Pharmaceutical composition for in vivo editing of an lpa gene, gene editing system, method for inactivation of lpa gene in vivo, reduction of lp(a) concentration in blood, treatment and / or prevention of cardiovascular diseases associated with lpa gene and in vivo editing of lpa gene in a mammal subject

Description

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 453,207, filed March 20, 2023, and U.S. Provisional Patent Application No. 63 / 554,838, filed February 16, 2024, which applications are incorporated herein by reference in their entirety. FUNDAMENTALS

[0002] Lipoprotein(a) [Lp(a)] is a low-density lipoprotein (LDL) particle comprising apolipoprotein(a) [apo(a)] covalently linked to apolipoprotein B-100 (apoB-100), which is the primary protein component of LDL particles. The apo(a) protein is encoded by the LPA gene, which is specifically expressed in hepatocytes in the liver of humans and certain non-human primates and secreted into the bloodstream, where it is a constituent component of Lp(a). LDL cholesterol (the quantified aggregate cholesterol content of LDL particles circulating in the bloodstream) is a well-established causal risk factor for atherosclerotic cardiovascular disease (ASCVD), which remains a leading cause of death worldwide, despite the existence of approved chronic care drugs, including statins, ezetimibe, and proprotein convertase subtilisin / kexin type 9 (PCSK9) inhibitors.Lp(a) concentration in the blood has been established as a specific causal risk factor for ASCVD, and there is no approved therapy specifically targeting LPA, apo(a), or Lp(a). Petition 870250102047, dated 07 / 11 / 2025, p. 9 / 460 2 / 272 Furthermore, unlike LDL cholesterol, Lp(a) has been established as a causal risk factor for calcified aortic valve disease, a distinct type of cardiovascular disease characterized by hardening or thickening of the aortic valves. SUMMARY

[0003] This application discloses a novel gene-editing technology, including gene-editing mRNA, guide oligonucleotides (e.g., guide RNA or gRNA), gene-editing and delivery systems and components, formulations and pharmaceutical compositions thereof, which, alone and / or in combination, constitute separate aspects of the subject matter of the invention disclosed herein. The disclosed gene-editing technology is capable of in vitro and in vivo editing of the LPA gene, specifically including LPA genes found in human liver hepatocytes. Several embodiments are disclosed that are directed at inactivating the LPA gene by introducing loss-of-function LPA variants that disrupt the production of apo(a) and / or Lp(a) protein, thereby reducing the concentration of apo(a) and Lp(a) in the blood to the substantial benefit of patients, such as those with existing cardiovascular disease or at risk of developing cardiovascular disease.

[0004] Consequently, gene editing and distribution systems, their respective components and elements, and the manufacture and / or use of these systems and components, described in this document, alone and / or in any combination, constitute individual aspects of the subject matter of the invention disclosed in this document. Thus, the use of the compositions and methods disclosed in this document to interrupt the production of apo(a) and / or Lp(a) protein and / or to prevent and / or treat cardiovascular diseases constitutes separate aspects of the subject matter of the invention disclosed in this document. The location, nature and / or degree of LPA gene disruption and / or proportional disruption Petition 870250102047, dated 07 / 11 / 2025, page 10 / 460 3 / 272 of the production of apo(a) and Lp(a) additionally constitute aspects of the subject matter of the invention disclosed in this document.

[0005] In some embodiments, the invention provides a pharmaceutical composition for in vivo editing of an LPA gene in a mammalian subject comprising a manipulated, non-naturally occurring gene editing system and a delivery system. In embodiments, the gene editing system includes one or more polynucleotides (e.g., mRNAs) encoding one or more CRISPR Cas nickases, a first guide oligonucleotide (e.g., gRNA), and a second guide oligonucleotide (e.g., gRNA). The first guide oligonucleotide comprises a first spacer sequence and a first scaffold region. The first spacer sequence is complementary to a first strand of the LPA gene at a first target sequence. The first scaffold region serves as a binding scaffold for at least one of one or more Cas nickases. The second guide oligonucleotide comprises a second spacer sequence and a second scaffold region.The second spacer sequence is complementary to a second strand of the LPA gene at a second target sequence. The second scaffold region serves as a binding scaffold for at least one of one or more Cas nickases. The delivery system is engineered to deliver one or more polynucleotides encoding one or more CRISPR Cas nickases, the first guide oligonucleotide and / or the second guide oligonucleotide, individually and / or collectively, to the liver. The first guide oligonucleotide and at least one of one or more Cas nickases are engineered to cause at least one of one or more Cas nickases to cut either the first or second strand of the LPA gene at a first location on human chromosome 6 from position 160,664,275 to 160,531,482. The second guide oligonucleotide and at least one of one or more Cas nickases are engineered to cause at least one of the Cas nickases to cut. Petition 870250102047, dated 07 / 11 / 2025, page 11 / 460 4 / 272 the other between the first or second strand of the LPA gene at a second location on chromosome 6 from position 160,664,275 to 160,531,482.

[0006] In some embodiments, expression of the edited LPA gene results in reduced or absent production of apo(a) protein in cells in which the LPA gene is edited. In some embodiments, expression of the edited LPA gene results in reduced or absent production of apo(a) protein in hepatocytes. In some embodiments, the hepatocytes are primary hepatocytes.

[0007] In some embodiments, expression of the edited LPA gene results in reduced amounts of LPA RNA, such as mRNA or premRNA, in a cell in which the LPA gene is edited. Without intending to be limited by theory, it is believed that transcription of the edited LPA gene may, in some embodiments, result in nonsense-mediated decay of LPA RNA.

[0008] In some modalities, the expression of the edited LPA gene results in a reduction or lack of apo(a) protein production or the production of non-functional apo(a) protein, resulting in a reduced concentration of Lp(a) in the blood. In some modalities, the concentration of Lp(a) in the blood is reduced to a certain extent to treat ASCVD and / or calcified aortic valve disease. In some modalities, the concentration of Lp(a) in the plasma is reduced. In some modalities, the serum blood concentration is reduced.

[0009] The embodiments of the invention are directed to pharmaceutical compositions comprising one or more components (e.g., mRNA, gRNAs) of the LPA gene editing system, including pharmaceutical compositions thereof that allow in vivo delivery. In an illustrative embodiment, the delivery system for the LPA gene editing system comprises lipid nanoparticles (LNPs) comprising: (a) one or more ionizable lipids, (b) cholesterol, (c) one or Petition 870250102047, dated 07 / 11 / 2025, p. 12 / 460 5 / 272 plus PEG-lipids, (d) a phospholipid; and optionally including a targeting fraction, such as a GalNAc lipid.

[0010] In embodiments, Cas nickase is a Cas9 nickase. In some embodiments, Cas9 nickase, when in operative interaction with the first or second guide oligonucleotide (e.g., gRNA), is manipulated to cut the opposite strand of the LPA gene to which the operative guide is hybridized. In some embodiments, Cas9 nickase, when in operative interaction with the first or second guide oligonucleotide, is manipulated to cut the same strand of the LPA gene to which the operative guide oligonucleotide (e.g., gRNA) is hybridized.

[0011] In illustrative embodiments, Cas nickase comprises a Cas9 nickase from Streptococcus pyogenes that carries a D10A mutation encoded within the polynucleotide (e.g., mRNA).

[0012] In some embodiments, the first guide oligonucleotide (e.g., gRNA) has a first spacer sequence that is substantially identical to a first protospacer sequence adjacent to a first protospacer-adjacent motif (PAM) sequence on one strand of the LPA gene, and the second guide oligonucleotide (e.g., gRNA) has a second spacer sequence that is substantially identical to a second protospacer sequence adjacent to a second protospacer-adjacent motif (PAM) sequence on the other strand of the LPA gene, wherein the Cas9 nickase carrying a D10A mutation, in operation with the first and second guide oligonucleotides, makes two cleavages in opposite strands (e.g., antisense and sense strands) of the LPA gene between the first and second protospacer-adjacent motifs (PAMs) in a PAM-out configuration (see, for example, Figure 1A).

[0013] In some embodiments, the first guide oligonucleotide (e.g., gRNA) has a first spacer sequence that is Petition 870250102047, dated 07 / 11 / 2025, p. 13 / 460 6 / 272 substantially identical to a first protospacer sequence adjacent to a first protospacer-adjacent motif (PAM) sequence on one strand of the LPA gene, and the second guide oligonucleotide (e.g., gRNA) has a second spacer sequence that is substantially identical to a second protospacer sequence adjacent to a second protospacer-adjacent motif (PAM) sequence on the other strand of the LPA gene, and wherein the Cas9 nickase carrying a D10A mutation, in operation with the first and second guide oligonucleotides, makes two cuts in opposite strands (e.g., antisense and sense strands) of the LPA gene off the first and second protospacer-adjacent motifs (PAMs) in a PAM-in configuration (see, for example, Figure 1C).

[0014] In some embodiments, Cas nickase comprises Cas9 nickase from Streptococcus pyogenes that carries an H840A mutation encoded within the polynucleotide (e.g., mRNA).

[0015] In some embodiments, the first guide oligonucleotide (e.g., gRNA) has a first spacer sequence that is substantially identical to a first protospacer sequence adjacent to a first protospacer-adjacent motif (PAM) sequence on one strand of the LPA gene, and the second guide oligonucleotide (e.g., gRNA) has a second spacer sequence that is substantially identical to a second protospacer sequence adjacent to a second protospacer-adjacent motif (PAM) sequence on the other strand of the LPA gene, wherein the Cas9 nickase carrying an H840A mutation, in operation with the first and second guide oligonucleotides, makes two cuts in the first and second protospacer sequences on opposite strands (e.g., antisense and sense strands) of the LPA gene between the first and second protospacer-adjacent motifs (PAMs) in a PAM-out configuration (see, for example, Figure 1B). Petition 870250102047, dated 07 / 11 / 2025, p. 14 / 460 7 / 272

[0016] In some embodiments, the first guide oligonucleotide (e.g., gRNA) has a first spacer sequence that is substantially identical to a first protospacer sequence adjacent to a first protospacer-adjacent motif (PAM) sequence on one strand of the LPA gene, and the second guide oligonucleotide (e.g., gRNA) has a second spacer sequence that is substantially identical to a second protospacer sequence adjacent to a second protospacer-adjacent motif (PAM) sequence on the other strand of the LPA gene, wherein the Cas9 nickase carrying an H840 mutation, in operation with the first and second guide oligonucleotides, makes two cuts in the first and second protospacer sequences on opposite strands (e.g., antisense and sense strands) of the LPA gene outside the first and second protospacer-adjacent motifs (PAMs) in a PAM-in configuration (see, for example, Figure 1D).

[0017] In some embodiments, the Cas9 nickase operating with the first and second guide nucleotides cuts the DNA to generate cleavages in opposite strands, resulting in 5' overhangs (e.g., as shown in Figures 1A and 1D). In some embodiments, the Cas9 nickase operating with the first and second guide nucleotides cuts the DNA to generate cleavages in opposite strands, resulting in 3' overhangs (e.g., as shown in Figures 1B and 1C). The overhangs can be of any length suitable to allow non-homologous end joining. The length of the overhangs is defined by the distance between the cleavages in the DNA strands. It will be understood that the length of the overhangs suitable to allow non-homologous end joining may vary depending on a number of factors. In some embodiments, the protrusions have a length of 1 to 200 nucleotides, such as 10 to 150 nucleotides, 15 to 100 nucleotides, or 20 to 50 nucleotides.In some forms, the protrusions have a length of... Petition 870250102047, dated 07 / 11 / 2025, p. 15 / 460 8 / 272 nucleotides or more, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides or more. In some embodiments, the overhangs have a length of 200 nucleotides or less, such as 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, or 50 nucleotides or less. In some embodiments, the overhangs have a length of 20 to 50 nucleotides, such as 23 to 45, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 31 to 39, 32 to 39, 33 to 39, or 34 to 38 nucleotides.

[0018] In some embodiments, the sequences of the first and second scaffold regions of the first and second guide oligonucleotides are the same. In some embodiments, the sequences of the first and second scaffold regions are different.

[0019] In embodiments, the in vivo LPA gene editing system comprises a polynucleotide (e.g., mRNA) encoding a CRISPR Cas9 nickase. In some embodiments, the in vivo LPA gene editing system additionally comprises one or more polynucleotides (e.g., mRNA), each encoding a CRISPR Cas nickase.

[0020] In embodiments, the in vivo LPA gene editing system comprises a Cas nickase that is manipulated to target protospacer sequences within or in proximity to exon 20 of the LPA gene, which extends from chromosome 6, position 160,599,659, to chromosome 6, position 160,599,500, by the first and second guide oligonucleotides (e.g., gRNAs). In some of these embodiments, the gene editing system is configured to effect indel variants and / or non-synonymous variants in the LPA gene.

[0021] In embodiments, the LPA in vivo gene editing system comprises a Cas nickase that is manipulated to be directed to protospacer sequences within or in proximity to exon 23 of the gene. Petition 870250102047, dated 07 / 11 / 2025, page 16 / 460 9 / 272 LPA, which extends from chromosome 6, position 160,591,101, to chromosome 6, position 160,590,944, via the first and second guide oligonucleotides (e.g., gRNAs). In some of these embodiments, the gene editing system is configured to effect indel variants and / or non-synonymous variants in the LPA gene.

[0022] In embodiments, the in vivo LPA gene editing system comprises a Cas nickase that is manipulated to target protospacer sequences within or in proximity to exon 25 of the LPA gene, which extends from chromosome 6, position 160,586,630, to chromosome 6, position 160,586,449, by the first and second guide oligonucleotides (e.g., gRNAs). In some of these embodiments, the gene editing system is configured to effect indel variants and / or non-synonymous variants in the LPA gene.

[0023] In embodiments, the in vivo LPA gene editing system comprises a Cas nickase that is manipulated to target protospacer sequences within or in proximity to exon 19 of the LPA gene, which extends from chromosome 6, position 160,601,098, to chromosome 6, position 160,600,917, by the first and second guide oligonucleotides (e.g., gRNAs). In some of these embodiments, the gene editing system is configured to effect indel variants and / or non-synonymous variants in the LPA gene.

[0024] In embodiments, the in vivo LPA gene editing system comprises a Cas nickase that is manipulated to target protospacer sequences within or near exon 31 of the LPA gene, which extends from chromosome 6, position 160,548,659, to chromosome 6, position 160,548,478, via the first and second guide oligonucleotides (e.g., gRNAs). In some of these embodiments, the gene editing system is configured to effect indel variants and / or non-indel variants. Petition 870250102047, dated 07 / 11 / 2025, page 17 / 460 10 / 272 synonyms in the LPA gene.

[0025] In embodiments, a plurality of different guide oligonucleotides (e.g., gRNAs) is used to effect the desired LPA gene editing. In some embodiments, the different guide oligonucleotides (e.g., gRNAs) are delivered in vivo to target human liver cells / tissues simultaneously and operate to effect LPA gene editing of human liver cells. In some embodiments, the different guide oligonucleotides (e.g., gRNAs) are delivered in vitro to target human liver cells / tissues (e.g., HuH-7 cells) simultaneously and operate to effect LPA gene editing of human liver cells.In some embodiments, one or more or all of the guide oligonucleotides (e.g., gRNAs) are delivered to the target liver tissue and liver cells via lipid nanoparticles (LNPs), which may comprise an ionizable lipid, cholesterol, PEG-lipid, and a phospholipid, and may also include a targeting fraction, such as a GalNAc lipid. In some embodiments, the phospholipid comprises distearolphosphatidylcholine (DSPC). The same or different LNPs may also serve to deliver mRNA encoding the gene editor, namely, a Cas nickase (e.g., a Cas9 nickase). In embodiments, mRNA and / or guide oligonucleotides (e.g., gRNAs) are selected from those specified in this document. In embodiments, Cas nickase (gene editor) and guide oligonucleotides (e.g., gRNAs) may be selected from gene editing systems and configurations illustrated in Figures 1A-1D.

