shown in Figures 54A and 54B). Data are presented as mean ± SEM (n=4-6), λ p <0.05 compared to normoxia; ° p <0.05 compared to the vehicle by the unpaired t-test with Bonferroni correction. Figure 44C.Blood urea nitrogen (BUN) values ​​(top panel) and plasma creatinine (bottom panel) in AA and SS mice under normoxia conditions or exposed to H / R: hypoxia (8% oxygen); 10 hours), followed by reoxygenation (21% oxygen; 3. Petition 870250099883, dated 10 / 31 / 2025, page 23 / 336 16 / 223 hours), treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). Data are means ± SEM (n=6). * p <0.05 compared to AA mice, Λp <0.05 compared to normoxia; ° p <0.05 compared to vehicle by one-way ANOVA. Figure 44D. Immunoblotting analysis using specific antibodies against phosphorylated (p-) NF-κB p65 and NF-κB p65 in kidneys of AA and SS mice treated as in Figure 44B. 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of immunoblots is shown in the lower panel. Data are presented as means ± SEM (n=4). * p<0.05 compared to AA mice; Λ p<0.05 compared to normoxia; ° p<0.05 compared to the vehicle by one-way ANOVA (DU: Densitometric Unit). Figure 44E.Immunotransfer analysis, using specific antibodies against NLRP3, VCAM-1, ET-1 and TBXS (thromboxane synthase) in kidneys of AA and SS mice treated as in Figure 44B. 75 pg of protein loaded onto an 11% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of the immunoblots is shown on the right. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; λ p<0.05 compared to normoxia; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit).

[0089] Figures 45A to 45C. In SCD mice exposed to H / R stress, Epeleuton reduces liver injury and prevents hyperactivation of inflammatory and redox-related pathways. Figure 45A. Representative microimage of hematoxylin and eosin (H&E) and Perls stained liver sections, magnified 200x, from SS mice exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours) treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks) (scale bar: 50 pm) (see also Table 38). Figure 45B. Immunotransfer analysis using specific antibodies against phosphorylated (p-)NF-kB p65, NF-kB p65, p-Nrf2, and Nrf2 in the liver of Petition 870250099883, dated 10 / 31 / 2025, page 24 / 336 17 / 223 AA and SS mice under normoxic conditions or exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours), treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of immunoblots is shown in the right panel. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; Λp<0.05 compared to normoxic; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit). Figure 45C. Immunotransfer analysis, using specific antibodies against NLRP3, NQO1, VCAM-1 and ET-1 in the liver of AA and SS mice treated as in Figure 45B. 75 pg of protein loaded onto an 11% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control.A representative gel from 4 / 5 with similar results is shown. Densitometric analysis of the immunoblots is shown on the right. Data are presented as means ± SEM (n=4 / 5). * p<0.05 compared to AA mice; λ p<0.05 compared to normoxia; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit).

[0090] Figures 46A and 46B. Epeleuton protects against the progression of inflammatory vasculopathy related to acute hypoxia / deoxygenation stress in mice with SCD. Figure 46A. Immunoblotting analysis, using specific antibodies against VCAM-1 (40 pgr of protein loaded onto an 8% T, 2.5% C polyacrylamide gel) in isolated aorta from AA and SS mice under normoxia or exposed to H / R treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). Actin serves as a protein loading control. A representative gel of 5 with similar results is shown. Densitometric analysis of immunoblots is shown in the lower panel. Data are presented as means ± SEM (n=5). * p<0.05 compared to AA mice; Λ p<0.05 compared to normoxia; ° p<0.05 compared to the vehicle by one-way ANOVA (DU: Densitometric Unit). Petition 870250099883, dated 10 / 31 / 2025, page 25 / 336 18 / 223 Figure 46B. Schematic diagram of the dual anti-inflammatory and pro-resolution effect of Epeleuton in a humanized mouse model for SCD (sickle cell disease). Epeleuton and its active substance 15(S)-HEPE promote pro-resolution mechanisms targeting inflammation, ROS (reactive oxygen species) burst, NF-kB activation, and NLRP3 inflammasome expression. This results in the prevention of red blood cell sickling, reduction of inflammatory vasculopathy, and pro-resolution reprogramming of macrophages (CD68 and CD80) in SCD target organs. VCAM-1: Vascular Cell Adhesion Molecule 1; ICAM-1: Intercellular Adhesion Molecule 1; TBXs: thromboxane synthases.

[0091] Figures 47A to 47C. Figure 47A. Weekly body weight measurement of SS mice treated with Epeleuton (1,000 mg / kg / d) for 6 weeks. Data are presented as mean ± SEM (n = 10-17). Figure 47B. Plasma urea nitrogen (BUN) (left panel) and creatinine (right panel) in AA and SS mice treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). Data are presented as mean ± SEM (n = 5) by one-way ANOVA. * p<0.05 compared to AA mice. Figure 47C. Plasma alanine transaminase (ALT, left panel) and aspartate transaminase (AST, right panel) in AA and SS mice treated as in Figure 47B. ° p<0.05 compared to the vehicle by one-way ANOVA.

[0092] Figures 48A to 48C. Figure 48A. Plasma C-reactive protein (CRP, left panel), Pentraxin-2 / SAP-1 (right panel). Figure 48B. Plasma CCL-2 (left panel) and CXCL-2 (right panel) were evaluated in AA and SS mice treated with vehicle or Epeleuton (1,000 mg / kg / day for 6 weeks). Data are presented as mean ± SEM (n = 4-5). * p<0.05 compared to AA mice. ° p<0.05 compared to vehicle by unpaired t-test with Bonferroni correction. Figure 48C. Hematocrit level (Hct, left panel) and circulating reticulocyte count (retics, right panel) in AA and SS mice treated with vehicle or Epeleuton (1,000 mg / kg / day for 6 weeks) under normoxia. Data are presented as mean ± SEM (n = 4-9) using the unpaired t-test with Bonferroni correction. Petition 870250099883, dated 10 / 31 / 2025, page 26 / 336 19 / 223

[0093] Figures 49A to 49C. Figure 49A. Flow cytometry gating strategy for identification of neutrophils in the periphery (upper panel) and spleen (lower panel). Neutrophils were recognized as CD45+Ly6G+ cells. Figures 49B and 49C. Spleen weight / mouse weight ratio (Figure 49B) and splenic neutrophils (Figure 49C) identified by flow cytometry analysis as CD45+Ly6G+ cells in AA and SS mice treated with vehicle or Epeleuton (1,000 mg / kg / day for 6 weeks). Data are mean ± SEM (n = 4-8).

[0094] Figures 50A and 50B. Figure 50A. Densitometric analysis of the immunoblots shown in Figures 40B to 40D. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle (DU: Unit (Densitometric). Figure 50B. Densitometric analysis of immunoblots shown in Figure 40E. Data are presented as means ± SEM(n=4); * p<0.05 compared to AA mice; ° p<0.05 compared to vehicle by one-way ANOVA (DU: Densitometric Unit).

[0095] Figures 51A and 51B. Figure 51A. Densitometric analysis of the immunoblots shown in Figure 40F. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; ° p<0.05 compared to the vehicle by one-way ANOVA (DU: Densitometric Unit). Figure 51B. Quantification of the band area of ​​Figure 40H. Data are presented as mean ± SEM (n = 5) (DU: Densitometric Unit). (Densitometric). ° p<0.05 compared to the vehicle.

[0096] Figures 52A to 52C. Figure 52A Plasma C-reactive protein (CRP, left panel), Pentraxin-2 / SAP-1 (right panel) and Figure 52B Spleen weight / mouse weight ratio (left panel) and splenic neutrophils (right panel) in AA and SS mice exposed to H / R: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours), treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). Data are presented as means ± SEM (n=3-9); * p<0.05 compared to the Petition 870250099883, dated 10 / 31 / 2025, page 27 / 336 20 / 223 AA mice; ° p<0.05 compared to the vehicle Figure 52C. Liver iron score.

[0097] Figure 53. Flow cytometry gating strategy for identification of renal leukocytes.

[0098] Figures 54A and 54B. Figure 54A. OxyBlot analysis of soluble liver fractions from AA and SS mice under normoxia or H / R conditions: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours), treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). Carbonylated proteins (1 mg) were detected by treatment with 2,4-dinitrophenylhydrazine and blotted with anti-DNP antibody. GAPDH serves as a protein load control. Band area quantification is shown on the right. Data are presented as means ± SEM (n=5). * p<0.05 compared to AA mice; Λp<0.05 compared to normoxia; ° p<0.05 compared to vehicle by one-way ANOVA. Figure 54B.Immunoblotting analysis using specific antibodies against HO-1 from the liver of AA and SS mice under normoxia or H / R conditions: hypoxia (8% oxygen; 10 hours), followed by reoxygenation (21% oxygen; 3 hours), treated with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). 50 pg of protein loaded onto an 11% T, 2.5% C polyacrylamide gel. GAPDH serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of the immunoblots is shown on the right. Data are presented as means ± SEM (n=4); * p<0.05 compared to AA mice; λ p<0.05 compared to normoxia; ° p<0.05 compared to vehicle by one-way ANOVA. (DU: Densitometric Unit).

[0099] Figure 55. Immunoblot analysis using specific antibodies against ICAM1, ET-1, and VCAM1 in isolated aorta from normoxia-treated AA and SS mice with vehicle or Epeleuton (1,000 mg / kg / d for 6 weeks). 75 pg of protein loaded onto an 8% T, 2.5% C polyacrylamide gel. Actin serves as a protein loading control. A representative gel of 4 with similar results is shown. Densitometric analysis of the immunoblots is shown below. Petition 870250099883, dated 10 / 31 / 2025, p. 28 / 336 21 / 223 right. Data are presented as means ± SEM(n=4); * p<0.05 compared to AA mice; ° p<0.05 compared to the vehicle by one-way ANOVA (DU: Densitometric Unit).

[0100] Figures 56A to 56D. 15(S)-HEPE acutely decreased the adhesion of red blood cells to heme-activated HUVECs. Figure 56A. Pretreatment of red blood cells with 15(S)-HEPE or vehicle control (n=7). Figure 56B. Pretreatment of HUVECs with 15(S)-HEPE or vehicle control (n=7). 10X phase-contrast microscope images of untreated HUVECs (Figure 56C) and HUVECs treated with 15(S)-HEPE (Figure 56D). P-values ​​were calculated using the paired t-test. Error bars represent the standard error of the mean (SEM). 50 pm scale. DETAILED DESCRIPTION

[0101] Although the present technology can be embodied in various ways, the description below of various embodiments is made with the understanding that the present disclosure should be considered as an exemplification of the present technology and is not intended to limit the present technology to the specific embodiments of the present technology. The headings are provided for convenience only and should not be construed as limiting this technology in any way. Embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading.

[0102] The use of numerical values ​​in the various quantitative values ​​specified in this application, unless expressly stated otherwise, is understood to be an approximation, as if the minimum and maximum values ​​within the stated ranges were both preceded by the term “approximately”. Thus, small variations from a stated value can be used to obtain substantially the same results as the stated value. Furthermore, the disclosure of ranges is understood to mean a continuous range that includes all values ​​between the stated minimum and maximum values, as well as any ranges that may be formed by those values. Also disclosed in this document are any and all ratios (and intervals of such ratios) that may be formed by Petition 870250099883, dated 10 / 31 / 2025, page 29 / 336 22 / 223 division of a cited numerical value by any other cited numerical value. Thus, those skilled in the art will realize that many of these ratios, ranges, and ranges of ratios can be unambiguously derived from the numerical values ​​presented in this document; and, in all cases, these ratios, ranges, and ranges of ratios represent various embodiments of the present technology.

[0103] Unless otherwise defined, all technical and scientific terms used in this document have the same meaning as commonly understood by someone skilled in the art to which this disclosure pertains. Although methods and materials similar to or equivalent to those described in this document may be used in the practice of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned in this document are expressly incorporated by reference in their entirety. In case of conflict, this descriptive report, including the definitions, shall prevail. Furthermore, the materials, methods, and examples are for illustrative purposes only and are not intended to be necessarily limiting. DEFINITIONS

[0104] As used in this document, “15-HEPE” refers to 15-hydroxy-eicosa-5Z,8Z,11Z,13E,17Z-pentaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. Similarly, as used in this document, a fatty acid, especially those written in abbreviated form (e.g., 15-HEPE), refers to the fatty acid in the form of a free acid and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing, provided that the acyl group or portion of the carbon chain of the molecule remains intact. The term “pharmaceutically acceptable” in this context means that the substance in question does not produce unacceptable toxicity to the individual or interaction with other components of the composition.A “derivative” of 15HEPE can be used instead in certain embodiments, which includes molecules in which the acyl group or part of the carbon chain of the 15-HEPE molecule is removed. Petition 870250099883, dated 10 / 31 / 2025, p. 30 / 336 23 / 223 HEPE has one or more modifications, although it does not include any derivative compounds without the hydroxyl group of 15-HEPE.

[0105] 15-HEPE is a chiral molecule and can be used in the enantiomeric (S)- or (R)- form, or as a racemic mixture. As used in this document, “15-HEPE” includes all these forms, without limitation as to stereospecificity. In any of the embodiments described in this document, 15-HEPE may comprise the (S)-form (i.e., 15(S)-hydroxy(5Z,8Z,11Z,13E,17Z)-eicosapentaenoic acid), the (R)-form (i.e., 15(R)-hydroxy(5Z,8Z,11Z,13E,17Z)-eicosapentaenoic acid), or mixtures of these forms. In some embodiments, 15-HEPE EE comprises the (S)-form, 15(S)-HEPE EE.

[0106] As used in this document, “DS102” and “Epeleuton” refer to 15-HEPE EE or a composition comprising 15-HEPE EE.

[0107] As used in this document, an “effective amount” refers to the amount of an active composition that is needed to confer a therapeutic effect on the individual. A “therapeutically effective amount” refers to a sufficient quantity of an administered agent or compound that will alleviate, to some extent, one or more of the symptoms of the disease, disorder, or condition being treated. This result may be the reduction and / or relief of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. For example, in some modalities, an “effective amount” for therapeutic uses is the amount of the composition, including a compound as disclosed in this document, needed to provide a clinically significant decrease in disease symptoms without undue adverse side effects.In some modalities, an appropriate “effective amount” in each individual case is determined using techniques such as a dose-escalation study. The term “therapeutically effective amount” includes, for example, a prophylactically effective amount. In other modalities, an “effective amount” of a compound disclosed in this document is an amount effective to achieve a desired pharmacological effect or therapeutic improvement without side effects. Petition 870250099883, dated 10 / 31 / 2025, page 31 / 336 24 / 223 undue adverse effects. In other modalities, it is understood that “an amount of effect” or “a therapeutically effective amount” varies from individual to individual, due to variation in metabolism, age, weight, general condition of the individual, the condition being treated, the severity of the condition being treated, and the judgment of the prescribing physician.

[0108] As used in this document, the term “treatment” or “to treat” in relation to a particular disease or disorder includes, but is not limited to, inhibiting the disease or disorder, for example, halting the development of the disease or disorder; alleviating the disease or disorder, for example, causing regression of the disease or disorder; or alleviating a condition caused by or resulting from the disease or disorder, for example, alleviating, preventing, or treating the symptoms of the disease or disorder. The term “prevention” or “to prevent” in relation to a particular disease or disorder includes preventing the onset of the disease if it has not yet occurred; preventing the occurrence of the disease or disorder in an individual who may be predisposed to the disorder or disease but has not yet been diagnosed as having the disorder or disease; and / or preventing the development of other diseases / disorders if they are already present. COMPOSITIONS

[0109] In some embodiments, pharmaceutical compositions or compositions are provided comprising a therapeutically effective amount of 15-HEPE in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing, as the active ingredient. In this document, the terms “composition” and “pharmaceutical composition” are used interchangeably. 15-HEPE, also occasionally called 15-OHEPA, can be synthesized from eicosapentaenoic acid (EPA, eicosa-5,8,11,14,17-pentaenoic acid or 20:5n-3), an omega-3 fatty acid, according to methods known in the art. For example, 15-HEPE can be synthesized by exposing EPA to the enzyme 15-lipoxygenase. In some embodiments, 15-HEPE is used in its free acid form. Petition 870250099883, dated 10 / 31 / 2025, p. 32 / 336 25 / 223 Alternatively, pharmaceutically acceptable esters, conjugates, and / or salts of 15-HEPE are used in the disclosure. In some embodiments, 15-HEPE is in the form of a C1-C5 alkyl ester, such as methyl ester, ethyl ester, propyl ester, isopropyl ester, butyl ester, pentyl ester, or a combination of any of the above. In some embodiments, 15-HEPE is in a glyceride form (e.g., diglyceride or triglyceride).

[0110] In some embodiments, 15-HEPE is in the form of an ethyl ester (also referred to in this document as E-15-HEPE, 15-HEPE EE or ethyl-15-HEPE). In some embodiments, 15-HEPE comprises the optically active ethyl ester of 15(S)-hydroxy-(5Z,8Z,11Z,13E,17Z)-eicosapentaenoic acid, or 15(S)-HEPE EE.

[0111] In some embodiments, 15-HEPE comprises lithium 15-HEPE or a mono-, di- or triglyceride of 15-HEPE.

[0112] In some embodiments, 15-HEPE (as the term “15-HEPE” is defined and exemplified in this document) is present in the composition in an amount of about 1 mg to about 10,000 mg, about 25 mg to about 7,500 mg, about 25 mg to about 5,000 mg, about 50 mg to about 5,000 mg, about 50 mg to about 3,000 mg, about 75 mg to about 2,500 mg, or about 100 mg to about 1.000 mg, for example, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about of 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425 mg, about 450 mg, about 475 mg, about 500 mg, about 525 mg, about 550 mg, about 575 mg, about 600 mg, about 625 mg, about 650 mg, about 675 mg, about 700 mg, about 725 mg, about 750 mg, about 775 mg, about 800. Petition 870250099883, dated 10 / 31 / 2025, page 33 / 33626 / 223 mg, approximately 825 mg, approximately 850 mg, approximately 875 mg, approximately 900 mg, approximately 925 mg, approximately 950 mg, approximately 975 mg, approximately 1000 mg, approximately 1025 mg, approximately 1050 mg, approximately 1075 mg, approximately 1100 mg, approximately 1125 mg, approximately 1150 mg, approximately 1175 mg, approximately 1200 mg, approximately 1225 mg, approximately 1250 mg, approximately 1275 mg, approximately 1300 mg, approximately 1325 mg, approximately 1350 mg, approximately 1375 mg, approximately 1400 mg, approximately 1425 mg, approximately 1450 mg, approximately 1475 mg approximately 1500 mg, approximately 1525 mg, approximately 1550 mg, approximately 1575 mg, approximately 1600 mg, approximately 1625 mg, approximately 1650 mg, approximately 1675 mg, approximately 1700 mg, approximately 1725 mg, approximately 1750 mg, approximately 1775 mg, approximately 1800 mg, approximately 1825 mg, approximately 1850 mg, approximately 1875 mg, approximately 1900 mg, approximately 1925 mg, approximately 1950 mg, approximately 1975 mg, approximately 2000 mg, approximately 2025 mg, approximately 2050 mg, approximately 2075 mg, approximately 2100 mg, approximately 2125 mg, approximately 2150 mg, approximately 2175 mg,approximately 2200 mg, approximately 2225 mg, approximately 2250 mg, approximately 2275 mg, approximately 2300 mg, approximately 2325 mg, approximately 2350 mg, approximately 2375 mg, approximately 2400 mg, approximately 2425 mg, approximately 2450 mg, approximately 2475 mg, approximately 2500 mg, 2525 mg, approximately 2550 mg, approximately 2575 mg, approximately 2600 mg, approximately 2625 mg, approximately 2650 mg, approximately 2675 mg, approximately 2700 mg, approximately 2725 mg, approximately 2750 mg, approximately 2775 mg, approximately 2800 mg, approximately 2825 mg, approximately 2850 mg, approximately 2875 mg, approximately 2900 mg, approximately 2925 mg, approximately 2950 mg, approximately 2975 mg, approximately 3000 mg, approximately 3025 mg, approximately 3050 mg, approximately 3075 mg, approximately 3100 mg, approximately 3125 mg, approximately 3150 mg, approximately 3175 mg, approximately 3200 mg, approximately 3225 mg, approximately 3250 mg, approximately 3275 mg, approximately 3300 mg, approximately 3325 mg, approximately 3350 mg, approximately 3375 mg, approximately 3400 mg, approximately 3425 mg, approximately 3450 mg, approximately 3475 mg, approximately 3500 mg, approximately 3525 mg, approximately 3550 mg, approximately 3575 mg,about 3600 mg, about 3625 mg, about 3650 mg, about 3675 mg, about 3700 mg, about 3725 mg, about 3750 mg, about 3775 mg, about 3800 mg, about 3825 mg, about 3850 mg, about 3875 mg, about 3900 mg, about 3925 mg, about 3950 mg, about 3975 mg, about 4000 mg, about 4025 mg, about 4050 mg, about 4075 mg, about 4100 mg, about 4125 mg, about 4150 mg, about 4175 mg, about, Petition 870250099883, dated 10 / 31 / 2025, page 34 / 336 27 / 223 of 4200 mg, approximately 4225 mg, approximately 4250 mg, approximately 4275 mg, approximately 4300 mg, approximately 4325 mg, approximately 4350 mg, approximately 4375 mg, approximately 4400 mg, approximately 4425 mg, approximately 4450 mg, approximately 4475 mg, approximately 4500 mg, approximately 4525 mg, approximately 4550 mg, approximately 4575 mg, approximately 4600 mg, approximately 4625 mg, approximately 4650 mg, approximately 4675 mg, approximately 4700 mg, approximately 4725 mg, approximately 4750 mg, approximately 4775 mg, approximately 4800 mg, approximately 4825 mg, approximately 4850 mg, approximately 4875 mg, approximately 4900 mg, approximately 4925 mg, approximately 4950 mg, approximately 4975 mg, approximately 5000 mg, approximately 5025 mg, approximately 5050 mg, approximately 5075 mg, approximately 5100 mg, approximately 5125 mg, approximately 5150 mg, approximately 5175 mg, approximately 5200 mg, approximately 5225 mg, approximately 5250 mg, approximately 5275 mg, approximately 5300 mg, approximately 5325 mg, approximately 5350 mg, approximately 5375 mg, approximately 5400 mg, approximately 5425 mg, approximately 5450 mg, approximately 5475 mg, approximately 5500 mg, approximately 5525 mg, approximately 5550 mg,approximately 5575 mg, approximately 5600 mg, approximately 5625 mg, approximately 5650 mg, approximately 5675 mg, approximately 5700 mg, approximately 5725 mg, approximately 5750 mg, approximately 5775 mg, approximately 5800 mg, approximately 5825 mg, approximately 5850 mg, approximately 5875 mg, approximately 5900 mg, approximately 5925 mg, approximately 5950 mg, approximately 5975 mg, approximately 6000 mg, approximately 6025 mg, approximately 6050 mg, approximately 6075 mg, approximately 6100 mg, approximately 6125 mg, approximately 6150 mg, approximately 6175 mg, approximately 6200 mg, approximately 6225 mg, approximately 6250 mg, approximately 6275 mg, approximately 6300 mg, approximately 6325 mg, approximately 6350 mg, approximately 6375 mg, approximately 6400 mg, approximately 6425 mg, approximately 6450 mg, approximately 6475 mg, approximately 6500 mg, approximately 6525 mg, approximately 6550 mg, approximately 6575 mg, approximately 6600 mg, approximately 6625 mg, approximately 6650 mg, approximately 6675 mg, approximately 6700 mg, approximately 6725 mg, approximately 6750 mg, approximately 6775 mg, approximately 6800 mg, approximately 6825 mg, approximately 6850 mg, approximately 6875 mg, approximately 6900 mg, approximately 6925 mg,about 6950 mg, about 6975 mg, about 7000 mg, about 7025 mg, about 7050 mg, about 7075 mg, about 7100 mg, about 7125 mg, about 7150 mg, about 7175 mg, about 7200 mg, about 7225 mg, about 7250 mg, about 7275 mg, about 7300 mg, about 7325 mg, about 7350 mg, about 7375 mg, about 7400 mg, about 7425 mg, about 7450 mg, about 7475 mg, about 7500 mg, about 7525 mg, about 7550 mg, about, Petition 870250099883, dated 10 / 31 / 2025, page 35 / 336 28 / 223 of 7575 mg, approximately 7600 mg, approximately 7625 mg, approximately 7650 mg, approximately 7675 mg, approximately 7700 mg, approximately 7725 mg, approximately 7750 mg, approximately 7775 mg, approximately 7800 mg, approximately 7825 mg, approximately 7850 mg, approximately 7875 mg, approximately 7900 mg, approximately 7925 mg, approximately 7950 mg, approximately 7975 mg, approximately 8000 mg, approximately 8025 mg, approximately 8050 mg, approximately 8075 mg, approximately 8100 mg, approximately 8125 mg, approximately 8150 mg, approximately 8175 mg, approximately 8200 mg, approximately 8225 mg, approximately 8250 mg, approximately 8275 mg, approximately 8300 mg, approximately 8325 mg, approximately 8350 mg, approximately 8375 mg, approximately 8400 mg, approximately 8425 mg, approximately 8450 mg, approximately 8475 mg, approximately 8500 mg, approximately 8525 mg, approximately 8550 mg, approximately 8575 mg, approximately 8600 mg, approximately 8625 mg, approximately 8650 mg, approximately 8675 mg, approximately 8700 mg, approximately 8725 mg, approximately 8750 mg, approximately 8775 mg, approximately 8800 mg, approximately 8825 mg, approximately 8850 mg, approximately 8875 mg, approximately 8900 mg, approximately 8925 mg,approximately 8950 mg, approximately 8975 mg, approximately 9000 mg, approximately 9025 mg, approximately 9050 mg, approximately 9075 mg, approximately 9100 mg, approximately 9125 mg, approximately 9150 mg, approximately 9175 mg, approximately 9200 mg, approximately 9225 mg, approximately 9250 mg, approximately 9275 mg, approximately 9300 mg, approximately 9325 mg, approximately 9350 mg, approximately 9375 mg, approximately 9400 mg, approximately 9425 mg, approximately 9450 mg, approximately 9475 mg, approximately 9500 mg, approximately 9525 mg, approximately 9550 mg, approximately 9575 mg, approximately 9600 mg, approximately 9625 mg, approximately 9650 mg, approximately 9675 mg, approximately 9700 mg, approximately 9725 mg, approximately 9750 mg, approximately 9775 mg, approximately 9800 mg, approximately 9825 mg, approximately 9850 mg, approximately 9875 mg, approximately 9900 mg, approximately 9925 mg, approximately 9950 mg, approximately 9975 mg or approximately 10,000 mg.

[0113] In some embodiments, the composition contains at least 50% by weight of the 15-HEPE composition (as the term “15-HEPE” is defined and exemplified in this document), for example, at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of 15-HEPE. In some embodiments, the 15-HEPE compositions may comprise 15-HEPE of even higher purity, for example, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% of 15-HEPE. The purity of the 15-HEPE may also be defined (e.g., impurity profile) by any of the descriptions. Petition 870250099883, dated 10 / 31 / 2025, p. 36 / 336 29 / 223 of the 15-HEPE provided in this document. The nature of essential fatty acids and their synthesis is such that the composition of 15-HEPE may include molecules of other essential fatty acids in the essential fatty acid metabolic cascade.