[0026] In some embodiments, the in vivo gene editing system comprises mRNA encoding a Cas nickase (gene editor) and comprises one or more guide oligonucleotides (e.g., gRNAs). A first guide oligonucleotide may comprise a first sequence Petition 870250102047, dated 07 / 11 / 2025, p. 18 / 460 11 / 272 spacer and a first scaffold region. A second guide oligonucleotide may comprise a second spacer sequence and a scaffold region that is different from or the same as the first scaffold region. The first spacer sequence may correspond to a first protospacer sequence and be designed to be complementary to, or otherwise hybridize with, the strand complementary to the first protospacer to facilitate cleavage by nickase (e.g., Cas nickase) in either DNA strand.The second spacer sequence may correspond to a second protospacer sequence that is located on the opposite strand to the first protospacer sequence and is in operational proximity to the first protospacer sequence, wherein the second spacer sequence is complementary to, or otherwise designed to hybridize with, the strand complementary to the second protospacer to facilitate a nickase cut on the strand that does not receive a cut through the action of nickase in connection with the first guide oligonucleotide.

[0027] In embodiments, the present invention provides isolated oligonucleotides (e.g., gRNAs) or nucleic acids encoding the same. The isolated oligonucleotides (e.g., gRNAs) each comprise (i) a spacer sequence comprising about 15 to about 26 nucleotides, such as about 17 to about 23 nucleotides, which is identical or substantially identical to a targeted protospacer sequence adjacent to a protospacer-adjacent motif (PAM) sequence within an LPA gene; and (ii) a scaffold region. Isolated oligonucleotides serve as guide nucleic acids to direct the gene editor to effect editing in the LPA gene. In embodiments, the edit or edits are configured to modify the LPA gene to effect indel variants or non-synonymous variants.

[0028] In some embodiments, the first protospacer is in Petition 870250102047, dated 07 / 11 / 2025, p. 19 / 460 12 / 272 sense strand and the second protospacer is on the antisense strand of the LPA gene. In some embodiments, the first protospacer is on the antisense strand and the second protospacer is on the sense strand of the LPA gene.

[0029] In some embodiments, the mRNA encoding a Cas nickase (gene editor) comprises: (a) a 5' untranslated region (UTR); (b) a 3' UTR region; (c) a poly(A) tail adjacent to the 3' UTR compared to the 5' UTR, said poly(A) tail comprising a chain of 80–150 nucleotides comprising adenine nucleotides; and (d) a gene editor coding region encoding a committed CRISPR Cas endonuclease domain, said gene editor coding region extending between the 5' UTR and the 3' UTR. In some embodiments, the gene editor coding region also encodes a polymerase domain.

[0030] In embodiments, mRNA has 90% or more sequence identity with any of the mRNA sequences listed in Table 1. For example, mRNA may have 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with any of the mRNA sequences listed in Table 1.

[0031] In modalities, Cas nickase is selected from: a Cas9 variant of Streptococcus pyogenes, a Cas9 variant of Staphylococcus aureus, or a Cas12a / Cpf1 variant.

[0032] In embodiments, the present disclosure describes a method for effecting a modification in an LPA gene to result in loss of function. The method comprises delivering in vivo to a human liver cell, or administering to a mammalian subject, a pharmaceutical composition. The pharmaceutical composition comprises a polynucleotide (e.g., mRNA) encoding Cas nickase, the first and second guide oligonucleotides (e.g., gRNAs), and the delivery system. In some ... Petition 870250102047, dated 07 / 11 / 2025, page 20 / 460 In 13 / 272 embodiments, the delivery system is engineered to deliver the Cas nickase-encoding polynucleotide, the first guide oligonucleotide, and / or the second guide oligonucleotide, individually or collectively, to the liver. In some embodiments, the delivery system comprises an LNP. In other embodiments, the method comprises delivering in vitro to a human liver cell (e.g., HuH-7 cell), or administering to a mammalian subject, a pharmaceutical composition.

[0033] In embodiments, LNP is formulated with an mRNA:guide oligonucleotide (e.g., gRNA) weight ratio of 1:1 + / - 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the mRNA or guide oligonucleotide, or any therapeutically effective ratio. A 1:1 + / - 100% weight ratio includes weight ratios from 1:2 to 2:1. A 1:1 mRNA:guide oligonucleotide weight ratio refers to the cumulative weight ratios of all mRNAs and all guide oligonucleotides. For example, if a single mRNA is included in the formulation and two guide oligonucleotides are included in the formulation, the weight ratio of the mRNA to the guide oligonucleotide will be the weight of the single mRNA relative to the combined weight of the two gRNAs in the formulation.

[0034] In modalities, the LNP has an N / P ratio of about 4 to about 7, about 4, about 4.5, about 5, about 5.5 or about 6, about 6.5 or about 7 with each ratio + / - 5-20%.

[0035] In embodiments, the buffer solution containing LNP has a pH of about 7.5 + / - 1.5 and comprises tris and / or sucrose.

[0036] In embodiments, the LNP has an average diameter of about 70 nm + / - 20 nm, 70 nm + / - 10 nm, 70 nm + / - 5 nm; 60 nm + / - 20 nm, 60 nm + / 10 nm, 60 nm + / - 5 nm; 50nm + / - 20nm, 50nm + / - 10nm, 50nm + / - 5nm; 45 nm + / - 20 nm, 45 nm + / - 10 nm, 45 nm + / - 5 nm.

[0037] In terms of modalities, this disclosure describes a Petition 870250102047, dated 07 / 11 / 2025, p. 21 / 460 14 / 272 method for in vivo editing of an LPA gene in a mammalian subject in need, comprising administering a pharmaceutical composition to the subject. The pharmaceutical composition comprises: (i) a polynucleotide (e.g., mRNA) that codes for a CRISPR Cas nickase, (ii) a first guide oligonucleotide (e.g., gRNA) comprising a first spacer sequence and a scaffold region; and (iii) a second guide oligonucleotide (e.g., gRNA) comprising a second spacer sequence and a scaffold region and (iv) a delivery system that is engineered to deliver the mRNA, the first gRNA and / or the second gRNA, individually and / or collectively, to the liver, wherein, in operation, the Cas nickase cuts each of the first and second strands of the LPA gene, at locations on chromosome 6, position 160,664,275, to chromosome 6, position 160,531,482.

[0038] In some forms, the mammalian subject is a human.

[0039] In modalities, the subject has a high concentration of Lp(a) in the blood. In certain modalities, the subject has an inversely associated apo(a) concentration.

[0040] In some modalities, the subject has cardiovascular disease associated with an elevated concentration of Lp(a) in the blood. In others, the subject has cardiovascular disease associated with an inversely associated concentration of apo(a) in the blood.

[0041] In some modalities, in vivo editing of the LPA gene results in a reduction in the concentration of Lp(a) in the blood. In others, in vivo editing of the LPA gene results in an inversely associated concentration of apo(a) in the blood. Petition 870250102047, dated 07 / 11 / 2025, p. 22 / 460 15 / 272

[0042] In some embodiments, the invention provides a method for inactivating the LPA gene in vivo in a mammalian subject to treat and prevent cardiovascular disease, comprising the step of: administering the pharmaceutical composition of the invention to the subject.

[0043] In some embodiments, the invention provides a method for reducing the concentration of Lp(a) in the blood or the inversely associated concentration of apo(a) in a mammalian subject to treat and prevent cardiovascular disease, comprising the step of: administering to the subject a pharmaceutical composition of the invention.

[0044] In some embodiments, the invention provides a method for treating and / or preventing cardiovascular diseases associated with the LPA gene in a mammalian subject, comprising the step of: administering to the subject a pharmaceutical composition of the invention.

[0045] In some embodiments, the invention provides a gene editing system for editing the LPA gene. The gene editing system is produced by expressing in a cell one or more exogenous polynucleotides (e.g., mRNA) encoding one or more CRISPR Cas nickases and by introducing first and second gRNAs into the cell. The first guide oligonucleotide (e.g., gRNA) comprises (i) a first spacer sequence that is complementary to a first strand of the LPA gene at a first target sequence and (ii) a first scaffold region that serves as a binding scaffold for at least one of one or more Cas nickases. The second guide oligonucleotide (e.g., gRNA) comprises (i) a second spacer sequence that is complementary to a second strand of the LPA gene at a second target sequence and (ii) a second scaffold region that serves as a binding scaffold for at least one of one or more Cas nickases.The first gRNA and at least one of one or more Cas nickases are manipulated to make at least one of them... Petition 870250102047, dated 07 / 11 / 2025, p. 23 / 460 16 / 272 or more Cas nickases cut one of the first or second strands of the LPA gene at a primary location on chromosome 6 from position 160,664,275 to 160,531,482. The second gRNA and at least one of one or more Cas nickases are manipulated to cause at least one of one or more Cas nickases to cut the other between the first or second strand of the LPA gene at a secondary location on chromosome 6 from position 160,664,275 to 160,531,482.

[0046] In some embodiments, the invention provides a gene editing system comprising (i) a means for expressing one or more CRISPR Cas nickases in a cell; and (ii) a means for targeting one or more Cas nickases to the first and second locations in the LPA gene and causing one or more Cas nickases to introduce a cut in a first strand of the LPA gene and introduce a cut in a second strand of the LPA gene.

[0047] In some embodiments, the invention provides a pharmaceutical composition for in vivo editing of an LPA gene in a mammalian subject, comprising a non-naturally occurring engineered gene editing system and a population of lipid nanoparticles that collectively encapsulate the gene editing system.The gene editing system comprises (i) a nickase or one or more polynucleotides (mRNAs) encoding a nickase; (ii) a first guide oligonucleotide (gRNA) comprising a first spacer sequence that includes a region that is complementary to a first strand of the LPA gene at a first target sequence and a first scaffold region that serves as a binding scaffold for the nickase; and (iii) a second guide oligonucleotide (gRNA) comprising a second spacer sequence that includes a region that is complementary to a second strand of the LPA gene at a second target sequence and a second scaffold region that serves as a binding scaffold for the nickase. The first and second strands are opposite strands. The first spacer. Petition 870250102047, dated 07 / 11 / 2025, page 24 / 460 17 / 272 has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% similar or identical, or is identical to guide protospacer 1 listed in Table 2 or Table 5, and where the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% similar or identical, or is identical to guide protospacer 2 listed in Table 2 or Table 5.

[0048] Additional aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description, in which only illustrative embodiments of the present disclosure are shown and described. As will be perceived, the present disclosure is capable of other and different embodiments, and its various details are capable of modifications in several obvious aspects, all without departing from the disclosure. Consequently, the figures and description should be considered illustrative and not restrictive in nature. BRIEF DESCRIPTION OF THE FIGURES

[0049] Figures 1A-1D are schematic drawings illustrating nickase-based editing systems and specifically dual nickase editing systems and configurations. The gene editor components and guide oligonucleotides (labeled as gRNAs) are identified and described operationally. In each configuration, the editing system makes single cuts in opposing DNA strands, which recruit DNA repair enzymes to facilitate non-homologous end-joint (NHEJ) repair to cause the edit (e.g., causing an indel variant or non-synonymous variant). Figure 1A illustrates a system and configuration employing a Cas9 nickase protein with a RuvC domain mutation, exemplified by Cas9 from Streptococcus pyogenes (S. pyogenes) with a D10A mutation, with Petition 870250102047, dated 07 / 11 / 2025, page 25 / 460 18 / 272 two guide oligonucleotides. The first guide oligonucleotide has a spacer sequence that is identical to a first protospacer sequence on a lower strand, and the second guide oligonucleotide has a spacer sequence that is identical to a second protospacer sequence on an upper strand, with the 5' end of the first spacer sequence and the 5' end of the second spacer sequence being close to each other compared to the 3' ends of the spacers. A Cas9 nickase carrying a D10A mutation, operating with the first and second guide oligonucleotides, makes two cuts in the respective target sequences on the upper and lower strands of the gene (e.g., LPA) between the first and second protospacer adjacent motifs (PAMs) in a PAM-out configuration, in which the protospacer adjacent motifs (PAMs) for the two protospacer sequences are separated by the length of the region encompassed by the protospacer sequences.In other words, the two PAMs are distal to each other and flank the two protospacer sequences in a PAM-out configuration. Figure 1B illustrates a system and configuration employing a Cas9 nickase protein with an HNH domain mutation, exemplified by S. pyogenes Cas9 with an H840A mutation, with two guide oligonucleotides. The first guide oligonucleotide has a spacer sequence that is identical to a first protospacer sequence on a lower strand, and the second guide oligonucleotide has a spacer sequence that is identical to a second protospacer sequence on an upper strand, with the 5' end of the first spacer sequence and the 5' end of the second spacer sequence being close to each other compared to the 3' ends of the spacers.The Cas9 nickase carrying an H840A mutation, when operating with the first and second guide oligonucleotides, makes a first cut in the first protospacer sequence and a second cut in the second sequences. Petition 870250102047, dated 07 / 11 / 2025, page 26 / 460 19 / 272 protospacer sequences on the respective lower and upper strands of the gene (e.g., LPA) between the first and second protospacer-adjacent motifs (PAMs) in a PAM-out configuration. Thus, as in Figure 1A, the two PAMs represented in Figure 1B are distal to each other and flank the two protospacer sequences in a PAM-out configuration. Figure 1C illustrates a system and configuration employing a Cas9 nickase protein with a RuvC domain mutation, exemplified by S. pyogenes Cas9 with a D10A mutation, with two guide oligonucleotides.The first guide oligonucleotide has a spacer sequence that is identical to a first protospacer sequence on an upper strand, and the second guide oligonucleotide has a spacer sequence that is identical to a second protospacer sequence on a lower strand, with the 3' end of the first spacer sequence and the 3' end of the second spacer sequence being close to each other compared to the 5' ends of the spacers. The Cas9 nickase carrying a D10A mutation, operating with the first and second guide oligonucleotides, makes two cuts in the respective target lower and upper strands of the LPA gene outside the first and second protospacer-adjacent motifs (PAMs) in a PAM-in configuration, in which the PAMs for the two protospacer sequences are close to each other and are flanked by the protospacer sequences.Figure 1D illustrates a system and configuration employing a Cas9 nickase protein with an HNH domain mutation, exemplified by S. pyogenes Cas9 with an H840A mutation, with two guide oligonucleotides. The first guide oligonucleotide has a spacer sequence that is identical to a first protospacer sequence on an upper strand, and the second guide oligonucleotide has a spacer sequence that is identical to a second protospacer sequence on a lower strand, with the 3' end of the first. Petition 870250102047, dated 07 / 11 / 2025, p. 27 / 460 The 20 / 272 spacer sequence and the 3' end of the second spacer sequence are close to each other compared to the 5' ends of the spacers. The Cas9 nickase carrying an H840A mutation, operating with the first and second guide oligonucleotides, makes a first cut in the first protospacer sequence and a second cut in the second protospacer sequence in the respective upper and lower strands of the LPA gene outside the first and second protospacer-adjacent motifs (PAMs) in a PAM-in configuration, in which the PAMs for the two protospacer sequences are close to each other and are flanked by the protospacer sequences. The arrows in the diagrams of Figs. 1A-1D indicate the location of the cuts. It should be understood that the D10A nickase is representative of nickases that cut the target tape, while the H840A nickase is representative of nickases that cut the non-target tape (e.g., the tape containing the protospacer).Consequently, it is contemplated that other nickases may be used in connection with the nickase-based editing systems described in this document.

[0050] Figure 2 is a graph of the percentages of LPA alleles edited in primary human hepatocytes (% edit, also referred to as editing efficiency) versus selected guide RNA pairs (first and second gRNAs) at relatively higher and lower doses, summarizing the LPA editing efficiencies in primary human hepatocytes using a gene editing system comprising a Cas9 nickase with the specified pairs of first and second guide RNAs. Specific guide RNA pairs are ranked by editing efficiency at the highest total RNA dose of 2,500 ng / ml. The lowest total RNA dose is 312.5 ng / ml. The Cas9 nickase is encoded within an mRNA (MS029) that was transfected into primary human hepatocytes at a total mRNA:total gRNA weight ratio of 1:1. Petition 870250102047, dated 07 / 11 / 2025, page 28 / 460 21 / 272

[0051] Figure 3 shows dose-response curves in immortalized human hepatocellular carcinoma (HuH-7) cells for five (5) pairs of first and second guide RNAs using a gene-editing system comprising a Cas9 double nickase system, as described in connection with Figure 2. The Cas9 nickase is encoded within an mRNA (MS029) that was transfected into HuH-7 cells at a total mRNA:total gRNA weight ratio of 1:1. As illustrated in Figure 3, each of the 5 pairs of guide oligonucleotides showed an increasing dose response with increasing concentrations.