[0114] In some embodiments, the composition contains no more than 20%, no more than 15%, no more than 10%, no more than 9%, no more than 8%, no more than 7%, no more than 6%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 1%, no more than 0.6%, no more than 0.5%, no more than 0.4%, no more than 0.3%, no more than 0.2% or no more than 0.1%, by weight of the composition, of omega-3 fatty acids other than 15-HEPE. Illustrative examples of “omega-3 fatty acids other than 15-HEPE” include alpha-linolenic acid (ALA), stearidonic acid (SDA), omega-3 eicosatetraenoic acid (ETA), eicosapentaenoic acid (EPA), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA). In some embodiments, the composition contains substantially none or no other omega-3 fatty acids.

[0115] In some embodiments, 15-HEPE (as the term “15-HEPE” is defined and exemplified in this document) represents at least 50%, by weight, of the total fatty acids present in the composition, for example, at least 50%, at least 60%, at least 66%, at least 70%, at least 75%, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%, by weight, of the total fatty acids present in the composition.

[0116] In some embodiments, the composition contains not more than 20%, not more than 15%, not more than 10%, not more than 9%, not more than 8%, not more than 7%, not more than 6%, not more than 5%, not more than 4%, not more than 3%, not more than 2%, not more than 1%, not more than 0.6%, not more than 0.5%, not more than 0.4%, not more than 0.3%, not more than 0.2% or not more than 0.1%, by weight, of the total fatty acids present in the composition, of any fatty acids other than 15-HEPE.

[0117] In some modalities, there may be some EPA Petition 870250099883, dated 10 / 31 / 2025, p. 37 / 336 30 / 223 residual from the synthesis of 15-HEPE present in the composition. In some of these embodiments, the composition contains no more than 10%, no more than 9%, no more than 8%, no more than 7%, no more than 6%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1%, no more than 0.6%, no more than 0.5%, no more than 0.4%, no more than 0.3%, no more than 0.6%, no more than 0.2% or no more than 0.1%, by weight, of the composition or of the total fatty acids present in the composition, EPA in a form that has not been modified to have the hydroxyl group. In other embodiments, the composition contains substantially none or no EPA in a form that has not been modified to have the hydroxyl group. ADDITIONAL ACTIVE AGENTS

[0118] In some embodiments, the composition comprising 15-HEPE according to various embodiments of the present technology may further comprise one or more additional active agents. In some embodiments, the composition comprises an amount of the additional active agent that is less than the generally recognized therapeutically effective amount for that agent. In other embodiments, the composition comprises an amount of the additional active agent that is equal to or greater than the generally recognized therapeutically effective amount for that agent. If an additional active agent is used, 15-HEPE may be co-formulated as a single dosage unit or may be formulated in two or more dosage units for coordinated, combined, or concomitant administration.

[0119] In some embodiments, the additional active agent(s) comprise(s) at least one selected from the group consisting of eicosapentaenoic acid (EPA), 5-hydroxy-eicosapentaenoic acid (5-HEPE), 12-hydroxy-eicosapentaenoic acid (12-HEPE), 18-hydroxy-eicosapentaenoic acid (18HEPE), 15-hydroxy-eicosatrienoic acid (15-HETrE), 15-hydroxyeicosatetraenoic acid (15-HETE), 14-hydroxy-docosahexaenoic acid (14-HDoHE), 17-hydroxy-docosahexaenoic acid (17-HDoHE), resolvin D1 (RvD1 or 17(S)-RvD1) and aspirin-activated resolvin D1 (AT-RvD1 or 17(R)-RvD1). Petition 870250099883, dated 10 / 31 / 2025, p. 38 / 336 31 / 223

[0120] As described in this document, 15-HEPE can be synthesized from EPA, for example, by 15-lipoxygenase. EPA itself has beneficial properties in the treatment of inflammatory and / or cardiovascular diseases and, therefore, it is possible to combine 15-HEPE with EPA in an alternative embodiment of the present composition.

[0121] As used in this document, “5-HEPE” refers to 5-hydroxy-5Z,8Z,10E,14Z,17Z-eicosapentaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. “12-HEPE” refers to 12-hydroxy-5Z,8Z,10E,14Z,17Z-eicosapentaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. “18-HEPE” refers to 8-hydroxy-5Z,8Z,11Z,14Z,16E-eicosapentaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. 5-HEPE, 12-HEPE, and 18-HEPE are derivatives of EPA and can be synthesized from EPA according to methods known in the art.

[0122] As used in this document, “15-HETrE” refers to 15-hydroxy-eicosa-8Z,11Z,13E-trienoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. 15-HETrE is an in vivo metabolite resulting from the 15-lipoxygenation of dihomo-gamma-linolenic acid (DGLA) and can be synthesized from DGLA according to methods known in the art. For example, 15-HETrE can be synthesized by exposing DGLA to the enzyme 15-lipoxygenase.

[0123] As used in this document, “15-HETE” refers to 15-hydroxy-eicosa-5Z,8Z,11Z,13E-tetraenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. 15-HETE is a metabolite of arachidonic acid (AA) and is a key precursor of many biologically active pro-resolution mediators.

[0124] As used in this document, “14-HDoHE” Petition 870250099883, dated 10 / 31 / 2025, p. 39 / 336 32 / 223 refers to 14-hydroxy-4Z,7Z,10Z,12E,16Z,19Z-docosahexaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. “17-HDoHE” refers to 17-hydroxy-4Z,7Z,10Z,13Z,15E,19Z-docosahexaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. 14-HDoHE and 17-HDoHE are derivatives of docosahexaenoic acid (DHA) and can be synthesized from DHA according to methods known in the art.

[0125] As used in this document, “resolvin D1”, “RvD1” or “17(S)-RvD1” refers to 7S,8R,17S-trihydroxy-4Z,9E,11E,13Z,15E,19Z-docosaexaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. “Aspirin-activated Resolvin D1”, “AT-RvD1” or “17(R)-RvD1” refers to 7S,8R,17R-trihydroxy-4Z,9E,11E,13Z,15E,19Z-docosaexaenoic acid in its free acid form and / or a pharmaceutically acceptable ester, conjugate or salt, or mixtures of any of the foregoing. RvD1 and AT-RvD1 are DHA derivatives with potential anti-inflammatory and analgesic activities.

[0126] In any of the above embodiments, the fatty acid or its derivative, as described, may be in its free acid form. Alternatively, pharmaceutically acceptable esters, conjugates, and / or salts are used in the disclosure. In some embodiments, the ester may be a C1-C5 alkyl ester, such as methyl ester, ethyl ester, propyl ester, isopropyl ester, butyl ester, pentyl ester, or a combination of any of the above. In some embodiments, the ester is in a glyceride form (e.g., diglyceride or triglyceride).

[0127] In some embodiments, 15-HEPE and one or more additional active agents are present in the composition, or are co-administered, in a weight ratio of 15-HEPE:additional active agent(s) of about 1:1000 to about 1000:1, about 1:500 to about 500:1, about 1:100 to about 100:1, about 1:50 to about 50:1, about 1:25 to about 25:1, about 1:10 Petition 870250099883, dated 10 / 31 / 2025, p. 40 / 336 33 / 223 to about 10:1, about 1:5 to about 5:1, about 1:4 to about 4:1, about 1:3 to about 3:1, about 1:2 to about 2:1 or about 1:1. DOSAGE FORMS

[0128] In some embodiments, the composition comprising 15-HEPE according to the various embodiments disclosed in this document may be formulated as one or more dosage units. The term “dosage unit” refers to a portion of a pharmaceutical composition containing an amount of a therapeutic agent suitable for a single administration to provide a therapeutic effect. These dosage units may be administered one to several times (i.e., 2, 3, 4, 5 or more) per day, or as often as necessary to obtain a therapeutic response.

[0129] In some embodiments, the composition may be administered orally or in a form suitable for oral administration. The term “oral administration” or “oral administration” includes any form of administration of a pharmaceutical composition to an individual in which the composition is placed in the individual’s mouth, whether or not the composition is swallowed. This therefore includes buccal and sublingual administration as well as esophageal administration. Non-limiting examples of dosage forms suitable for oral administration include tablets (e.g., suspension tablets, bite-suspension tablets, fast-dispersing tablets or chewable tablets), capsules, soft capsules (e.g., soft gelatin capsule, hard gelatin capsule or HPMC capsule), lozenges, sachets, pouches, pellets, suspension, elixirs, syrups and any other solid dosage form reasonably adapted for oral administration.The composition may be in the form of liquid dosage forms or dose units to be ingested directly, or may be mixed with food or beverages prior to ingestion. Non-limiting examples of suitable liquid dosage forms include solutions, suspensions, elixirs, syrups, liquid aerosol formulations, and the like.

[0130] In some embodiments, the dosage unit is a capsule, that is, the composition is formulated in one or more capsules. One or Petition 870250099883, dated 10 / 31 / 2025, page 41 / 336 34 / 223 more capsules can be packaged in a blister pack or in a container (e.g., bottle).

[0131] In some embodiments, a composition comprising 15-HEPE encapsulated in a capsule shell is provided. In some embodiments, the composition is administered to an individual who needs it in an amount sufficient to provide up to about 1 g, about 2 g, about 3 g, about 4 g, about 5 g, about 6 g, about 7 g, about 8 g, about 9 g, or about 10 g of 15-HEPE per day. In some embodiments, the composition is administered to the individual in an amount sufficient to provide about 4 g about 8 g, about 1 g about 2 g, about 2 g about 4 g, about 3 g about 8 g, about 4 g about 6 g of 15-HEPE per day. When discussing the amount of 15-HEPE in the composition, it can be divided into several dosage units. There is a limit as to the size for oral administration.For example, if an individual is to receive approximately 4 g of 15-HEPE per day, this can be divided into up to 4 capsules, each providing approximately 1 g of 15-HEPE. In some embodiments, approximately 500 mg to approximately 1 g of 15-HEPE are encapsulated in the capsule shell.

[0132] In some embodiments, the capsule is a soft gelatin capsule. In some embodiments, the capsule is a hard gelatin capsule. In some embodiments, the capsule shell is composed of gelatin (e.g., Gelatin RXL or bone gelatin with a lower molecular weight) and / or plasticizers selected from one or more D-Sorbitol and 1,4-sorbitans. In some embodiments, the capsule shell comprises Gelatin RXL that has been treated with a proteolytic enzyme to cut the gelatin pattern and effectively decrease its molecular weight. In some embodiments, the composition comprises 15-HEPE esters of D-Sorbitol and 1,4-sorbitan. In some embodiments, the gelatin is described in U.S. Patent No. 7,485,323, which is incorporated by reference herein in its entirety.

[0133] In some embodiments, the plasticizer comprises 1,4-sorbitans in an amount of about 20% to about 30%, per Petition 870250099883, dated 10 / 31 / 2025, p. 42 / 336 35 / 223 for example, about 24% to about 28%, 24% or 28% (on a dry basis), and / or DSorbitol in an amount of about 30% to about 50%, for example, about 35% to about 45% (on a dry basis).

[0134] In some embodiments, the capsule shell comprises modified starch, carrageenan (e.g., red algae extract), disodium phosphate, glycerol and / or sorbitol. In some embodiments, the capsule shell also comprises water. In some embodiments, the capsule shell is stable up to a temperature of about 65 °C and / or a pH of about 12.

[0135] In some embodiments, the capsule shell also comprises glycerol, purified water, titanium dioxide, medium-chain triglycerides and / or lecithin.

[0136] In some embodiments, the capsule shell is odorless and has a neutral color (e.g., colorless, white, or transparent).

[0137] Alternatively, the compositions of this disclosure may be formulated for rectal, topical or parenteral administration (e.g., subcutaneous, intramuscular, intravenous, intradermal or infusion).

[0138] In some embodiments, the compositions of this disclosure may comprise one or more pharmaceutically acceptable excipients. The term “pharmaceutically acceptable excipient” in this document means any substance, other than a therapeutic agent, used as a carrier or vehicle for the administration of a therapeutic agent to an individual or added to a composition to improve its handling or storage properties or to enable or facilitate the formation of a unit dose of the composition, and which does not produce unacceptable toxicity or interaction with other components of the composition. By way of example only, a pharmaceutical composition according to this disclosure may include one or more antioxidants, surfactants, preservatives, flavoring agents, cosolvents, viscosity aids, suspension aids and lipophilic phases.

[0139] In some modalities, the composition Petition 870250099883, dated 10 / 31 / 2025, p. 43 / 336 36 / 223 comprises one or more antioxidants, such as ascorbic acid, palmitic acid, ascorbyl palmitate, α-tocopherol, idebenone, ubiquinone, ferulic acid, coenzyme Q10, lycopene, green tea, catechins, epigallocatechin-3-gallate (EGCG), green tea polyphenols (GTP), silymarin, coffee cherry, resveratrol, grape seed, pomegranate extracts, genisten, pycnogenol, niacinamide and the like. In one embodiment, the composition comprises from about 0.01% by weight to about 2% by weight of an antioxidant, for example, about 0.01% by weight, about 0.02% by weight, about 0.03% by weight, about 0.04% by weight, about 0.05% by weight, about 0.06% by weight, about 0.07% by weight, about 0.08% by weight, about 0.09% by weight, about 0.1% by weight, about 0.11% by weight, about 0.12% by weight, about 0.13% by weight, about 0.14% by weight, about 0.15% by weight, about 0.16% by weight, about 0.17% by weight, about 0.18% by weight, about 0.19% by weight, about 0.2% by weight,approximately 0.21% by weight, approximately 0.22% by weight, approximately 0.23% by weight, approximately 0.24% by weight, approximately 0.25% by weight, approximately 0.26% by weight, approximately 0.27% by weight, approximately 0.28% by weight, approximately 0.29% by weight, approximately 0.3% by weight, approximately 0.31% by weight, approximately 0.32% by weight, approximately 0.33% by weight, approximately 0.34% by weight, approximately 0.35% by weight, approximately 0.36% by weight, approximately 0.37% by weight, approximately 0.38% by weight, approximately 0.39% by weight, approximately 0.4% by weight, approximately 0.41% by weight, approximately 0.42% by weight, approximately 0.43% by weight, approximately 0.44% by weight, approximately 0.45% by weight, approximately 0.46% by weight, approximately 0.47% by weight, approximately 0.48% by weight, approximately 0.49% by weight, approximately 0.5% by weight, approximately 0.51% by weight, approximately 0.52% by weight, approximately 0.53% by weight, approximately 0.54% by weight, approximately 0.55% by weight, approximately 0.56% by weight, approximately 0.57% by weight, approximately 0.58% by weight, approximately 0.59% by weight, approximately 0.6% by weight, approximately 0.61% by weight, approximately 0,62% by weight, approximately 0.63% by weight, approximately 0.64% by weight, approximately 0.65% by weight, approximately 0.66% by weight, approximately 0.67% by weight, approximately 0.68% by weight, approximately 0.69% by weight, approximately 0.7% by weight, approximately 0.71% by weight, approximately 0.72% by weight, approximately 0.73% by weight, approximately 0.74% by weight, approximately 0.75% by weight, approximately 0.76% by weight, approximately, Petition 870250099883, dated 10 / 31 / 2025, page 44 / 336 37 / 223 0.77% by weight, approximately 0.78% by weight, approximately 0.79% by weight, approximately 0.8% by weight, approximately 0.81% by weight, approximately 0.82% by weight, approximately 0.83% by weight, approximately 0.84% ​​by weight, approximately 0.85% by weight, approximately 0.86% by weight, approximately 0.87% by weight, approximately 0.88% by weight, approximately 0.89% by weight, approximately 0.9% by weight, approximately 0.91% by weight, approximately 0.92% by weight, approximately 0.93% by weight, approximately 0.94% by weight, approximately 0.95% by weight, approximately 0.96% by weight, approximately 0.97% by weight, approximately 0.98% by weight, approximately 0.99% by weight, approximately 1% by weight, approximately 1.1% by weight, approximately 1.2% by weight, approximately 1.3% by weight, approximately 1.4% by weight, approximately 1.5% by weight, approximately 1.6% by weight, approximately 1.7% by weight, approximately 1.8% by weight, approximately 1.9% by weight, or approximately 2% by weight of one or more antioxidants. THERAPEUTIC METHODS AND USES OF 15-HEPE

[0140] In some embodiments, methods of treatment and / or prevention of a hematological disorder and / or its symptoms are provided in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, uses of 15-HEPE are provided to treat and / or prevent a hematological disorder and / or its symptoms in an individual who needs it, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document.

[0141] In some modalities, hematological disorders include, but are not limited to, the following diseases and conditions:

[0142] · Red blood cell disorders

[0143] Anemia

[0144] Hemolytic anemia (hereditary or acquired)

[0145] Iron deficiency anemia

[0146] Hereditary spherocytosis

[0147] Chronic hemolysis Petition 870250099883, dated 10 / 31 / 2025, page 45 / 336 38 / 223

[0148] Pyruvate kinase deficiency

[0149] Glucose-6-phosphate dehydrogenase (G6PD) deficiency

[0150] Hemoglobin disorders

[0151] Sickle cell disease

[0152] Thalassemia (alpha and beta thalassemia)

[0153] Bleeding disorders

[0154] Hemophilia

[0155] Thrombophilia

[0156] Thrombocytopenia

[0157] Idiopathic thrombocytopenic purpura (ITP)

[0158] Heparin-induced thrombocytopenia (HIT)

[0159] Venous thromboembolism

[0160] Arterial thrombosis

[0161] Embolism

[0162] Blood cancers

[0163] Syndrome Myelodysplastic syndrome (MDS)

[0164] Lymphoma

[0165] Leukemia

[0166] Myeloma

[0167] In some forms, the individual has diabetes, including, for example, type I diabetes or type II diabetes. In some embodiments, the method or use further comprises determining that the individual has diabetes before administering the composition comprising 15-HEPE. In some embodiments, the use or application further comprises determining that the individual has diabetes before administering the composition comprising 15-HEPE. In some embodiments, the individual has elevated baseline fasting glucose levels of at least 100 mg / dL, at least 115 mg / dL, at least 120 mg / dL, at least 125 mg / dL, at least 130 mg / dL, at least 135 mg / dL, at least 140 mg / dL, at least 145 mg / dL, at least 150 mg / dL, at least 155 mg / dL, Petition 870250099883, dated 10 / 31 / 2025, p. 46 / 336 39 / 223 at least 160 mg / dL, at least 165 mg / dL or at least 170 mg / dL.

[0168] In some embodiments, the individual has cardiovascular disease. The term “cardiovascular disease” refers to any disease or disorder of the heart (cardiac diseases or disorders) or blood vessels (vascular diseases or disorders) or any symptoms thereof. Non-limiting examples of cardiovascular diseases include hypertriglyceridemia, hypercholesterolemia, mixed dyslipidemia, coronary artery disease, stroke, atherosclerosis, arrhythmia, hypertension, myocardial infarction, vasculitis, cardiomyopathy, pericarditis, congestive heart failure, myocardial necrosis, vascular ischemia, vascular disease, thrombotic disease, deep vein thrombosis, and other cardiovascular or related diseases. In some embodiments, the method further comprises determining that the individual has cardiovascular disease before administering the composition comprising 15-HEPE.In some applications, the use also includes determining that the individual has cardiovascular disease before administering the composition containing 15-HEPE.

[0169] In some embodiments, the individual has high blood pressure. In some embodiments, the method further comprises determining that the individual has high blood pressure before administering the composition comprising 15-HEPE. In some embodiments, the use further comprises determining that the individual has high blood pressure before administering the composition comprising 15-HEPE. In some embodiments, the individual has a blood pressure of at least 100 mmHg, at least 115 mmHg, at least 120 mmHg, at least 125 mmHg, at least 130 mmHg, at least 135 mmHg, at least 140 mmHg, at least 145 mmHg, at least 150 mmHg, at least 155 mmHg, at least 160 mmHg, at least 165 mmHg, or at least 170 mmHg.

[0170] In some modalities, the method also includes determining that the individual has at least one risk factor for hematological disorders before administering the composition comprising the 15 Petition 870250099883, dated 10 / 31 / 2025, page 47 / 336 40 / 223 In some embodiments, the use further includes determining that the individual has at least one risk factor for hematological disorders before administering the composition comprising 15-HEPE. Non-limiting examples of risk factors for hematological disorders include reduced red blood cell counts, increased red blood cell distribution width, and increased reticulocyte count. In some embodiments, the method further includes determining a baseline red blood cell count, a baseline red blood cell distribution width, and / or a baseline reticulocyte count of the individual before administering the composition comprising 15-HEPE.

[0171] In some forms, the individual has a reduced red blood cell count of at least 10% below normal, at least 15% below normal, at least 20% below normal, at least 25% below normal, or at least 30% below normal.

[0172] In some forms, the individual has a wider red blood cell distribution width, where the red blood cells vary in size by about 15% to 20%, 20% to 25%, 25% to 30%, 30% to 35%, or 35% to 40%.

[0173] In some forms, the individual has an increased reticulocyte count of at least about 5% of the total red blood cell count, at least about 10% of the total red blood cell count, at least about 15% of the total red blood cell count, or at least about 20% of the total red blood cell count.

[0174] In some embodiments, the individual exhibits an increase in red blood cell count, a decrease in red blood cell distribution width, and / or a decrease in reticulocyte count after receiving the composition comprising 15-HEPE compared to baseline or to a second individual who did not receive the composition that Petition 870250099883, dated 10 / 31 / 2025, page 48 / 336 41 / 223 includes 15-HEPE.

[0175] In some embodiments, the method further comprises determining that the individual has at least one risk factor for thrombophilia disorders before administering the composition comprising 15-HEPE. In some embodiments, the use further comprises determining that the individual has at least one risk factor for thrombophilia disorders before administering the composition comprising 15-HEPE. Thrombophilia disorders refer to a class of conditions characterized by abnormal blood clotting that increases the risk of thrombosis. Non-limiting examples of risk factors for thrombophilia disorders include reduced prothrombin times, reduced activated partial thromboplastin times, and increased fibrinogen concentration.In some embodiments, the method further comprises the determination of a baseline prothrombin time, a baseline activated partial thromboplastin time, and / or a baseline fibrinogen concentration of the individual prior to administration of the composition comprising 15-HEPE. In some embodiments, the use further comprises the determination of a baseline prothrombin time, a baseline activated partial thromboplastin time, and / or a baseline fibrinogen concentration of the individual prior to administration of the composition comprising 15-HEPE.

[0176] In some modalities, the individual has a reduced prothrombin time of at least 10% below normal, at least 15% below normal, at least 20% below normal, at least 25% below normal, or at least 30% below normal.

[0177] In some modalities, the individual has a reduced activated partial thromboplastin time of at least 10% below normal, at least 15% below normal, at least 20% below normal, at least 25% below normal, or at least 30% below normal.

[0178] In some modalities, the individual has an increased fibrinogen concentration of at least 10% below normal, at least 15% below normal, at least 20% below normal, at least 25% Petition 870250099883, dated 10 / 31 / 2025, page 49 / 336 42 / 223 below normal or at least 30% below normal.

[0179] In some embodiments, the individual exhibits an increase in prothrombin time, an increase in activated partial thromboplastin time and / or a decrease in fibrinogen concentration after receiving the composition comprising 15-HEPE compared to baseline or to a second individual who did not receive the composition comprising 15-HEPE.

[0180] In some embodiments, methods of treatment and / or prevention of endothelial dysfunction are provided in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document.

[0181] In some forms, uses of are provided 15-HEPE is used to treat and / or prevent endothelial dysfunction in an individual who requires it, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various modalities disclosed in this document.

[0182] In some embodiments, methods are provided for treating, preventing, and / or reducing cellular stress apoptosis in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, uses of 15-HEPE are provided to treat, prevent, and / or reduce cellular stress apoptosis in an individual who needs it, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, the individual exhibits a reduction in markers associated with apoptosis, such as Bcl-2 family proteins, activated caspase fragments, and / or cleaved PARP-1 after receiving the composition comprising 15-HEPE compared to baseline or Petition 870250099883, dated 10 / 31 / 2025, page 50 / 336 43 / 223 with a second individual who did not receive the composition comprising 15HEPE.

[0183] In some embodiments, methods are provided for treating, preventing, and / or reducing inflammation in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, uses of 15-HEPE are provided to treat, prevent, and / or reduce inflammation in an individual who needs it, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, the individual exhibits a reduction in T-cell activation, B-cell activation, and / or chemotaxis after receiving the composition comprising 15-HEPE compared to baseline or to a second individual who did not receive the composition comprising 15-HEPE.

[0184] In some embodiments, methods are provided for treating and / or preventing sickle cell disease and / or its symptoms in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document. In some embodiments, uses of 15-HEPE are provided for treating and / or preventing sickle cell disease and / or its symptoms in an individual who needs them, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document.

[0185] In some forms, sickle cell disease and its associated symptoms include, but are not limited to, inflammatory vasculopathy, vasoconstriction, bronchoconstriction, iron overload, hemoglobinopathy, chromic hemolysis, sickling, anemia, inflammation, pain, acute and / or chronic organ damage (e.g., lung, kidney, liver, spleen), and oxidative stress. Petition 870250099883, dated 10 / 31 / 2025, page 51 / 336 44 / 223

[0186] In some embodiments, methods are provided for treating and / or preventing heparin-induced thrombocytopenia (HIT) and / or its symptoms in an individual who needs them, the methods comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various embodiments disclosed in this document.

[0187] In some forms, uses of 15-HEPE is used to treat and / or prevent heparin-induced thrombocytopenia (HIT) and / or its symptoms in an individual requiring them, the use comprising administering to the individual a therapeutically effective amount of a composition comprising 15-HEPE according to various modalities disclosed in this document.

[0188] In some modalities, after treatment with a composition of the present technology, the individual presents one or more of the following results:

[0189] (a) no increase or a decrease in serum aminotransferase (ALT) and / or aspartate aminotransferase (AST) levels from baseline, placebo control and / or untreated patient;

[0190] (b) no increase or a decrease in bilirubin (BUN) levels compared to baseline, placebo control and / or the untreated patient;

[0191] (c) no increase or a reduction in the area of ​​fibrosis compared to baseline, placebo control and / or untreated patient;

[0192] (d) no increase or a decrease in fasting glucose levels compared to baseline, placebo control and / or the untreated patient;

[0193] (e) no increase or a decrease in insulin levels from baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, page 52 / 336 45 / 223

[0194] (f) no increase or a decrease in alkaline phosphate (ALP) levels from baseline, placebo control and / or untreated patient;

[0195] (g) no increase or a decrease in hemoglobin A1C (HbA1C) levels from baseline, placebo control and / or untreated patient;

[0196] (h) no increase or decrease in homeostatic model of insulin resistance (HOMA-IR) assessment levels from baseline, placebo control and / or untreated patient;

[0197] (i) no increase or a decrease in adipose tissue insulin resistance (adipo-IR) levels compared to baseline, placebo control and / or untreated patient;

[0198] (j) no increase or a decrease in total cholesterol levels compared to baseline, placebo control and / or untreated patient;

[0199] (k) no increase or a decrease in triglyceride levels compared to baseline, placebo control and / or untreated patient;

[0200] (l) no increase or a decrease in diglyceride levels compared to baseline, placebo control and / or untreated patient;

[0201] (m) no increase or a decrease in very low-density lipoprotein (VLDL-C) cholesterol levels from baseline, placebo control and / or untreated patient;

[0202] (n) no increase or a decrease in levels of remnant particulate cholesterol (RLP-C) compared to baseline, placebo control and / or untreated patient;

[0203] (o) no increase or a decrease in non-high-density lipoprotein cholesterol (non-HDL cholesterol) levels from baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, page 53 / 336 46 / 223

[0204] (p) no reduction or an increase in high-density lipoprotein cholesterol (HDL-C) levels from baseline, placebo control and / or untreated patient;

[0205] (q) no increase or a decrease in low-density lipoprotein (LDL-C) cholesterol levels from baseline, placebo control and / or untreated patient;

[0206] (r) no increase or a decrease in hydroxyproline levels in the kidneys compared to baseline, placebo control and / or the untreated patient;

[0207] (s) no increase or a decrease in interleukin-33 (IL-33) levels from baseline, placebo control and / or untreated patient;

[0208] (t) no increase or a decrease in interleukin-17 (IL-17) levels from baseline, placebo control and / or untreated patient;

[0209] (u) no increase or a decrease in aryl hydrocarbon receptor (AhR) levels from baseline, placebo control and / or untreated patient;

[0210] (v) no increase or a decrease in TNF-like ligand 1A (TL1A) levels from baseline, placebo control and / or untreated patient;

[0211] (w) no increase or a decrease in tumor necrosis factor (TNF-α) levels from baseline, placebo control and / or untreated patient;

[0212] (x) no increase or a decrease in interleukin-13 (IL-13) levels compared to baseline, placebo control and / or untreated patient;

[0213] (y) no increase or a decrease in interleukin-6 (IL-6) levels from baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, page 54 / 336 47 / 223

[0214] (z) no increase or a decrease in interleukin 1 beta-β (IL-1 β) levels from baseline, placebo control and / or untreated patient;

[0215] (aa) no increase or a decrease in type 1 collagen levels compared to baseline, placebo control and / or untreated patient;

[0216] (bb) no increase or a decrease in transforming growth factor-β (TGF-β) levels compared to baseline, placebo control and / or untreated patient;

[0217] (cc) no increase or a decrease in α-smooth muscle (α-SMA) action levels relative to baseline, placebo control and / or untreated patient;

[0218] (dd) no increase or a decrease in levels of tumor necrosis factor ligand member 11A superfamily (TNRSF11A) relative to baseline, placebo control and / or untreated patient;

[0219] (ee) no increase or a decrease in serine protease 2 (PRSS2) levels from baseline, placebo control and / or untreated patient;

[0220] (ff) no increase or a decrease in copper-containing amine oxidase 3 (AOC3) levels from baseline, placebo control and / or untreated patient;

[0221] (gg) no increase or a decrease in leukocyte immunoglobulin-like B1 receptor (LILBR1) levels compared to baseline, placebo control and / or untreated patient;

[0222] (hh) no increase or a decrease in transferrin receptor (TR) protein 1 levels from baseline, placebo control and / or untreated patient;

[0223] (ii) no increase or a decrease in elafin (PI3) levels compared to baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, page 55 / 336 48 / 223

[0224] (jj) no increase or a decrease in serum amyloid A4 (SAA4) levels compared to baseline, placebo control and / or untreated patient;

[0225] (kk) no increase or a decrease in monocyte chemoattractant protein-1 (MCP-1) levels compared to baseline, placebo control and / or untreated patient;

[0226] (ll) no increase or a decrease in chemokine ligand 16 (CC motif) (CCL16) levels from baseline, placebo control and / or untreated patient;

[0227] (mm) no increase or a decrease in TLT2 transcription levels compared to baseline, placebo control, and / or untreated patient;

[0228] (nn) no increase or a decrease in dipeptidyl peptidase 4 (DPP4) levels from baseline, placebo control and / or untreated patient; and

[0229] (oo) no increase or a decrease in inhibitor of metalloproteinase-1 (TIMP-1) levels from baseline, placebo control and / or untreated patient;

[0230] (pp) no increase or a decrease in plasminogen activator inhibitor-1 (PAI-1) levels from baseline, placebo control and / or untreated patient;

[0231] (qq) no increase or decrease in a score of NAFLD (NFS) in relation to baseline, placebo control and / or untreated patient; and

[0232] (rr) no increase or a decrease in fibrosis-4 (FIB-4) levels compared to baseline, placebo control and / or untreated patient;

[0233] (ss) no increase or a decrease in liver stiffness levels compared to baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, page 56 / 336 49 / 223

[0234] (tt) no increase or a decrease in liver fat content compared to baseline, placebo control and / or untreated patient;

[0235] (uu) no reduction or an increase in glycerophospholipid levels compared to baseline, placebo control and / or untreated patient;

[0236] (vv) no increase or a decrease in blood pressure compared to baseline, placebo control and / or untreated patient;

[0237] (ww) no increase or decrease in an elevated liver fibrosis score (ELF) compared to baseline, placebo control and / or untreated patient;

[0238] (xx) no increase or a decrease in collagen production in pulmonary and / or dermal fibroblasts compared to baseline, placebo control and / or untreated patient;

[0239] (yy) no reduction or an increase in glucose uptake compared to baseline, placebo control and / or untreated patient;

[0240] (zz) an increase in the viability of lung and / or dermal fibroblasts compared to baseline, placebo control and / or untreated patient;

[0241] (ab) no change or a reduction in interleukin-8 (IL-8) levels compared to baseline, placebo control and / or untreated patient;

[0242] (ac) no change or a reduction in interleukin-23 (IL-23) levels from baseline, placebo control and / or untreated patient;

[0243] (ad) no change or a reduction in interleukin-11 (IL-11) levels compared to baseline, placebo control and / or untreated patient; and / or

[0244] (ae) no change or a reduction in Petition 870250099883, dated 10 / 31 / 2025, page 57 / 336 50 / 223 interferon γ (IFNy) compared to baseline, placebo control, and / or untreated patient;

[0245] (af) no change or a reduction in T and / or B cell activation compared to baseline, placebo control and / or untreated patient;

[0246] (ag) no change or a reduction in chemotaxis compared to baseline, placebo control and / or untreated patient;

[0247] (ah) no change or a reduction in phosphorylated members of the B-cell lymphoma family 2 (Bcl-2) compared to baseline, placebo control and / or untreated patient;

[0248] (ai) no change or a reduction in activated caspase fragment levels compared to baseline, placebo control and / or untreated patient;

[0249] (aj) no change or a reduction in levels of cleaved poly(ADP-ribose) polymerase-1 (PARP-1) from baseline, placebo control and / or untreated patient;

[0250] (ak) no change or a reduction in waist circumference from baseline, placebo control and / or untreated patient;

[0251] (al) no change or a reduction in an AST-to-platelet ratio (ARPI) index from baseline, placebo control and / or untreated patient;

[0252] (am) no change or a reduction in a liver inflammation and fibrosis (LIF) score compared to baseline, placebo control and / or untreated patient;

[0253] (an) no change or a reduction in a Lok score compared to baseline, placebo control and / or untreated patient;

[0254] (to) no change or a reduction in a Petition 870250099883, dated 10 / 31 / 2025, page 58 / 336 51 / 223 fibrosis score compared to baseline, placebo control, and / or untreated patient;

[0255] (ap) no change or a reduction in a King score from baseline, placebo control and / or untreated patient;

[0256] (aq) no change or a reduction in a Bonacini score compared to baseline, placebo control and / or untreated patient;

[0257] (ar) no change or a reduction in a transient elastography (TE) score compared to baseline, placebo control and / or untreated patient.

[0258] (as) no increase or a decrease in vascular adhesion molecules compared to baseline, placebo control and / or untreated patient;

[0259] (at) no increase or a reduction in cardiovascular risk proteins compared to baseline, placebo control and / or untreated patient;

[0260] (au) no increase or a decrease in chemokines compared to baseline, placebo control and / or untreated patient;

[0261] (av) no increase or a decrease in tumor necrosis factor receptor superfamily members relative to baseline, placebo control and / or untreated patient;

[0262] (aw) no change or an increase in red blood cell count from baseline, placebo control and / or untreated patient;

[0263] (ax) no change or an increase in white blood cell count compared to baseline, placebo control and / or untreated patient;

[0264] (ay) no change or an increase in Petition 870250099883, dated 10 / 31 / 2025, page 59 / 336 52 / 223 platelet count compared to baseline, placebo control and / or untreated patient;

[0265] (az) no change or an increase in prothrombin time compared to baseline, placebo control and / or untreated patient;

[0266] (ba) no change or an increase in activated partial thromboplastin time compared to baseline, placebo control and / or untreated patient;

[0267] (bc) no change or an increase in hemoglobin production compared to baseline, placebo control and / or untreated patient;

[0268] (bd) no change or an increase in the synthesis of beta globin chains of the hemoglobin tetramer compared to baseline, placebo control and / or untreated patient;

[0269] (be) no change or a reduction in red blood cell hemolysis compared to baseline, placebo control and / or untreated patient;

[0270] (bf) no change or a reduction in shortness of breath compared to baseline, placebo control and / or untreated patient;

[0271] (bg) no change or a reduction in heart rate compared to baseline, placebo control and / or untreated patient;

[0272] (bh) no change or a reduction in spleen size from baseline, placebo control and / or untreated patient;

[0273] (bi) no change or a reduction in liver size compared to baseline, placebo control and / or untreated patient;

[0274] (bj) no change or a reduction in dactylitis compared to baseline, placebo control and / or untreated patient;

[0275] (bk) no change or a reduction in crises Petition 870250099883, dated 10 / 31 / 2025, page 60 / 336 53 / 223 of pain compared to baseline, placebo control and / or untreated patient;

[0276] (bl) no change or a reduction in the abnormal development of blood clots compared to baseline, placebo control and / or untreated patient;

[0277] (bm) no change or a reduction in the width of the red blood cell distribution compared to baseline, placebo control and / or untreated patient;

[0278] (bn) no change or a reduction in reticulocyte count compared to baseline, placebo control and / or untreated patient; and / or

[0279] (bo) no change or a reduction in fibrinogen concentration compared to baseline, placebo control and / or untreated patient.

[0280] (bp) no change or a reduction in serum creatinine levels compared to baseline, placebo control and / or untreated patient.

[0281] (bq) no change or a reduction in C-reactive protein (CRP) levels compared to baseline, placebo control and / or untreated patient.

[0282] (br) no change or a reduction in pentraxin-2 levels compared to baseline, placebo control and / or untreated patient.

[0283] (bs) no change or a reduction in monocyte chemoattractant protein 1 (MCP-1 / CCL2) levels compared to baseline, placebo control and / or untreated patient.

[0284] (bt) no change or a reduction in circulating neutrophils compared to baseline, placebo control and / or untreated patient.

[0285] (bu) no change or a reduction in vascular cell adhesion molecule 1 (VCAM-1) levels from baseline, Petition 870250099883, dated 10 / 31 / 2025, page 61 / 336 54 / 223 control with placebo and / or untreated patient.

[0286] (bv) no change or a reduction in levels of intercellular adhesion molecule 1 (ICAM-1) compared to baseline, placebo control and / or untreated patient.

[0287] (bw) no change or a reduction in endothelin-1 (ET-1) levels from baseline, placebo control and / or untreated patient.

[0288] (bx) no change or an increase in hematocrit levels compared to baseline, placebo control and / or untreated patient.

[0289] (by) no change or an increase in hemoglobin levels compared to baseline, placebo control and / or untreated patient.

[0290] (bz) no change or a reduction in the number of sickle cells compared to baseline, placebo control and / or untreated patient.

[0291] (ca) no change or a reduction in CD68 levels compared to baseline, placebo control and / or untreated patient.

[0292] (cb) no change or a reduction in CD80 levels compared to baseline, placebo control and / or untreated patient.

[0293] (cc) no change or a reduction in NF-kB p65 activation compared to baseline, placebo control and / or untreated patient.

[0294] (cd) no change or a reduction in NLRP3 inflammasome activation (protein 3 containing NOD, LRR and pyrin domains) compared to baseline, placebo control and / or untreated patient.

[0295] (ce) no change or a reduction in vascular endothelial activation compared to baseline, placebo control and / or untreated patient.

[0296] (cf) no change or a reduction in Petition 870250099883, dated 10 / 31 / 2025, page 62 / 336 55 / 223 vascular recruitment of neutrophils compared to baseline, placebo control, and / or untreated patient.

[0297] (cg) no change or a reduction in inflammatory cell infiltration compared to baseline, placebo control and / or untreated patient.

[0298] (ch) no change or a reduction in thrombus formation compared to baseline, placebo control and / or untreated patient.

[0299] (ci) no change or a reduction in iron overload and / or iron accumulation in the liver compared to baseline, placebo control and / or untreated patient.

[0300] (cj) no change or a reduction in oxidative stress compared to baseline, placebo control and / or untreated patient.

[0301] (ck) no change or a reduction in nuclear factor erythroid-related factor 2 (Nrf2) levels compared to baseline, placebo control, and / or untreated patient.

[0302] (cl) no change or a reduction in oxidation and / or heme oxygenase-1 (HO-1) levels compared to baseline, placebo control and / or untreated patient.

[0303] (cm) no change or a reduction in selectin E levels compared to baseline, placebo control and / or untreated patient.

[0304] (cn) no change or a reduction in red blood cell adhesion compared to baseline, placebo control and / or untreated patient.

[0305] In some embodiments, the method further comprises measuring a baseline level of one or more markers or parameters set out in (a) to (cn) above in the individual prior to administration of the composition comprising 15-HEPE. In some embodiments, the use further comprises measuring a baseline level of one or more markers Petition 870250099883, dated 10 / 31 / 2025, page 63 / 336 56 / 223 or parameters set forth in (a) to (cn) above in the individual before administration of the composition comprising 15-HEPE. In some embodiments, the method further comprises measuring a second level of one or more markers or parameters set forth in (a) to (cn) above in the individual after administration of the composition comprising 15-HEPE. In some embodiments, the use further comprises measuring a second level of one or more markers or parameters set forth in (a) to (cn) above in the individual after administration of the composition comprising 15-HEPE.

[0306] In some modalities, after treatment with the composition comprising 15-HEPE, for example, over a period of about 1 to 12 weeks, about 1 to 8 weeks, or about 1 to 4 weeks, the individual exhibits one or more of the results described in (a) to (cn) above. For example, the individual exhibits one or more of the following results:

[0307] (a) no increase or decrease in serum ALT and / or AST levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0308] (b) no increase or decrease in BUN levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or placebo control and / or Petition 870250099883, dated 10 / 31 / 2025, p. 64 / 336 57 / 223 untreated patients;

[0309] (c) no increase or decrease in the area of ​​fibrosis of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0310] (d) no increase or decrease in fasting glucose levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0311] (e) no increase or decrease in insulin of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0312] (f) no increase or decrease in ALP levels of at least about 5%, at least about 10%, at least about 15%, Petition 870250099883, dated 10 / 31 / 2025, p. 65 / 336 58 / 223 at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0313] (g) no increase or decrease in levels of HB1Ac of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or the untreated patient;

[0314] (h) no increase or decrease in levels of HOMA-IR of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0315] (i) no increase or decrease in adipoIR levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, by Petition 870250099883, dated 10 / 31 / 2025, page 66 / 336 59 / 223 less about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to baseline, placebo control, and / or the untreated patient;

[0316] (j) no increase or decrease in total cholesterol levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0317] (k) no increase or decrease in triglyceride levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0318] (l) no increase or decrease in diglyceride levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, control Petition 870250099883, dated 10 / 31 / 2025, p. 67 / 336 60 / 223 with placebo and / or to the untreated patient;

[0319] (m) no increase or decrease in levels of VLDL-C of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0320] (n) no increase or decrease in RLPC levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0321] (o) no increase or decrease in non-HDL cholesterol levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0322] (p) no reduction or increase in levels of HDL-C of at least about 5%, at least about 10%, at least about Petition 870250099883, dated 10 / 31 / 2025, p. 68 / 336 61 / 223 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0323] (q) no increase or decrease in LDLC levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0324] (r) no increase or decrease in renal hydroxyproline levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0325] (s) no increase or decrease in IL-33 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 69 / 336 62 / 223 less about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to baseline, placebo control, and / or untreated patient;

[0326] (t) no increase or decrease in IL-17 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0327] (u) no increase or decrease in AhR levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0328] (v) no increase or decrease in TL1A levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95%; relative to baseline, placebo control and / or Petition 870250099883, dated 10 / 31 / 2025, p. 70 / 336 63 / 223 untreated patients;

[0329] (w) no increase or decrease in TNFα levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0330] (x) no increase or decrease in IL-13 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0331] (y) no increase or decrease in IL-6 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0332] (z) no increase or decrease in IL-1 β levels of at least about 5%, at least about 10%, at least about 15%, Petition 870250099883, dated 10 / 31 / 2025, p. 71 / 336 64 / 223 at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0333] (aa) no increase or decrease in type 1 collagen levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0334] (bb) no increase or decrease in levels of TGF-β of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0335] (cc) no increase or decrease in α-SMA of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, by Petition 870250099883, dated 10 / 31 / 2025, page 72 / 336 65 / 223 less about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0336] (dd) no increase or decrease in TNRSF11A of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0337] (ee) no increase or decrease in levels of PRSS2 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0338] (ff) no increase or decrease in levels of AOC3 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or Petition 870250099883, dated 10 / 31 / 2025, p. 73 / 336 66 / 223 untreated patients;

[0339] (gg) no increase or decrease in levels of LILBR1 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0340] (hh) no increase or decrease in TR levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0341] (ii) no increase or decrease in PI3 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0342] (jj) no increase or decrease in SAA4 levels of at least about 5%, at least about 10%, at least about 15%, Petition 870250099883, dated 10 / 31 / 2025, p. 74 / 336 67 / 223 at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0343] (kk) no increase or decrease in levels of MCP-1 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0344] (ll) no increase or decrease in levels of CCL16 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0345] (mm) no increase or decrease in levels of TLT2 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, by Petition 870250099883, dated 10 / 31 / 2025, page 75 / 336 68 / 223 less about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to baseline, placebo control, and / or untreated patient;

[0346] (nn) no increase or decrease in levels of DPP4 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0347] (oo) no increase or decrease in levels of TIMP-1 of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0348] (pp) no increase or decrease in PAI levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or placebo control and / or Petition 870250099883, dated 10 / 31 / 2025, p. 76 / 336 69 / 223 untreated patients;

[0349] (qq) no increase or decrease in an NFS of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0350] (rr) no increase or decrease in FIB levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0351] (ss) no increase or decrease in liver stiffness of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0352] (tt) no increase or decrease in liver fat content of at least about 5%, at least about 10%, at least about Petition 870250099883, dated 10 / 31 / 2025, page 77 / 336 70 / 223 of 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0353] (uu) no reduction or increase in glycerophospholipid levels of at least about less about 15%, at least about less about 30%, at least about less about 45%, at least about less about 60%, at least about less about 75%, at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 65%, at least about 70%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0354] (vv) no increase or decrease in blood pressure of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0355] (ww) no increase or decrease in an ELF score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 78 / 336 71 / 223 approximately 60%, at least approximately 65%, at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% relative to baseline, placebo control, and / or untreated patient;

[0356] (zz) no increase or decrease in collagen production in lung and / or dermal fibroblasts of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0357] (yy) no reduction or increase in glucose uptake of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0358] (zz) an increase in lung and / or dermal fibroblast viability of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, to Petition 870250099883, dated 10 / 31 / 2025, p. 79 / 336 72 / 223 control with placebo and / or to the untreated patient;

[0359] (ab) no change or a reduction in IL-8 level scores of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0360] (ac) no change or a decrease in IL-23 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo-controlled and / or untreated patient levels; and / or

[0361] (ad) no change or a reduction in IL-11 level scores of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0362] (ae) no change or reduction in levels of IFNY of at least about 5%, at least about 10%, at least about Petition 870250099883, dated 10 / 31 / 2025, p. 80 / 336 73 / 223 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0363] (af) no change or a reduction in T and / or B cell activation of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0364] (ag) no change or a reduction in chemotaxis of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0365] (ah) no change or a reduction in Bcl-2 family members of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, by Petition 870250099883, dated 10 / 31 / 2025, p. 81 / 336 74 / 223 less about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0366] (ai) no change or a reduction in activated caspase fragment levels relative to at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0367] (aj) no change or a reduction in cleaved PARP-1 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0368] (ak) no change or a reduction in waist circumference of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, to Petition 870250099883, dated 10 / 31 / 2025, p. 82 / 336 75 / 223 control with placebo and / or to the untreated patient;

[0369] (al) no change or a reduction in a ARPI of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient;

[0370] (am) no change or a reduction in a LIF score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0371] (an) no change or a reduction in the Lok score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0372] (to) no change or a reduction in the fibrosis score of at least about 5%, at least about 10%, at least about Petition 870250099883, dated 10 / 31 / 2025, p. 83 / 336 76 / 223 of 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0373] (ap) no change or a reduction in the King score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0374] (aq) no change or a reduction in the Bonacini score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or the untreated patient; and / or

[0375] (ar) no change or a reduction in the TE score of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 84 / 336 77 / 223 less about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% compared to baseline, placebo control, and / or untreated patient;

[0376] (as) an increase in vascular adhesion molecules of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0377] (at) an increase in cardiovascular risk proteins of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0378] (au) an increase in chemokines of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient; and Petition 870250099883, dated 10 / 31 / 2025, p. 85 / 336 78 / 223

[0379] (av) an increase in tumor necrosis factor receptor superfamily members of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0380] (aw) no change or an increase in red blood cell count of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0381] (ax) no change or an increase in white blood cell count of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0382] (ay) no change or an increase in platelet count of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 86 / 336 79 / 223 less about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% in relation to baseline, placebo control and / or untreated patient;

[0383] (az) no change or an increase in prothrombin time of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0384] (ba) no change or an increase in activated partial thromboplastin time of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0385] (bc) no change or increase in hemoglobin production of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 87 / 336 80 / 223 less approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% relative to baseline, placebo control, and / or untreated patient;

[0386] (bd) no change or an increase in the synthesis of beta globin chains of hemoglobin tetramer of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0387] (be) no change or a reduction in red blood cell hemolysis of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0388] (bf) no change or a reduction in shortness of breath of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient; Petition 870250099883, dated 10 / 31 / 2025, p. 88 / 336 81 / 223

[0389] (bg) no change or a reduction in heart rate of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0390] (bh) no change or a reduction in spleen size of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0391] (bi) no change or a reduction in liver size of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0392] (bj) no change or a reduction in dactylitis of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 89 / 336 82 / 223 less about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% in relation to baseline, placebo control and / or untreated patient;

[0393] (bk) no change or a reduction in pain crises of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0394] (bl) no change or a reduction in the abnormal development of blood clots of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient;

[0395] (bm) no change or a reduction in red blood cell distribution of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 90 / 336 83 / 223 less approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% compared to baseline, placebo control, and / or the untreated patient;

[0396] (bn) no change or a reduction in reticulocyte count of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient; and / or

[0397] (bo) no change or a reduction in fibrinogen concentration of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0398] (bp) no change or a reduction in serum creatinine levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient. Petition 870250099883, dated 10 / 31 / 2025, p. 91 / 336 84 / 223

[0399] (bq) no change or a reduction in C-reactive protein (CRP) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0400] (br) no change or a reduction in pentraxin-2 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0401] (bs) no change or a reduction in monocyte chemoattractant protein-1 (MCP-1 / CCL2) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0402] (bt) no change or a reduction in circulating neutrophils of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 92 / 336 85 / 223 less about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0403] (bu) no change or a reduction in vascular cell adhesion molecule 1 (VCAM-1) levels of at least about 5%, at least about 10%, at least about less about 25%, at least about less about 40%, at least about less about 55%, at least about less about 70%, at least about less about 85%, at least about 15%, at least about 20%, at least about 30%, at least about 35%, at least about 45%, at least about 50%, at least about 60%, at least about 65%, at least about 75%, at least about 80%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0404] (bv) no change or a reduction in intercellular adhesion molecule 1 (ICAM-1) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0405] (bw) no change or a reduction in endothelin-1 (ET-1) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 93 / 336 86 / 223 less approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% compared to baseline, placebo control, and / or untreated patient.

[0406] (bx) no change or increase in hematocrit levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0407] (by) no change or an increase in hemoglobin levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0408] (bz) no change or a reduction in the number of sickle cells of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient. Petition 870250099883, dated 10 / 31 / 2025, p. 94 / 336 87 / 223

[0409] (ca) no change or a reduction in CD68 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0410] (cb) no change or a reduction in CD80 levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0411] (cc) no change or a reduction in NF-kB p65 activation of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0412] (cd) no change or a reduction in NLRP3 inflammasome activation (protein 3 containing NOD, LRR and pyrin domains) of at least about 5%, at least about 10%, at least about 15%, at least Petition 870250099883, dated 10 / 31 / 2025, page 95 / 336 88 / 223 approximately 20%, at least approximately 25%, at least approximately 30%, at least approximately 35%, at least approximately 40%, at least approximately 45%, at least approximately 50%, at least approximately 55%, at least approximately 60%, at least approximately 65%, at least approximately 70%, at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% relative to baseline, placebo control, and / or untreated patient.

[0413] (ce) no change or a reduction in vascular endothelial activation of at least about less about 15%, at least about less about 30%, at least about less about 45%, at least about less about 60%, at least about less about 75%, at least about 5%, at least about 10%, at least about 20%, at least about 25%, at least about 35%, at least about 40%, at least about 50%, at least about 55%, at least about 65%, at least about 70%, at least about 80%, at least about 85%, at least about 90% or at least about 95% in relation to baseline, placebo control and / or untreated patient.

[0414] (cf) no change or a reduction in vascular neutrophil recruitment of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0415] (cg) no change or a reduction in inflammatory cell infiltration of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, by Petition 870250099883, dated 10 / 31 / 2025, page 96 / 336 89 / 223 less about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0416] (ch) no change or a reduction in thrombus formation of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0417] (ci) no change or a reduction in iron overload and / or iron accumulation in the liver of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0418] (cj) no change or a reduction in oxidative stress of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or placebo control and / or Petition 870250099883, dated 10 / 31 / 2025, p. 97 / 336 90 / 223 untreated patient.

[0419] (ck) no change or a reduction in nuclear factor erythroid factor-related 2 (Nrf2) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0420] (cl) no change or a reduction in oxidation and / or heme oxygenase-1 (HO-1) levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0421] (cm) no change or a reduction in E-selectin levels of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% relative to baseline, placebo control, and / or untreated patient.

[0422] (cn) no change or a reduction in red blood cell adhesion of at least about 5%, at least about 10%, at least Petition 870250099883, dated 10 / 31 / 2025, p. 98 / 336 91 / 223 less about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% relative to baseline, placebo control and / or untreated patient.

[0423] In any of the embodiments described above in this document, the therapeutically effective dose of the composition of the present technology is between 1 mg and 20 g of 15-HEPE (as the term “15-HEPE” is defined and exemplified in this document) per day, for example, about 50 mg, about 100 mg, about 500 mg, about 750 mg, about 1 g, about 2 g, about 3 g, about 4 g, about 5 g, about 6 g, about 7 g, about 8 g, about 9 g, about 10 g, about 11 g, about 12 g, about 13 g, about 14 g, about 15 g, about 16 g, about 17 g, about 18 g, about 19 g or about 20 g of 15-HEPE per day. In some modalities, the therapeutically effective dose is between 4 g and 10 g of 15-HEPE per day. In another modality, the therapeutically effective dose is 4 g of 15-HEPE per day.