[0052] Figure 4A is a schematic drawing illustrating the LPA gene sequence to which the guide spacers GA1183, GA1184, GA1264, and GA1266 correspond. The corresponding amino acid sequence is provided below the gene sequence and is numbered. Guide pairs (GA1183 / GA1184, GA1264 / GA1184, GA1266 / GA1184) for double cutting of the LPA gene are shown. The guide pairs were formulated into lipid nanoparticles (LNPs) with SpCas9-D10A nickase mRNA (MS029) and tested for editing efficiency, with LNP 1 corresponding to the guide pair GA1183 / GA1184, LNP 2 corresponding to the guide pair GA1264 / GA1184, and LNP 3 corresponding to the guide pair GA1266 / GA1184. The results are shown in Figure 4B.

[0053] Figure 4B is a graph illustrating the editing efficiency (% edit) of human primary hepatocyte (PHH) cells incubated with LNPs (LNP 1, LNP 2, LNP 3, as described in the brief description of Figure 4A) in a dose-responsive manner ranging from 0 to 40,000 ng / mL of total RNA (guides and mRNA). As illustrated in Figure 4B, the gene editing system (guide and mRNA pairs encoding SpCas9-D10A nickase) resulted in an increasing response with increasing concentrations.

[0054] Figure 5 is a graph showing the percentage of Petition 870250102047, dated 07 / 11 / 2025, page 29 / 460 22 / 272 apo(a) protein secreted from a HuH-7 reporter cell line exposed to varying concentrations of LNP ranging from 0 to 5000 ng / mL (total RNA). The LNP corresponds to LNP 1, as described in the brief description of Figures 4A-B, and includes the guide pair GA1183 / GA1184 and the mRNA encoding the SpCas9-D10A nickase (MS029). Apo(a) protein concentration was assessed using a validated Lp(a) ELISA kit from Mercodia. The HuH-7 reporter cell line was generated by (i) infection with lentivirus containing an expression cassette comprising an open reading frame (ORF) of LPA followed by an internal ribosome entry site (IRES) and puromycin N-acetyltransferase (puro), driven by a cytomegalovirus (CMV) promoter and (ii) selection with puromycin. As illustrated in Figure 5, the relative percent reduction in apo(a) protein secreted by the reporter cell line was reduced in a dose-dependent manner with LNP.

[0055] Figures 6A and 6B are graphs of the LPA gene editing efficiency (% indel) in livers harvested from transgenic mice expressing the human LPA gene fourteen days after administration of a gene editing system (guide GA1296, guide GA1295, and mRNA MS029). The gene editing system was formulated into lipid nanoparticles (LNPs) and delivered to transgenic mice via retro-orbital injection at various concentrations. The concentrations shown in Figures 6A and 6B correspond to mg of total RNA (guide and mRNA pair) per kilogram (based on mouse weight). As illustrated in Figures 6A and 6B, gene editing efficiency increased in a dose-dependent manner with increasing dose of the gene editing system.

[0056] Figure 7 is a graph of the percent change in plasma apo(a) protein level (measured as a percent change from baseline) in transgenic mice expressing the human LPA gene fourteen days after administration of a gene-editing system. Petition 870250102047, dated 07 / 11 / 2025, page 30 / 460 23 / 272 (guideline GA1296, guideline GA1295, and mRNA MS029). The gene editing system was formulated into lipid nanoparticles (LNPs) and delivered to transgenic mice via retro-orbital injection at various concentrations. The concentrations shown in Figure 7 correspond to mg of total RNA (guideline and mRNA pair) per kilogram (based on mouse weight). Plasma apo(a) concentrations were determined at baseline (-7 days) and 14 days after administration of the gene editing system. As illustrated in Figure 7, the percent reduction in plasma apo(a) protein levels increased in a dose-dependent manner with increasing dose of the gene editing system.

[0057] Figure 8A is a graph of the change in plasma apo(a) protein levels (measured as a percentage change from baseline) in transgenic mice expressing the human LPA gene 7 and 14 days after administration of a gene editing system (guide GA1296, guide GA1295, and mRNA MS029). The gene editing system was formulated into lipid nanoparticles (LNPs) and delivered to transgenic mice via retro-orbital injection at various concentrations. The concentrations shown in Figure 8A correspond to mg of total RNA (guide and mRNA pair) per kilogram (based on mouse weight). Plasma apo(a) concentrations were determined at baseline (-7 days) and 7 and 14 days after administration of the gene editing system. As illustrated in Figure 8A, the percentage reduction in plasma apo(a) protein levels increased in a dose-dependent manner with increasing dose of the gene editing system.

[0058] Figure 8B is a graph of the change in plasma apo(a) protein levels (measured as a percentage change from baseline) in transgenic mice expressing the human LPA gene 14 days after administration of various gene editing systems (pairs of Petition 870250102047, dated 07 / 11 / 2025, page 31 / 460 24 / 272 guide oligonucleotides and MS029 mRNA). The gene editing system was formulated in lipid nanoparticles (LNPs) and delivered to transgenic mice via retro-orbital injection at a dose of 0.5 mg / kg. The dose corresponds to mg of total RNA (guide pair and mRNA) per kilogram (based on mouse weight). Plasma apo(a) concentrations were determined at baseline (-7 days) and 14 days after administration of the gene editing systems.

[0059] Figure 9 is a diagrammatic representation showing the locations where the selected gRNA spacers described in this document are complementary to the LPA gene and thus are able to hybridize with it. Due to the repetitive nature of some sequences in the LPA gene (e.g., type IV kringle repeats), the spacers of some of the selected gRNAs are complementary to more than one location in the LPA gene. DETAILED DESCRIPTION OF ILLUSTRATIVE MODALITIES

[0060] This document provides, among other things, compounds and compositions for modifying or editing the LPA gene and methods for using them. In embodiments, the methods result in reduced Lp(a) concentrations in the blood by inactivating the LPA gene. In embodiments, editing the LPA gene results in indel variants and non-synonymous variants in the LPA sequence. Compositions and methods aimed at editing the LPA gene using an editing system that can install the edit, such as a Cas nickase (e.g., a Cas9 nickase) and two guide oligonucleotides (e.g., gRNAs), are disclosed.

[0061] For convenience, this Detailed Description is arranged in the following sections: I. DEFINITIONS Petition 870250102047, dated 07 / 11 / 2025, p. 32 / 460 25 / 272 II. APOLIPOPROTEIN PROTEIN AND LPA GENE III. GENE EDITING / GENE MODIFICATION IV. Guide Nucleic Acids and Targeted DNA Sequences V. GENE EDITING SYSTEMS VI. THERAPEUTIC APPLICATIONS VII. Pharmaceutical Compositions A. Lipid Nanoparticle (LNP) Compositions 1. Amino Lipids a) Formula (I) b) Formula (Ia) c) Variations of Formula (I) and (Ia) 2. LNP Compositions Comprising Different Amino Lipids 3. Types of Additional Amino Lipids 4. PEG-Lipids 5. Phospholipid 6. Cholesterol 7. GalNAc-Lipid 8. Phosphate Charge Neutralizer 9. Antioxidants 10. Other Lipids 11. LNP Formulation 12. Payload VIII. KITS IX. DOSAGE X. MEANS XI. EXAMPLES XII. OTHER MODALITIES Petition 870250102047, dated 07 / 11 / 2025, page 33 / 460 26 / 272 I. DEFINITIONS

[0062] The following are definitions of some terms presented throughout this disclosure. In some cases, the terms are defined in areas of this descriptive report different from this Definitions section.

[0063] As used in this descriptive report and the accompanying claims, the singular forms a, an, and the include plural referents unless the content clearly indicates otherwise. It should also be noted that the term or is generally employed in its inclusive sense and / or unless the content clearly indicates otherwise. The terms and / or and any combination thereof and their grammatical equivalents, as used in this document, may be used interchangeably. These terms may convey that any combination is specifically contemplated. For illustrative purposes only, the following phrases A, B and / or C or A, B, C or any combination thereof may mean A individually; B individually; C individually; A and B; B and C; A and C; and A, B and C. The term or may be used conjuncturally or disjuncturally unless the context specifically refers to a disjunctive use.The use of the term "or" implies that the disjunctive sense is contemplated. That is, although A, B, or C may mean A, B, and / or C, or A, B, and C, or any combination thereof, A, B, or C will also include A or B or C, but not (A and B), (A and C), (B and C), and (A, B, and C).

[0064] The term about or approximately may mean within an acceptable range of error for the particular value, as determined by one skilled in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, about may mean within 1 or more than 1 standard deviation, Petition 870250102047, dated 07 / 11 / 2025, p. 34 / 460 27 / 272 according to practice in the art. Alternatively, approximately may mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly in relation to biological systems or processes, the term may mean within an order of magnitude, within 5 times, and more preferably within 2 times of a value. When particular values ​​are described in the application and claims, unless otherwise indicated, the term approximately means within an acceptable error range for the particular value to be assumed.

[0065] As used in this descriptive report and in the claims, the words comprising (and any form of comprising, such as comprises and to comprise), having (and any form of having, such as has and to have), including (and any form of including, such as includes and to include) or containing (and any form of containing, such as contains and to contain) are inclusive or open-ended and do not exclude additional and unmentioned elements or steps of the method. It is contemplated that any embodiment discussed in this descriptive report can be implemented in relation to any method or composition of this disclosure and vice versa. Furthermore, the compositions of this disclosure can be used to achieve the methods of this disclosure.

[0066] An article, composition, method or similar comprising one or more elements may consist of one or more elements or may consist essentially of one or more elements. As used in this descriptive report and claims, consisting of (and any form of consisting of, such as consists of and consists in) means including and limited to. As used in this descriptive report and claims, an article, composition, method or similar consisting essentially of (and any form of consisting essentially in, such as consists essentially in and consists essentially in) means Petition 870250102047, dated 07 / 11 / 2025, page 35 / 460 28 / 272 that the article, composition, method or similar includes the enumerated elements specified; such as components, compounds, materials, steps or similar, and may include additional elements that do not materially affect the basic and novel characteristics of the article, composition, method or similar.

[0067] The reference in the descriptive report to some modalities, a modality, a modality, one or more modalities, modalities or other modalities means that a particular feature, structure or characteristic described in connection with the modalities is included in at least one or more modalities, but not necessarily all modalities, of this disclosure. To the extent that the disclosure describes aspects, components or elements associated with a particular modality in more detail or breadth, it is contemplated that the aspects, components or elements associated with such modality should be understood as encompassing the additional detail and breadth described in the disclosure.

[0068] The words "preferably" and "preferably" refer to embodiments of the invention that may provide certain benefits under certain circumstances. However, other embodiments may also be preferred under the same or other circumstances. Furthermore, mention of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

[0069] The term nucleic acid, as used in this document, refers to a polymer containing at least two nucleotides (i.e., deoxyribonucleotides or ribonucleotides) in single- or double-stranded form and includes DNA and RNA. Nucleotides contain a deoxyribose sugar (DNA) or ribose sugar (RNA), a base, and a phosphate group. Nucleotides are linked together through phosphate groups. Bases include purines and pyrimidines, which additionally include the natural compounds adenine (A), thymine (T), and guanine. Petition 870250102047, dated 07 / 11 / 2025, page 36 / 460 29 / 272 (G), cytosine (C), uracil (U), inosine (I) and natural analogs and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications that add new reactive groups, such as, but are not limited to, amines, alcohols, thiols, carboxylates and alkyl halides. Nucleic acids include nucleic acids containing analogs of known nucleotides or modified core residues or modified linkages or sugar residues, or non-canonical / chemically modified nucleobases and combinations thereof, which are synthetic, naturally occurring and non-naturally occurring and which have binding properties similar to those of the reference nucleic acid. Examples of such analogues and / or modified residues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral methyl phosphonates, 2'-O-methyl ribonucleotides and peptide nucleic acids (PNAs).

[0070] The term nucleic acid includes any oligonucleotide (e.g., gRNA) or polynucleotide (e.g., mRNA, genomic DNA), with fragments containing up to 150 nucleotides generally termed oligonucleotides and longer fragments termed polynucleotides. A deoxyribo-oligonucleotide consists of a 5-carbon sugar called deoxyribose covalently linked to phosphate at the 5' and 3' carbons of this sugar to form an alternating, unbranched polymer. DNA can be in the form of, for example, antisense molecules, plasmid DNA, precondensed DNA, a PCR product, vectors, expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. A ribo-oligonucleotide consists of a similar repeating structure in which the 5-carbon sugar is ribose.Consequently, the terms polynucleotide and oligonucleotide can refer to a polymer or oligomer of nucleotide or nucleoside monomers consisting of naturally occurring bases, sugars, and intersugar linkages (structure). Petition 870250102047, dated 07 / 11 / 2025, page 37 / 460 30 / 272 main). The terms polynucleotide and oligonucleotide may also include polymers or oligomers comprising non-naturally occurring monomers, or portions thereof, that function similarly. These modified or substituted oligonucleotides are often preferred over native forms due to properties such as, for example, enhanced cellular uptake, reduced immunogenicity, and increased stability in the presence of nucleases. It should be understood that the terms polynucleotide and oligonucleotide may also include polymers or oligomers comprising combinations of deoxy- and ribonucleotides or variants thereof in combination with modifications to the main structure, such as those described in this document.

[0071] The nucleic acid described in this document may include one or more nucleotide variants, including non-standard nucleotides, unnatural nucleotides, nucleotide analogs and / or modified nucleotides.Examples of modified nucleotides include, but are not limited to, diaminopurine, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylkeosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine. 5'-methoxycarboxymethyluracil, 5methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxosin, pseudouracil, queosin, 2-thiocytosine, 5-methyl-2-thiouracil, 2thiouracil, 4-thiouracil, 5-methyluracil, acid methyl ester uracil-5-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, 2,6diaminopurine and the like.In some cases, nucleotides may be included. Petition 870250102047, dated 07 / 11 / 2025, page 38 / 460 31 / 272 modifications in their phosphate fractions, including modifications in a triphosphate fraction. Non-limiting examples of such modifications include longer phosphate chains (e.g., a phosphate chain with 4, 5, 6, 7, 8, 9, 10 or more phosphate fractions) and modifications with thiol fractions (e.g., alpha-thiotriphosphate and beta-thiotriphosphates).

[0072] The nucleic acid described in this document may be modified in the base moiety (e.g., in one or more atoms that are typically available to form a hydrogen bond with a complementary nucleotide and / or in one or more atoms that are not normally capable of forming a hydrogen bond with a complementary nucleotide), sugar moiety, or phosphate backbone. Modifications of the backbone may include, but are not limited to, a phosphorothioate, a phosphorodithioate, a phosphorosellenoate, a phosphorodisellenoate, a phosphoranyladate, a phosphoramidate, and a phosphorodiamidate linkage. A phosphorothioate linkage replaces a sulfur atom with an unbridged oxygen in the phosphate backbone and retards nuclease degradation of oligonucleotides. A phosphorodiamidate linkage (N3'^P5') prevents nuclease recognition and degradation.Modifications to the main structure may also include peptide linkages instead of phosphorus in the main structure (e.g., N-(2-aminoethyl)glycine units linked by peptide bonds in a peptide nucleic acid) or linking groups including carbamate, amides, and linear and cyclic hydrocarbon groups. Oligonucleotides with modified main structures are reviewed in Micklefield, Curr. Med. Chem., 8 (10): 1157-79, 2001 and Lyer et al., Curr. Opin. Mol. Ther., 1 (3): 344-358, 1999. The nucleic acid molecules described in this document may contain a sugar moiety comprising ribose or deoxyribose, as present in naturally occurring nucleotides, or a modified sugar moiety or sugar analog. Petition 870250102047, dated 07 / 11 / 2025, page 39 / 460 32 / 272 Modified sugar fractions include, but are not limited to, 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminoethyl, 2'-fluoro, N3'^P5' phosphoroamidate, 2'-dimethylaminooxyethoxy, 2'-2'-dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidinium ethyl, carbamate-modified sugars, and bicyclic modified sugars. 2'-O-methyl or 2'-O-methoxyethyl modifications may be included to promote the A-form or RNA-like conformation in oligonucleotides, increase RNA binding affinity, and enhance nuclease resistance. The modified sugar moieties may also include an extra bridging link (e.g., a methylene bridge linking the 2'-O and 4'-C atoms of ribose in a blocked nucleic acid) or a sugar analog, such as a morpholine ring (e.g., as in a morpholino phosphorodiamidate).

[0073] This disclosure covers man-made nucleic acid molecules, isolated or substantially purified, and compositions containing such molecules. As used in this document, an isolated or purified DNA molecule or RNA molecule is a DNA molecule or RNA molecule that exists outside its native environment. An isolated DNA molecule or RNA molecule may exist in a purified form or may exist in a non-native environment, such as, for example, a transgenic host cell. For example, an isolated or purified nucleic acid molecule or biologically active portion thereof is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.In one embodiment, an isolated nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.

[0074] As used in this document, the terms protein, Petition 870250102047, dated 07 / 11 / 2025, page 40 / 460 33 / 272 Polypeptide and peptide are used interchangeably and refer to a polymer of amino acid residues linked by peptide bonds and which may be composed of two or more polypeptide chains. The terms polypeptide, protein, and peptide refer to a polymer of at least two amino acid monomers linked by amide bonds. An amino acid may be the L-optical isomer or the D-optical isomer. More specifically, the terms polypeptide, protein, and peptide refer to a molecule composed of two or more amino acids in a specific order; for example, the order as determined by the nucleotide base sequence in the gene or RNA that encodes the protein. Proteins are essential for the structure, function, and regulation of the body's cells, tissues, and organs, and each protein has unique functions. Examples of proteins include hormones, enzymes, antibodies, and any fragments thereof.In some cases, a protein may be a portion of a protein, for example, a domain, a subdomain, or a motif of the protein. In some cases, a protein may be a variant (or mutant) of the protein, in which one or more amino acid residues are inserted, deleted, and / or substituted in the naturally occurring (or at least a known) amino acid sequence of the protein. A protein or a variant thereof may be naturally occurring or recombinant. Methods for detecting and / or measuring polypeptides in biological material are well known in the art and include, but are not limited to, Western blotting, flow cytometry, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), and various proteomic techniques, such as mass spectrometry. An exemplary method for measuring or detecting a polypeptide is an immunoassay, such as an ELISA.This type of protein quantification can be based on an antibody capable of capturing a specific antigen and a second antibody capable of detecting the captured antigen. Petition 870250102047, dated 07 / 11 / 2025, page 41 / 460 34 / 272

[0075] The term subject or patient encompasses mammals. Examples of mammals include, but are not limited to, any member of the class Mammalia: humans, non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs and cats; laboratory animals including rodents such as rats, mice and guinea pigs; and the like.

[0076] A subject in need refers to an individual who has a disease, a symptom of the disease, or a predisposition to the disease, with the aim of curing, healing, alleviating, mitigating, altering, remedying, improving, or affecting the disease, the symptom of the disease, or the predisposition to the disease. In one or more modalities, the subject has a high concentration of Lp(a) in the blood.

[0077] To administer and its grammatical equivalents, as used in this document, may refer to the delivery of one or more pharmacological substances (e.g., mRNA encoding editor proteins, guide oligonucleotides), pharmaceutical products (e.g., LNPs encapsulating pharmacological substances for delivery to target cells / tissues), or pharmaceutical compositions thereof, as described in this document, to a subject or patient. By way of example and without limitation, administration may be performed by intravenous (iv) injection, subcutaneous (sc) injection, intradermal (id) injection, intraperitoneal (ip) injection, intramuscular (im) injection, intravascular injection, intracerebroventricular (icv) injection, intrathecal (it) injection, infusion (inf.), oral (po) routes, topical (top.) administration, or rectal (pr) administration. One or more of these routes may be employed.

[0078] The term parenteral, as used in this document, includes subcutaneous, intracutaneous, intravenous injection or infusion techniques, Petition 870250102047, dated 07 / 11 / 2025, page 42 / 460 35 / 272 intramuscular, intra-articular, intra-arterial, intrasynovial, intrasternal, intracerebroventricular, intrathecal, intralesional and intracranial. Parenteral administration may be, for example, by bolus injection or by gradual infusion over time. In addition, it may be administered to the subject via injectable depot routes, such as the use of injectable or biodegradable depot materials and methods for 1, 3 or 6 months.

[0079] The terms treat, treating or treatment and their grammatical equivalents, as used in this document, may include relieving, reducing or improving at least one symptom of a disease or condition, preventing further symptoms, inhibiting the disease or condition, for example, halting the development of the disease or condition, alleviating the disease or condition, causing regression of the disease or condition, mitigating a condition caused by the disease or condition or interrupting the symptoms of the disease or condition prophylactically and / or therapeutically. Treating may refer to the administration of a composition comprising a nanoparticle, such as a lipid nanoparticle (LNP), to a subject before or after the onset, or suspected onset, of a disease or condition.Treating includes the concepts of alleviating, which refers to decreasing the frequency of occurrence or recurrence, or the severity, of any symptoms or other harmful effects related to a disease or condition and / or the side effects associated with the disease or condition. The term treating also encompasses the concept of managing, which refers to reducing the severity of a particular disease or disorder in a patient or delaying its recurrence, for example, prolonging the remission period in a patient who has suffered from the disease. The term treating further encompasses the concepts of preventing, anticipating, and prevention. It is appreciated that, while not preventing, the treatment of a disorder or condition does not require that the disorder, condition, or symptoms associated with it be completely eliminated. Petition 870250102047, dated 07 / 11 / 2025, page 43 / 460 36 / 272

[0080] As used in this document, the terms prevent, preventing, prevention and the like refer to reducing the likelihood of developing a disease or condition in a subject who does not have, but is at risk of or is susceptible to developing a disease or condition.

[0081] The term improve, as used in this document, may refer to slowing, suppressing, attenuating, diminishing, stopping, or stabilizing the development or progression of a disease.

[0082] As used in this document, delaying the development of a disease means postponing, preventing, slowing down, delaying, stabilizing, and / or delaying the progression of the disease. This delay can be for varying periods of time, depending on the history of the disease and / or the individuals being treated. A method that delays or alleviates the development of a disease, or delays the onset of the disease, is a method that reduces the likelihood of developing one or more symptoms of the disease within a given period of time and / or reduces the extent of symptoms within a given period of time, when compared to not using the method. Such comparisons are typically based on clinical studies, using a sufficient number of subjects to generate a statistically significant result.

[0083] Development or progression of a disease means initial manifestations and / or subsequent progression of the disease. Disease development may be detectable and assessed using standard clinical techniques well known in the art. However, development also refers to progression that may be undetectable. For the purpose of this disclosure, development or progression refers to the biological course of symptoms. Development includes occurrence, recurrence, and onset.

[0084] As used in this document, onset or occurrence of a disease includes initial onset and / or recurrence.

[0085] The term therapeutic agent or pharmacological substance Petition 870250102047, dated 07 / 11 / 2025, page 44 / 460 37 / 272 may refer to any agent that, when administered to a subject, has a therapeutic, diagnostic and / or prophylactic effect and / or produces a desired biological and / or pharmacological effect. Therapeutic agents may also be referred to as actives or active agents. Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins and nucleic acids, such as guide oligonucleotides and mRNA.

[0086] The term pharmaceutical composition and its grammatical equivalents, as used in this document, may refer to a mixture or solution comprising a therapeutically effective amount of an active pharmaceutical ingredient together with one or more excipients, carriers and / or a pharmaceutically acceptable therapeutic agent to be administered to a subject, for example, a human in need.

[0087] The term pharmaceutically acceptable and its grammatical equivalents, as used in this document, may refer to an attribute of a material that is useful in the preparation of a pharmaceutical composition that is generally safe, non-toxic, and neither biologically nor otherwise undesirable and is acceptable for veterinary and human pharmaceutical use. Pharmaceutically acceptable may refer to a material, such as a carrier or diluent, that does not negate the biological activity or properties of the compound and is relatively non-toxic, i.e., the material can be administered to a subject without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the pharmaceutical composition in which it is contained.

[0088] A pharmaceutically acceptable excipient, carrier or diluent refers to an excipient, carrier or diluent that can be administered to a subject together with an agent and that does not destroy the pharmacological activity of the agent and is not toxic when administered in Petition 870250102047, dated 07 / 11 / 2025, pp. 45 / 460 38 / 272 doses sufficient to deliver a therapeutic amount of the agent.

[0089] A pharmaceutically acceptable salt may be an acid or base salt that is generally considered in the art to be suitable for use in contact with the tissues of humans or animals without toxicity, irritation, excessive allergic response, or other problem or complication. Those skilled in the art will recognize from this disclosure and knowledge in the art that other pharmaceutically acceptable salts include those listed by Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, p. 1418 (1985).

[0090] As used in this document, the term therapeutically effective amount means an amount of an agent to be delivered (e.g., nucleic acid, drug, payload, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that is sufficient, when administered to a subject suffering from or susceptible to an infection, disease, disorder and / or condition, to treat, improve symptoms, diagnose, prevent and / or delay the onset of the infection, disease, disorder and / or condition.

[0091] The ranges provided in this document are understood to be an abbreviation for all values ​​within the range. For example, a range from 1 to 50 is understood as including any number, combination of numbers, or subrange of the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, as well as all intermediate decimal values ​​between the aforementioned integers, such as, for example... For example, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9. With regard to sub-ranges, nested sub-ranges extending from any endpoint of the range are specifically contemplated. For example, a nested sub-range of an exemplary range from 1 to 50 might comprise 1 to 10, 1 to 20, 1 to 30, and 1 to 40 in one direction, or 50 to 40, 50 to Petition 870250102047, dated 07 / 11 / 2025, pp. 46 / 460 39 / 272 30, 50 to 20 and 50 to 10 in the other direction.

[0092] The numbers expressing quantities of components, molecular weights, and so forth used in the descriptive report and claims should be understood as being modified in all cases by the term approximately. Consequently, unless otherwise indicated, the numerical parameters set forth in the descriptive report and claims are approximations that may vary depending on the desired properties to be obtained by the present invention. At a minimum, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be interpreted in light of the reported number of significant digits and applying common rounding techniques.

[0093] Notwithstanding that the numerical ranges and parameters that establish the broad scope of the invention are approximations, the numerical values ​​established in the specific examples are reported with the greatest possible accuracy. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective test measurements.

[0094] The term complementary is used throughout this application to describe two related nucleic acid sequences that can form a double-stranded complex of a first upper strand from 5' to 3' and a second lower strand from 3' to 5'. A spacer sequence of a guide nucleic acid is considered complementary to a sequence of a target nucleic acid. In the context of a guide oligonucleotide, a sequence can be considered sufficiently complementary to a target sequence if it is capable of hybridizing sufficiently with the intended DNA strand so that it can be used to guide an editing protein to the target sequence to cause an intended edit. Thus, a guide oligonucleotide is Petition 870250102047, dated 07 / 11 / 2025, pp. 47 / 460 40 / 272 complementary if, for example, it is able to hybridize sufficiently with the intended DNA strand so that it operationally positions the editor in the desired location to facilitate the intended editing.

[0095] As used in this document, a nucleic acid sequence that is substantially identical to another nucleic acid sequence is a nucleotide sequence that has 70% or more sequence identity with the other nucleic acid sequence. In some embodiments, a nucleic acid sequence that is substantially identical to another nucleic acid sequence has 75% or more, 80% or more, 85% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the other nucleic acid sequence.

[0096] For the purposes of percent sequence identity between an RNA sequence and a DNA sequence, the uracil bases in RNA should be considered identical to the thymine bases in DNA.

[0097] As used in this document, sequence identity refers to the extent to which two ideally aligned nucleic acid sequences are invariant over a component alignment window, for example, nucleotides. Identity can be readily calculated by known methods, including, but not limited to, those described in: Computational Molecular Biology (Lesk, AM, ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, AM, and Griffin, HG, eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

[0098] As used in this document, the term percentage of Petition 870250102047, dated 07 / 11 / 2025, pp. 48 / 460 41 / 272 Sequence identity or percentage of identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) nucleic acid (or its complementary strand) compared to a test (subject) nucleic acid (or its complementary strand) when the two sequences are optimally aligned. The percentage of sequence identity can be determined, when the compared sequences are aligned for maximum match, as measured using a sequence comparison algorithm described below and as known in the art, or by visual inspection.

[0099] For sequence comparison, typically one sequence acts as a reference sequence against which the test sequences are compared. When using a sequence comparison algorithm, the test and reference sequences are entered into a computer, subsequence coordinates are assigned if necessary, and the sequence algorithm program parameters are assigned. The sequence comparison algorithm then calculates the percentage of sequence identity for the test sequences with respect to the reference sequence, based on the assigned program parameters.The ideal alignment of sequences for aligning a comparison window is well known to those versed in the technique and can be conducted by tools such as the Smith and Waterman local homology algorithm, the Needleman and Wunsch homology alignment algorithm, the Pearson and Lipman similarity search method, and optionally by computerized implementations of these algorithms, such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, CA). Sequence alignment can be analyzed using a Burrows-Wheeler transform, such as the open-source software BOWTIE available at https: / / github.com / BenLangmead / bowtie. An identity fraction for... Petition 870250102047, dated 07 / 11 / 2025, pp. 49 / 460 42 / 272 aligned segments of a test sequence and a reference sequence is the number of identical components that are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, that is, the entire reference sequence or a defined smaller part of the reference sequence. The sequence identity percentage is represented as the identity fraction multiplied by 100.

[0100] Percentage identity can also be determined using BLASTX version 2.0 for translated nucleotide sequences and BLASTN version 2.0 for polynucleotide sequences. The software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high-score sequence pairs (HSPs) by identifying short words of length W in the query sequence that match or satisfy some positive-value threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., 1990). These initial neighborhood word hits act as seeds to initiate searches to find longer HSPs that contain them.Word matches are then extended in both directions along each sequence, as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a matching residue pair; always > 0) and N (penalty score for mismatched residues; always < 0). The extension of word matches in each direction is stopped when the cumulative alignment score falls by an amount X from its maximum value reached, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of any sequence is reached. Petition 870250102047, dated 07 / 11 / 2025, page 50 / 460 43 / 272 The parameters of the BLAST algorithm, W, T, and X, determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses a default word length (W) of 11, an expectation (E) of 10, a cutoff point of 100, M=5, N=-4, and a comparison of both strands.

[0101] In addition to calculating the percentage of sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, for example, Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90: 5873-5787 (1993)). One similarity measure provided by the BLAST algorithm is the least-sum probability (P(N)), which gives an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, a test nucleic acid sequence is considered similar to a reference sequence if the least-sum probability in a comparison of the test nucleotide sequence with the reference nucleotide sequence is less than about 0.1 to less than about 0.001.

[0102] Sequence identity (or, for example, identical or identical to), as used in this document, refers to the number of nucleotides or amino acids that exactly match between two different sequences. When comparing RNA and DNA sequences, the bases Uracil and Thymine are considered the same base. Gaps are not counted, and the measurement is typically relative to the shorter of the two sequences.

[0103] For example, for nucleotide sequences: A: AAGGCTT; B: AAGGC; and C: AAGGCAT, the identity of sequence A compared to reference sequence B ((Identity(A,B)) is 100% (5 identical nucleotides / min(length(A),length(B))); Identity of sequence B with reference sequence C is 100%; but the identity of sequence A with reference sequence C is 85% ((6 identical nucleotides / 7)). Petition 870250102047, dated 07 / 11 / 2025, p. 51 / 460 44 / 272

[0104] Sequence similarity (or, for example, similar sequences), as used in this document, can be described as an optimal matching problem that finds the minimum number of edit operations (insertions, deletions, and replacements) in order to transform a first sequence into an exact copy of a second sequence being aligned (edit distance). If the lengths of the first and second sequences are different, the similarity is determined with respect to the length of the shorter sequence. That is, the sequence similarity is [1-(number of edit operations / length of the shorter sequence)]. Using this, the percentage sequence similarity for nucleotide sequences A: AAGGCTT; B: AAGGC; and C: AAGGCAT, the similarity of sequence A and sequence B is 60%, the similarity of sequence B and sequence C is 60%, and the similarity of sequence A and sequence C is 86%.