[0424] In some embodiments, the composition is administered to the individual in an amount sufficient to provide a daily dose of 15-HEPE (as the term “15-HEPE” is defined and exemplified herein) of about 1 mg to about 20,000 mg, about 25 mg to about 10,000 mg, about 50 mg to about 5,000 mg, about 75 mg to about 2,500 mg or about 100 mg to about 1,000 mg, for example, about 25 mg, about 50 mg, about 75 mg, about 100 mg, about 125 mg, about 150 mg, about 175 mg, about 200 mg, about 225 mg, about 250 mg, about 275 mg, about 300 mg, about 325 mg, about 350 mg, about 375 mg, about 400 mg, about 425 mg, about 450 mg, about 475 mg, about 500 mg, about 525 mg, about 550 mg, about 575 mg, about 600 mg, about 625 mg, about 650 mg, about 675 mg, about 700 mg, about 725 mg, about Petition 870250099883, dated 10 / 31 / 2025, page 99 / 336 92 / 223 750 mg, approximately 775 mg, approximately 800 mg, approximately 825 mg, approximately 850 mg, approximately 875 mg, approximately 900 mg, approximately 925 mg, approximately 950 mg, approximately 975 mg, approximately 1000 mg, approximately 1025 mg, approximately 1050 mg, approximately 1075 mg, approximately 1100 mg, approximately 1025 mg, approximately 1050 mg, approximately 1075 mg, approximately 1200 mg, approximately 1225 mg, approximately 1250 mg, approximately 1275 mg, approximately 1300 mg, approximately 1325 mg, approximately 1350 mg, approximately 1375 mg, approximately 1400 mg, approximately 1425 mg, approximately 1450 mg, approximately 1475 mg, approximately 1500 mg, approximately 1525 mg, approximately 1550 mg, approximately 1575 mg, approximately 1600 mg, approximately 1625 mg, approximately 1650 mg, approximately 1675 mg, approximately 1700 mg, approximately 1725 mg, approximately 1750 mg, approximately 1775 mg, approximately 1800 mg, approximately 1825 mg, approximately 1850 mg, approximately 1875 mg, approximately 1900 mg, approximately 1925 mg, approximately 1950 mg, approximately 1975 mg, approximately 2000 mg, approximately 2025 mg, approximately 2050 mg, approximately 2075 mg, approximately 2100 mg, approximately 2125 mg,approximately 2150 mg, approximately 2175 mg, approximately 2200 mg, approximately 2225 mg, approximately 2250 mg, approximately 2275 mg, approximately 2300 mg, approximately 2325 mg, approximately 2350 mg, approximately 2375 mg, approximately 2400 mg, approximately 2425 mg, approximately 2450 mg, approximately 2475 mg, approximately 2500 mg, approximately 2525 mg, approximately 2550 mg, approximately 2575 mg, approximately 2600 mg, approximately 2625 mg, approximately 2650 mg, approximately 2675 mg, approximately 2700 mg, approximately 2725 mg, approximately 2750 mg, approximately 2775 mg, approximately 2800 mg, approximately 2825 mg, approximately 2850 mg, approximately 2875 mg, approximately 2900 mg, approximately 2925 mg, approximately 2950 mg, approximately 2975 mg, approximately 3000 mg, approximately 3025 mg, approximately 3050 mg, approximately 3075 mg, approximately 3100 mg, approximately 3125 mg, approximately 3150 mg, approximately 3175 mg, approximately 3200 mg, approximately 3225 mg, approximately 3250 mg, approximately 3275 mg, approximately 3300 mg, approximately 3325 mg, approximately 3350 mg, approximately 3375 mg, approximately 3400 mg, approximately 3425 mg, approximately 3450 mg, approximately 3475 mg, approximately 3500 mg,about 3525 mg, about 3550 mg, about 3575 mg, about 3600 mg, about 3625 mg, about 3650 mg, about 3675 mg, about 3700 mg, about 3725 mg, about 3750 mg, about 3775 mg, about 3800 mg, about 3825 mg, about 3850 mg, about 3875 mg, about 3900 mg, about 3925 mg, about 3950 mg, about 3975 mg, about 4000 mg, about 4025 mg, about 4050 mg, about 4075 mg, about 4100 mg, about 4125, Petition 870250099883, dated 10 / 31 / 2025, page 100 / 336 93 / 223 mg, approximately 4150 mg, approximately 4175 mg, approximately 4200 mg, approximately 4225 mg, approximately 4250 mg, approximately 4275 mg, approximately 4300 mg, approximately 4325 mg, approximately 4350 mg, approximately 4375 mg, approximately 4400 mg, approximately 4425 mg, approximately 4450 mg, approximately 4475 mg, approximately 4500 mg, approximately 4525 mg, approximately 4550 mg, approximately 4575 mg, approximately 4600 mg, approximately 4625 mg, approximately 4650 mg, approximately 4675 mg, approximately 4700 mg, approximately 4725 mg, approximately 4750 mg, approximately 4775 mg, approximately 4800 mg, approximately 4825 mg, approximately 4850 mg, approximately 4875 mg, approximately 4900 mg, approximately 4925 mg, approximately 4950 mg, approximately 4975 mg, approximately 5000 mg, approximately 5025 mg, approximately 5050 mg, approximately 5075 mg, approximately 5100 mg, approximately 5125 mg, approximately 5150 mg, approximately 5175 mg, approximately 5200 mg, approximately 5225 mg, approximately 5250 mg, approximately 5275 mg, approximately 5300 mg, approximately 5325 mg, approximately 5350 mg, approximately 5375 mg, approximately 5400 mg, approximately 5425 mg, approximately 5450 mg, approximately 5475 mg, approximately 5500 mg,approximately 5525 mg, approximately 5550 mg, approximately 5575 mg, approximately 5600 mg, approximately 5625 mg, approximately 5650 mg, approximately 5675 mg, approximately 5700 mg, approximately 5725 mg, approximately 5750 mg, approximately 5775 mg, approximately 5800 mg, approximately 5825 mg, approximately 5850 mg, approximately 5875 mg, approximately 5900 mg, approximately 5925 mg, approximately 5950 mg, approximately 5975 mg, approximately 6000 mg, approximately 6025 mg, approximately 6050 mg, approximately 6075 mg, approximately 6100 mg, approximately 6125 mg, approximately 6150 mg, approximately 6175 mg, approximately 6200 mg, approximately 6225 mg, approximately 6250 mg, approximately 6275 mg, approximately 6300 mg, approximately 6325 mg, approximately 6350 mg, approximately 6375 mg, approximately 6400 mg, approximately 6425 mg, approximately 6450 mg, approximately 6475 mg, approximately 6500 mg, approximately 6525 mg, approximately 6550 mg, approximately 6575 mg, approximately 6600 mg, approximately 6625 mg, approximately 6650 mg, approximately 6675 mg, approximately 6700 mg, approximately 6725 mg, approximately 6750 mg, approximately 6775 mg, approximately 6800 mg, approximately 6825 mg, approximately 6850 mg, approximately 6875 mg,about 6900 mg, about 6925 mg, about 6950 mg, about 6975 mg, about 7000 mg, about 7025 mg, about 7050 mg, about 7075 mg, about 7100 mg, about 7125 mg, about 7150 mg, about 7175 mg, about 7200 mg, about 7225 mg, about 7250 mg, about 7275 mg, about 7300 mg, about 7325 mg, about 7350 mg, about 7375 mg, about 7400 mg, about 7425 mg, about 7450 mg, about 7475 mg, about 7500, Petition 870250099883, dated 10 / 31 / 2025, page 101 / 336 94 / 223 mg, approximately 7525 mg, approximately 7550 mg, approximately 7575 mg, approximately 7600 mg, approximately 7625 mg, approximately 7650 mg, approximately 7675 mg, approximately 7700 mg, approximately 7725 mg, approximately 7750 mg, approximately 7775 mg, approximately 7800 mg, approximately 7825 mg, approximately 7850 mg, approximately 7875 mg, approximately 7900 mg, approximately 7925 mg, approximately 7950 mg, approximately 7975 mg, approximately 8000 mg, approximately 8025 mg, approximately 8050 mg, approximately 8075 mg, approximately 8100 mg, approximately 8125 mg, approximately 8150 mg, approximately 8175 mg, approximately 8200 mg, approximately 8225 mg, approximately 8250 mg, approximately 8275 mg, approximately 8300 mg, approximately 8325 mg, approximately 8350 mg, approximately 8375 mg, approximately 8400 mg, approximately 8425 mg, approximately 8450 mg, approximately 8475 mg, approximately 8500 mg, approximately 8525 mg, approximately 8550 mg, approximately 8575 mg, approximately 8600 mg, approximately 8625 mg, approximately 8650 mg, approximately 8675 mg, approximately 8700 mg, approximately 8725 mg, approximately 8750 mg, approximately 8775 mg, approximately 8800 mg, approximately 8825 mg, approximately 8850 mg, approximately 8875 mg,approximately 8900 mg, approximately 8925 mg, approximately 8950 mg, approximately 8975 mg, approximately 9000 mg, approximately 9025 mg, approximately 9050 mg, approximately 9075 mg, approximately 9100 mg, approximately 9125 mg, approximately 9150 mg, approximately 9175 mg, approximately 9200 mg, approximately 9225 mg, approximately 9250 mg, approximately 9275 mg, approximately 9300 mg, approximately 9325 mg, approximately 9350 mg, approximately 9375 mg, approximately 9400 mg, approximately 9425 mg, approximately 9450 mg, approximately 9475 mg, approximately 9500 mg, approximately 9525 mg, approximately 9550 mg, approximately 9575 mg, approximately 9600 mg, approximately 9625 mg, approximately 9650 mg, approximately 9675 mg, approximately 9700 mg, approximately 9725 mg, approximately 9750 mg, approximately 9775 mg, approximately 9800 mg, approximately 9825 mg, approximately 9850 mg, approximately 9875 mg, approximately 9900 mg, approximately 9925 mg, approximately 9950 mg, approximately 9975 mg, approximately 10,000 mg, approximately 11,000 mg, approximately 12,000 mg, approximately 13,000 mg, approximately 14,000 mg, approximately 15,000 mg, approximately 16,000 mg, approximately 17,000 mg, approximately 18,000 mg,approximately 19,000 mg or approximately 20,000 mg.

[0425] In some modalities, the compound is administered to the individual for a period ranging from about 3 days to about 1 year, for example, about 3 days, about 4 days, about 5 days, about 6 days, about 1 week, about 1.5 weeks, about 2 weeks, about 2.5 weeks, about 3 weeks, about 1 month, about 2 months, about 3 months, about 4 Petition 870250099883, dated 10 / 31 / 2025, p. 102 / 336 95 / 223 months, approximately 5 months, approximately 6 months, approximately 7 months, approximately 8 months, approximately 9 months, approximately 10 months, approximately 11 months, or approximately 1 year.

[0426] In some modalities, the composition is administered to the individual once a day, twice a day, three times a day, or four times a day for a period of approximately 3 days, approximately 5 days, approximately 7 days, approximately 10 days, approximately 2 weeks, approximately 3 weeks, approximately 4 weeks, approximately 1 month, approximately 2 months, approximately 3 months, approximately 4 months, approximately 5 months, approximately 6 months, approximately 7 months, approximately 8 months, approximately 9 months, approximately 10 months, approximately 11 months, approximately 1 year, approximately 1.25 years, approximately 1.5 years, approximately 1.75 years, approximately 2 years, approximately 2.25 years, approximately 2.5 years, approximately 2.75 years, approximately 3 years, approximately 3.25 years, approximately 3.5 years, approximately 3.75 years, approximately 4 years, approximately 4.25 years, approximately 4.5 years, approximately 4.75 years, approximately 5 years, or more than 5 years.

[0427] In some modalities, the composition is administered to the individual one or more times (e.g., two, three, four or more times) per day. In some modalities, the composition is administered to the individual every day, on alternate days, every three days, weekly, bi-weekly (i.e., every two weeks), every three weeks, monthly, every two months, or every three months. In some modalities, the composition may be administered continuously or intermittently, for example, in one or more cycles. In these modalities, in each cycle, the composition may be administered for various durations and / or frequencies, as described above.

[0428] In some embodiments, the composition may be administered over a predetermined period. Alternatively, the composition may be administered until a certain therapeutic reference value is reached. In some embodiments, the methods presented in this document include a step of evaluating one or more therapeutic reference parameters in a biological sample, such as, but not limited to, a lipid biomarker, a metabolic biomarker, an inflammatory biomarker, a cancer biomarker, to determine whether administration of the composition should be continued. In some Petition 870250099883, dated 10 / 31 / 2025, page 103 / 336 96 / 223 modalities, the uses presented in this document include a step in evaluating one or more therapeutic reference parameters in a biological sample, such as, but not limited to, a lipid biomarker, a metabolic biomarker, an inflammatory biomarker, a cancer biomarker, to determine whether administration of the composition should be continued.

[0429] In some embodiments, the composition may be administered by various routes, as determined by a person skilled in the art as appropriate for an indication of interest. In some embodiments, the composition is administered by oral or enteral administration, intravenous injection, intraperitoneal injection, intertumoral injection, bone marrow injection, lymph node injection, subcutaneous injection and / or cerebrospinal fluid injection.

[0430] In some embodiments, the composition is administered with or without food. In some embodiments, the composition is administered to an individual in a fasting state, for example, who has not consumed any food in the previous 12 hours, 8 hours, 4 hours or 2 hours. In some embodiments, the composition is administered to an individual in a fed state, for example, within 2 hours, 1 hour, 45 minutes or 30 minutes after a meal.

[0431] Without need of further description, it is believed that a person skilled in the art can, using the foregoing description and the following illustrative examples, manufacture and utilize the agents of this disclosure and practice the methods and uses claimed. The following working examples are provided to facilitate the practice of this disclosure and should not be construed as limiting in any way the remainder of the disclosure. EXAMPLES EXAMPLE 1: RENAL INTERSTITIAL FIBROSIS INDUCED BY UNILATERAL URETERAL OBSTRUCTION (UUO)

[0432] The objective of this study was to examine the effects of DS109 (15-HETrE) and DS102 (15-HEPE) in UUO-induced renal interstitial fibrosis. Petition 870250099883, dated 10 / 31 / 2025, page 104 / 336 97 / 223

[0433] Figure 1 shows the study design from surgery and treatment to day 14 of the study. 1.1 MATERIALS AND METHODS

[0434] Test Substances: The test substances for this study were DS109 (15-HETrE) and DS102 (15-HEPE). To prepare the assay solutions of each substance, DS109 was first weighed and then dissolved in a 0.5% hydroxypropyl methylcellulose (HPMC) carrier, and DS102 was diluted in a 0.5% HPMC carrier.

[0435] Surgery for UUO: On day 0 of the study, surgery for UUO was performed on mice under anesthesia with sodium pentobarbital. First, the mouse's hair was shaved, and then the abdomen was opened to exteriorize the mouse's left ureter. The ureter was connected with 4-0 nylon sutures at two points. The mouse's peritoneum and skin were then closed with sutures, and the mouse was transferred to a clean cage until it recovered from anesthesia. The left ureter of mice operated on with camouflage was exposed but not ligated.

[0436] Drug Administration: DS109 and DS102 were administered orally to mice at a volume of 10 milliliters (ml) / kilogram (kg).

[0437] Treatment Doses: DS109 was administered at three dose levels of 5, 50, and 250 milligrams (mg) / kg once daily, from Day 0 to Day 13 of the study. DS102 was administered at two dose levels of 50 and 500 mg / kg once daily, from Day 0 to Day 13 of the study.

[0438] Animals: Seven-week-old female C57BL / 6 mice (i.e., animals) were obtained and housed and fed a normal diet under controlled conditions. The animals were kept in a specific pathogen-free (SPF) facility under controlled conditions of temperature (e.g., 23 ± 2 °C), humidity (e.g., 45 ± 10%), lighting (e.g., artificial 12-hour light-dark cycles; light from 8:00 to 20:00), and air exchange. High pressure was maintained in the room. Petition 870250099883, dated 10 / 31 / 2025, p. 105 / 336 98 / 223 experiments were conducted to prevent contamination of the facility. The animals were housed in TPX cages with a maximum of four mice per cage. Clean, sterilized paper was used as bedding and replaced once a week. Sterilized, normal solid diet was provided ad libitum, placed in a metal lid on top of the cage. Pure water was also provided ad libitum in a water bottle fitted with a rubber stopper and a siphon tube. Water bottles were replaced once a week, cleaned and sterilized in an autoclave, and reused. The mice were identified by ear puncture, and each cage was labeled with a specific identification code.

[0439] Renal Biochemistry Measurement: To quantify the hydroxyproline content in the kidneys, frozen left kidney samples were processed by an acid-alkaline hydrolysis method as follows: kidney samples were dissolved in normal (N) 2-ounce sodium hydroxide (NaOH) at 65 °C and autoclaved at 121 °C for 20 minutes. The lysed samples (400 pL) were acid-hydrolyzed with 400 pL of 6N hydrochloric acid (HCl) at 121 °C for 20 minutes and neutralized with 400 pL of 4N NaOH containing 10 mg / mL of activated carbon. An AC buffer (e.g., 2.2M acetic acid / 0.48M citric acid, 400 pL) was added to the samples, followed by centrifugation to collect the supernatant. A standard curve of hydroxyproline was constructed using serial dilutions of trans-4-hydroxy-L-proline starting from 16 pg / ml. The samples and prepared standards (e.g., each 400 pL) were mixed with 400 pL of chloramine T solution and incubated for 25 minutes at room temperature.The samples were then mixed with Ehrlich's solution (e.g., 400 pL) and heated to 65 °C for 20 minutes to develop the color. After the samples were cooled on ice and centrifuged to remove precipitates, the optical density of each supernatant was measured at 560 nanometers (nm). Hydroxyproline concentrations were calculated from the hydroxyproline standard curve. Protein concentrations of the kidney samples were determined using a bicinchonin protein assay (BCA) kit and used to normalize the calculated hydroxyproline values. Hydroxyproline contents in the kidneys were expressed in micrograms (pg) per mg of kidney. Petition 870250099883, dated 10 / 31 / 2025, page 106 / 336 99 / 223 protein.

[0440] Histopathological analysis: To visualize collagen deposition, kidney sections were stained with picro-Sirius red solution. For quantification of the interstitial fibrosis area, bright-field images in the corticomedullary region were captured using a digital camera with 200x magnification, and positive areas in 5 fields / section were measured.

[0441] Quantitative RT-PCR: Total ribonucleic acid (RNA) was extracted from kidney samples using RNAiso. One pg of RNA was reverse transcribed with a reaction mixture containing 4.4 micromolar (mM) magnesium chloride (MgCb), 40 U RNase inhibitor, 0.5 mM dNTP, 6.28 μM random hexamer, 5x first-strand buffer, 10 mM dithiothreitol, and 200 U MMLV-RT in a final volume of 20 μL. The reaction was carried out for one hour at 37 °C, followed by five minutes at 99 °C. Real-time PCR was performed using DICE real-time PCR and TB Green™ Premix Ex Taq™ II. To calculate the relative expression level of microRNA (mRNA), the expression of each gene (e.g., αSMA, TIMP-1, TGF-β, and type 1 collagen) was normalized relative to the reference gene 36B4 (gene symbol: Rplp0). Information on the PCR primer sets and plate layout is described in Tables 1 and 2. TABLE 1. PCR PRIMERS FOR MEASUREMENTS QUANTITATIVE RT-PCR SEQ ID NO. Gene ID of the set Sequence 1 2 36B4 MA057856 forward reverse 5'-TTCCAGGCTTTGGGCATCA-3' 5'- ATGTTCAGCATGTTCAGCAGTGTG-3' 3 4 Alpha-SMA MA057911 forward reverse 5'-AAGAGCATCCGACACTGCTGAC-3' 5'- AGCACAGCCTGAATAGCCACATAC3' 5 6 TIMP-1 MA098519 forward reverse 5'-TGAGCCCTGCTCAGCAAAGA-3' 5'-GAGGACCTGATCCGTCCACAA-3' 7 TGF-β MA030397 forward 5'- Petition 870250099883, dated 10 / 31 / 2025, p. 107 / 336 100 / 223 8 reverse GTGTGGAGCAACATGTGGAACTCTA- 3' 5'-TTGGTTCAGCCACTGCCGTA-3' 9 10 Collagen type 1 MA075477 direct reverse 5'- CCAACAAGCATGTCTGGTTAGGAG3' 5'-GCAATGCTGTTCTTGCAGTGGTA3' 36B4: Ribosomal protein, large, P0 (Rplp0) Alpha-SMA: Actin, alpha 2, smooth muscle, aorta (Acta2) TIMP-1: Tissue inhibitor of metalloproteinase 1 (Timp1) TGF-β: Transforming growth factor, beta 1 (Tgfbl) Collagen type 1: Collagen, type I, alpha 2 (Col1a2) TABLE 2. SPECIFICATIONS FOR PCR PLATES FOR QUANTITATIVE RT-PCR MEASUREMENTS Mouse ID Plate 1 101-308 2 401-608 3 701-708 Alpha-SMA Plate 1-2 Plate 2-2 Plate 3-2 36B4 Plate 1-1 Plate 2-1 Plate 3-1 TIMP-1 Plate 1-3 Plate 2-3 Plate 3-2 36B4 Plate 1-1 Plate 2-1 Plate 3-1 TGF-β Plate 1-4 Plate 2-4 Plate 3-3 36B4 Plate 1-1 Plate 2-1 Plate 3-1 Collagen type 1 Plate 1-5 Plate 2-5 Plate 3-3 36B4 Plate 1-1 Plate 2-1 Plate 3-1

[0442] Sample Collection: For serum samples, non-fasting blood was collected in separate serum tubes without anticoagulant via direct cardiac puncture and centrifuged at 3,500 xg for 4 minutes at 4°C. The supernatant was collected and stored at -80°C for shipment. For kidney samples, the left kidney was collected and cut into two horizontal parts. The upper part of the left kidney was fixed in Bouin's solution and then embedded in paraffin. The paraffin blocks were stored at room temperature for analysis. Petition 870250099883, dated 10 / 31 / 2025, page 108 / 336 101 / 223 histological. The lower part of the left kidney was cut into two parts coronally. The anterior part of the left kidney was frozen in liquid nitrogen and stored at -80 °C for gene expression assay. The posterior part of the left kidney was frozen in liquid nitrogen and stored at -80 °C for renal biochemistry.

[0443] Statistical Tests: Statistical analyses were performed using the Bonferroni multiple comparison test. P-values ​​<0.05 were considered statistically significant. A trend was considered when a one-tailed t-test returned P-values ​​<0.1. Results were expressed as mean ± SD. 1.2 EXPERIMENTAL DESIGN AND TREATMENT

[0444] The study design included the following study groups:

[0445] · Group 1 (Simulated Control): Eight mice subjected to sham surgery were kept without any treatment until sacrifice.

[0446] · Group 2 (Vehicle): Eight mice with UUO received vehicle [0.5% HPMC] orally at a volume of 10 ml / kg once daily, from Day 0 to Day 13.

[0447] · Group 3 (DS109 Low): Eight mice with UUO received the vehicle supplemented with DS109 orally at a dose of 5 mg / kg once daily, from Day 0 to Day 13.

[0448] • Group 4 (DS109 Medium): Eight mice with UUO received the vehicle supplemented with DS109 orally at a dose of 50 mg / kg once daily, from Day 0 to Day 13.

[0449] • Group 5 (DS109 High): Eight mice with UUO received the vehicle supplemented with DS109 orally at a dose of 250 mg / kg once daily, from Day 0 to Day 13.

[0450] • Group 6 (DS102 Low): Eight mice with UUO received oral vehicle supplemented with DS102 at a dose of 50 mg / kg once daily, from Day 0 to Day 13. Petition 870250099883, dated 10 / 31 / 2025, page 109 / 336 102 / 223

[0451] · Group 7 (DS102 High): Eight mice with UUO received an oral vehicle supplemented with DS102 at a dose of 500 mg / kg once daily, from Day 0 to Day 13.

[0452] Table 3 summarizes the treatment schedule for each of Groups 1 to 7 during the study. TABLE 3. SUMMARY OF TREATMENT SCHEDULE Group Number of mice Model Test substance Dose (mg / kg) Volume (ml) Regimen Sacrifice (Day) 1 8 Simulated - - - Day 0 - Day 13 14 2 8 UUO Vehicle - 10 PO, QD, Day 0 - Day 13 14 3 8 UUO DS109 5 10 PO, QD, Day 0 - Day 13 14 4 8 UUO DS109 50 10 PO, QD, Day 0 - Day 13 14 5 8 UUO DS109 250 10 PO, QD, Day 0 - Day 13 14 6 8 UUO DS102 50 10 PO, QD, Day 0 - Day 13 14 7 8 UUO DS102 500 10 PO, QD, Day 0 - Day 13 14

[0453] Monitoring and Sacrifice of Animals: The viability, clinical signs, and behavior of the mice were monitored daily. Individual body weight was measured daily before treatment and throughout the treatment period. Mice were observed for significant clinical signs of toxicity, moribundity, and mortality. Petition 870250099883, dated 10 / 31 / 2025, page 110 / 336 103 / 223 approximately 60 minutes after each administration. The animals were sacrificed by exsanguination via direct cardiac puncture under isoflurane anesthesia on day 14. 1.3. RESULTS

[0454] Changes in body weight and general considerations: Figure 2 shows the changes in body weight of all animals. In all animals, body weight decreased after surgery and gradually recovered during the treatment period. The average body weight of the Vehicle group was significantly lower than that of the Sham control group from Day 2 to Day 5 and from Day 10 to Day 11. There were no significant changes in average body weight on any day during the treatment period between the Vehicle group and the treatment groups. No animals died in any of the groups during the treatment period. In the present study, none of the animals showed deterioration in their general condition.

[0455] Body and kidney weight on the day of sacrifice: Figure 3 and Table 4 show the body weight of the animals on the day of sacrifice. There was no significant difference in average body weight on the day of sacrifice between the Simulated control group and the Vehicle group. There were no significant differences in average body weight on the day of sacrifice between the Vehicle group and the treatment groups. TABLE 4. BODY WEIGHT ON THE DAY OF SACRIFICE Group Body Weight (g) Right Kidney Weight (mg) Ratio between Right Kidney Weight and Body Weight (%) Left Kidney Weight (mg) Ratio between Left Kidney Weight and Body Weight (%) Simulated Control, (n=8) 19.2 ± 0.7 122 ± 8 0.64 ± 0.05 115 ± 14 0.60 ± 0.08 Vehicle, (n=8) 18.9 ± 0.5 139 ± 15 0.73 ± 0.09 488±150 2.56 ± 0.77 Petition 870250099883, dated 10 / 31 / 2025, page 111 / 336 104 / 223 DS109 low, (n=8) 19.1 ± 0.9 137 ± 7 0.71 ± 0.04 533 ± 138 2.79 ± 0.65 DS109 medium, (n=8) 18.6 ± 0.6 135 ± 6 0.73 ± 0.05 523 ± 91 2.83 ± 0.50 DS109 high, (n=8) 18.6 ± 0.7 130 ± 13 0.70 ± 0.05 425 ± 105 2.26 ± 0.53 DS102 low, (n=8) 18.8 ± 0.6 133 ± 10 0.70 ± 0.05 469 ± 60 2.49 ± 0.30 DS102 high, (n=8) 18.7 ± 0.5 136 ± 6 0.71 ± 0.04 487 ±108 2.61 ± 0.57

[0456] Figures 4A to 4D and Table 4 show the kidney weight and kidney / body weight ratio of the animals on the day of sacrifice. The Vehicle group showed a significant increase in the average weight of the right kidney compared to the Sham control group. However, there were no significant differences in the average weight of the right kidney between the Vehicle group and the treatment groups. The Vehicle group also showed a significant increase in the average ratio between the weight of the right kidney and body weight compared to the Sham control group. There were no significant differences in the average ratio between the weight of the right kidney and body weight between the Vehicle group and the treatment groups. The Vehicle group also showed a significant increase in the average weight of the left kidney compared to the Sham control group. There were no significant differences in the average weight of the left kidney between the Vehicle group and the treatment groups.Finally, the Vehicle group showed a significant increase in the mean ratio between left kidney weight and body weight compared to the Sham control group, but there were no significant differences in the mean ratio between left kidney weight and body weight between the Vehicle group and the treatment groups.