[0105] It should be understood that sequence comparisons can be determined including or excluding chemical modifications. Thus, when comparing a modified oligonucleotide with an unmodified reference oligonucleotide, the percentage of sequence identity is determined based on the nucleobase sequences in the modified oligonucleotide, where the modified nucleobases are considered equivalent to the unmodified nucleobases from which the modified nucleobases are derived. For example, 2,4-Dichlorotoluene, 2,4-Dibromotoluene, and 2,4-Diiodotolume are considered equivalent to Thymine for the purpose of comparing the sequence identity of a modified oligonucleotide with an unmodified reference oligonucleotide. As another example, 4-methylbenzimidazole and 9-methylimidazole are considered equivalent to Adenine for the purpose of comparing the sequence identity of a modified oligonucleotide with an unmodified reference oligonucleotide. If the Petition 870250102047, dated 07 / 11 / 2025, page 52 / 460 45 / 272 Modified oligonucleotides include modifications to the linker moiety (e.g., different phosphate linker) and / or the sugar (e.g., ribose or dideoxyribose modified at 2'), so the nucleobase sequence of the modified oligonucleotides is compared to the nucleobase sequence in the unmodified reference sequence to determine sequence identity. For example, for nucleotide sequences: A: mA*AGGCmT *mT; B: AAGGCTT; and C: AAGGCAT, the identity of sequence A with reference sequence B is 100% (7 identical nucleotides / 7); the identity of sequence A with reference sequence C is 85% (6 identical nucleotides / 7). The percentage sequence similarity of the examples above is: Similarity of sequences A and B is 100% and sequences A and C are 86%.

[0106] When chemical modifications are included in determining identity, sequence identity is determined based on the exact modifications of each nucleotide of the reference modified oligonucleotide (e.g., based on any modifications to the linker, sugar moiety, and nucleobase). Consequently, an unmodified (or differently modified) nucleotide of an oligonucleotide is not considered identical to a corresponding modified oligonucleotide of a reference modified oligonucleotide. Thus, for example, when the following two sequences are compared for identity purposes: A: AAGGCTTC; B: mA*AGGCmT*mT, the identity of sequence A with reference sequence B is 57% (4 identical nucleotides / 7) when chemical modifications are not excluded; and the identity of sequence A with reference sequence B is 100% (7 identical nucleotides / 7) when chemical modifications are excluded.

[0107] The comparison of any modified sequence can be determined with or without chemical modifications being considered if so Petition 870250102047, dated 07 / 11 / 2025, p. 53 / 460 46 / 272 stated, for example, in a claim as such.

[0108] As used in this document, a guide nucleic acid spacer sequence is considered homologous to a target nucleic acid protospacer sequence if a gene editing system comprising a guide oligonucleotide with the spacer sequence is capable of making a modification (e.g., cut) in the target nucleic acid (e.g., cut in the sense strand or antisense strand of the target nucleic acid). A spacer sequence that is homologous to a protospacer sequence may be identical or substantially identical to the protospacer sequence.

[0109] In some embodiments, a first nucleotide sequence that is homologous to a second nucleotide sequence can hybridize with the complementary sequence of the second nucleotide sequence under strict or highly strict conditions. Strict hybridization conditions and strict hybridization washout conditions in the context of nucleic acid hybridization are sequence-dependent and differ under different environmental parameters. An extensive guide to nucleic acid hybridization is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology—Nucleic Acid Probe Hybridization Part I, Chapter 2 Overview of Hybridization Principles and Nucleic Acid Probe Assay Strategy Elsevier, New York (1993).Generally, highly stringent hybridization and washing conditions are selected to be approximately 5 °C lower than the thermal melting point Tm for the specific sequence at a defined ionic strength and pH. Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes with a perfectly matched probe. Very stringent conditions are selected to be equal to Tm for a particular probe. An example of stringent hybridization conditions is for hybridization of complementary nucleotide sequences that have more than 100 residues. Petition 870250102047, dated 07 / 11 / 2025, p. 54 / 460 47 / 272 complementary in a filter on a Southern or Northern blot is 50% formamide with 1 mg heparin at 42 °C, with hybridization being performed overnight. An example of highly rigorous washing conditions is 0.15M NaCl at 72 °C for about 15 minutes. An example of rigorous washing conditions is a 0.2* SSC wash at 65 °C for 15 minutes (see Sambrook and Russel, Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, 2001 for a description of SSC buffer). Often, a high-rigorous wash is preceded by a low-rigorous wash to remove the background probe signal. An example of a medium-rigorous wash for a duplex of, for example, more than 100 nucleotides, is 1* SSC at 45 °C for 15 minutes. An example of a low-rigor wash for a duplex of, for example, more than 100 nucleotides, is 46* SSC at 40 °C for 15 minutes.For short probes (e.g., about 10 to 50 nucleotides), stringent conditions typically involve salt concentrations less than about 1.0 M Na+ ion, typically about 0.01 to 1.0 M Na+ ion concentration (or other salts) at pH 7.0 to 8.3 and a temperature typically at least about 30 °C. Stringent conditions can also be achieved with the addition of destabilizing agents such as formamide.

[0110] The term effect or effect and its grammatical equivalents are used throughout this disclosure to refer to an action taken that will induce the creation of an intended result. The entire process by which the result is produced may not necessarily be carried out by the system used to effect the editing. Cellular processing may, for example, play a role in achieving the intended result. However, the intended result would not occur without the system. That is, the system is necessary for the intended result to be effected. For example, a double nickase in vivo editing system, such as those illustrated in the Figures Petition 870250102047, dated 07 / 11 / 2025, page 55 / 460 48 / 272 The 1A-1D system, which includes a Cas9 nickase and two guide oligonucleotides, can perform an edit on a gene without carrying out the final processing steps that result in the edit being fully incorporated into both strands of the gene. Cellular DNA repair enzymes can perform the final processing steps. Although all the steps necessary to complete the edit are not performed by the dual nickase editing system, it would still be said that the system performed the edit.

[0111] As used in this document, inactivating the LPA gene and grammatical equivalents thereof refer to edits to the LPA gene by a gene editing system that result in decreased expression of apo(a), expression of a non-functional variant of apo(a), and / or expression of an apo(a) variant with reduced function relative to wild-type apo(a). Edits to the LPA gene made by the gene editing systems described in this document may result in indel and / or non-synonymous variants. Indel and / or non-synonymous variants of the LPA gene may result in the production of pre-mRNA that is degraded by, for example, nonsense-mediated decay. Indel and / or non-synonymous variants of the LPA gene may result in the production of apo(a) variants with reduced function and, in some cases, no function, relative to wild-type apo(a).

[0112] In several places throughout the application, guidance is provided by way of examples, which examples, including particular aspects thereof, may be used in various combinations and be the subject of claims. In each case, the cited elements serve only as a representative group and should not be construed as an exclusive list. It should be understood that the particular examples, materials, quantities and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention, as set forth herein. Petition 870250102047, dated 07 / 11 / 2025, p. 56 / 460 49 / 272 document, and it is contemplated that the various aspects set forth in the examples and disclosure may be combined and set forth in distinct patentable claims.

[0113] For any method disclosed in this document that includes discrete steps, the steps may be conducted in any feasible order and, as appropriate, any combination of two or more steps may be conducted simultaneously. II. APOLIPOPROTEIN PROTEIN AND LPA GENE

[0114] The LPA gene is highly similar to the PLG (plasminogen) gene, from which it evolved in primates, and the protein products of the two genes have structural similarities. Each has kringle type IV (KIV) and kringle type V (KV) domains and protease-like domains. Apo(a) comprises 10 types of KIV domains (KIVi to KIV10), with a variable number of KIV2 repeat domains ranging from 2 to more than 40 and single domains of the other 9 types, a single KV domain, and an inactive protease-like domain. Lp(a) concentrations in the blood are largely genetically determined and vary inversely with the number of KIV2 repeats, as LPA alleles with fewer repeats result in smaller apo(a) isoforms that are produced and processed more rapidly in hepatocytes. There is wide interindividual variation in Lp(a) blood concentrations, with one in five individuals having elevated concentrations that signify a substantially increased risk of cardiovascular disease.On the other hand, individuals with very low concentrations of Lp(a) in the blood, caused by naturally occurring null variants in LPA, are protected against ASCVD without any significant adverse consequences.

[0115] Apolipoprotein(a) [apo(a)] is a defining component of Lp(a). Apo(a) is understood to be synthesized primarily in hepatocyte cells of the liver. Apo(a) comprises single copies of the KIVi domain and Petition 870250102047, dated 07 / 11 / 2025, page 57 / 460 50 / 272 KIV3 to KIV10 domains, a variable number of KIV2 repeat domains ranging from 2 to more than 40, a single KV domain, and an inactive protease-like domain. The wild-type apo(a) protein annotated in the reference human genome (GRCh38 / hg38, NCBI) has six KIV2 repeat domains, is 2040 amino acids long, and has the amino acid sequence below. It should be understood that the sequence below represents one of the many apo(a) isoforms present in the human population.

[0116] It should be understood that the preceding sequence employs conventional standard nomenclature well known in the art, with each letter denoting an amino acid. Letter 3 Letters Amino Acid A Ala alanine B Asx aspartic acid or asparagine C Cys cysteine ​​D Asp aspartic acid E Glu glutamic acid F Phe phenylalanine G Gly glycine H His histidine I Ile isoleucine K Lys lysine L Leu leucine M Met methionine N Asn asparagine P Pro proline Q Gln glutamine R Arg arginine S Ser serine Petition 870250102047, dated 07 / 11 / 2025, page 58 / 460 51 / 272 T Thr threonine V Val valine W Trp tryptophan o Y Tyr tirosina Z Glx glutamic acid or glutamine

[0117] The LPA gene, which is annotated in the reference human genome (GRCh38 / hg38, NCBI), is composed of 39 exons and is located on chromosome 6 at 6q25.3 from nucleotide 160, 664, 275 to nucleotide 160,531,482.

[0118] The complete sequence of the human LPA gene is available at UniProtKB - P08519 (APOA_HUMAN).

[0119] Elevated Lp(a) concentrations in the blood are a well-established casual risk factor for ASCVD and calcified aortic valve disease. Individuals with very low Lp(a) concentrations in the blood, caused by naturally occurring null variants in LPA, are protected against ASCVD without any significant adverse consequences.

[0120] The inventors show below that editing to introduce indel or non-synonymous variants into the coding sequence of the LPA gene using a gene editing approach is possible, providing a unique treatment approach for patients with elevated Lp(a) concentrations in the blood.

[0121] Any subject with an elevated concentration of Lp(a) in the blood can be treated using the gene editing approach described in this document. Subjects with elevated concentrations of Lp(a) in the blood can be identified through laboratory tests, genetic screening or similar methods, or a combination thereof.

[0122] In modalities, one method involves identifying a subject with a high concentration of Lp(a) in the blood and administering to the subject a Petition 870250102047, dated 07 / 11 / 2025, page 59 / 460 52 / 272 composition comprising components capable of introducing indel or non-synonymous variants into the coding sequence of the LPA gene. Administration of the composition to the subject may involve administering a therapeutically effective amount of the composition to the subject. Edits made to the LPA gene may result in reduced functionality of the apo(a) protein. Edits made to the LPA gene may result in a reduction in the concentration of Lp(a) in the blood.

[0123] The compositions described in this document that include a gene editing system include one or more guide nucleic acids designed to target one or more protospacer regions in the LPA gene. III. GENE EDITING / GENE MODIFICATION

[0124] The term gene editing or gene modification and their grammatical equivalents, as used in this document, refer to genetic manipulation in which one or more nucleotides are modified, inserted, substituted, or removed from a genome. Gene editing can be performed using man-made, non-naturally occurring gene editing systems comprising one or more nucleases, which may be derived from naturally occurring nucleases or artificially manipulated. Gene modification may include introducing a double-strand break, a nonsense variant, a frameshift variant, a splice site alteration, or an inversion in a polynucleotide sequence, for example, a target polynucleotide sequence. Gene modification can also be performed using other editing systems, such as dual nickase editor systems, as illustrated and described in Figures 1A-1D.

[0125] Any suitable gene editing system can be used to effect editing in the LPA gene. The gene editing system may include a gene editor and a suitable guide nucleic acid for use. Petition 870250102047, dated 07 / 11 / 2025, page 60 / 460 53 / 272 with the gene editor. For the purposes of this disclosure, a gene editor system that includes a nucleic acid capable of being translated, or transcribed and translated, into a gene editor protein or protein component of a gene editor is considered a gene editor system that includes a gene editor. The nucleic acid may be, for example, plasmid DNA or mRNA. The mRNA may be mature mRNA or pre-mRNA that can be processed, for example, within a cell, to mature mRNA, which can then be translated, for example, within a cell, to produce the gene editor. For the purposes of this disclosure, a gene editor system that includes a nucleic acid capable of being transcribed to produce gRNA is considered a gene editor system comprising gRNA. The nucleic acid may be, for example, plasmid DNA. In embodiments, the gene editor is a variant of Cas9 or a related gene editor.In these modalities, the gene editor is a nickase, as described in Figures 1A-1D. A. Cas9 and related nucleic acid-targeted editing proteins

[0126] A ribonucleoprotein complex from S. pyogenes capable of introducing double-strand breaks into double-stranded DNA was published by Jennifer Doudna's group in 2012 (Jinek et al. Science August 17, 2012;337(6096):81621). In this context, the term ribonucleoprotein is used to refer to a non-covalent combination of RNA and protein. Clustered regularly interspaced short palindromic repeats (CRISPR) and a CRISPR-associated protein (Cas) have been described. CRISPR regions have been shown to be transcribed into short RNA sequences (crRNA), which can then form a hairpin with another short RNA sequence called transactivator CRISPR RNA (tracrRNA) to form a guide RNA (gRNA). Operationally, crRNA comprises a nucleotide sequence Petition 870250102047, dated 07 / 11 / 2025, p. 61 / 460 54 / 272 (known as a spacer or spacer sequence) that is complementary to the target DNA strand, while tracrRNA serves as a binding scaffold for the Cas protein. The Cas protein can then complex with the gRNA, and the ribonucleoprotein is targeted to a sequence substantially identical to the crRNA sequence. The sequence that is substantially identical to the crRNA is known as the protospacer sequence and is directly adjacent to a protospacer-adjacent motif (PAM). For S. pyogenes Cas9, PAM is an NGG sequence, where N represents any standard nucleotide and G represents guanine.

[0127] The Cas protein contains two nuclease domains capable of cleaving the phosphate backbone of a nucleic acid, called the HNH domain and the RuvC domain. The HNH domain cleaves the backbone of the complementary strand to the gRNA, referred to as the target strand, while the RuvC domain cleaves the backbone of the opposite strand, also referred to as the non-target strand or displaced strand (i.e., the strand containing the protospacer). When the gRNA-Cas complex binds to a double-stranded DNA sequence, each nuclease domain cleaves the backbone of one strand of DNA, causing a double-strand break (DSB). DSBs can be repaired by the cell in several ways, including the creation of an insertion or deletion (indel), homology-directed repair (HDR), microhomology-mediated end joining (MMEJ), or mismatch repair (MMR). Multiple Cas-based systems have been engineered to exploit each of these repair pathways.The guide RNA design was further characterized and manipulated to improve editing efficiency and produce different editing results.

[0128] Other variants of Cas9 and Cas-like proteins have also been characterized. In addition, the amino acid sequence of each domain Petition 870250102047, dated 07 / 11 / 2025, page 62 / 460 The 55 / 272 nuclease of Cas9 can be mutated to impair the nuclease activity of the Cas9 protein to produce a Cas9 nickase protein (nCas9) that introduces a single-strand break in a targeted DNA sequence, instead of a double-strand break. The D10A mutation of the RuvC domain results in a Cas9 protein that will cut only the strand complementary to the gRNA (i.e., the target strand). Such nickases based on the D10A mutation of the RuvC domain of the Cas9 protein are used in base-editing systems to cut the target strand, which is the strand opposite the strand containing the protospacer. The H840A mutation of the HNH domain results in a Cas9 protein that will cut only the offset strand (i.e., the strand containing the protospacer sequence). Such nickases based on the H840A mutation of the HNH domain of the Cas9 protein are used in template-based editing systems to cut the non-target strand or the protospacer sequence.Mutations that impair both nuclease domains produce a catalytically killed Cas9 (also called dCas9), which is still capable of binding to a gRNA and targeting a region of a gene, but does not inherently alter the target region. A variety of modified and unmodified Cas proteins have been described (see, for example, Cong et al., Science 339, 819-823 (2013); Mali et al., Science 339, 823-826 (2013); Hwang et al., Nature Biotechnology 31, 227-229 (2013); Jinek et al., eLife 2, e00471 (2013); Dicarlo et al., Nucleic Acids Research (2013); and Jiang et al., Nature Biotechnology 31, 233-239 (2013)). Cas9- and Cas-like proteins include, but are not limited to, SpCas9 (e.g., dCas9 and nCas9), SaCas9 (e.g., SaCas9d, SaCas9d, SaKKH Cas9), NmeCas9, CasX, CasY, Cas12a / Cpf1, C2c1, C2c2, C2c3, and Argonauta. A gene editor described in this document may include a Cas9- or Cas-related domain or protein, or suitable variants of the domain or protein. B. Dual Nickase editor systems

[0129] A dual nickase gene editing system Petition 870250102047, dated 07 / 11 / 2025, page 63 / 460 56 / 272 comprises one or more nickases, a first guide oligonucleotide, and a second guide oligonucleotide. At least one of the nickases is configured to interact with the first guide oligonucleotide. In interaction with the first guide oligonucleotide, the nickase is manipulated to cut either the first or second strand of the LPA gene. At least one of the nickases is configured to interact with the second guide oligonucleotide. In interaction with the second guide oligonucleotide, the nickase is manipulated to cut either the first or second strand of the LPA gene. The nickases that interact with the first and second guide oligonucleotides may be the same or different. The resulting cuts in opposite strands in the LPA gene may activate a cellular DNA repair mechanism, which may result in an indel variant or non-synonymous variant in the LPA gene.Consequently, the double nickase system can effect either the indel variant or the non-synonymous variant.

[0130] Figures 1A-1D illustrate dual nickase editing systems comprising a single nickase editor. The nickase editor is a protein or protein complex capable of effecting indel variants or non-synonymous variants at a targeted DNA site using two guide nucleic acids. The nickase editor may comprise a Cas9 nickase.

[0131] A dual nickase editing system (nickase protein and two guide nucleic acids) may be able to locate a specific target in a gene or genome by cutting both strands at separate positions in a targeted DNA site. The nickase protein can be catalytically inactivated or compromised so that it cuts at most one strand of a double-stranded nucleic acid target. The D10A mutation of the RuvC domain of the Cas9 protein described above and the H840A mutation of the HNH domain of the Cas9 protein described above are examples of a compromised nuclease that is capable of being used in a dual nickase editing system. Petition 870250102047, dated 07 / 11 / 2025, page 64 / 460 57 / 272

[0132] Any suitable dual nickase editing system can be used to effect editing in the LPA gene of a cell or subject. A cell or subject can be treated with a lipid nanoparticle (LNP) assembled encapsulating or otherwise comprising the nickase protein or a nucleic acid, such as an mRNA, encoding the nickase protein and two guide nucleic acids to effect editing.

[0133] The double nickase editing process can occur as shown in Figure 1A or Figure 1C. The targeted DNA site is engaged by the Cas9-D10A protein via the spacer region of the first guide nucleic acid, which is substantially identical to a protospacer sequence on one strand of the targeted DNA site. The Cas9-D10A domain cuts the target strand of the first guide nucleic acid (i.e., the strand hybridized with the first spacer sequence). Separately, the targeted DNA site is engaged by the Cas9-D10A protein via the spacer region of the second guide nucleic acid, which is substantially identical to a protospacer sequence on the other strand of the targeted DNA site. The Cas9-D10A domain cuts the target strand of the second guide nucleic acid (i.e., the strand hybridized with the second spacer sequence).The orientation of the protospacer sequences relative to each other determines whether the two cleavage sites are some distance apart (Figure 1A) or close together (Figure 1C). The two cleavages in opposing DNA strands are subsequently repaired by the cell via non-homologous end joining and may produce indel or non-synonymous variants.

[0134] The double nickase editing process can occur as shown in Figure 1B or Figure 1D. The targeted DNA site is engaged by the Cas9-H840A protein via the spacer region of the first guide nucleic acid, which is substantially identical to a protospacer sequence on a strand of the targeted DNA site. The Cas9 domain Petition 870250102047, dated 07 / 11 / 2025, page 65 / 460 58 / 272 H840A cuts the non-target strand of the first guide nucleic acid (i.e., the strand with the first protospacer sequence). Separately, the targeted DNA site is engaged by the Cas9-H840A protein via the spacer region of the second guide nucleic acid, which is substantially identical to a protospacer sequence on the other strand of the targeted DNA site. The Cas9-H840A domain cuts the non-target strand of the second guide nucleic acid (i.e., the strand with the second protospacer sequence). The orientation of the protospacer sequences relative to each other determines whether the two cutting sites are close together (Figure 1B) or some distance apart (Figure 1D). The two cuts in opposing DNA strands are subsequently repaired by the cell via non-homologous end joining and may produce indel or non-synonymous variants.

[0135] In some embodiments, Cas9 nickase (or any other suitable nickase) operating with the first and second guide nucleotides cuts opposite strands of DNA to generate 5' overhangs (e.g., as shown in Figures 1A and 1D). In some embodiments, Cas9 nickase (or any other suitable nickase) operating with the first and second guide nucleotides cuts opposite strands of DNA to generate 3' overhangs (e.g., as shown in Figures 1B and 1C). The overhangs may be of any suitable length to permit non-homologous end joining. It will be understood that the length of the overhangs suitable to permit non-homologous end joining may vary based on, among other things, the composition of the overhangs. In some embodiments, the protrusions have a length of 1 to 200 nucleotides, such as 10 to 150 nucleotides, 15 to 100 nucleotides, or 20 to 50 nucleotides.In some embodiments, the protrusions have a length of 10 nucleotides or more, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or. Petition 870250102047, dated 07 / 11 / 2025, p. 66 / 460 59 / 272 nucleotides or more. In some embodiments, the overhangs have a length of 200 nucleotides or less, such as 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60 or 50 nucleotides or less. In some embodiments, the overhangs have a length of 20 to 50 nucleotides, such as 23 to 45, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 31 to 39, 32 to 39, 33 to 39 or 34 to 38 nucleotides.

[0136] One implementation of a dual nickase editing system is the D10A mutation of the RuvC domain of the Streptococcus pyogenes Cas9 protein (SpCas9-D10A). The protein and cDNA sequences of SpCas9D10A are shown in Table 1. Also shown in Table 1 is a chemically modified mRNA sequence (MS029) that has been manipulated to express SpCas9-D10A in cells, including with respect to editing in the LPA gene, as further described in this document.

[0137] One implementation of a dual nickase editing system is the H840A mutation of the RuvC domain of the Streptococcus pyogenes Cas9 protein (SpCas9-H840A). The protein and cDNA sequences of SpCas9H840A are shown in Table 1. Also shown in Table 1 is a chemically modified mRNA sequence that has been manipulated to express SpCas9-H840A in cells, including with respect to editing in the LPA gene, as further described in this document. Table 1. SpCas9 nickase protein, cDNA, and mRNA sequences Legend Ψ N1-methyl pseudouridine

[0138] In some embodiments, an mRNA encoding a nickase has a sequence of an mRNA listed in Table 1. In some embodiments, an mRNA encoding a nickase has a sequence that is Petition 870250102047, dated 07 / 11 / 2025, p. 67 / 460 60 / 272 at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to an mRNA sequence listed in Table 1.

[0139] In some embodiments, an mRNA encoding a nickase has a coding sequence of an mRNA listed in Table 1. In some embodiments, an mRNA encoding a nickase has a coding sequence that is at least about 90% identical, at least about 91% identical, at least about 92% identical, at least about 93% identical, at least about 94% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, or at least about 99% identical to a coding sequence of an mRNA sequence listed in Table 1.

[0140] It will be understood that the coding sequence of an mRNA listed in Table 1 may be modified or optimized, the untranslated regions (UTRs) and / or the 5' and 3' ends (e.g., within three or within five nucleotides from the end) may be modified or optimized to enhance or alter the stability and / or expression of the mRNA. In some embodiments, the mRNA may comprise one or more stabilizing motifs, such as a 5' and / or 3' end stabilizing motif.

[0141] As described in this document, dual nickase editing systems are disclosed to perform editing in the LPA gene. IV. Guide Nucleic Acids and Targeted DNA Sequences

[0142] In embodiments, a dual nickase editing system comprises more than one guide nucleic acid. In some embodiments, a Petition 870250102047, dated 07 / 11 / 2025, pp. 68 / 460 The 61 / 272 dual nickase editing system comprises two guide nucleic acids.

[0143] A guide nucleic acid sequence directs a gene editor to a target genomic location. The guide nucleic acid may vary depending on the gene editor. This disclosure refers to guide nucleic acids as guide nucleic acid sequences, guide RNAs, gRNAs, and / or guide oligonucleotides. As described in this document, guide RNAs may comprise an RNA sequence that may or may not be chemically modified. Although gRNAs commonly comprise RNA sequences, it should be understood that portions of a guide RNA may not be ribonucleic acids but may comprise deoxyribonucleic acid or other chemical substitutions, including nucleotide analogs.

[0144] Each guide nucleic acid may include a nucleotide sequence that is complementary to a targeted site on chromosomal DNA. The portion of the guide nucleic acid that specifies the target site is referred to in this document as the spacer. The spacer is typically located at the 5' end of the guide nucleic acid. The strand of chromosomal DNA that contains a sequence that is complementary to the spacer is referred to in this document as the target strand. The non-target strand, also referred to as the offset strand, of chromosomal DNA harbors a sequence that is identical or substantially identical to the spacer, referred to in this document as the protospacer.

[0145] In one or more embodiments, each guide nucleic acid includes a spacer sequence that is identical or substantially identical to a protospacer sequence of the LPA gene. In embodiments, the gene editing system comprises two guide nucleic acids, each with different spacer sequences, where each spacer sequence is identical or substantially identical to a protospacer sequence specified in Table 2 or Table 5. In some embodiments, a Petition 870250102047, dated 07 / 11 / 2025, p. 69 / 460 62 / 272 A guide oligonucleotide comprises a spacer comprising a sequence identical or substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a protospacer sequence specified in Table 2 or Table 5. In some embodiments, a guide oligonucleotide comprises a spacer comprising a sequence identical or substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a protospacer sequence specified in Table 2 or Table 5 with 0, 1, 2, 3, 4, or 5 mismatches. In some embodiments, a guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to a protospacer sequence specified in Table 2 or Table 5.In some embodiments, a guide oligonucleotide comprises a spacer with a sequence that is identical to a protospacer sequence specified in Table 2 or Table 5.

[0146] In embodiments, a gene editing system described in this document comprises a first guide oligonucleotide and a second guide oligonucleotide, wherein the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 1 specified in Table 2 or Table 5 and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to a corresponding guide protospacer sequence 2 (in the same row) specified in Table 2 or Table 5. In some embodiments, the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a guide protospacer sequence 1 specified in Table 2 or Table 5 and the second guide oligonucleotide comprises an identical or Petition 870250102047, dated 07 / 11 / 2025, page 70 / 460 63 / 272 substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a corresponding guide protospacer sequence 2 (in the same row) specified in Table 2 or Table 5. In some embodiments, the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a guide protospacer sequence 1 specified in Table 2 or Table 5 with 0, 1, 2, 3, 4, or 5 mismatches, and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of a corresponding guide protospacer sequence 2 (on the same line) specified in Table 2 or Table 5 with 0, 1, 2, 3, 4, or 5 mismatches.In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to a guide protospacer sequence 1 specified in Table 2 or Table 5, and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to a corresponding guide protospacer sequence 2 (in the same row) specified in Table 2 or Table 5.In some embodiments, the first guide oligonucleotide comprises a spacer sequence identical to a guide protospacer sequence 1 specified in Table 2 or Table 5, and the second guide oligonucleotide comprises a spacer sequence identical to a corresponding guide protospacer sequence 2 (in the same row) specified in Table 2 or Table 5. Table 2. Examples of protospacers to which the spacers of Petition 870250102047, dated 07 / 11 / 2025, p. 71 / 460 64 / 272 guide oligonucleotides may correspond The PAM sequence is shown in bold and underlined; the corresponding spacers may have sequences identical to the protospacer sequences (U is replaced by T if the spacer sequence is RNA).

[0147] Each guide nucleic acid may include a portion that is recognized and binds to the gene editor (e.g., nickase). The portion of the guide nucleic acid that recognizes and binds to the gene editor may be referred to in this document as the scaffold region. The scaffold region may form one or more stem-loop structures that are recognized by the gene editor. The length of a loop and a stem may vary. In one or more embodiments, a loop may range from about 3 to about 10 nucleotides in length. In one or more embodiments, a stem may range from about 6 to about 20 nucleotides in length. A stem may comprise one or more protrusions of 1 to 10 nucleotides or about 10 nucleotides. In one or more embodiments, the total length of a second region may range from about 16 to 60 nucleotides in length. In one or more embodiments, a loop may be about 4 nucleotides long.In one or more embodiments, a stem may be about 12 nucleotides long. The scaffold region may include a region that does not form a stem-loop structure. This portion without substantial secondary structure may be of any suitable length, such as ranging from about 3 to about 100 nucleotides in length. The portion of the scaffold region without substantial secondary structure may be located at the 3' end of the guide nucleic acid. In some embodiments, the scaffold region comprises a tracr sequence. In some embodiments, the scaffold region consists of, or essentially consists of, a tracr sequence.

[0148] In one or more modalities, the sequence of the region of Petition 870250102047, dated 07 / 11 / 2025, p. 72 / 460 The 65 / 272 scaffold includes one of the following sequences: 5'GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGC -3', or 5'GUUUGAGAGCUAUGCUGGAAACAGCAUAGCAAGUUCAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-3'.

[0149] In one or more embodiments, the scaffold region may have a sequence that is at least 75%, at least 85%, at least 90%, or at least 95% identical to one of the sequences in this document. It should be evident to one skilled in the art that the sequence and / or length of the appropriate scaffold region may change depending on a number of factors, such as the editing protein used. In one or more embodiments, the scaffold region may include DNA and / or RNA nucleotides. The scaffold region may be modified as described in this document.

[0150] In one or more embodiments, the scaffold region sequence comprises, consists essentially of, or consists of: 5'mGUUUUAGmAmGmCmUmAGmAmAmAmUmAmGmCmAmAGUUmAAmAA mUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmA mAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmC 3', where m of mN is 2'-O-methyl ribose.

[0151] In one or more embodiments, a guide oligonucleotide may include an unstructured or structured RNA motif designed to be able to prevent nucleic acid degradation. The RNA motif may be located at the 3' end of the nucleic acid. The nucleic acid may include any suitable RNA motif, such as RNA motifs including the sequences listed below.

[0152] In one or more embodiments, a guide oligonucleotide Petition 870250102047, dated 07 / 11 / 2025, p. 73 / 460 66 / 272 includes an RNA motif at the 5' end of the nucleic acid. In one or more embodiments, the guide oligonucleotide includes an RNA motif at both the 5' and 3' ends. If two or more RNA stabilizing motifs are incorporated into a guide oligonucleotide, they may have the same sequence or they may have different sequences.

[0153] A guide oligonucleotide may include an unstructured RNA motif comprising, consisting essentially of, or consisting of the sequence 5'-UUU-3'. In embodiments, the unstructured motif comprises modifications of the following form: 5'-*mU*mU*mU-3', where mU* indicates a phosphorothiolated 2'-O-methyl uracil base and mU indicates a 2'-O-methyl uracil base.

[0154] A guide oligonucleotide may include a tevopreQ1 motif. A tevopreQ1 motif may be modified from a pre-keosin1-1 riboswitch aptamer. A guide oligonucleotide may include a tevopreQ1 motif comprising, consisting essentially of, or consisting of the sequence 5'CGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGAA-3'.

[0155] A guide oligonucleotide may include an mpknot motif. An mpknot motif may be modified from a frame-displacement pseudonode of Moloney murine leukemia virus. A guide oligonucleotide may include an mpknot motif comprising, consisting essentially of, or consisting of the sequence 5'GGGUCAGGAGCCCCCCCCCUGAACCCAGGAUAACCCUCAAAGUCGGGG GGCAACCC-3'.

[0156] In some embodiments, a gRNA consists of, or essentially consists of, a sequence of the following form: 5'mN*mN*mN* NNNNNNNNNNNNNNNNNmGUUUUAGmAmGmCmUmAGmAmAmAmUmA mGmCmAmAGUUmAAmAAmUAmAmGmGmCmUmAGUmCmCGUUAmUmC Petition 870250102047, dated 07 / 11 / 2025, page 74 / 460 67 / 272 AAmCmUmUGmAmAmAmAmAmGmUmGGmCmAmCmCmGmAmGmUmCm GmGmUmGmCmU*mU*mU*mU-3', where N refers to any nucleotide, m in mN is 2'-O-methyl ribose, and * refers to a phosphorothioate linkage. The first 20 nucleotides may correspond to a spacer sequence. The spacer sequence may be identical or substantially identical to a protospacer listed in Table 2 or Table 5.