[0457] Renal Chemistry: Figure 5 and Table 5 show the hydroxyproline content in the kidneys of the animals. The Vehicle group showed a significant increase in hydroxyproline content in the kidneys compared to the Simulated control group. The DS109 low, DS109 high, DS102 low and DS102 high groups Petition 870250099883, dated 10 / 31 / 2025, page 112 / 336 105 / 223 showed significant reductions in hydroxyproline levels in the kidneys compared to the Vehicle group. There was no significant difference in hydroxyproline levels in the kidneys between the Vehicle group and the DS109 middle group. TABLE 5. HYDROXYPROLINE LEVELS IN THE KIDNEYS Hydroxyproline group in the kidneys (pg / mg of total protein) Sham control, (n=8) 3.02 ± 1.89 Vehicle, (n=8) 16.67 ± 7.83 Low DS109, (n=8) 9.94 ± 2.02 Medium DS109, (n=8) 13.94 ± 6.44 High DS109, (n=8) 8.30 ± 1.04 Low DS102, (n=8) 8.47 ± 2.08 High DS102, (n=8) 8.59 ± 1.99

[0458] Histological Analysis: Figures 6A to 6G and the Table show the staining with Sirius red, and Figure 7 shows the area of ​​fibrosis in the animals. Figure 6A shows representative photomicrographs of kidney sections stained with Sirius red. The Vehicle group showed a significant increase in the percentage of fibrosis area (area positive for Sirius red) compared to the Sham control group. Bonferroni Multiple Comparison revealed that the area of ​​fibrosis in the intermediate DS109 group tended to decrease compared to the Vehicle group. There were no significant differences in the area of ​​fibrosis between the Vehicle group and the other treatment groups. The Mann-Whitney U test was conducted due to the presence of notable outliers and revealed that the area of ​​fibrosis in the low DS109, medium DS109, high DS109, low DS102, and high DS102 groups tended to decrease (p<0.1) compared to the Vehicle group. TABLE 6. FIBROSIS AREA OF THE ANIMALS Group Area positive for red Sirius (%) Area positive for red Sirius (%) _Median Simulated control, (n=8) 0.63 ± 0.22 0.51 ± 0.15 Petition 870250099883, dated 10 / 31 / 2025, page 113 / 336 106 / 223 Vehicle, (n=8) 5.00 ± 1.37 4.55 ± 0.94 DS109 low, (n=8) 4.23 ± 1.90 3.22 ± 1.47 DS109 medium, (n=8) 3.58 ± 1.04 3.28 ± 1.41 DS109 high, (n=8) 4.71 ± 0.96 3.76 ± 0.81 DS102 low, (n=8) 5.01 ± 3.11 4.19 ± 3.33 DS102 high, (n=8) 4.01 ± 1.92 3.08 ± 1.16

[0459] Gene Expression Analyses: Gene expression analyses for alpha-SMA, TIMP-1, TGF-β, and type 1 collagen are shown in Figures 8A to 8D and Table 7. TABLE 7. GENE EXPRESSION ANALYSIS Alpha-SMA TIMP-1 TGF-β Collagen type 1 Simulated control, (n=8) 1.00 ± 0.18 1.00 ± 0.14 1.00 ± 0.09 1.00 ± 0.13 Vehicle, (n=8) 3.82 ± 0.58 133.20 ± 26.86 3.88 ± 0.30 11.52 ± 2.15 Low DS109, (n=8) 3.87 ± 0.82 153.60 ± 37.12 4.29 ± 0.93 10.76 ± 1.45 Medium DS109, (n=8) 4.61 ± 3.15 167.70 ± 122.60 6.01 ± 4.77 15.23 ± 11.52 DS109 high, (n=8) 4.85 ± 1.22 180.90 ± 23.12 5.48 ± 0.36 13.88 ± 1.91 DS102 low, (n=8) 3.74 ± 0.81 138.30 ± 30.39 4.31 ± 0.69 11.80 ± 1.78 DS102 high, (n=8) 5.54 ± 1.54 124.80 ± 28.60 5.37 ± 0.76 14.09 ± 2.88

[0460] Alpha-SMA: The Vehicle group showed a significant increase in the level of α-SMA mRNA expression compared to the Sham control group. There were no significant differences in the level of α-SMA mRNA expression between the Vehicle group and the treatment groups.

[0461] TIMP-1: The Vehicle group showed a significant increase in TIMP-1 mRNA expression levels compared to the Sham control group. There were no significant differences in the expression levels of Petition 870250099883, dated 10 / 31 / 2025, page 114 / 336 107 / 223 TIMP-1 mRNA difference between the vehicle group and the treatment groups.

[0462] TGF-β: The Vehicle group showed a significant increase in TGF-β mRNA expression level compared to the Sham control group. There were no significant differences in TGF-β mRNA expression level between the Vehicle group and the treatment groups.

[0463] Collagen type 1: The Vehicle group showed a significant increase in the level of type 1 collagen mRNA expression compared to the Sham control group. There were no significant differences in the level of type 1 collagen mRNA expression between the Vehicle group and the treatment groups. 1.4 SUMMARY

[0464] As demonstrated by Sirius red staining and hydroxyproline levels in the kidneys, renal fibrosis was established in the Vehicle group in the present study.

[0465] DS109: Treatment with low-dose DS109 showed significant reductions (p<0.05) in kidney hydroxyproline levels and a trend toward reduction (p<0.1) in fibrosis area compared to the Vehicle group. Treatment with medium-dose DS109 showed a trend toward reduction (p<0.1) in fibrosis area compared to the Vehicle group. Finally, treatment with high-dose DS109 showed significant reductions (p<0.05) in kidney hydroxyproline levels and a trend toward reduction (p<0.1) in fibrosis area compared to the Vehicle group.

[0466] DS102: Treatment with low-dose DS102 showed a significant reduction in hydroxyproline content in the kidneys (p<0.05) and a trend toward reduction (p<0.1) in the area of ​​fibrosis compared to the Vehicle group. Treatment with high-dose DS102 showed significant reductions in hydroxyproline content in the kidneys (p<0.05) and a trend toward reduction (p<0.1) in the area of ​​fibrosis compared to the Vehicle group.

[0467] In conclusion, the results of this study suggest that DS109 and DS102 have a suppressive effect on renal fibrogenesis and potential Petition 870250099883, dated 10 / 31 / 2025, page 115 / 336 108 / 223 as therapeutic agents for chronic kidney diseases that progress to fibrosis. EXAMPLE 2: BILE DUCT LIGATURE (BDL) STUDY FOR CHOLESTATIC LIVER DISEASE AND / OR HEPATIC FIBROSIS

[0468] The objective of this study was to examine the effects of DS012 in BDL-induced cholestasis.

[0469] Figure 9 shows the study design from surgery and treatment to day 14 of the study. 2.1 MATERIALS AND METHODS

[0470] Test Substance: The test substance for this study was DS102. To prepare the assay solutions of each substance, DS102 was diluted in a 0.5% hydroxypropylmethylcellulose (HPMC) vehicle.

[0471] BDL surgery: On Day 0 of the study, surgery BDL was performed under pentobarbital anesthesia. First, the mouse's hair was shaved, the abdominal cavity was opened, and the common bile duct was ligated twice with 7-0 surgical silk. The mouse's peritoneum and skin were closed with sutures, and the mice were transferred to a clean cage (e.g., resting cage) until they recovered from anesthesia. Mice operated on with camouflage had the common bile duct exposed but not ligated.

[0472] Drug Administration: DS102 was administered orally at a volume of 10 milliliters (ml) / kilogram (kg).

[0473] Treatment Doses: DS102 was administered at three dose levels of 50, 250, and 500 milligrams (mg) / kg once daily, from Day 0 to Day 13 of the study.

[0474] Animals: Male mice were obtained Six-week-old pathogen-free C57BL / 6J animals were kept in a specific pathogen-free (SPF) facility under controlled conditions of temperature (e.g., 23 ± 2 °C), humidity (e.g., 45 ± 10%), lighting (e.g., artificial 12-hour light-dark cycles; light from 8:00 to 20:00), and air exchange. High pressure was maintained in the experimental room to prevent contamination of the facility. The animals were housed in TPX cages with Petition 870250099883, dated 10 / 31 / 2025, page 116 / 336 109 / 223, a maximum of four mice per cage. Clean, sterilized paper was used as bedding and replaced once a week. A normal, sterilized solid diet was provided ad libitum, placed in a metal lid on top of the cage. Pure water was also provided ad libitum in a water bottle fitted with a rubber stopper and a siphon tube. Water bottles were replaced once a week, cleaned and sterilized in an autoclave, and reused. Mice were identified by ear puncture, and each cage was labeled with a specific identification code.

[0475] Serum Biochemistry Measurement: To visualize collagen deposition, liver sections fixed in Bouin were stained with picro-Sirius red solution. For quantitative analysis of fibrosis area, bright-field images of sections stained with Sirius red were captured using a digital camera with 100x magnification, and positive areas in five fields / section were measured.

[0476] Histological analysis: To visualize collagen deposition, kidney sections were stained with picro-Sirius red solution. For quantification of the interstitial fibrosis area, bright-field images in the corticomedullary region were captured using a digital camera with 200x magnification, and positive areas in 5 fields / section were measured.

[0477] Quantitative RT-PCR: Total ribonucleic acid (RNA) was extracted from liver samples using RNAiso. One pg of RNA was reverse transcribed with a reaction mixture containing 4.4 mM magnesium chloride (MgCl2), 40 U RNase inhibitor, 0.5 mM dNTP, 6.28 μM random hexamer, 5x first-strand buffer, 10 mM dithiothreitol, and 200 U MMLV-RT in a final volume of 20 μL. The reaction was carried out for 1 hour at 37 °C, followed by 5 minutes at 99 °C. Real-time PCR was performed using DICE real-time PCR and TB Green™ Premix Ex Taq™ II. To calculate the relative mRNA expression level, the expression of each gene (α-SMA, TIMP-1, TGF-β, and type 1 collagen) was normalized relative to the reference gene 36B4 (gene symbol: Rplp0). Information on the PCR primer sets and plate layout is described in Tables 8 and 9. Petition 870250099883, dated 10 / 31 / 2025, page 117 / 336 110 / 223 TABLE 8. PCR PRIMERS FOR MEASUREMENTS QUANTITATIVE RT-PCR SEQ ID NO. Gene ID of the set Sequence 1 2 36B4 MA057856 direct reverse 5'-TTCCAGGCTTTGGGCATCA-3' 5'- ATGTTCAGCATGTTCAGCAGTGTG-3' 3 4 Alpha-SMA MA057911 direct reverse 5'-AAGAGCATCCGACACTGCTGAC-3' 5'- AGCACAGCCTGAATAGCCACATAC3' 5 6 TIMP-1 MA098519 direct reverse 5'-TGAGCCCTGCTCAGCAAAGA-3' 5'-GAGGACCTGATCCGTCCACAA-3' 7 8 TGF-β MA030397 direct reverse 5'- GTGTGGAGCAACATGTGGAACTCTA-3' 5'-TTGGTTCAGCCACTGCCGTA-3' 9 10 Collagen type 1 MA075477 direct reverse 5'-CCAACAAGCATGTCTGGTTAGGAG3' 5'-GCAATGCTGTTCTTGCAGTGGTA3' 36B4: Ribosomal protein, large, P0 (Rplp0) Alpha-SMA: Actin, alpha 2, smooth muscle, aorta (Acta2) TIMP-1: Tissue inhibitor of metalloproteinase 1 (Timp1) TGF-β: Transforming growth factor, beta 1 (Tgfbl) Collagen type 1: Collagen, type I, alpha 2 (Col1a2) TABLE 9. SPECIFICATIONS FOR PCR PLATES FOR QUANTITATIVE RT-PCR MEASUREMENTS Mouse ID Plate 1 101-308 2 401-608 3 701-708 Alpha-SMA Plate 1-2 Plate 2-2 Plate 3-2 36B4 Plate 1-1 Plate 2-1 Plate 3-1 TIMP-1 Plate 1-3 Plate 2-3 Plate 3-2 36B4 Plate 1-1 Plate 2-1 Plate 3-1 Petition 870250099883, dated 10 / 31 / 2025, page 118 / 336 111 / 223 TGF-β Plate 1-4 Plate 2-4 Plate 3-3 36B4 Plate 1-1 Plate 2-1 Plate 3-1 Collagen type 1 Plate 1-5 Plate 2-5 Plate 3-3 36B4 Plate 1-1 Plate 2-1 Plate 3-1

[0478] Sample Collection: For serum samples, non-fasting blood was collected in separate anticoagulant-free serum tubes via direct cardiac puncture and centrifuged at 3,500 xg for 4 minutes at 4°C. The supernatant was collected and stored at -80°C for biochemistry (30 μL) and shipment (the remainder). For liver samples, the left lateral lobe was collected and cut into six pieces. Two pieces of the left lateral lobe were fixed in Bouin's solution and then embedded in paraffin. The samples were stored at room temperature for histological analysis. The other two pieces of the left lateral lobe were embedded in OCT compound and flash-frozen in liquid nitrogen. The samples were stored at -80°C. The remaining pieces of the left lateral lobe were frozen in liquid nitrogen and stored at 80°C for gene expression analyses.The right medial lobe, the left medial lobe, the right lobe, and the caudate lobe were frozen in liquid nitrogen and stored at -80 °C for shipment.

[0479] Statistical Tests: Statistical analyses were performed using the Bonferroni multiple comparison test. P-values ​​<0.05 were considered statistically significant. A trend was considered when a one-tailed t-test returned P-values ​​<0.1. Results were expressed as mean ± SD. 2.2 EXPERIMENTAL DESIGN AND TREATMENT

[0480] The study design included the following study groups:

[0481] · Group 1 (Simulated Control): Eight mice subjected to sham surgery were kept without any treatment until sacrifice. Petition 870250099883, dated 10 / 31 / 2025, page 119 / 336 112 / 223

[0482] · Group 2 (Vehicle): Fifteen mice operated on with BDL received vehicle [0.5% HPMC] orally at a volume of 10 ml / kg once daily, from Day 0 to Day 13.

[0483] · Group 3 (Lower DS102): Fifteen mice operated on with BDL received oral vehicle supplemented with DS102 at a dose of 50 mg / kg once daily, from Day 0 to Day 13.

[0484] • Group 4 (DS102 Medium): Fifteen mice operated on with BDL received oral vehicle supplemented with DS102 at a dose of 250 mg / kg once daily, from Day 0 to Day 13.

[0485] • Group 5 (DS102 High): Fifteen mice operated on with BDL received oral vehicle supplemented with DS102 at a dose of 500 mg / kg once daily, from Day 0 to Day 13.

[0486] Table 10 summarizes the treatment schedule for each of Groups 1 to 5 during the study. TABLE 10. SUMMARY OF TREATMENT SCHEDULE Group Number of mice Mice Test substance Dose (mg / kg) Volume (ml) Regimen Sacrifice 1 8 Simulated - - - - Day 14 2 15 BDL Vehicle - 10 PO, QD, Day 0 13 Day 14 3 15 BDL DS102 50 10 PO, QD, Day 0 13 Day 14 4 15 BDL DS102 250 10 PO, QD, Day 0 13 Day 14 5 15 BDL DS102 500 10 PO, QD, Day 0 13 Day 14

[0487] Monitoring and Sacrifice of Animals: The viability, clinical signs, and behavior of mice were Petition 870250099883, dated 10 / 31 / 2025, pp. 120 / 336 113 / 223 mice were monitored daily. Individual body weight was measured daily before treatment and throughout the treatment period. Mice were observed for significant clinical signs of toxicity, moribundity, and mortality approximately 60 minutes after each administration. Animals were sacrificed on Day 14 after BDL surgery by exsanguination via direct cardiac puncture under isoflurane anesthesia. 2.3. RESULTS

[0488] Changes in body weight and general considerations: Figure 10 shows the changes in body weight of all animals. The average body weight in all groups, except the Sham control group, gradually decreased during the study period. The average body weight of the Vehicle group was significantly lower than that of the Sham control group from Day 2 to Day 14. There were no significant changes in average body weight on any day during the study period between the Vehicle group and the DS102 treatment groups.

[0489] During the treatment period, the mice found dead before reaching Day 14 were as follows: three of the 15 mice were found dead in the Vehicle group; seven of the 15 mice were found dead in the DS102 low, DS102 medium, and DS102 high groups. In this model, a percentage of deaths is expected simply due to disease induction, and the observed mortality rate is consistent with historical data.

[0490] Weight of the body and liver on the day of sacrifice: A Figure 11 and Table 11 show the body weight of the animals on the day of sacrifice. The Vehicle group showed a significant reduction in average body weight on the day of sacrifice compared to the Simulated control group. There were no significant differences in average body weight on the day of sacrifice between the Vehicle group and the DS102 treatment groups. TABLE 11. BODY WEIGHT ON THE DAY OF SACRIFICE Petition 870250099883, dated 10 / 31 / 2025, pp. 121 / 336 114 / 223 Group Body Weight (g) Liver Weight (mg) Liver to Body Weight Ratio (%) Simulated Control, (n=8) 23.1 ± 0.7 1132±90 4.9 ± 0.4 Vehicle, (n=12) 16.8 ± 1.8 1438±180 8.7 ± 1.4 Low DS102, (n=8) 17.4 ± 2.9 1392 ± 328 8.3 ± 2.3 Medium DS102, (n=8) 17.0 ± 2.4 1513 ± 182 9.0 ± 1.2 High DS102, (n=8) 16.4 ± 1.6 1231 ± 255 7.6 ± 1.5

[0491] Figures 12A and 12B and Table 11 show the liver weight and liver / body weight ratio of the animals on the day of sacrifice. The Vehicle group showed a significant increase in mean liver weight compared to the Sham control group. The mean liver weight in the high DS102 group tended to decrease compared to the Vehicle group. There were no significant differences in mean liver weight between the Vehicle group and the other treatment groups. The Vehicle group showed a significant increase in the mean liver weight / body weight ratio compared to the Sham control group. The mean liver weight / body weight ratio in the high DS102 group tended to decrease compared to the Vehicle group. There were no significant differences in the mean liver weight / body weight ratio between the Vehicle group and the other treatment groups.

[0492] Biochemistry Figure 13 and Table 12 show the serum aminotransferase (ALT) of the animals. The Vehicle group showed a significant increase in serum ALT levels compared to the Sham control group. There were no significant differences in serum ALT levels between the Vehicle group and the DS102 treatment groups. However, based on historical data from this model, it is known that ALT levels decrease on Day 14 without treatment. Therefore, this may affect the ability to detect differences between the groups. TABLE 12. BIOCHEMISTRY Serum ALT Group (U / L) Total Serum Bilirubin Petition 870250099883, dated 10 / 31 / 2025, pp. 122 / 336 115 / 223 (mg / dL) Simulated control, (n=8) 22 ± 2 0.4 ± 0.1 Vehicle, (n=12) 335±185 24.9 ± 9.6 Low DS102, (n=8) 402 ±112 26.8 ± 6.9 Medium DS102, (n=8) 351 ±155 23.5 ± 9.8 High DS102, (n=8) 383 ± 147 26.2 ± 6.1

[0493] Figure 14 and Table 12 show the total serum bilirubin of the animals. The Vehicle group showed a significant increase in serum total bilirubin level compared to the Sham control group. There were no significant differences in serum total bilirubin level between the Vehicle group and the DS102 treatment groups.

[0494] Histological Analysis: Figures 15A to 15E and Table 13 shows the Sirius red staining and Figure 16 shows the area of ​​fibrosis in the animals. Figure 14A shows representative photomicrographs of liver sections stained with Sirius red. Liver sections from the Vehicle group showed greater collagen deposition in the portal region of the liver lobule and PV-CV or PV-PV bridging fibrosis compared to the Simulated control group. The Vehicle group showed a significant increase in the area of ​​fibrosis (area positive for Sirius red) compared to the Simulated control group. The intermediate DS102 group showed a significant reduction in the area of ​​fibrosis compared to the Vehicle group. The area of ​​fibrosis in the high DS102 group tended to decrease compared to the Vehicle group. There was no significant difference in the area of ​​fibrosis between the Vehicle group and the low DS102 group. TABLE 13. HISTOLOGICAL ANALYSIS Group Area positive for red Sirius (%) Simulated control, (n=8) 0.46 ± 0.25 Petition 870250099883, dated 10 / 31 / 2025, pp. 123 / 336 116 / 223 Vehicle, (n=12) 1.93 ± 0.67 DS102 low, (n=8) 1.70 ± 0.63 DS102 medium, (n=8) 1.06 ± 0.48 DS102 high, (n=8) 1.42± 0.60

[0495] Gene Expression Analyses: Gene expression analyses for α-SMA, TIMP-1, TGF-β, and type 1 collagen are shown in Figures 17A to 17D and Table 14. TABLE 14. GENE EXPRESSION ANALYSES Alpha-SMA TIMP-1 TGF-β Collagen type 1 Simulated control, (n=8) 1.00 ± 0.24 1.00 ± 0.82 1.00 ± 0.08 1.00 ± 0.24 Vehicle, (n=12) 2.98 ± 2.16 33.09 ± 13.75 1.65 ± 0.44 4.77 ± 2.53 Low DS102, (n=8) 3.21 ± 1.67 43.82 ± 26.19 1.48 ± 0.48 4.94 ± 2.76 Medium DS102, (n=8) 2.66 ± 1.33 30.65 ± 16.80 1.50 ± 0.44 4.21 ± 1.90 DS102 high, (n=8) 1.42 ± 0.75 16.09 ± 10.16 1.00 ± 0.23 2.51 ± 1.39

[0496] α-SMA: The Vehicle group showed a significant increase in α-SMA mRNA expression level compared to the Sham control group. α-SMA mRNA expression level in the high DS102 group tended to decrease compared to the Vehicle group. There were no significant differences in α-SMA mRNA expression level between the Vehicle group and the DS102 treatment groups.

[0497] TIMP-1: The Vehicle group showed a significant increase in TIMP-1 mRNA expression level compared to the Sham control group. TIMP-1 mRNA expression level in the high DS102 group tended to decrease compared to the Vehicle group. There were no significant differences in TIMP-1 mRNA expression level between the Vehicle group and the DS102 treatment groups.

[0498] TGF-β: The Vehicle group showed an increase Petition 870250099883, dated 10 / 31 / 2025, pp. 124 / 336 117 / 223 significant in TGF-β mRNA expression level compared to the sham control group. The high DS102 group showed a significant reduction in TGF-β mRNA expression level compared to the vehicle group. There were no significant differences in TGF-β mRNA expression level between the vehicle group and the DS102 treatment groups.

[0499] Collagen type 1: The Vehicle group showed a significant increase in the level of type 1 collagen mRNA expression compared to the Sham control group. The level of type 1 collagen mRNA expression in the high DS102 group tended to decrease compared to the Vehicle group. There were no significant differences in the level of type 1 collagen mRNA expression between the Vehicle group and the DS102 treatment groups. 2.4 SUMMARY

[0500] In this study, biochemical parameters (e.g., ALT and total bilirubin), histological collagen deposition (e.g., area of ​​fibrosis), and gene expression levels (e.g., α-SMA, TIMP-1, TGFβ, type 1 collagen) in the Vehicle group increased significantly compared with the Sham control group. These results suggest that cholestasis and hepatic fibrosis were established in the Vehicle group.

[0501] Treatment with DS102 at the medium dose showed a significant reduction (p<0.05) in the area of ​​fibrosis compared to the vehicle group. Treatment with DS102 at the high dose showed a significant reduction (p<0.05) in the mRNA expression level of TGF-β and a trend toward significance (p<0.01) for the reduction in the area of ​​fibrosis, liver weight, liver / body weight ratio, mRNA expression levels of α-SMA, TIMP-1, and type 1 collagen compared to the vehicle group. These results indicate that DS102 inhibits the production of several pro-fibrotic cytokines in the liver, has a suppressive effect on hepatic fibrosis, and has potential as a therapeutic agent for cholestatic liver diseases. EXAMPLE 3: EFFECTS OF DS102 ON TGF-β RECEPTORS, SIGNALING AND INDUCED FIBROTIC PROTEINS Petition 870250099883, dated 10 / 31 / 2025, pp. 125 / 336 118 / 223

[0502] The objective of this study was to examine the effects of 15-HEPE and 15-HEPE EE on the expression of TGF-β receptors, TGF-β-induced intracellular signaling, and pro-fibrotic epithelial-mesenchymal transition proteins. 3.1 MATERIALS AND METHODS

[0503] Cytotoxicity test: The cytotoxicity of the free acid and ethyl ester of 15-HEPE was tested in different liver (hepatoma) cell lines to understand the concentration range in the test system.

[0504] Transcriptional activity: A promoter (luciferase) assay was performed to measure TGFp-induced transcriptional activation after 15-HEPE administration.

[0505] Sucrose gradient ultracentrifugation and confocal microscopy were used to identify the translocation of TGF-β receptor microdomains induced by 15-HEPE by sucrose. Sucrose density gradient analysis of TGF-β receptors was performed on the plasma membranes of Mv1Lu cells (mink lung epithelial cells) treated with 100 μM 15-HEPE and an equal volume of DMSO (dimethyl sulfoxide) at 37 °C for 0, 1, 4, and 24 hours, and cell lysates from these treated cells were subjected to sucrose density gradient ultracentrifugation. The sucrose gradient fractions were then analyzed by Western blot analysis using the antibodies anti-TβR-I (TGF-β receptor type I), anti-TβR-II (TGF-β receptor type II), anti-TpRIII (TGF-β receptor type III, beta-glucan), anti-EGFR (epidermal growth factor receptor) and anti-caveolin-1.The localization of the lipid raft / caveolae and non-lipid raft microdomains of TβR-I, TβR-II, TβR-III, EGFR, and caveolin1 in the plasma membrane of untreated cells or cells treated with 15-HEPE was evaluated to determine the effects of 15-HEPE on the membrane microdomain localization of TGF-β receptors. 3.2. RESULTS

[0506] The effects of 15-HEPE on signaling induced by TGF-β and cellular responses were determined. To test the effect of 15-HEPE Petition 870250099883, dated 10 / 31 / 2025, pp. 126 / 336 In the study of TGF-β-induced signaling, the activities of 15-HEPE to regulate TGF-β-stimulated phosphorylation and nuclear translocation of Smad2, which are the main signaling events leading to TGF-β-induced cellular responses, were tested. An important biological activity of TGF-β is the transcriptional activation of genes responsible for epithelial-mesenchymal transition (EMT), a crucial event in wound healing, tissue fibrosis, and cancer progression. The effect of 15-HEPE on the expression of proteins related to TGFβ-induced epithelial-mesenchymal transition (such as fibronectin, PAI-1, and N-cadherin, etc.) in HepG2 and LXR cells was evaluated. HepG2 cells (human hepatoma cell line) were treated with increasing doses of stage II 15-HEPE in DMEM containing 0.1% FBS for one hour and continuously stimulated with or without 200 picomolar (pM) doses of TGF-β for 48 hours.

[0507] 15-HEPE directly inhibited TGFβ signaling as shown in Figures 18A and 18B. Specifically, Figure 18A shows that 15-HEPE induced degradation of the TGF-β type II receptor and blocked TGF-β-induced epithelial-mesenchymal transition (EMT) and blocked the production of TGF-β-induced epithelial-mesenchymal transition (EMT) protein (i.e., profibrotic). HepG2 cells (human hepatoma cell line) were treated with increasing doses of stage II 15-HEPE in DMEM containing 0.1% FBS for one hour and continuously stimulated with or without 200 picomolar (pM) TGF-β for 48 hours. The two panels shown in Figure 18A are two separate experiments performed under the same experimental conditions. The results of these separate experiments indicate that 15-HEPE blocks TGF-β-induced EMT protein production and TGF-β type II receptor-induced degradation.Figure 18A also shows the effects of 15-HEPE on plasminogen activator inhibitor-1 (PA-1), a TGF-β-induced protein associated with increased cardiovascular risk. Figure 18B shows that 15-HEPE inhibits TGF-β-stimulated intracellular signaling (e.g., SMAD2 / 3 phosphorylation) in liver stellate cells. The experiment performed in Figure 18B involved pretreating LX2 cells (human liver stellate cells) with concentrations. Petition 870250099883, dated 10 / 31 / 2025, pp. 127 / 336 120 / 223 increasing doses between 0 μM and 100 μM DS102 for 24 hours, followed by 30 minutes of TGF-β stimulation. The results of the experiment indicated that 15-HEPE inhibits TGF-β stimulation.