[0157] A guide nucleic acid for a dual nickase editing system can have any suitable length. The length may depend on the CRISPR Cas component of the gene editing system and the components used. For example, different Cas proteins from different bacterial species have varying ideal spacer sequence lengths. Consequently, the spacer sequence may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, or more than 50 nucleotides in length. In one or more embodiments, the spacer sequence comprises 15 to 24 nucleotides in length. In some modalities, the spacer sequence comprises 18 to 24 nucleotides in length. In one or more modalities, the spacer sequence comprises 19 to 21 nucleotides in length.In one or more embodiments, the spacer sequence comprises 20 nucleotides of length + / - 1 nucleotide, + / - 2 nucleotides, or + / - 3 nucleotides.

[0158] In one or more embodiments, each guide nucleic acid includes a spacer sequence and otherwise conforms to a conventional 100-nucleotide Streptococcus pyogenes CRISPR gRNA sequence.

[0159] Each guide nucleic acid (e.g., guide RNA) can be about 15-300 nucleotides long and can comprise a sequence of at least 10 contiguous nucleotides that is substantially Petition 870250102047, dated 07 / 11 / 2025, page 75 / 460 68 / 272 identical to a protospacer sequence at a targeted DNA site. In one or more embodiments, the 3' end of the protospacer sequence is immediately adjacent to a canonical PAM sequence (e.g., NGG). In one or more embodiments, the 3' end of the protospacer sequence is not immediately adjacent to a canonical PAM sequence. In one or more embodiments, the 3' end of the protospacer sequence is immediately adjacent to a NAG, NGA, NGC, NGT, or other non-NGG sequence.

[0160] In one or more embodiments, a guide nucleic acid includes DNA nucleotides. In one or more embodiments, a guide nucleic acid includes both DNA and RNA. In one or more embodiments, a guide nucleic acid is RNA, also referred to in this document as guide RNA or gRNA. In one or more embodiments, a guide nucleic acid is a modified nucleic acid. As used in this document, a modified nucleic acid is a nucleic acid comprising at least one modified nucleobase moiety, sugar, or backbone (e.g., linkage).

[0161] In one or more embodiments, a guide nucleic acid may be synthesized. The guide nucleic acid may comprise a spacer sequence configured to hybridize with the complementary sequence on a target strand under, for example, conditions within a cell. In embodiments, the guide nucleic acid comprises a spacer sequence that is homologous to a protospacer sequence in an LPA gene. The guide nucleic acid may comprise a spacer sequence that is identical or substantially identical to a protospacer sequence. In one or more embodiments, the guide nucleic acid comprises a spacer with a sequence identical or substantially identical to a protospacer set forth in Table 2 or Table 5.

[0162] In one or more embodiments, the guide oligonucleotide may Petition 870250102047, dated 07 / 11 / 2025, p. 76 / 460 69 / 272 have a sequence established in Table 3, in which zero, one, or more nucleotides can be modified. Table 3. Exemplary sequences of guide oligonucleotides.

[0163] Although some of the guide nucleic acids described in this document have been experimentally tested and are known to effect the desired edits, multiple other guide nucleic acid sequences may be compatible with the installation of the desired edits. The guide oligonucleotides that have been experimentally tested contained modified nucleotides. Some examples of modified guide oligonucleotide sequences are provided in Table 4, some of which have been experimentally tested as described in the Examples section below. It will be understood that guide oligonucleotides modified in other ways may also be suitable for effecting the desired edits. For example, the guide oligonucleotides listed in Table 3 may be modified in a manner similar to those listed in Table 4 or in any other suitable manner.

[0164] In some embodiments, a guide oligonucleotide comprises one or more modified nucleotides. The nucleotides may be modified in any suitable manner. In some embodiments, the nucleotide comprises a modified sugar moiety. The sugar moiety may be modified in any suitable manner. In some embodiments, the modified sugar moieties comprise a 2'-O-methyl, 2'-O-methoxyethyl, 2'-O-aminoethyl, 2'-fluoro, N3'^P5' phosphoroamidate, 2'-dimethylamino-oxyethoxy, 2'-dimethylaminoethoxyethoxy, 2'-guanidinium, 2'-O-guanidinium ethyl, carbamate-modified sugars, or bicyclic modified sugars. In some embodiments, the modified nucleotide comprises a modification with 2' Petition 870250102047, dated 07 / 11 / 2025, page 77 / 460 70 / 272 O-methyl. In some embodiments, the nucleotide comprises a modification of the main structure. In some embodiments, the modifications of the structure comprise a phosphorothioate, a phosphorodithioate, a phosphorosellenoate, a phosphorodisellenoate, a phosphoanylthioate, a phosphoranyladate, a phosphoramidate, or a phosphorodiamidate linkage. In some embodiments, the modification of the main structure comprises a phosphorothioate linkage.

[0165] In some embodiments, a spacer sequence of a guide oligonucleotide comprises from 1 to 20 modified nucleotides. In some embodiments, a spacer sequence comprises from 1 to 10 modified nucleotides. In some embodiments, a spacer sequence comprises from 1 to 5 modified nucleotides. In some embodiments, a spacer sequence comprises from 1 to 3 modified nucleotides. In some embodiments, one or more of the five plus 5' nucleotides of a spacer sequence are modified. In some embodiments, one or more of the five plus 5' nucleotides of a spacer sequence are modified to include a 2'-O-methyl group, a phosphorothioate linkage, or a combination thereof. In some embodiments, one or more of the three plus 5' nucleotides of a spacer sequence are modified.In some embodiments, one or more of the three plus 5' nucleotides of a spacer sequence are modified to include a 2'-O-methyl group, a phosphorothioate linkage, or a combination thereof. In some embodiments, the three plus 5' nucleotides of a spacer sequence are modified. In some embodiments, the three plus 5' nucleotides of a spacer sequence are modified to include a 2'-O-methyl group, a phosphorothioate linkage, or a combination thereof. In some embodiments, the three plus 5' nucleotides of a spacer sequence are modified to include a 2'-O-methyl group and a phosphorothioate linkage.

[0166] In some modalities, a scaffold sequence of a Petition 870250102047, dated 07 / 11 / 2025, p. 78 / 460 71 / 272 A scaffold oligonucleotide comprises from 1 to 76 modified nucleotides, such as from 1 to 70 modified nucleotides, from 1 to 60 modified nucleotides, or from 1 to 55 modified nucleotides. In some embodiments, a scaffold sequence of a scaffold oligonucleotide comprises from 10 to 76 modified nucleotides, such as from 20 to 76 modified nucleotides, such as from 30 to 76 modified nucleotides, from 40 to 76 modified nucleotides, or from 50 to 76 modified nucleotides. In some embodiments, a scaffold sequence of a guide oligonucleotide comprises 20 to 70 modified nucleotides, as well as 30 to 65 modified nucleotides, 40 to 60 modified nucleotides, or 50 to 55 modified nucleotides.

[0167] In some embodiments, 20% to 95% of the nucleotides in the scaffold sequence are modified. In some embodiments, 30% to 90%, such as 40% to 85%, 45% to 80%, 50% to 75%, 60% to 75% or 65% to 75% of the nucleotides in the scaffold sequence are modified.

[0168] In some embodiments, a modified scaffold nucleotide comprises a 2'-sugar modification. In some embodiments, a modified scaffold nucleotide comprises a 2'-O-methyl group. In some embodiments, 20% to 95% of the nucleotides in the scaffold sequence comprise a 2'-sugar modification. In some embodiments, 30% to 90%, such as 40% to 85%, 45% to 80%, 50% to 75%, 60% to 75%, or 65% to 75% of the nucleotides in the scaffold sequence comprise a 2'-sugar modification. In some embodiments, 20% to 95% of the nucleotides in the scaffold sequence comprise a 2'-O-methyl group. In some embodiments, 30% to 90%, such as 40% to 85%, 45% to 80%, 50% to 75%, 60% to 75%, or 65% to 75% of the nucleotides in the scaffold sequence comprise a 2'-O-methyl group.

[0169] Table 5 summarizes the percentages of edited LPA alleles in primary human hepatocytes (% edited, also referred to as Petition 870250102047, dated 07 / 11 / 2025, page 79 / 460 72 / 272 as editing efficiency) versus selected guide RNA pairs (first and second gRNAs) at relatively higher and lower doses, summarizing the LPA editing efficiencies in primary human hepatocytes using a gene editing system comprising a Cas9 nickase with the specified pairs of first and second guide RNAs.

[0170] Table 6 shows the number of nucleotides between the cuts (the overhang length) for some of the gRNA pairs indicated in Table 5 and indicates the targeted exon. All cuts in Table 5 were in a PAM-out configuration.

[0171] In some embodiments, the location of the first cut and the location of the second cut are spaced about 1 to 200 nucleotides apart, such as 10 to 150 nucleotides, 15 to 100 nucleotides, or 20 to 50 nucleotides apart. In some forms, the distance between the first and second cuts is 10 nucleotides or more, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides or more. In some embodiments, the distance between cuts is 200 nucleotides or less, such as 190, 180, 170, 160, 150, 140, 130, 120, 110, 100, 90, 80, 70, 60, or 50 nucleotides or less. In some embodiments, the distance between cuts is 20 to 50 nucleotides, such as 23 to 45, 30 to 40, 31 to 40, 32 to 40, 33 to 40, 31 to 39, 32 to 39, 33 to 39, or 34 to 38 nucleotides.

[0172] Table 4 provides the complete gRNA sequences of the guides that were tested to produce the results shown in Table 5. Petition 870250102047, dated 07 / 11 / 2025, p. 80 / 460 73 / 272 Table 4. Examples of end-modified gRNAs and corresponding additional modified gRNAs (with the same spacer sequence as the end-modified gRNAs) m = 2' O-methyl analog; * = 3' phosphorothioate; the first 20 nucleotides of each sequence correspond to the spacer sequence; no guide ID indicates that a guide ID has not yet been assigned Table 5. Guide RNA identifiers and pair-editing efficiencies of selected guide RNA pairs at different doses. The tested guide oligonucleotides comprise RNA spacer sequences identical to the protospacer sequences shown in the table above, but with U replaced by T. Editing results are shown for gRNA pairs that were evaluated by transfection with MessengerMax. *Editing results for in vitro LNP distribution studies for guide pairs with spacer sequences corresponding to GA1264 / GA1184 (GA1297 / GA1296) and GA1266 / GA1184 (GA1298 / GA1296) are shown in Figure 4B and were similar to a guide pair with spacer sequences corresponding to GA1183 / GA1184 (GA1295 / GA1296) - see also Table 4 and Table 7B.**The spacer for the GA1265 tab overlaps the spacers for GA1264 (and GA1297), GA1266 (and GA1298), and GA1184 (and GA1295) (see Figure 4A for alignment of the spacer / protospacer sequences of GA1297, GA1298, and GA1295) - the protospacer for GA1265 is between (and offset by one of) the protospacer for GA1264 (and GA1297) and GA1266 (and GA1298).** Petition 870250102047, dated 07 / 11 / 2025, page 81 / 460 74 / 272 Table 6. Spacing between cuts and target exons for selected gRNA pairs.

[0173] In embodiments, a gene editing system described in this document comprises a first guide oligonucleotide and a second guide oligonucleotide, wherein the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 1 specified in Table 5 and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to a corresponding guide protospacer sequence 2 (on the same row) specified in Table 5.In embodiments, the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 1 specified in Table 5 and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to a corresponding guide protospacer sequence 2 specified in Table 5, wherein the tested guide pair from Table 5 exhibited an edit of 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, or 90% or more at a concentration of 2500 ng / ml, or wherein the gRNA pair corresponds to GA1264 / GA1184, GA1265 / GA1184 or GA1266 / GA1184.In embodiments, the gene editing system comprises a first guide oligonucleotide and a second guide oligonucleotide, wherein the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 1 specified in Table 5 and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 2. Petition 870250102047, dated 07 / 11 / 2025, page 82 / 460 75 / 272 corresponding to that specified in Table 5, where the tested guide pair from Table 5 exhibited an edition of 50% or more, 60% or more, 70% or more, 80% or more, 85% or more, or 90% or more at a concentration of 2500 ng / ml, or where the gRNA pair corresponds to GA1264 / GA1184, GA1265 / GA1184, or GA1266 / GA1184. In embodiments, the first guide oligonucleotide comprises a spacer sequence identical or substantially identical to a guide protospacer sequence 1 specified in Table 5 and the second guide oligonucleotide comprises a spacer sequence identical or substantially identical to a corresponding guide protospacer sequence 2 specified in Table 5, wherein the tested guide pair exhibited an edition of 70% or more, 80% or more, 85% or more, or 90% or more at a concentration of 2500 ng / ml, or wherein the guide pair corresponds to GA1264 / GA1184, GA1265 / GA1184 or GA1266 / GA1184.

[0174] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'CUGUCACCAGGCAUUGUGUC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'UGUCCUUGCAACUCUCUCACAGGG-3'. For clarity, an oligonucleotide comprising nucleotides 6 to 20 of 5'CUGUCACCAGGCAUUGUGUC-3' would comprise 5'-ACCAGGCAUUGUGUC3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUGUCACCAGGCAUGUGUC3' and the second guide oligonucleotide comprises a spacer with a Petition 870250102047, dated 07 / 11 / 2025, page 83 / 460 76 / 272 sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-UGUCCUUGCAACUCACGG-3'.

[0175] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'GUAGUAGCAGUCCUGUACCC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CAUUAUGGACAGAGUUACCG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GUAGUAGCAGUCCUGUACCC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CAUUAUGGACAGAGUUACCG-3'.

[0176] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AGGACACUCGAUUCUGUCAC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CACAACUCCCACAGUGGCCC-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical. Petition 870250102047, dated 07 / 11 / 2025, p. 84 / 460 77 / 272 a 5'-AGGACACUCGAUUCUGUCA-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CACAACUCCCACAGUGGCCC-3'.

[0177] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CUGUCACUGGACAUUGUGUC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AAGUGUCCUUGCGACGUCCA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUGUCACUGGACAUUGUGUC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'AAGUGUCCUUGCGACGUCCA-3'.

[0178] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'GGAGCAAAGCCCCACAGUCC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'GUUGGUGCUGAAAUUCAAAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is Petition 870250102047, dated 07 / 11 / 2025, p. 85 / 460 78 / 272 at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GGAGCAAAGCCCCACAGUCC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least less about 90%, at least about 95% identical or is identical to 5'GUUGGUGCUGAAAUUCAAAG-3'.

[0179] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'GGAGCAAAGCCCCGGGGUCC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'GUUGGUGCUGAAAUUCAAAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GGAGCAAAGCCCCGGGGUCC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'GUUGGUGCUGAAAUUCAAAG-3'.

[0180] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'CUGGAACUGGGACCACCGU-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5' Petition 870250102047, dated 07 / 11 / 2025, p. 86 / 460 79 / 272 ACAGAGCUUCCUUCUGAAGA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUGGAACUGGGACCACCGU-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACAGAGCUUCCUUCUGAAGA-3'.

[0181] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AUGCCAGUGUGGUGUCAUAG-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'ACCACAGAAUACUACCCAAA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-AUGCCAGUGUGGUGUCAUAG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACCACAGAAUACUACCCAAA-3'.

[0182] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'GGAGCCAGAAUAACAUUCGG-3'; and the second guide oligonucleotide Petition 870250102047, dated 07 / 11 / 2025, p. 87 / 460 80 / 272 comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CUAGAGGCUUUUUUUGAACA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GGAGCCAGAAUAACAUUCGG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CUAGAGGCUUUUUUUGAACA-3'.

[0183] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CAGAUGCUGAGAUUAGUCCU-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UGGAUUCCUGCAGUAGUUCC-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CAGAUGCUGAGAUUAGUCCU-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'UGGAUUCCUGCAGUAGUUCC-3'.

[0184] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to Petition 870250102047, dated 07 / 11 / 2025, page 88 / 460 81 / 272 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UGACACCACAUUGGCAUCGG-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'ACAUGUUCUUCCUGUGAUAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-UGACACCACAUUGGCAUCGG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACAUGUUCUUCCUGUGAUAG-3'.