[0508] A 15-HEPE sucrose density gradient analysis of TGF-β receptors was performed on the plasma membranes of mink lung epithelial cells (Mv1Lu) treated with 100 μM 15-HEPE and an equal volume of dimethyl sulfoxide (DMSO) at 37 °C for 0, 1, 4 and 24 hours, and cell lysates from these treated cells were subjected to ultracentrifugation in a sucrose density gradient. The sucrose gradient fractions were then analyzed by Western blot analysis using the antibodies anti-TeR-I (TGF-β receptor type I - Figure 18C), anti-TeR-II (TGF-β receptor type II - Figure 18D), anti-TeR-III (TGF-β receptor type III, beta-glucan - Figure 18E), anti-EGFR (epidermal growth factor receptor - Figure 18F), and anti-caveolin-1 (Figure 18G). Fractions 4 to 5 contained lipid rafts / caveolae, while fractions 7 to 10 were non-lipid raft fractions.Treatment with 15-HEPE did not affect the abundance of TβR-I proteins, but it did induce the translocation of TβR-I to the lipid raft within 24 hours of treatment (Figure 18C). Stars (★) indicate that 15-HEPE increased the abundance of TβR-I (24 hours) in the fraction compared to the control and shorter treatment durations (Figure 18C). 15-HEPE induced the translocation of TβR-II from one to four hours and further induced degradation within 24 hours of treatment (Figure 18D). Triangles (▼) indicate the translocation and decrease in the abundance of TβR-II in the fraction compared to control cells (Figure 18D). In Figures 18E, 18F, and 18G, 15-HEPE did not alter the location and abundance of TβR-III, EGFR, and caveolin-1. 3.3 SUMMARY

[0509] Thus, taken together, these results demonstrate that 15-HEPE, both in free acid form and in ethyl ester form, induced translocation and degradation of type II TGF-β receptors, and blocked production Petition 870250099883, dated 10 / 31 / 2025, pp. 128 / 336 121 / 223 of TGF-β-induced pro-fibrotic protein in the production of pro-fibrotic proteins and inhibited TGF-β-induced intracellular signaling (SMAD2 / 3) in liver stellate cells. Thus, 15-HEPE and 15-HEPE EE can directly inhibit TGF-β signaling, results that support the therapeutic potential of 15-HEPE and 15-HEPE EE in the treatment of various fibrotic diseases, including non-alcoholic steatohepatitis (NASH), other fibrotic diseases, cardiometabolic diseases, as well as various cancer indications. EXAMPLE 4: THE EFFICACY OF ORALLY ADMINISTERED DS102 IN PATIENTS WITH NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD)

[0510] The aim of the study was to evaluate the safety and efficacy of orally administered DS102 capsules versus placebo in the treatment of adult patients with NAFLD. 4.1 Study Endpoints

[0511] Primary Endpoints: The primary endpoints of this study included the efficacy and safety of DS102 administration. Efficacy was assessed based on the change in serum alanine aminotransferase (ALT) from baseline to Week 16 and the change in liver stiffness measured by transient elastography from baseline to Week 16. Safety was assessed by the number of treatment-emergent adverse events (TEAEs) in each treatment group that led to treatment interruption.

[0512] Secondary Endpoints: The secondary endpoints of this study included a change in any of the following: serum ALT from baseline to Weeks 2, 4, 8, and 12; aspartate aminotransferase (AST) from baseline to Weeks 2, 4, 8, 12, and 16; AST:ALT ratio from baseline to Weeks 2, 4, 8, 12, and 16; fibrosis index-4 (FIB-4) from baseline to Week 16; NAFLD fibrosis score (NFS) from baseline to Week 16; change in liver fat as measured by the controlled attenuation parameter (CAP) from baseline to Week 16; enhanced liver fibrosis score (ELF) from baseline to Week 16; and assessment of the homeostatic model of insulin resistance. Petition 870250099883, dated 10 / 31 / 2025, pp. 129 / 336 122 / 223 (HOMA-IR) and adipose tissue insulin resistance (adipo-IR) from baseline to weeks 2, 4, 8, 12, and 16.

[0513] Exploratory Analysis: The exploratory analysis included the analysis of lipid and metabolic parameters, including total cholesterol, triglycerides, very low-density lipoprotein cholesterol (VLDL-C), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), non-high-density lipoprotein cholesterol (non-HDL-C), remnant particle cholesterol (RLP-C), fasting glucose, insulin, free fatty acids, and hemoglobin A1C (HbA1C). Additional exploratory analysis included high-throughput lipidomics and proteomics. 4.2 STUDY DESIGN

[0514] This was a multicenter, randomized, placebo-controlled, double-blind, parallel-group, exploratory phase IIa study to investigate the safety and efficacy of orally administered DS102 capsules and the dose-response relationship between two doses of DS102 and placebo in patients with NAFLD aged 18–75 years. Three parallel groups of patients with confirmed NAFLD were investigated in this study to compare two different doses of DS102 with placebo over a 16-week treatment period. The study was designed to include 96 evaluable patients, with 32 patients randomized to each treatment group.

[0515] The study consisted of a 28-day screening period, a 16-week treatment period, and a four-week follow-up period. At the screening visit, patients were assessed using screening tests. Patients who met the inclusion criteria and those who did not meet the exclusion criteria were included.

[0516] A schematic diagram of the overall study timeline is presented in Figure 19. After patients were included in the study, they were prevented from using any other treatment for NAFLD. Any medication (e.g., prescription and over-the-counter drugs) or therapeutic intervention deemed necessary for the patient and which, in the opinion of Petition 870250099883, dated 10 / 31 / 2025, pp. 130 / 336 123 / 223 Researcher's assessment, which does not interfere with safety and efficacy evaluations, was maintained unless it is included in the list of "Concomitant Medications" provided below.

[0517] Before the start of the comparative treatment period, patients returned to the site for an initial disease assessment and eligible patients were randomly allocated to one of three parallel-group treatment regimens in a 1:1:1 randomization:

[0518] · Treatment Group A: Two capsules of Placebo 500 mg administered orally twice daily (4 capsules per day) for 16 weeks.

[0519] · Treatment Group B: One 500 mg capsule of DS102 & 1 x 500 mg placebo capsule administered orally twice daily (4 capsules per day) for 16 weeks.

[0520] • Treatment Group C: Two capsules of DS102 500 mg administered orally twice daily (4 capsules per day) for 16 weeks.

[0521] To maintain double-blind conditions, the DS102 capsule and the placebo capsule were identical in appearance. 4.3 PATIENTS AND TRIAGE

[0522] To participate in this study, patients had to meet all of the following inclusion criteria and had to not meet any of the following exclusion criteria. Inclusion and exclusion criteria were verified at the screening visit (Visit 1) and at the start of treatment / baseline visit (Visit 2).

[0523] The inclusion criteria for this study were as follows:

[0524] • Patients diagnosed with NAFLD by the presence of hepatic steatosis on imaging or histology in the absence of secondary causes.

[0525] · Patients with ALT > 1.5 ULN and < 5 ULN on two occasions with an interval of seven or more days during screening. Petition 870250099883, dated 10 / 31 / 2025, pp. 131 / 336 124 / 223

[0526] · Patients with a history of liver biopsy showing NASH and / or fibrosis > F1 or NFS > -1.455 or Fib-4 > 1.3 or Fibroscan > 8kPa in the three months prior to screening.

[0527] · Patients with a body mass index (BMI) between 25.0 and 40.0 kg / m2. Patients with a history of controlled obesity or controlled diabetes were eligible to participate in the study.

[0528] · Patients whose pre-study clinical laboratory results did not interfere with their participation in the study, in the Researcher's opinion.

[0529] · Patients aged between 18 and 75 years.

[0530] · Female patients and male patients with female partners who have the potential to become pregnant should use adequate contraceptive methods or have a sterilized partner during the study. Adequate contraception is defined as: systemic hormonal contraceptives; intrauterine device or barrier method of contraception in conjunction with spermicide; or agreeing to sexual abstinence, defined as a patient abstaining from heterosexual intercourse throughout the risk period associated with the study treatments and in accordance with her preferred and habitual lifestyle. Hormonal contraceptives should be at a stable dose for at least one month prior to baseline.

[0531] • Patients able to communicate well with the The researcher is responsible for understanding and complying with the study requirements and for understanding and signing the written informed consent.

[0532] The exclusion criteria for this study were as follows:

[0533] · Patients with an unstable metabolic condition, such as a weight change > 5% in the three months prior to inclusion.

[0534] · Patients with a medical / surgical history of gastric bypass surgery, orthotopic liver transplantation (OLT), or listed for OLT. Petition 870250099883, dated 10 / 31 / 2025, pp. 132 / 336 125 / 223

[0535] · Patients with uncontrolled type 2 diabetes mellitus, i.e., HbA1c > 9% (75 mmol / mol) at the time of screening.

[0536] · Patients with decompensated or severe liver disease, as evidenced by one or more of the following: confirmed or suspected cirrhosis, esophageal varices, ascites, suspected portal hypertension, hospitalization for liver disease in the 60 days prior to screening, bilirubin > 2 x ULN or ALT or AST > 5 x ULN. Patients with Gilbert's syndrome were eligible if conjugated bilirubin was < 1.5 x ULN.

[0537] · Patients with active inflammatory bowel disease or who require medical therapy.

[0538] · Patients with a diagnosis or suspicion of autoimmune diseases, such as systemic lupus erythematosus (SLE) and / or rheumatoid arthritis (RA).

[0539] · Patients with a history of or active malignancies unrelated to the liver, except curatively treated skin cancer (basal cell or squamous cell carcinomas).

[0540] · Patients with significant systemic disease or serious illness other than liver disease, including coronary artery disease, cerebrovascular disease, pulmonary disease, renal failure, serious psychiatric illness, respiratory or hypertensive disease, as well as diabetes and arthritis that, in the Researcher's opinion, prevent the patient from participating in and completing the study.

[0541] · Patients requiring antidiabetic treatment (including insulin sensitizing agents) and / or lipid-lowering treatment who were not on a stable dose for at least three months prior to screening were excluded. If patients were insulin-dependent, this treatment should have been initiated at least three months prior to screening; however, dose adjustments were permitted.

[0542] • Patients with known hypersensitivity to any ingredient in the study treatment.

[0543] • Patients who test positive for antibodies Petition 870250099883, dated 10 / 31 / 2025, pp. 133 / 336 Tests for 126 / 223 against human immunodeficiency virus (HIV), hepatitis B surface antigen, or antibodies against hepatitis C are performed during screening.

[0544] · Patients with liver disease of other etiologies, such as drug-induced autoimmune hepatitis, primary biliary cholangitis (PBC), primary sclerosing cholangitis (PSC), hemochromatosis, alpha-1 antitrypsin (A1AT) deficiency, or Wilson's disease.

[0545] • Patients with a significant history of drug / solvent abuse, in the Researcher's opinion.

[0546] · Patients with a history of alcohol abuse, in the Researcher's opinion, or who drink more than 21 units per week (men) or 14 units per week (women), where one unit consists of 10 ml or 8 mg of pure alcohol.

[0547] · Patients who used dietary supplements rich in omega-3 or omega-6 fatty acids in the four weeks prior to baseline.

[0548] • Patients who have participated in any other clinical study with an investigational drug in the three months prior to the first day of administration of the study treatment.

[0549] · Pregnant patients, planning to become pregnant, breastfeeding and / or who did not wish to use adequate contraceptive methods during the study.

[0550] • Patients who, in the Researcher's opinion, are not suitable to participate in the study. 4.4 CONDUCT OF THE STUDY

[0551] During the study, ten clinic visits were scheduled after the screening visit: one at the beginning of the comparative / baseline treatment period (Day 0 / Visit 2) and eight during the comparative treatment period (Week 2 / Visit 3, Week 4 / Visit 4, Week 6 / Visit 5, Week 8 / Visit 6, Week 10 / Visit 7, Week 12 / Visit 8, Week 14 / Visit 9, Week 16 / Visit 10). A final safety follow-up visit (Visit 11) was conducted four Petition 870250099883, dated 10 / 31 / 2025, pp. 134 / 336 127 / 223 weeks after Visit 10 or two weeks after the final visit attended, if the patient did not complete the study. Table 15 describes the clinical visits for the study. TABLE 15 · FLOWCHART OF CLINICAL VISITS OF STUDY Screening / Visit 1 Baseline / Visit 2 Visit 3 / Week 2 Visit 4 / Week 4 Visit 5 / Week 6 Visit 6 / Week 8 Visit 7 / Week 10 Visit 8 / Week 12 Visit 9 / Week 14 EOT / Visit 10 / Week 16 Follow-up / Visit 11 / Week 20 Study Procedure Day 28 to -1 Day 0 Day 14 Day 28 Day 42 Day 56 Day 70 Day 84 Day 98 Day 112 Day 14D Consultation.Window + / -2 days +7-2 days +7-2 days +A2 days +Λ2 days +Λ2 days +Λ2 days +- / -2 days + / -4 days Informed Consent X Inclusion Exclusion XX Demographics X Medical History XX Physical Examination XXXXXXXX 12-lead ECG XXX Plasma PK Sampling 1 XXXXXXX Vital Signs XXXXXXXX Clinical Laboratory Tests 5 XXXXXXX Profile II 3 XXX Urinalysis XX Virology X Pregnancy Test 4 XXXXXXX ALT, AST 5 XX XXXXXXX HOMA-IR / Adipo-IR XXXXXXX ELF XX Liver Stiffness and GAP XX FIB-4 XX NFS [including BMI] XX Biomarkers Blood Sample XXXX Exploratory Blood Sample XX Patient Randomization X IMP / Placebo Dispensing XXXXXXXX Study Drug / Placebo Administration X------ -X IMP Accountability Card / Diary Review XXXXXXXXX Assessment of AE X------ -X Assessment of concomitant medications X x---------- [1] Pharmacokinetics only. Sample was collected before dosing.[2] Includes biochemistry, hematology and coagulation tests. This was done in fasting (minimum of eight hours). [3] Lipid profile was obtained in fasting (minimum of eight hours). [4] Only female patients with the potential to become pregnant. [5] ALT should be evaluated on two occasions during screening, with seven or more days between each screening. Petition 870250099883, dated 10 / 31 / 2025, pp. 135 / 336 128 / 223

[0552] Screening Visit (Visit 1): After obtaining informed consent, patients received a Patent Screening Number. Ideally, the patient should be fasting. The following screening assessments / sample collections were performed: verification of inclusion / exclusion criteria; demographic data; medical history; physical examination; 12-lead electrocardiogram (ECG); vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); virology; pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests (ALT measured on two occasions during screening); and assessment of concomitant medications.Unscheduled visits occurred when a patient needed to make a visit between scheduled dates due to an adverse event (AE), difficulty in meeting the requirements of the study protocol, or a significant change in their disease status. All necessary medical procedures were followed. If eligible, before leaving the clinic, the patient was instructed not to eat breakfast before the next visit to allow for a minimum fasting period of eight hours.

[0553] Treatment Period: Following the completion of a successful screening visit, patients began the comparative treatment period (16 weeks). At the start of the comparative treatment period, after confirmation of continued eligibility, patients were randomly assigned to one of three treatment regimens. Patients took the allocated investigational drug (IMP), either one DS102 capsule or one placebo capsule, twice daily during the comparative treatment period. Each self-administration of ME was recorded on a patient diary card. Patients were instructed to take DS102 in the morning and evening with or after food (except on the mornings of clinical visits 3, 4, 6, 8, and 10, when patients were instructed not to take DS102 before the visit and to take DS102 as soon as possible after the clinical visit). At baseline (Visit 2), at Week 2 (Visit 3), at Week 4 Petition 870250099883, dated 10 / 31 / 2025, pp. 136 / 336 At visits 129 / 223 (Visit 4), Week 8 (Visit 6), Week 12 (Visit 8), Week 16 (Visit 10), and Week 20 (Visit 11), the patient was asked if they had fasted for a minimum of eight hours prior to the visit. If not, the duration of the fasting period was documented, and the patient was re-instructed on the duration of the fasting period. The patient then received a light breakfast (e.g., tea or orange juice and toast). At baseline (Visit 2), Week 8 (Visit 8), and Week 16 (Visit 10), blood sample assessment was performed before the patient received the light breakfast. Unscheduled visits occurred when a patient needed to make a visit between scheduled dates due to an adverse event (AE), difficulty in meeting the requirements of the study protocol, or a significant change in their disease status. All necessary medical procedures were followed.Patients who discontinued the study early had the study procedures scheduled for Visit 10 performed as soon as possible after patient withdrawal so that all study-related information could be recorded. At the investigator's discretion, urine DOA and breath alcohol tests were performed at any time during the study.

[0554] Baseline (Visit 2): Patients attended the research center at Visit 2. Blood collection was the first assessment performed. After blood collection, the following assessments were performed: verification of inclusion / exclusion criteria; medical history; physical examination; 12-lead eCG; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); lipid profile; urinalysis; pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; ELF; liver stiffness and CAP; FIB-4; NFS (including BMI); biomarker blood sample; exploratory blood sample; patient randomization; administration of the study drug / placebo; assessment of adverse events; and assessment of concomitant medications. If all study entry criteria are met Petition 870250099883, dated 10 / 31 / 2025, pp. 137 / 336 For patients attended (130 / 223), the Researcher randomized the patient and provided them with the assigned IMP or placebo from one of the patient treatment packages. The first dose of IMP or placebo was administered on-site as soon as all baseline assessments were completed. The patient took their second dose of IMP or placebo on the evening of Day 0. Capsules were then administered twice daily. Patients took IMP or placebo on the morning of their return visit to the site (Visit 3). Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow for a minimum fasting period of eight hours.

[0555] Week 2 (Visit 3): Patients returned to the research center on Visit 3. Patients did not take IMP or placebo on the morning of Visit 3. The following assessments were performed: physical examination; pharmacokinetic sampling; vital signs (e.g., blood pressure, heart rate, and body temperature); ALT and AST tests; HOMA-IR / Adipo-IR; AE assessment; and assessment of concomitant medications. The IMP or placebo was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsules continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, on Visit 4. Patients did not take IMP or placebo on the morning of the return visit (Visit 4).Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow for a minimum fasting period of eight hours.

[0556] Week 4 (Visit 4): Patients returned to the research center on Visit 4. Patients did not take IMP or placebo on the morning of Visit 4. The following assessments were performed: physical examination; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; assessment of adverse events; and assessment of concomitant medications. IMP or placebo was Petition 870250099883, dated 10 / 31 / 2025, pp. 138 / 336 131 / 223 was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, at Visit 5. Patients did not take IMP or placebo on the morning of the return visit (Visit 5).

[0557] Week 6 (Visit 5): Patients returned to the research center at Visit 5. The following assessments were performed: assessment of adverse events (AEs) and assessment of concomitant medications. The IMP or placebo was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, at Visit 6. Patients did not take IMP or placebo on the morning of the return visit (Visit 6). Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow for a minimum fasting period of eight hours.

[0558] Week 8 (Visit 6): Patients returned to the research center on Visit 6. Patients did not take IMP or placebo on the morning of Visit 6. Blood collection was the first assessment performed. After blood collection, the following assessments were performed: physical examination; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); lipid profile; pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; biomarker blood samples; AE assessment; and assessment of concomitant medications. The IMP or placebo was returned, and another ME or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily.After the conclusion of this visit, the... Petition 870250099883, dated 10 / 31 / 2025, pp. 139 / 336 132 / 223 patients were informed that they should return to the research center in two weeks, at Visit 7. Patients took IMP or placebo on the morning of their return visit (Visit 7).

[0559] Week 10 (Visit 7): Patients returned to the research center on Visit 7. The following assessments were performed: assessment of adverse events (AEs) and assessment of concomitant medications. The IMP or placebo was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, on Visit 8. Patients did not take IMP or placebo on the morning of the return visit (Visit 8). Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow for a minimum fasting period of eight hours.

[0560] Week 12 (Visit 8): Patients returned to the research center on Visit 8. Patients did not take IMP or placebo on the morning of Visit 8. The following assessments were performed: physical examination; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; AE assessment; and assessment of concomitant medications. The IMP or placebo was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, on Visit 9.Patients did not take IMP or placebo on the morning of their return visit to the site (Visit 9).

[0561] Week 14 (Visit 9): Patients returned to the research center on Visit 9. The following assessments were performed: assessment Petition 870250099883, dated 10 / 31 / 2025, pp. 140 / 336 133 / 223 of EA and assessment of concomitant medications. The IMP or placebo was returned, and another IMP or placebo was given to the patient. The patient took the next dose of IMP or placebo as soon as all assessments of the visit were completed. The capsule continued to be administered twice daily. After the conclusion of this visit, patients were informed that they should return to the research center in two weeks, at Visit 10. Patients should not take IMP or placebo on the morning of the return visit to the center (Visit 10). Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow a minimum fasting period of eight hours.

[0562] Week 16 (Visit 10) or Early Withdrawal: Patients returned to the research center at Visit 10. Patients did not take IMP or placebo on the morning of Visit 10. Blood collection was the first assessment performed. After blood collection, the following assessments were performed: physical examination; 12-lead eCG; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); urinalysis; lipid profile; pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; ELF; liver stiffness and CAP; FIB-4; NFS [including BMI]; blood samples for biomarkers; exploratory blood sample; AE assessment; and assessment of concomitant medications. IMP or placebo was returned.No other IMP or placebo blisters or patient diary cards were issued. Following the completion of the study assessments at this visit, there were ongoing restrictions to the study. After the completion of this visit, patients were informed that they should return to the research center in four weeks, at Visit 11, to assess any AEs since that visit and to undergo safety and efficacy assessments. Before leaving the clinic, the patient was instructed not to eat breakfast before the next appointment to allow for a minimum fasting period of eight hours.

[0563] Follow-up Visit (Week 20 / Visit 11): Four weeks after Visit 10 (or two weeks after the withdrawal visit) Petition 870250099883, dated 10 / 31 / 2025, page 141 / 336 134 / 223 anticipated), patients returned to the research site. The following assessments were performed: physical examination; pharmacokinetic sampling; vital signs (blood pressure, heart rate, and body temperature); samples for clinical laboratory safety tests (hematology, serum biochemistry, and coagulation tests); pregnancy test (for female patients with the potential to become pregnant); ALT and AST tests; HOMA-IR / Adipo-IR; biomarkers; assessment of adverse events; and assessment of concomitant medications. 4.5 EVALUATIONS

[0564] Efficacy assessments included: ALT, AST, ALT:AST ratio; HOMA-IR / Adipo-IR; ELF; liver stiffness and CAP; FIB-4 index; and NFS. A detailed description of each is provided below.

[0565] ALT, AST, ALT:AST ratio: Elevated liver enzymes (ALT and AST) are a marker of liver injury and were assessed at Visit 1 / Screening (on two occasions during screening with 7 or more days between visits), Visit 2 / Baseline, Visit 3 / Week 2, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16 and Follow-up Visit 11 / Week 20.

[0566] HOMA-IR / Adipo-IR: HOMA-IR / Adipo-IR levels are a method for measuring insulin resistance. HOMA-IR is calculated by multiplying fasting plasma insulin (FPI) by fasting plasma glucose (FPG) and then dividing by the constant 405. Adipo-IR is calculated by multiplying fasting non-esterified fatty acids (NEFA) χ fasting insulin. Blood samples were collected to assess HOMA-IR and Adipo-IR at Visit 2 / Baseline, Visit 3 / Week 2, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16, and Follow-up Visit 11 / Week 20. All individuals were required to fast for a minimum of eight hours prior to blood collection. If individuals had not fasted for a minimum of eight hours, the duration of the fast was recorded and individuals were encouraged to fast properly at their next clinical visit.

[0567] ELF: An ELF score is a set of Petition 870250099883, dated 10 / 31 / 2025, page 142 / 336 135 / 223 extracellular matrix markers consisting of tissue inhibitor of metalloproteinases 1 (TIMP-1), amino-terminal propeptide of type III procollagen (PIIINP), and hyaluronic acid (HA). Blood samples were collected to perform this assessment at baseline (Visit 2) and at Week 16 (Visit 10).

[0568] Liver stiffness and CAP: Liver stiffness and CAP were assessed using transient elastography (e.g., FibroScan® 502 Touch model or equivalent). Patients were examined fasting and at the same time of day, if possible, at baseline (Week 0) and at Visit 10 (Week 16).For this evaluation, the following conditions were met: patients were lying in the supine position with their right arm in maximum abduction behind their head, in a position similar to that used for liver biopsy (LB); the transducer tip was placed on the skin between the ribs over the right lobe of the liver (the physician took measurements with the probe placed in the intercostal space); during the FibroScan® examination, the choice of M+ or XL+ probe was determined by the Automatic Probe Selection (APS) tool (if the APS tool advised using the “XL+ probe” or continuously “alternating” between “M+ and XL+ probes”, only the XL+ probe was used); and the operator, aided by a time-motion ultrasound image, located a portion of the liver free of large vascular structures (the depth of measurement was between 35 and 75 mm for the XL+ probe and 25-65 mm for the M+ probe, and the explored volume would be 3 cm3).For each patient, the operator performed an examination that included at least 10 valid measurements or a maximum of 20 attempts, using the XL+ or M+ probe, at the same location. The complete examination did not last more than 10 to 15 minutes. The final stiffness and CAP values ​​were recorded as median values ​​of valid measurements.

[0569] FIB-4 Index: The FIB-4 index is based on age, platelet count, ALT level, and AST level and was assessed at Baseline (Visit 2) and Week 16 (Visit 10). The FIB-4 score is determined as shown in the equation below. Age (years) x AST (U / L) FIB - 4 =-------------------------------Platelet count (109 / L) x vALT (U / L) Petition 870250099883, dated 10 / 31 / 2025, pp. 143 / 336 136 / 223

[0570] NFS: The NFS is based on age, hyperglycemia, BMI, platelet count, albumin level, and AST / ALT ratio. NAFLD fibrosis score = -1.675 + 0.037 χ age (years) + 0.094 χ BMI (kg / m2) + 1.13 χ GFR / diabetes (yes = 1, no = 0) + 0.99 χ AST / ALT ratio - 0.013 χ platelets (x109 / l) - 0.66 χ albumin (g / dl). NFS was assessed at Baseline (Visit 2) and Week 16 (Visit 10).

[0571] The safety assessments included the following: Medical history; physical examination; ECG; vital signs; clinical laboratory safety tests (e.g., hematology, serum biochemistry, coagulation, lipid profile, and urinalysis); virology; pregnancy test; blood sampling; pharmacokinetic sampling; exploratory blood collection; biomarker blood collection; urine DOA and blood alcohol test; adverse event assessment; concomitant medication; bioanalysis; sample, storage, handling, and shipping; and restrictions. A detailed description of each is provided below.

[0572] Medical History: A complete review of the patient's medical history was conducted by the Researcher or a designated person at the Screening Visit (Visit 1) and Baseline Visit (Visit 2) to ensure that no exclusion criteria were met. Any concomitant disease, whether or not considered relevant to the study by the Researcher, was reported. The date of diagnosis or the duration of the condition was recorded whenever possible.

[0573] Physical Examination: A physical examination (including height and weight) was performed by the Researcher according to the study flowchart in Table 19 at Visit 1 / Screening, Visit 2 / Baseline, Visit 3 / Week 2, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16, and Follow-up Visit 11 / Week 20, in accordance with local practices. This examination was performed in its entirety at baseline and directed towards symptoms thereafter (i.e., a standard panel of body systems was not assessed unless indicated by the patient). For example, if the patient reports to the Researcher the presence of a “rash,” then the skin was assessed. No additional body systems were required to be assessed unless clinically justified. All Petition 870250099883, dated 10 / 31 / 2025, pp. 144 / 336 137 / 223 abnormal results were recorded. Changes in physical examination findings compared to baseline examination were recorded as an anomaly.

[0574] ECG: A 12-lead ECG of 10 mm / 1 mv, 25 mm / s with a 10-second rhythm band of lead II was recorded at each time point. ECGs were recorded using the GE Mac 1200 or equivalent model. Patients were at quiet rest in a fully supine position for 5 minutes before the ECG was performed. Recordings were made on the days indicated in the study flowchart in Table 19 at Visit 1 / Screening, Visit 2 / Baseline, and Visit 10 / Week 16.

[0575] Vital Signs: Vital sign measurements were performed according to the Study Flowchart in Table 19 at Visit 1 / Screening, Visit 2 / Baseline, Visit 3 / Week 2, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16, and Follow-up Visit 11 / Week 20. Vital sign measurements were performed before any blood sample was collected. All new findings or changes from previous findings considered clinically significant were recorded as an AE if the finding was made after the patient's signature. Vital sign measurements included: blood pressure taken in the supine position (e.g., after at least 5 minutes of rest), systolic and diastolic blood pressure (in mmHg); resting heart rate, in beats per minute (bpm); and temperature measured according to clinical practice.

[0576] Clinical Laboratory Safety Tests: Safety tests were performed for hematology, serum biochemistry, coagulation, lipid profile, and urinalysis: Blood and urine samples were collected according to the Study Flowchart in Table 19 for routine hematology, serum biochemistry, coagulation, and urinalysis, along with a Lipid Profile. All samples were analyzed at the central laboratory. All subjects were kept fasting for a minimum of eight hours before blood collection. If subjects had not fasted for a minimum of eight hours, the duration of fasting was recorded and subjects were encouraged to fast. Petition 870250099883, dated 10 / 31 / 2025, pp. 145 / 336 138 / 223 appropriately at the next clinical visit.

[0577] · Hematology: Complete blood count to include red blood cell count, hemoglobin, hematocrit, white blood cell count, differential white blood cell count, platelet count and reticulocyte count.

[0578] · Serum biochemistry: Urea (blood urea nitrogen); BUN), creatinine, uric acid, total bilirubin, indirect and direct bilirubin, sodium, potassium bicarbonate, phosphorus, calcium chloride, alkaline phosphatase (ALP), aspartate aminotransferase (AST), alanine aminotransferase (ALT), ALT / AST ratio, lactate dehydrogenase (LDH), creatine phosphokinase (CPK), albumin, total protein, cholesterol, triglycerides, glucose, C-reactive protein (CRP).

[0579] · Coagulation: prothrombin time (PT), international normalized ratio (INR) and activated partial prothrombin time (APTT).

[0580] · Lipid Profile: LDL, HDL and VLDL-C.

[0581] · Urine analysis: pH, protein, glucose, blood, ketones, leukocytes, leukocyte esterase, bilirubin, specific gravity, urobilinogen and nitrate. Microreflex if blood, protein, leukocyte esterase or nitrate / nitrite are present.

[0582] Virology: A blood sample was collected for virological testing, including HIV, hepatitis C, and hepatitis B, as detailed in the study flowchart in Table 19.

[0583] Pregnancy Test: For female patients with the potential to become pregnant, a pregnancy test was performed according to the Study Flowchart in Table 19 at Visit 1 / Screening, Visit 2 / Baseline, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16 and Visit 11 / Week 20.

[0584] Blood Collection: Blood samples were obtained and laboratory results were reviewed for clinically significant values ​​by each Researcher after sample analysis and verification. Additional blood may have been required for repeat laboratory tests. Petition 870250099883, dated 10 / 31 / 2025, pp. 146 / 336 139 / 223 security.

[0585] Pharmacokinetic (PK) Sampling: Blood samples for PK analysis were collected by direct venipuncture, according to the study flowchart in Table 19, at Visit 2 / Baseline, Visit 3 / Week 2, Visit 4 / Week 4, Visit 6 / Week 8, Visit 8 / Week 12, Visit 10 / Week 16, and Follow-up Visit 11 / Week 20. A 1 ml blood sample was collected at each time point. After centrifugation, plasma samples were split in two, and a reserve sample was kept at the central laboratory until bioanalytical assays were completed.

[0586] Exploratory Blood Collection: Blood was collected according to the Study Flowchart in Table 19 at baseline (Week 0) and at Visit 10 / Week 16 and stored for possible genetic matrix analysis or further exploratory testing at a later date.

[0587] Blood Collection for Biomarkers: Blood was collected according to the Study Flowchart in Table 19 at baseline (Week 0), Visit 6 / Week 8, Visit 10 / Week 16 and Follow-up Visit 11 / Week 20 and was stored for potential biomarker analysis.

[0588] Urine DOA and Blood Alcohol Test: As clinically appropriate, at the Researcher's discretion, a breath alcohol test was performed and a urine sample was collected from patients at any time during the conduct of the study and the test was done to detect the following: amphetamine, barbiturate, benzodiazepine, cocaine, cannabinoids and opiates.

[0589] Concomitant Medication: Patients were on a stable dose of any concomitant medication for at least three months prior to screening, and this dose should have remained stable throughout the duration of the study. If patients were insulin-dependent, this treatment should have been initiated at least three months prior to screening; however, dose adjustments were permitted.

[0590] Restrictions: The study includes restrictions on diet, alcohol, caffeine, and physical activity. Regarding diet, patients avoided consuming Petition 870250099883, dated 10 / 31 / 2025, pp. 147 / 336 140 / 223 dietary supplements rich in omega-3 or omega-6 fatty acids were avoided during the study and in the four weeks prior to baseline (e.g., cod liver oil capsules). Regarding alcohol, patients avoided consuming more than 21 units per week (men) or 14 units per week (women), where one unit consists of 10 ml or 8 mg of pure alcohol. There were no restrictions on caffeine before or during the study. For physical activity, patients were to avoid strenuous exercise and physical activity for at least three to four hours before safety laboratory testing (e.g., biochemistry). 4.6 Drug Investigation

[0591] DS102 capsules were white, opaque, hard-shell capsules (size 0) containing 500 mg of 15-HEPE ethyl ester (EE) with 5% w / w colloidal silicon dioxide as a viscosity modifier.

[0592] The DS102 placebo (paraffin oil) was a white, opaque, hard-shelled capsule (size 0) containing an equivalent weight of liquid paraffin filling with 1% w / w colloidal silicon dioxide as a viscosity modifier.

[0593] DS102 and Placebo capsules were stored between 2 and 8 °C in a secure area (e.g., a locked cabinet or drug storage room), protected against unintentional use. The labels were dose-blind and contained the randomization number.

[0594] Dosage and Administration: This study involved a comparison of DS102 with placebo, administered orally twice daily for a total period of 16 weeks. The last administration of the study drug occurred the day before the Week 16 / Early Termination Visit (ET). Patients were to take the capsules with or after food. Medications for other conditions permitted in the study were taken as usual. The blister packs consisted of 7 days of 4 capsules, and ultimately, patients took the assigned medication for 16 consecutive weeks. Petition 870250099883, dated 10 / 31 / 2025, pp. 148 / 336 141 / 223 4.7 ADVERSE EVENTS AND SERIOUS ADVERSE EVENTS

[0595] The adverse events (AEs), serious adverse events (SAEs) and unexpected adverse events (UAEs) of this study were defined as follows.

[0596] AE: Any undesirable experience that occurs with a patient who has taken the first dose of the study drug, regardless of whether or not it is considered related to the investigational ME(s). AEs were recorded on the case report form, defining the relationship to the ME and the severity.

[0597] SAE: If a patient experienced a serious adverse event after the first dose of the study drug, the event was recorded as an SAE. An SAE is characterized as an unfavorable medical occurrence at any dose, including any of the following: results in death, is life-threatening, requires hospitalization or prolongation of existing hospitalization, or results in persistent or significant disability / incapacity. The term “life-threatening” refers to an event in which the patient was at risk of death at the time of the event. It does not refer to an event that, hypothetically, could have caused death if it were more severe. Examples of important but non-life-threatening events included intensive treatment in an emergency department, allergic bronchospasm, blood dyscrasias or seizures that did not result in hospitalization, or the development of drug dependence or abuse.

[0598] UAE: An experience not previously reported in the Researcher's Brochure or in a similar product information sheet, such as the Summary of Product Characteristics (SPC).

[0599] The intensity of an AE is an estimate of the relative severity of the event made by the Researcher based on their clinical experience. The following definitions were used to classify the severity of an AE:

[0600] · Mild: The adverse event was transient and easily tolerated.

[0601] · Moderate: The adverse event caused discomfort Petition 870250099883, dated 10 / 31 / 2025, pp. 149 / 336 142 / 223 to the patient and interrupted their usual activities.

[0602] · Serious: The adverse event caused considerable interference with the patient's usual activities and may have been disabling or life-threatening.

[0603] The causality of the adverse event to the experimental treatment was also established taking into account the patient's history, the findings of the most recent physical examination, and concomitant medications. The following definitions were used to determine the causality of an adverse event:

[0604] · Unrelated: the temporal relationship of the beginning of Regarding the experimental treatment, the adverse event (EA) was not reasonable, or another cause could explain its occurrence.

[0605] · Related: the temporal relationship of the onset of EA, in relation to the experimental treatment, was reasonable, followed a known pattern of response to treatment, and an alternative cause was unlikely.

[0606] All AEs were reported throughout the duration of the study up to and including the follow-up period. 4.8 Drug-Induced Liver Injury

[0607] Drug-induced severe liver injury (DILI): Regardless of the perceived cause, in the case of severe DILI, the investigational drug was discontinued until the episode was considered resolved. If the investigational drug was found to be the cause of the liver injury, the patient was not challenged again with the drug. Severe DILI stipulates evidence of liver impairment, as demonstrated by a total bilirubin >2*ULN or INR >1.5.

[0608] Patients with abnormal baseline liver biochemistry: When determining abnormal baseline liver biochemistry, a one-time increase relative to baseline levels was calculated, rather than using the ULN. Thus, a baseline ALT or AST value of 3* (or >200 IU / L) was followed by repeat testing at 72 hours to confirm / determine whether the biochemical changes were improving or worsening. Information on adverse events was collected along with... Petition 870250099883, dated 10 / 31 / 2025, page 150 / 336 143 / 223 A complete physical examination was performed. An examination for hepatic etiology and / or other appropriate tests were carried out. In the case of hepatic dysfunction, the patient was treated as having severe DILI. Discontinuation of drug treatment was considered if any of the criteria for severe DILI occurred. 4.9 SERIOUS ADVERSE REACTIONS AND UNEXPECTED ADVERSE REACTIONS

[0609] Adverse Reaction: All harmful and unintended responses to a drug related to any dose were considered adverse drug reactions. The phrase “responses to a drug” means that a causal relationship between a drug and an AE was at least a reasonable possibility (i.e., the relationship cannot be ruled out). For marketed medicinal products, an adverse reaction is a response to a drug that is harmful and unintended, and that occurs at doses normally used in humans for prophylaxis, diagnosis or therapy of diseases or for modification of physiological function.

[0610] Unexpected Adverse Reaction: An unexpected adverse drug reaction is an adverse reaction whose nature or severity is not consistent with the applicable product information.

[0611] Suspected Unexpected Serious Adverse Reaction (SUSAR): Any serious adverse reaction that may have been related to IMP and that was unexpected according to the definition above. 4.10 STATISTICAL METHODOLOGY AND DATA MANAGEMENT

[0612] This clinical study employed a randomized, double-blind, placebo-controlled parallel-group design. Randomization was used to minimize attribution bias and to increase the likelihood that known and unknown patient attributes (e.g., demographic characteristics) would be evenly balanced between treatment groups. Blinding was used to reduce potential bias during data collection and safety and efficacy assessment. The use of placebo as a comparator was Petition 870250099883, dated 10 / 31 / 2025, pp. 151 / 336 144 / 223 justified as a reasonable design to evaluate safety and efficacy in patients based on the brevity of the study duration and the absence of any possible long-term irreversible harm that may have resulted from placebo treatment.

[0613] Sample Size Estimate: Assuming a 20% delta in the response percentage between the active drug and placebo arms, a 25% standard deviation, and a 20% dropout rate, this resulted in a need for 32 patients per group for a statistical test with a significance level of 5% and a power of 80%. The sample size was re-estimated in a provisional analysis based on the recommendation of an unblinded study. The sample size could have been increased to a maximum of 150 patients in total to achieve a conditional power of 80% for the primary outcome.

[0614] Instructions for Blinding and Code Breaking: All study site personnel, as well as personnel involved in monitoring or conducting the study, were unaware of each patient's treatment assignments. Randomization details were kept strictly confidential, accessible only in emergencies to authorized personnel, until the formal removal of blinding. The study's blind code was broken only after all patient data had been recorded and verified and the database was locked.

[0615] Interim Analysis and Data Monitoring: The safety of the interim analysis was performed to estimate conditional power when at least 50% of patients completed the Week 16 visit. The interim analysis was based on data collected for the primary and co-primary efficacy endpoints, as well as for the secondary endpoints, and was used to estimate the conditional power to meet the primary objective of the study, to potentially re-estimate the sample size, and to potentially drop the less effective treatment arm.

[0616] Clinically Significant Response: A mean or median reduction of at least 20% in ALT or liver stiffness in Petition 870250099883, dated 10 / 31 / 2025, page 152 / 336 145 / 223 compared to placebo and a mean or median reduction of at least 10% greater in ALT and liver stiffness compared to placebo.

[0617] The analysis sets included the registered set, the complete analysis set (FAS), the per-protocol set (PPS), the safety analysis set (SAS), and the pharmacokinetic set (PK). A detailed description of each analysis set is provided below.

[0618] Enrolled Population: Patients who signed the informed consent form. Screening failures were patients from the Enrolled Population who did not meet the eligibility requirements and were removed from the study before randomization.

[0619] FAS: Randomized patients who received at least one administration of the study treatment and had at least one post-baseline measurement. Patients were analyzed according to the treatment they were assigned at randomization, regardless of the treatment they actually received.

[0620] PPS: A subset of the FAS consisting of FAS patients who did not have major protocol violations. All protocol deviations were assessed and documented on a case-by-case basis before database lockout, and major deviations deemed to have a serious impact on efficacy outcomes led to the exclusion of the patient in question from the PPS.

[0621] SAS: Patients who received at least one administration of the study treatment. Patients were analyzed according to the treatment actually received.

[0622] PK Set: Patients in the SAS who had at least one DS102 PK concentration. Patients were analyzed according to the treatment actually received.

[0623] Safety Analysis: Demographic data, medical history, and physical examination were listed for each patient and summarized descriptively. All AEs recorded during the study were coded for system organ class and preferred terms using the current version of Petition 870250099883, dated 10 / 31 / 2025, pp. 153 / 336 146 / 223 Medical Dictionary for Regulatory Activities (MedDRA). Adverse events (AEs) were tabulated and summarized by treatment, relationship to treatment, severity, and severity. Clinical laboratory values ​​(e.g., hematology, biochemistry, and urinalysis) were listed for each patient by treatment and day. Values ​​outside the normal ranges of the laboratory were listed separately with associated comments regarding their clinical significance, with potentially clinically significant abnormalities highlighted and summarized by treatment. Clinical laboratory values ​​obtained before dosing were defined as reference values. Breath alcohol test and DOA test results were listed for each patient. Individual vital sign values ​​were listed and summarized descriptively for each treatment and day.12-lead ECG assessments were listed for each patient with all associated comments and summarized by treatment and day. Concomitant medications (if any), categorized by drug group and subgroup according to the most recent version of the World Health Organization's drug dictionary, were listed and summarized by treatment. In general, appropriate descriptive statistics were applied according to the nature of the variable. Categorical variables were presented using counts and percentages, while continuous variables were presented using mean, standard deviation, median, minimum, maximum, coefficient of variation, and number of patients.

[0624] Pharmacokinetic Analysis: Plasma concentrations of 15(S)-HEPE were tabulated and summarized descriptively. Individual and mean plasma concentration-time profiles of 15(S)-HEPE were presented graphically.

[0625] Primary Variables: The primary efficacy variable was the change from baseline in serum ALT at Week 16 (Visit 10). Active treatment groups were compared to placebo using an analysis of covariance (ANCOVA) model, including the corresponding baseline value as a covariate. Comparisons with placebo were made according to Dunnett's multiple test procedure. For missing Week 16 values, Petition 870250099883, dated 10 / 31 / 2025, page 154 / 336 147 / 223 the last available value was carried forward (LOCF). Similar methods were applied to liver stiffness. For ALT, longitudinal modeling was also considered.

[0626] Secondary variables: Secondary efficacy variables and their changes from baseline to Week 16 (Visit 10) were summarized with descriptive statistics by treatment group and visit. This applies to AST, AST:ALT ratio, liver fat measured by CAP, liver stiffness measures by transient elastography, FIB-4, NFS, ELF, and HOMA-IR / Adipo-IR. The change from baseline for the active treatment groups was compared to placebo using an ANOVA model, including a term for center effects. A significance level of 5% was used for all treatment comparisons.

[0627] Exploratory Analysis: The exploratory analysis included the analysis of lipid and metabolic parameters, including total cholesterol, triglycerides, very low-density lipoprotein cholesterol (VLDL-C), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), non-high-density lipoprotein cholesterol (non-HDL-C), remnant particle cholesterol (RLP-C), fasting glucose, insulin, free fatty acids, and hemoglobin A1C (HbA1C). Additional exploratory analysis included high-throughput lipidomics and proteomics. 4.11 Results

[0628] This study demonstrated that patients diagnosed with NAFLD who received DS102 at a dose of 1 g or 2 g per day showed a statistically significant reduction in markers of metabolic overload and an improvement in insulin sensitivity and glycemic control.

[0629] Figure 20 shows that the three treatment groups were well balanced at baseline and had similar lipidomic and metabolomic profiles. Baseline patient characteristics are shown in Table 16, where 10% to 13% of patients were on therapy with Petition 870250099883, dated 10 / 31 / 2025, pp. 155 / 336 148 / 223 statin at baseline. TABLE 16. BASELINE CHARACTERISTICS OF INDIVIDUALS DS102 at 2 g (n = 31) DS102 at 1 g (n = 32) Placebo (n = 30) Age, median, years 47.0 53.5 50.0 Sex, % Female 32.3 37.5 30.0 Male 67.7 62.5 70.0 Race, % White 100.00 93.75 90.00 Other 0.00 6.25 10.00 BMI, median, kg / m2 30.9 33.5 33.9 Statin Use, % 9.7 12.5 13.3 Fasting plasma glucose, mean, mg / dL 119.1 110.9 120.3 Hemoglobin A1C (%), mean 6.3 6.2 6.2 ALT, median, IU / L 74.0 70.5 96.5 Liver stiffness, median, kPa 7.9 8.2 8.4 HOMA-IR, median 4.4 5.1 5.0 Triglycerides, median, mg / dL 242.0 146.0 150.0

[0630] Figures 21A to 21C show the changes in insulin, glucose, and free fatty acid levels from baseline to Week 16 in patients who received DS102 at 1 g or 2 g per day compared to placebo. The reduction in insulin, glucose, and free fatty acid levels after DS102 administration is clinically significant, as metabolic substrates, including glucose, carbohydrates, and free fatty acids, drive the pathogenesis of NASH.

[0631] Figures 22A and 22B show the changes in Petition 870250099883, dated 10 / 31 / 2025, pp. 156 / 336 149 / 223 HOMA-IR and adipo-IR levels from baseline to Week 16 in patients receiving DS102 at 1 g or 2 g per day compared to placebo. Patients showed an improvement in both insulin resistance indices (e.g., a reduction in HOMA-IR and adipo-IR levels) at Week 16, with significant improvements in Set Per Protocol (PPS) observed in patients receiving 2 g of DS102.

[0632] Figures 23A and 23B show the changes in glycosylated hemoglobin (e.g., HbA1c) levels from baseline to Week 16 in patients who received DS012 at 1 g or 2 g per day compared to a placebo. Specifically, Figure 23A shows the change in HbA1c levels and Figure 23B shows the change in HbA1c levels in the proportion of patients who had high HbA1c levels at baseline but achieved normal levels at Week 16. Since HbA1c is a measure of the amount of glucose bound to the body's red blood cells and a proxy for long-term glycemic control, these results indicate that DS102 administration provides clinically significant improvements and normalizes glycemic control in a dose-dependent manner.

[0633] Figures 24A and 24B show the mean and median change (%) in patient lipid profile at Week 16 in the safety analysis ensemble (SAS). These results are described in Figures 25A to 25C and illustrate that DS102 administration significantly improved patients' lipid profile, maintaining or reducing total cholesterol, VLDL-C, non-HDL cholesterol, remnant particulate cholesterol (RPC), and triglyceride levels in patients. Significantly, the reductions did not plateau at Week 16, suggesting that DS102 administration could induce even greater changes in longer-duration studies.

[0634] As shown in Figure 26, DS102 administration also reverses the hepatotoxic lipid signature of NASH and improves several classes of lipids that are altered in patients diagnosed with NASH. Specifically, administration of 2 g of DS102 significantly decreased the Petition 870250099883, dated 10 / 31 / 2025, pp. 157 / 336 150 / 223 levels of various hepatotoxic diglycerides and significantly increased levels of several glycerophospholipid groups. This finding is important because patients with NASH have low levels of hepatic and plasma glycerophospholipids.

[0635] Figure 27 shows that DS102 administration also resolved NASH based on validated diagnostic tests, such as the OWL Liver Care non-invasive diagnostic test for NASH. OWL Liver Care is a test that was developed based on plasma lipidomics in patients with biopsy-confirmed NASH and provides high predictive values. OWL Liver Care has an area under the curve (AUC) of 0.88 to distinguish patients with NAFLD and normal liver and an AUC of 0.79 to distinguish patients with NAFLD without steatohepatitis and NASH. DS102 administration significantly improved and normalized OWL Liver Care scores diagnosed with NASH in a dose-dependent manner compared to placebo at Week 16. Table 17 shows baseline test diagnoses for each treatment group and demonstrates that most patients were classified as NASH or NAFLD at baseline, with a smaller percentage of patients in the 2 g DS102 group. TABLE 17. OWL TEST DIAGNOSES IN THE LINE OF BASE Arm Diagnostic Baseline Change in Diagnosis (Week 16 versus baseline) Improvement Stable Worsening Placebo NASH 16 1 15 - Steatosis 7 1 4 2 Without NAFLD 3 - 1** 2 DS102a 1 g NASH 19 5 14 - Steatosis 5 - 2 3 Without NAFLD 4 - 3 1 DS102a 2 g NASH 12 5 7 - Steatosis 14 1 9 4 Petition 870250099883, dated 10 / 31 / 2025, pp. 158 / 336 151 / 223 Without NAFLD 3* - 2*, ** 1

[0636] DS102 administration also reduced liver fat content, as assessed by CAP in patients diagnosed with NAFLD, as shown in Figure 28. Furthermore, DS102 is expected to induce greater changes in liver fat content in longer-term studies and when assessed by more sensitive methods.

[0637] Administration of DS102 also reduced triglyceride levels in patients, as shown in Table 18, and therefore it is contemplated that DS102 would also be effective in reducing cardiovascular risk. TABLE 18. CHANGES IN LEVELS OF Triglycerides of patients who received DS102 in week 16 DS102 (2 g) Triglycerides (placebo-corrected mean percent change from baseline) Complete Analysis -40.2 Subgroup: Triglycerides > Upper Limit of Normal (> 150 mg / dL) -39.0 Subgroup: Elevated Triglycerides (> 200 mg / dL) -20.4

[0638] Figures 29A to 29C show that DS102 administration decreases inflammatory and pro-fibrotic proteins. For this assessment, blood samples before and after treatment with DS102 were analyzed for a panel of over 350 different protein biomarkers. Treatment with 2 g of DS102 significantly reduced the expression of over 150 markers associated with inflammation, fibrosis, lipid metabolism, apoptosis, and chemotaxis. Resolution of metabolic overload and lipotoxicity was observed after treatment with DS102, which prevents subsequent cellular stress, inflammation, and fibrosis. The reduction in inflammatory and pro-fibrotic proteins suggests the Petition 870250099883, dated 10 / 31 / 2025, pp. 159 / 336 152 / 223 potential of DS102 to provide resolution of NASH and prevention of fibrosis.

[0639] Administration of DS102 also decreased the expression of several NASH development targets, as shown in Figure 30. In particular, administration of 2 g of DS102 decreased drug development targets for NASH to include CCR2 / 5 signaling (Cenicriviroc - Allergan), Galectin3 (GR-MD-02 - Galectin) and AOC3 (Boehringer Ingelheim).

[0640] The volcano plot in Figure 31 (data with Bonferroni and Benjamini-Hochberg tests) shows that administration of 2 g of DS102 decreased inflammatory and pro-fibrotic proteins based on changes in protein expression. Table 19 shows the most significant reductions in inflammatory and pro-fibrotic proteins based on the Bonferroni test. TABLE 19. SIGNIFICANT PROTEINS BASED ON Bonferroni test Protein Description PAI-1 TGF-β-induced protein, increased in metabolic syndrome, atherosclerosis, fibrosis TIMP-1 Pro-fibrotic DPP4 T cell activation, DPP4 inhibition increases GLP-1 TLT2 Increases T cell activation and elimination of apoptotic cells CCL16 Chemokine that binds to CCR 1,2,5,8. Cenicriviroc (Allergan) is a CCR2 / 5 antagonist MCP-1 (CCL2) Chemokine that binds to CCR 2, 4. Cenicriviroc (Allergan) is a CCR2 / 5 antagonist. Increase in NASH, atherosclerosis, etc. SAA4 Apolipoprotein PI3 / Elafin Graft-versus-host disease TR Iron homeostasis LILRB1 Receptor for MHC class I antigens TNRSF11A Interaction between T cells and dendritic cells Petition 870250099883, dated 10 / 31 / 2025, pp. 160 / 336 153 / 223

[0641] Administration of 1 g of DS102 also showed significant reductions for TR. Table 20 shows the most significant reductions in inflammatory and pro-fibrotic proteins based on an analysis with a linear model. TABLE 20. SIGNIFICANT PROTEINS BASED ON LINEAR MODEL Protein Description TLT2 Increases T cell activation and elimination of apoptotic cells AOC3 Impairs glucose homeostasis. Increased NASH, atherosclerosis. PRSS2 Expressed in the pancreas, involved in cell adhesion

[0642] This analysis also indicated that 1 protein in the DS107 group out of 1 protein in the Placebo group exceeded the first limit based on the Benjamini-Hochberg test.

[0643] DS102 administration also decreased the expression of several vascular adhesion molecules, as shown in Figure 32. Vascular adhesion molecules are involved in atherosclerosis and their circulating levels are associated with cardiovascular risk.

[0644] DS102 administration also reduced the expression of several proteins associated with increased cardiovascular risk, as shown in Figure 33.

[0645] DS102 administration also decreased the expression of several circulating chemokines, as shown in Figure 34. Chemokines are important drivers of chronic inflammation in atherosclerosis.

[0646] DS102 administration also decreased the expression of several members of the tumor necrosis factor receptor superfamily, as shown in Figure 35. Members of the receptor superfamily Petition 870250099883, dated 10 / 31 / 2025, page 161 / 336 Tumor necrosis factor 154 / 223 are involved in inflammation and atherosclerosis.

[0647] DS102 also proved to be safe and well tolerated, with no observed differences in safety and tolerability compared to placebo. There were no serious adverse events (SAEs) related to the drug and a low incidence of adverse events (AEs), which was consistent across all treatment groups. Most AEs were mild to moderate, as well as transient, and no patient experienced AEs that led to treatment discontinuation. The safety profile in each treatment group is shown in Table 21. TABLE 21. SECURITY PROFILE FOR GROUPS OF STUDY Patients, n (%) DS102 at 2 g (n=30) DS102 at 1 g (n = 32) Placebo (N=31) > 1 AE 15 (50.0) 19 (59.4) 17 (54.8) > 1 AE related to the study drug 3 (10.0) 2 (6.3) 4 (12.9) > 1 SAE 1 (3.3) 0 1 (3.2) AEs that led to treatment interruption 0 0 1 (3.2) SAEs related to the study drug 0 0 0 Death 0 0 0

[0648] DS102 was also evaluated for potential efficacy in improving related indications, primary biliary cirrhosis (PBC) and primary sclerosing cholangitis (PSC), as shown in Figures 36A and 36B. Importantly, administration of 2 g of DS102 reduced alkaline phosphate (ALP) as well as several markers of hepatic fibrosis, suggesting that DS102 will also be effective in the treatment of PBC and PSC.

[0649] Figure 37 is a boxplot of the minimum relative plasma concentrations of 15-HEPE ethyl ester (EE), indicating that there was a higher systemic exposure in the DS102 treatment group in Petition 870250099883, dated 10 / 31 / 2025, page 162 / 336 155 / 223 Weeks 8 and 16, as expected. 4.12 SUMMARY

[0650] In general, these results indicate that DS102 targets multiple stages of NASH pathology, significantly reducing metabolic burden and improving insulin sensitivity. DS102 administration also improved patients' lipid profiles, reversing the lipid accumulation levels associated with NASH. Specifically, patients who received DS102 showed a reduction in the accumulation of hepatotoxic lipid levels, including total cholesterol, non-HDL cholesterol, RLP cholesterol, triglycerides, diglycerides, and VLDL-C, as well as an increase in glycerophospholipid levels. These effects are significant because patients diagnosed with NASH are characterized by elevated levels of total cholesterol, triglycerides, diglycerides, and VLDL-C, and low levels of glycerophospholipids and omega-3 PUFAs.Furthermore, changes in various lipids are expected to lead to a reduction in cardiovascular risk and improvement in several aspects of metabolic syndrome.

[0651] The results also suggested that there is a dose-dependent effect in favor of administering 2 g or more of DS102, with large and statistically significant improvements compared to placebo.

[0652] In conclusion, DS102 is suitable as monotherapy or as part of a combination therapy for the treatment of NASH and is expected to reduce cardiovascular risk, including in patients diagnosed with NASH or cardiometabolic diseases, including metabolic syndrome. EXAMPLE 5: A 26-WEEK TOXICITY STUDY OF 15(S)-HEPE EE BY ORAL GAVAGE IN RATS WITH A FOUR-WEEK RECOVERY PERIOD

[0653] The objectives of this study were to determine (1) the potential toxicity of 15(S)-HEPE EE, an omega-3 fatty acid used in the treatment of liver and lung diseases, when administered by oral gavage for 26 weeks in rats and to assess the potential reversibility of any findings; and Petition 870250099883, dated 10 / 31 / 2025, pp. 163 / 336 156 / 223 (2) the toxicokinetic characteristics of 15(S)-HEPE EE. 5.1 STUDY DESIGN

[0654] Test and control items were administered to appropriate animals by oral gavage once daily, seven days a week, for a minimum of 26 weeks. The volume for each animal was based on the most recent body weight measurements. Doses were administered using a syringe with an attached gavage cannula. The first day of dosing was designated as Day 1. Dosing formulations were removed from the refrigerator and shaken for at least 30 minutes before dosing. Dosing formulations were also shaken continuously during dosing.

[0655] Due to the appearance of clinical signs, including stooped posture, bristled coat, abnormal gait, and body weight loss, animals 3206M, 3515F, and 3703F received a dose suspension starting on Day 45, and the remaining animals in Group 3 received a dose suspension starting on Day 48. Animals will begin dosing at the lowest dose level (3000 mg / kg / day) starting on Day 64. The following tables illustrate the treatments (Table 22) and animal groups (Table 23) that were used in the study. TABLE 22 · TREATMENT CHART Group Number Treatment Dose Level (mg / kg) Dose Volume (mg / kg) Dose Concentration (mg / ml) Adjusted Dose Concentration (mg / ml) Number of Animals Main Study Recovery Toxicokinetics MFMFMF 1 Control 0 10 0 0 15 15 5 5 3 3 2 15(S)- HEPE EE 2,000 10 200 206^204° 15 15 5 5 9 9 3 15(S)- HEPE EE 6,000a 10 600 618h 15 15 5 5 9 9 3 15(S)- HEPE EE 3,000a 10 300 309b / 306ü 15 15 5 5 9 9 1Due to the appearance of clinical signs, including stooped posture, ruffled coat, abnormal gait, and body weight loss, the animals were given a dosing rest period starting on Day 48. The animals will begin dosing at the lowest dose level (3,000 mg / kg / day) starting on Day 64.bConcentration adjusted for batches 2540M-1801 and 2540M-1302. Concentration adjusted for batches 2540M / 1901 and 2540M / 1902. TABLE 23 · ANIMAL GROUPINGS Petition 870250099883, dated 10 / 31 / 2025, page 164 / 336 157 / 223 Group No. Number of Animals Main Study Recovery Toxicokinetics Males Females Males Females Males Females 1 1001-1015 1501-1515 1101-1105 1601-1605 1201-1203 1701-1703 2 2001-2015 2501-2515 2101-2105 2601-2605 2201-2209 2701-2709 3 3001-3015 3501-3515 3101-3105 3601-3605 3201-3209 3701-3709 The spare animals will be numbered 4001M, 4002M and 4501F, 4502F.

[0656] Recovery Period: After completion of the dosing period, animals designated for recovery were kept for a minimum recovery period of four weeks.

[0657] Rationale for Route and Dosage Levels: The oral route of administration was selected for this study because this is the intended route for human dosing. A previous 26-week oral toxicity study in rats, administered once daily, showed no adverse effects at the highest dose tested (1 mg / kg / day). See Warren, H (2017). A 26-Week Study of 15(S)-HEPE EE by Oral (Gavage) in Rats with a 4-Week Recovery Period. Charles River Study No. 529123. As no dose-limiting toxicity was observed in this study, an additional 28-day dose-ranging study determined a maximum tolerated oral dose (MTD) of 6 g / kg / day. See Murie, E (ongoing). A Pilot 28-Day Study of DS102 by Oral Gavage in Rats. Charles River Study No. 506611. This current study was conducted to evaluate the chronic toxicity potential of 15(S)-HEPE EE (DS102) in this MTD to meet ICH M3 (R2). See ICH Harmonised Tripartite Guideline M3 (R2).Nonclinical Safety Studies for the Conduct of Human Clinical Trials and Marketing Authorization for Pharmaceuticals. 5.2 PROCEDURES, OBSERVATIONS AND MEASUREMENTS IN LIFE

[0658] Procedures, observations, and measurements were performed on all animals in the main and recovery studies. Toxicokinetic animals were weighed and clinical observations were recorded in Petition 870250099883, dated 10 / 31 / 2025, pp. 165 / 336 158 / 223 same time points as the animals in the main study.

[0659] Mortality / moribundity controls were performed daily. The animals were observed for general health / mortality and moribundity. The animals were not removed from the cage during observation unless necessary for identification or confirmation of possible findings.

[0660] Observations in the cage were made daily. The animals were not removed from their cages during the observation, except for identification or confirmation of possible findings.

[0661] Detailed clinical observations were made weekly. The animals were removed from the cage to be examined.

[0662] Post-dose observations were made regularly throughout the day. All animals were examined for reaction to treatment. The onset, intensity, and duration of these signs were recorded; special attention was given to animals during and in the first hour after dosing.

[0663] Body weight measurements were taken twice during the pre-treatment period; once daily during the dosing period; and twice weekly during the recovery period. Animals were weighed individually. Weight was recorded on the first day of the scheduled necropsy (for primary and recovery animals only).

[0664] Food consumption was measured quantitatively on a weekly basis, starting in week 1 through the dosing and recovery periods.

[0665] Water consumption was monitored regularly throughout the study by means of visual inspection of the water bottles.

[0666] Ophthalmological examinations were performed with an indirect ophthalmoscope after application of a mydriatic agent (Tropicamide 1%, Mydriacy). During pre-treatment, all animals in the main and recovery studies were examined. During weeks 13 and 26, the main study animals (control and high dose) were examined. During week 30, all animals in recovery were examined. Petition 870250099883, dated 10 / 31 / 2025, pp. 166 / 336 159 / 223 5.3 LABORATORY ASSESSMENTS

[0667] Sample Collection: Blood was collected from the tail vein, unless immediately before necropsy, in which case blood was collected from the orbital sinus under non-recoverable isoflurane anesthesia. Blood was collected in ascending order of animals, unless samples were collected before necropsy, in which case the order of euthanasia was followed. Additional blood samples were obtained (e.g., due to coagulation of non-serum samples) if the permitted sampling frequency and blood volume were not exceeded. After collection, samples were transferred to the appropriate laboratory for processing. Samples were collected according to the following table. TABLE 24. SAMPLES FOR PATHOLOGY EVALUATION CLINIC Group No. Time Point Hematology Coagulation Chemistry Clinical Urinalysis Main Study and Recovery Animals Week 26 - - - X Recovery Day 183 XXX - Main Study Immediately Before Necropsy XXX - Recovery Animals Week 30 - - - X Immediately Before Necropsy XXX - Unplanned Euthanasia (when possible) Before Euthanasia XXX - X = sample to be collected; - = not applicable.

[0668] Hematology: A 0.5 ml blood sample was Petition 870250099883, dated 10 / 31 / 2025, page 167 / 336 160 / 223 collected using the anticoagulant K2EDTA. Blood smears were labeled, stained, and stored. Blood smears were analyzed according to the following parameters. TABLE 25. HEMATOLOGICAL PARAMETERS Red blood cell count Hemoglobin concentration Hematocrit Mean corpuscular volume White blood cell count Neutrophil count (absolute) Lymphocyte count (absolute) Monocyte count (absolute) Red blood cell distribution width Eosinophil count (absolute) Basophil count (absolute) Mean corpuscular hemoglobin concentration Large unstained cells Mean corpuscular hemoglobin Reticulocyte count (absolute) Platelet count (absolute)

[0669] Coagulation: A 0.5 ml blood sample was collected using 3.8% (w / v) trisodium citrate antico...

Claims

1. A method of treating and / or preventing a hematological disorder in an individual who needs it, characterized by the fact that it comprises administering to the individual a composition comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof.

2. Method according to claim 1, characterized in that the hematological disorder is selected from the group consisting of a red blood cell disorder, a hemoglobin disorder, a hemorrhagic disorder, and a blood cancer.

3. Method, according to claim 2, characterized in that the red blood cell disorder is selected from the group consisting of anemia, hemolytic anemia, iron deficiency anemia, hereditary spherocytosis, chronic hemolysis, pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase (G6PD) deficiency.

4. Method according to claim 2, characterized in that the hemoglobin disorder is selected from the group consisting of sickle cell disease, alpha thalassemia and beta thalassemia.

5. Method, according to claim 2, characterized in that the bleeding disorder is selected from the group consisting of hemophilia, thrombophilia, thrombocytopenia, idiopathic thrombocytopenic purpura (ITP), heparin-induced thrombocytopenia (HIT), venous thromboembolism, arterial thrombosis and embolism.

6. Method according to claim 2, characterized in that the blood cancer is selected from the group consisting of myelodysplastic syndrome (MDS), lymphoma, leukemia and myeloma.

7. Method for treating and / or preventing sickle cell disease and / or the symptoms associated with it in an individual who needs it, characterized in that it comprises administering to the individual a composition that includes 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a conjugated ester, Petition 870250078726, dated 03 / 09 / 2025, page 620 / 638 2 / 17 or a pharmaceutically acceptable salt thereof.

8. Method, according to claim 7, characterized in that the associated symptoms comprise inflammatory vasculopathy, vasoconstriction, bronchoconstriction, iron overload, hemoglobinopathy, chromic hemolysis, sickling, anemia, inflammation, pain, acute and / or chronic organ damage and / or oxidative stress.

9. Method according to claim 8, characterized in that the organ is the lung, kidney, liver or spleen.

10. A method for treating and / or preventing heparin-induced thrombocytopenia (HIT) in an individual requiring it, characterized in that it comprises administering to the individual a composition that includes 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof.

11. Method, according to any of the claims 110, characterized in that the individual shows no change or shows a reduction in serum creatine levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

12. Method, according to any of the claims 111, characterized in that the individual does not show any change or shows a reduction in C-reactive protein (CRP) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

13. Method, according to any of the claims 112, characterized in that the individual shows no change or shows a reduction in pentraxin-2 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

14. Method, according to any of the claims 113, characterized in that the individual has no alteration or has a reduction in the levels of monocyte chemoattractant protein-1 (MCP-1 / CCL2) after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

15. Method, according to any of the claims 114, characterized in that the individual does not show any change or reduction in circulating neutrophils after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo. (bt) no change or a reduction in relation to baseline, placebo control and / or untreated patient.

16. Method, according to any of the claims 115, characterized in that the individual shows no change or shows a reduction in the levels of vascular cell adhesion molecule 1 (VCAM-1) after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

17. Method, according to any of the claims 116, characterized in that the individual does not show any change or shows a reduction in the levels of intercellular adhesion molecule 1 (ICAM-1) after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

18. Method, according to any of the claims 117, characterized in that the individual shows no change or shows a reduction in endothelin-1 (ET-1) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

19. Method, according to any of the claims 118, characterized in that the individual does not show any change or shows Petition 870250078726, dated 03 / 09 / 2025, page 622 / 638 4 / 17 an increase in hematocrit levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

20. Method, according to any of the claims 119, characterized in that the individual shows no change or shows an increase in hemoglobin levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

21. Method, according to any of the claims 120, characterized in that the individual shows no change or shows a reduction in the number of sickle-shaped red blood cells after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

22. Method, according to any of the claims 121, characterized in that the individual shows no change or a reduction in CD68 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

23. Method, according to any of the claims 122, characterized in that the individual shows no change or a reduction in CD80 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

24. Method, according to any of the claims 123, characterized in that the individual shows no change or a reduction in NF-kB p65 activation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

25. Method, according to any of the claims 124, characterized in that the individual does not exhibit any alteration or exhibits Petition 870250078726, dated 03 / 09 / 2025, page 623 / 638 5 / 17 a reduction in NLRP3 inflammasome activation after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

26. Method, according to any of the claims 125, characterized in that the individual does not show any alteration or shows a reduction in vascular endothelial activation after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

27. Method, according to any of the claims 126, characterized in that the individual shows no change or shows a reduction in vascular recruitment of neutrophils after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

28. Method, according to any of the claims 127, characterized in that the individual shows no change or shows a reduction in inflammatory cell infiltration after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

29. Method, according to any of the claims 128, characterized in that the individual shows no change or shows a reduction in thrombus formation after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

30. Method, according to any of the claims 129, characterized in that the individual shows no change or shows a reduction in iron overload and / or iron accumulation in the liver after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

31. Method, according to any of the claims 1- Petition 870250078726, dated 03 / 09 / 2025, page 624 / 638 6 / 17 30, characterized in that the individual does not show any alteration or shows a reduction in oxidative stress after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

32. Method, according to any of the claims 131, characterized in that the individual shows no change or shows a reduction in the levels of nuclear factor erythroid 2-related factor 2 (Nrf2) after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

33. Method, according to any of the claims 132, characterized in that the individual does not show any change or shows a reduction in oxidation and / or heme oxygenase-1 (HO-1) levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

34. Method, according to any of the claims 133, characterized in that the individual shows no change or shows a reduction in E-selectin levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

35. Method, according to any of the claims 134, characterized in that the individual shows no change or a reduction in red blood cell adhesion after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

36. Method, according to any one of claim 135, characterized in that the 15-HEPE is in the form of free acid.

37. Method, according to any one of claims 135, characterized in that the 15-HEPE is in esterified form. Petition 870250078726, dated 03 / 09 / 2025, pp. 625 / 638 7 / 17 38. Method according to claim 37, characterized in that the esterified form is a C1-C5 alkyl ester.

39. Method according to claim 38, characterized in that the esterified form is an ethyl ester.

40. Method according to claim 37, characterized in that the esterified form is a triglyceride.

41. Method, according to any one of claim 135, characterized in that the 15-HEPE is in salt form.

42. Method, according to any one of claims 141, characterized in that 15-HEPE is in the enantiomeric form 15(S)HEPE and / or in the enantiomeric form 15(R)-HEPE.

43. Method, according to any one of claims 142, characterized in that the composition comprises one or more additional active agents selected from the group consisting of eicosapentaenoic acid (EPA), 5-hydroxyeicosapentaenoic acid (5-HEPE), 12-hydroxyeicosapentaenoic acid (12-HEPE), 18-hydroxyeicosapentaenoic acid (18-HEPE), 15-hydroxyeicosatrienoic acid (15-HETrE), 15-hydroxyeicosatetraenoic acid (15-HETE), 14-hydroxydocosahexaenoic acid (14-HDoHE), 17-hydroxydocosahexaenoic acid (17-HDoHE), resolvin D1 (RvD1 or 17(S)-RvD1) and aspirin-activated resolvin D1 (AT-RvD1 or 17(R)-RvD1).

44. Method, according to any one of claims 143, characterized in that 15-HEPE represents at least 80% by weight of the composition.

45. Method, according to any one of claims 143, characterized in that 15-HEPE represents at least 80% by weight of all fatty acids present in the composition.

46. ​​A method, according to any one of claims 143, characterized in that the composition comprises no more than 10% by weight of omega-3 fatty acids other than 15-HEPE.

47. Method, according to any of the claims 1 Petition 870250078726, dated 03 / 09 / 2025, p. 626 / 638 8 / 17 43, characterized in that omega-3 fatty acids other than 15-HEPE do not represent more than 10% by weight of all fatty acids present in the composition.

48. Method, according to any one of claims 1-47, characterized in that the composition is formulated in one or more dosage units administered orally.

49. Method according to claim 48, characterized in that the dosage unit is a capsule.

50. Method according to claim 49, characterized in that about 500 mg to about 1,000 mg of 15-HEPE are present in each capsule.

51. A method, according to any one of the claims, characterized in that the composition further comprises a pharmaceutically acceptable excipient.

52. Method, according to any of the claims 151, characterized in that the composition is administered to the individual to provide a daily dose of about 1 g to about 8 g of 15-HEPE.

53. Method according to claim 52, characterized in that the composition is administered to the individual to provide a daily dose of approximately 8 g of 15-HEPE.

54. Method, according to claim 52 or claim 53, characterized in that the composition is administered in 1 to 8 capsules per day.

55. Composition characterized by comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt, for use in the treatment and / or prevention of a hematological disorder in an individual who needs it.

56. Composition for use according to claim 55, characterized in that the hematological disorder is selected from the group consisting of a red blood cell disorder, a hemoglobin disorder, a bleeding disorder and a blood cancer.

57. Composition for use according to claim 56, characterized in that the red blood cell disorder is selected from the group consisting of anemia, hemolytic anemia, iron deficiency anemia, hereditary spherocytosis, chronic hemolysis, pyruvate kinase deficiency and glucose-6-phosphate dehydrogenase (G6PD) deficiency.

58. Composition for use according to claim 56, characterized in that the hemoglobin disorder is selected from the group consisting of sickle cell disease, alpha thalassemia and beta thalassemia.

59. Composition for use, according to claim 56, characterized in that the bleeding disorder is selected from the group consisting of hemophilia, thrombophilia, thrombocytopenia, idiopathic thrombocytopenic purpura (ITP), heparin-induced thrombocytopenia (HIT), venous thromboembolism, arterial thrombosis and embolism.

60. Composition for use according to claim 56, characterized in that the blood cancer is selected from the group consisting of myelodysplastic syndrome (MDS), lymphoma, leukemia and myeloma.

61. Composition characterized by comprising 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof, for use in the treatment and / or prevention of sickle cell disease and / or symptoms associated therewith in an individual who requires it.

62. Composition for use, according to claim 61, characterized in that the associated symptoms include inflammatory vasculopathy, vasoconstriction, bronchoconstriction, iron overload, hemoglobinopathy, chromic hemolysis, sickling, anemia, inflammation, pain, acute and / or chronic organ damage and / or oxidative stress.

63. Composition for use according to claim 62, characterized in that the organ is the lung, kidney, liver or spleen.

64. Composition characterized by the fact that it comprises Petition 870250078726, dated 03 / 09 / 2025, page 628 / 638 10 / 17 15-hydroxyeicosapentaenoic acid (15-HEPE) in the form of free acid or a pharmaceutically acceptable ester, conjugate or salt thereof, for use in the treatment and / or prevention of heparin-induced thrombocytopenia (HIT) in an individual who requires it.

65. Composition for use, according to any of claims 55-64, characterized in that the individual shows no change or a reduction in serum creatinine levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

66. Composition for use, according to any of claims 55-65, characterized in that the individual shows no change or shows a reduction in C-reactive protein (CRP) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

67. Composition for use, according to any of claims 55-66, characterized in that the individual shows no change or a reduction in pentraxin-2 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

68. Composition for use, according to any of claims 55-67, characterized in that the individual has no alteration or has a reduction in monocyte chemoattractant protein-1 (MCP-1 / CCL2) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

69. Composition for use, according to any of claims 55-68, characterized in that the individual does not exhibit Petition 870250078726, dated 03 / 09 / 2025, page 629 / 638 11 / 17 alteration or reduction in circulating neutrophils after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo. (bt) no alteration or a reduction in relation to baseline, placebo control and / or untreated patient.

70. Composition for use, according to any of claims 55-69, characterized in that the individual has no alteration or has a reduction in the levels of vascular cell adhesion molecule 1 (VCAM1) after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

71. Composition for use, according to any of claims 55-70, characterized in that the individual does not show any alteration or shows a reduction in the levels of intercellular adhesion molecule 1 (ICAM-1) after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

72. Composition for use, according to any of claims 55-71, characterized in that the individual shows no change or shows a reduction in endothelin-1 (ET-1) levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

73. Composition for use, according to any of claims 55-72, characterized in that the individual shows no change or shows an increase in hematocrit levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

74. Composition for use, according to any of the claims 55-73, characterized in that the individual does not show any change or shows an increase in hemoglobin levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

75. Composition for use, according to any of claims 55-74, characterized in that the individual shows no change or shows a reduction in the number of sickle-shaped red blood cells after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

76. Composition for use, according to any of claims 55-75, characterized in that the individual shows no change or a reduction in CD68 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

77. Composition for use, according to any of claims 55-76, characterized in that the individual has no change or has a reduction in CD80 levels after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

78. Composition for use, according to any of claims 55-77, characterized in that the individual shows no alteration or a reduction in NF-kB p65 activation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

79. Composition for use, according to any of claims 55-78, characterized in that the individual does not show any alteration or shows a reduction in NLRP3 inflammasome activation after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

80. Composition for use, according to any of claims 55-79, characterized in that the individual shows no alteration or a reduction in vascular endothelial activation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

81. Composition for use, according to any of claims 55-80, characterized in that the individual shows no alteration or shows a reduction in vascular recruitment of neutrophils after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

82. Composition for use, according to any of claims 55-81, characterized in that the individual shows no change or shows a reduction in inflammatory cell infiltration after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

83. Composition for use, according to any of claims 55-82, characterized in that the individual shows no change or a reduction in thrombus formation after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

84. Composition for use, according to any of claims 55-83, characterized in that the individual does not exhibit any alteration or exhibits a reduction in iron overload and / or iron accumulation in the liver after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

85. Composition for use, according to any of claims 55-84, characterized in that the individual shows no alteration or a reduction in oxidative stress after receiving the composition comprising 15-HEPE compared to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

86. Composition for use, according to any of claims 55-85, characterized in that the individual has no alteration or has a reduction in the levels of nuclear factor erythroid factor-related factor 2 (Nrf2) after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

87. Composition for use, according to any of claims 55-86, characterized in that the individual does not show any alteration or shows a reduction in oxidation and / or heme oxygenase-1 (HO-1) levels after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

88. Composition for use according to any of claims 55-87, characterized in that the individual has no alteration or has a reduction in E-selectin levels after receiving the composition comprising 15-HEPE relative to baseline or to a control individual who does not receive the composition comprising 15-HEPE or who receives placebo.

89. Composition for use, according to any of claims 55-88, characterized in that the individual does not show any alteration or shows a reduction in red blood cell adhesion after receiving the composition comprising 15-HEPE in relation to baseline or to a control individual who did not receive the composition comprising 15-HEPE or who received placebo.

90. Composition for use according to any one of claims 55-89, characterized in that the 15-HEPE is in the form of free acid.

91. Composition for use according to any one of claims 55-89, characterized in that the 15-HEPE is in esterified form.

92. Composition for use according to claim 91, characterized in that the esterified form is a C1-C5 alkyl ester.

93. Composition for use according to claim 92, characterized in that the esterified form is an ethyl ester.

94. Composition for use according to claim 91, characterized in that the esterified form is a triglyceride.

95. Composition for use according to any one of claims 55-94, characterized in that the 15-HEPE is in salt form.

96. Composition for use according to any one of claims 55-95, characterized in that the 15-HEPE is in the enantiomeric form of 15(S)-HEPE and / or in the enantiomeric form of 15(R)-HEPE.

97. Composition for use, according to any one of claims 55-96, characterized in that the composition comprises one or more additional active agents selected from the group consisting of eicosapentaenoic acid (EPA), 5-hydroxy-eicosapentaenoic acid (5-HEPE), 12-hydroxy-eicosapentaenoic acid (12-HEPE), 18-hydroxy-eicosapentaenoic acid (18HEPE), 15-hydroxy-eicosatrienoic acid (15-HETrE), 15-hydroxyeicosatetraenoic acid (15-HETE), 14-hydroxy-docosahexaenoic acid (14-HDoHE), 17-hydroxy-docosahexaenoic acid (17-HDoHE), resolvin D1 (RvD1 or 17(S)-RvD1) and aspirin-activated resolvin D1 (AT-RvD1 or 17(R)-RvD1).

98. Composition for use according to any of claims 55-97, characterized in that 15-HEPE represents at least 80% by weight of the composition.

99. Composition for use, according to any of claims 55-97, characterized in that 15-HEPE represents at least 80% of the weight of all fatty acids present in the composition.

100. Composition for use, according to any one of claims 55-97, characterized in that the composition comprises no more than 10% by weight of omega-3 fatty acids other than 15-HEPE.

101. Composition for use, according to any one of claims 55-97, characterized in that omega-3 fatty acids other than 15-HEPE do not represent more than 10% by weight of all fatty acids present in the composition.

102. Composition for use, according to any one of claims 55-97, characterized in that the composition is formulated in one or more dosage units for oral administration.

103. Composition for use, according to claim 102, characterized in that the dosage unit is a capsule.

104. Composition for use, according to claim 103, characterized in that about 500 mg to about 1,000 mg of 15-HEPE are present in each capsule.

105. Composition for use, according to any one of claims 55-104, characterized in that the composition further comprises a pharmaceutically acceptable excipient.

106. Composition for use according to any one of claims 55-105, characterized in that the composition is administered to the individual to provide a daily dose of about 1 g to about 8 g of 15-HEPE.

107. Composition for use according to claim 106, characterized in that the composition is administered to the individual to provide a daily dose of approximately 8 g of 15-HEPE.

108. Composition for use, according to claim 106 or claim 107, characterized in that the composition is administered in Petition 870250078726, dated 03 / 09 / 2025, page 635 / 638 17 / 17 1 to 8 capsules per day.

Images