[0185] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CAUAGAUGACCAAGAUUGAC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UGAUACCACACUGGCAUCAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CAUAGAUGACCAAGAUUGAC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'UGAUACCACACUGGCAUCAG-3'. Petition 870250102047, dated 07 / 11 / 2025, p. 89 / 460 82 / 272

[0186] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CCAUCACUGGACAUUGCGUC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AACUCUCCUCACAACUCCCA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CCAUCACUGGACAUUGCGUC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'AACUCUCCUCACAACUCCCA-3'.

[0187] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CUGCAUCUGAGCAUCGUGUC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CGUCCCUCCGAAUGUUAUUC-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUGCAUCUGAGCAUCGUGUC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about Petition 870250102047, dated 07 / 11 / 2025, pp. 90 / 460 83 / 272 of 90%, at least approximately 95% identical or is identical to 5'CGUCCCUCCGAAUGUUAUUC-3'.

[0188] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AAACAGCCGUGGACGUCGCA-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UGAACAAGGUAAGAAGUCUC-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-AAACAGCCGUGGACGUCGCA-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'UGAACAAGGUAAGAAGUCUC-3'.

[0189] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'ACAGAGGCUCCUUCUGAACA-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'GCUUGGAACCGGGGCCACUG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-ACAGAGGCUCCUUCUGAACA-3' and the second guide oligonucleotide Petition 870250102047, dated 07 / 11 / 2025, p. 91 / 460 84 / 272 comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'GCUUGGAACCGGGGCCACUG-3'.

[0190] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AUGCCAGUGUGGUGUCAUAG-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'ACAACAGAAUAUUAUCCAAA-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-AUGCCAGUGUGGUGUCAUAG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACAACAGAAUAUUAUCCAAA-3'.

[0191] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'CUAUGACACCACAUUGGCAU-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'ACAUGUUCUUCCUGUGAUAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about Petition 870250102047, dated 07 / 11 / 2025, p. 92 / 460 85 / 272 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUAUGACACCACAUUGGCAU-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACAUGUUCUUCCUGUGAUAG-3'.

[0192] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AAUAACAUUCGGAGGGACGA-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UAUUCUGGCUCCAAGCCUAG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-AAUAACAUUCGGAGGGACGA-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'UAUUCUGGCUCCAAGCCUAG-3'.

[0193] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'GUAGCAGUCCUGUACCCCGG-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'CAUUAUGGACAGAGUUACCG-3'. In some embodiments, the first Petition 870250102047, dated 07 / 11 / 2025, p. 93 / 460 The 86 / 272 guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GUAGCAGUCCUGUACCCCGG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CAUUAUGGACAGAGUUACCG-3'.

[0194] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'AGUAGCAGUCCUGUACCCCG-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'CAUUAUGGACAGAGUUACCG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-AGUAGCAGUCCUGUACCCCG-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CAUUAUGGACAGAGUUACCG-3'.

[0195] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'UAGUAGCAGUCCUGUACCCC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to Petition 870250102047, dated 07 / 11 / 2025, page 94 / 460 87 / 272 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'CAUUAUGGACAGAGUUACCG-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-UAGUAGCAGUCCUGUACCCC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'CAUUAUGGACAGAGUUACCG-3'.

[0196] In some embodiments, the first guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'UGGACCACAUGGCUUUGCUC-3'; and the second guide oligonucleotide comprises a spacer sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'ACGUACUCCACCACUGUCAC-3'. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-UGGACCACAUGGCUUUGCUC-3' and the second guide oligonucleotide comprises a spacer with a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'ACGUACUCCACCACUGUCAC-3'.

[0197] Table 7A summarizes the dose-response curves in immortalized human hepatocellular carcinoma (HuH-7) cells for five (5) pairs of first and second guide RNAs using an editing system. Petition 870250102047, dated 07 / 11 / 2025, page 95 / 460 88 / 272 genes comprising a Cas9 dual nickase system. The Cas9 nickase is encoded within an mRNA (MS029) that was transfected into HuH7 cells at a total mRNA:total gRNA weight ratio of 1:1. Table 7B summarizes the dose-response curves in HuH-7 cells tested in a separate experiment under conditions similar to those used to generate the results presented in Table 7A. Table 7A. Average % of edited selected pairs of guide RNA pairs at different doses. Average % of Edition ID of the pair of 10000 5000 2500 1250 625 312.5 156.25 78.125 guides ng / ml ng / ml ng / ml ng / ml ng / ml ng / ml ng / ml ng / ml GA1183 / GA1184 62.4 55.2 48.7 35.5 30.8 22.5 15.4 13 GA1227 / GA1245 62 45.7 40.6 34.3 26.3 21 13 10 GA1189 / GA1190 58.6 48.1 29.2 22.9 19.4 12 7.6 6.2 GA1231 / GA1250 41.3 34 16.9 13.5 7.6 3.9 2.4 2.2 GA1234 / GA1253 36.1 22.4 15.5 13.3 10.2 6.9 4 2.5 Table 7B. Average % of edited selected pairs of guide RNA pairs at different doses. Average % of Edition ID of the guide pair 5000 ng / ml 2500 ng / ml 312.5 ng / ml GA1183 / GA1184 24.6 37.2 14.6 GA1264 / GA1184 33.9 38.6 16.0 GA1265 / GA1184 37.1 35.1 14.1 GA1266 / GA1184 29.7 32.3 16.8 Petition 870250102047, dated 07 / 11 / 2025, page 96 / 460 89 / 272 GA1076 / GA1270 25.7 27.9 10.8

[0198] In one or more embodiments, a guide oligonucleotide, or portions thereof, is chemically modified. Chemical modification of the guide oligonucleotide can provide enhanced stability when transfected into mammalian cells. For example, gRNAs can be chemically modified to comprise a combination of modifications to the 2'-O-methylribose and phosphorothioate sugar backbone in at least one 5' nucleotide and at least one 3' nucleotide of each gRNA. In one or more cases, the three 5'-terminal nucleotides and three 3'-terminal nucleotides are chemically modified to comprise combinations of modifications with 2'-O-methylribose and phosphorothioate sugars.

[0199] This disclosure also covers guide nucleic acids comprising component portions (e.g., crRNA, tracrRNA, or scaffold region which may comprise tracrRNA and connector regions between them) of the guide nucleic acids specified above.

[0200] The guide oligonucleotides described in this document can be synthesized chemically, enzymatically, or by a combination thereof. For example, the guide oligonucleotide can be synthesized using conventional phosphoramidite-based solid-phase synthesis methods. Alternatively, a gRNA can be synthesized in vitro by operationally linking the DNA encoding the gRNA to a promoter control sequence that is recognized by, for example, a phage RNA polymerase. Examples of suitable phage promoter sequences include, but are not limited to, T7, T3, SP6 promoter sequences or variations thereof. In one or more embodiments, a guide oligonucleotide comprises two separate molecules (e.g., crRNA (comprising the spacer) and tracrRNA or scaffold region, which may comprise tracrRNA). A portion Petition 870250102047, dated 07 / 11 / 2025, p. 97 / 460 90 / 272 of a guide oligonucleotide molecule (e.g., tracrRNA or scaffold region, which may comprise tracrRNA) can be chemically synthesized and the other molecule (e.g., crRNA) can be enzymatically synthesized. Portions of the guide oligonucleotide can be linked to each other by splice ligation or other suitable methods, thus forming a larger unified guide oligonucleotide. Purification processes, including anion exchange ion-pairing processes and / or reverse-phase chromatography performed alone or sequentially with or without filtration followed by lyophilization and / or aliquoting, can be employed to increase the total length purity of the post-synthesis and / or linkage of the guide oligonucleotide for use as a suitable pharmaceutical substance in a pharmaceutical compound.

[0201] In some embodiments, the guide oligonucleotide may include, in addition to RNA nucleotides, DNA nucleotides and / or nucleotide analogs. A gRNA may comprise molecules other than RNA.

[0202] In some modalities, more than two guide nucleic acids can be used simultaneously to install edits at one or more target genomic locations. The use of more than two guide nucleic acids with different sequences can improve the effectiveness of the edit.

[0203] A gene editing and distribution system, as described in this document, may comprise a guide oligonucleotide with a spacer region manipulated to bind to a target sequence on a strand of the human LPA gene that opposes a protospacer within the LPA gene. In embodiments, the gene editing system is configured so that the nickase, in cooperation with a guide oligonucleotide, cuts a strand of the LPA gene within or in proximity to the target sequence or the protospacer. In some embodiments, the gene editing system is manipulated so that the nickase cuts within 5 nucleotides, within 4 Petition 870250102047, dated 07 / 11 / 2025, page 98 / 460 91 / 272 nucleotides, within 3 nucleotides, within 2 nucleotides, within 1 nucleotide, or at the location between the 3' end of the protospacer and the PAM, or at a corresponding location in the target sequence. In embodiments, the gene editing system is manipulated so that the gene editing system cuts within 2 or 3 nucleotides from the 3' end of the protospacer or at the corresponding location in the target sequence. In embodiments, the gene editing system is manipulated so that the gene editing system cuts (i) within the protospacer and within 2 or 3 nucleotides from the 3' end of the protospacer, or (ii) at the corresponding location in the target sequence.

[0204] In some embodiments, the target sequence to which the guide oligonucleotide spacer region binds corresponds to (i.e., is complementary to) a protospacer sequence listed in Table 2 or Table 5. In some embodiments, the spacer sequence is identical to, or has at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identity with a protospacer listed in Table 2 or Table 5. In some embodiments, the guide oligonucleotide includes a spacer sequence that is identical or substantially identical to a protospacer listed in Table 2 or Table 5, or a 3' portion thereof, with 0, 1, 2, 3, 4, or 5 mismatches. In some embodiments, the guide oligonucleotide spacer region comprises a sequence identical to the 15, 16, 17, 18, 19, or twenty nucleotides plus 3' of a protospacer listed in Table 2 or Table 5.For example, a spacer may comprise a sequence identical to the 15, 16, 17, 18, 19 or twenty nucleotides plus 3' of the protospacer in the first row and first column of Table 2 (5'-GGAGCCAGAATAACATTCGG-3'), which means that the spacer may comprise a sequence of 5'GGAGCCAGAAUAACAUUCGG-3', 5'-GAGCCAGAAUAACAUUCGG-3', 5'Petition 870250102047, dated 07 / 11 / 2025, page 99 / 460. 92 / 272 AGCCAGAAUAACAUUCGG-3', 5'-GCCAGAAUAACAUUCGG-3, 5'CCAGAAUAACAUUCGG-3' or 5'-CAGAAUAACAUUCGG-3'. In some embodiments, the guide oligonucleotide comprises a spacer with a sequence identical to a protospacer listed in Table 2 or Table 5.

[0205] A gene editing and delivery system, as described in this document, may comprise a first guide oligonucleotide and a second guide oligonucleotide. In embodiments, the first guide oligonucleotide binds to a first target sequence on a first strand of the human LPA gene and the second guide oligonucleotide binds to a second target sequence on a second strand of the LPA gene. The first target sequence opposes and is complementary to a first protospacer within the LPA gene. The second target sequence opposes and is complementary to a second protospacer within the LPA gene.In some modalities, the gene editing system is manipulated so that one or more nickases, in cooperation with the first guide oligonucleotide, cut one strand of the LPA gene within or in proximity to the first target sequence or the first protospacer and, in cooperation with the second guide oligonucleotide, cut the other strand of the LPA gene within or in proximity to the second target sequence or the second protospacer.In some embodiments, the gene editing system is manipulated so that one or more nickases, in cooperation with the first guide oligonucleotide, cut one strand of the LPA gene within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, within 2 nucleotides, within 1 nucleotide, or at the location between the 3' end of the first protospacer and the PAM, or at a corresponding location in the first target sequence, and, in cooperation with the second guide oligonucleotide, cut the other strand of the LPA gene within 5 nucleotides, within 4 nucleotides, within 3 nucleotides, within 2 nucleotides, within 1 nucleotide, or at the location between the 3' end of the second. Petition 870250102047, dated 07 / 11 / 2025, pp. 100 / 460 93 / 272 protospacer and PAM or at a corresponding location in the second target sequence. In embodiments, the gene editing system is manipulated so that the gene editing system cuts one strand of the LPA gene within 2 or 3 nucleotides from the 3' end of the first protospacer or the corresponding location in the first target sequence and cuts the other strand of the LPA gene within 2 or 3 nucleotides from the 3' end of the second protospacer or the corresponding location in the second target sequence.In embodiments, the gene editing system is manipulated so that the gene editing system cuts one strand of the LPA gene (i) within the protospacer and within 2 or 3 nucleotides from the 3' end of the first protospacer or (ii) at the corresponding location in the first target sequence and cuts the other strand of the LPA gene (i) within the second protospacer and within 2 or 3 nucleotides from the 3' end of the second protospacer or (ii) at the corresponding location in the second target sequence.

[0206] In some embodiments, the target sequence to which the spacer region of the first guide oligonucleotide binds corresponds to a guide protospacer 1 sequence listed in Table 2 or Table 5, and the target sequence to which the spacer region of the second guide oligonucleotide binds corresponds to a guide protospacer 2 sequence listed in Table 2 or Table 5, wherein guide protospacer 1 and guide protospacer 2 are in the same row of Table 2 or Table 5. In some embodiments, the spacer sequence of the first guide oligonucleotide is identical to, or has at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identity with a guide protospacer 1 listed in Table 2 or Table 5, and the spacer sequence of the second guide oligonucleotide is identical to, or has at least about 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, or at least approximately 95% identification with one. Petition 870250102047, dated 07 / 11 / 2025, p. 101 / 460 94 / 272 guide protospacer 2 listed in Table 2 or Table 5, wherein guide protospacer 1 and guide protospacer 2 are in the same row of Table 2 or Table 5. In some embodiments, the first guide oligonucleotide includes a spacer sequence that is identical or substantially identical to a guide protospacer 1 sequence listed in Table 2 or Table 5, or a 3' portion thereof, with 0, 1, 2, 3, 4, or 5 mismatches, and the second guide oligonucleotide includes a spacer sequence that is identical or substantially identical to a guide protospacer 2 sequence listed in Table 2 or Table 5, or a 3' portion thereof, with 0, 1, 2, 3, 4, or 5 mismatches, wherein guide protospacer 1 and guide protospacer 2 are in the same row of Table 2 or Table 5. 5.In some embodiments, the spacer region of the first guide oligonucleotide comprises a sequence identical to the 15, 16, 17, 18, 19, or twenty nucleotides plus 3' of a guide protospacer 1 listed in Table 2 or Table 5, and the spacer region of the second guide oligonucleotide comprises a sequence identical to the 15, 16, 17, 18, 19, or twenty nucleotides plus 3' of a guide protospacer 2 listed in Table 2 or Table 5, wherein guide protospacer 1 and guide protospacer 2 are in the same row of Table 2 or Table 5. In some embodiments, the first guide oligonucleotide comprises a spacer with a sequence identical to a guide protospacer 1 listed in Table 2 or Table 5, and the second guide oligonucleotide comprises a spacer with a sequence identical to a guide protospacer 2 listed in Table 2 or Table 5. Table 2 or Table 5, where guide protospacer 1 and guide protospacer 2 are in the same row of Table 2 or Table 5. V. GENE EDITING SYSTEMS

[0207] The term gene editor is used throughout this disclosure to refer to a protein or protein complex that is capable of inserting, Petition 870250102047, dated 07 / 11 / 2025, p. 102 / 460 95 / 272 replace, delete, or cut a DNA sequence in a genome in the presence of, or in operation with, guide nucleic acids. The guide nucleic acids and the gene editor are collectively referred to in this document as a gene editor system or gene editing system. With some gene editing systems, intracellular enzymes, such as DNA repair enzymes, may facilitate or otherwise be required to finalize the incorporation of the edit into the genome. In some embodiments, a gene editor that cuts a DNA strand may, in operation, interact with two different guide oligonucleotides to cut opposite strands of genomic DNA. The cuts in opposite strands may facilitate one or more DNA repair mechanisms to cause the edit (e.g., cause an indel variant or non-synonymous variant).

[0208] Gene editing systems are nucleotide-directed. These systems typically include at least one editing protein and a guide nucleic acid. The proteins and systems described above, such as Cas9, nucleotide-directed editing proteins, and nickases, are encompassed by the term gene editing system. The guide nucleic acids described above may also be a component of a gene editing system.

[0209] The editing proteins described in this document are nickases, which, operating with a guide oligonucleotide, cut a single strand of genomic DNA. For a given nickase to cut opposite strands of genomic DNA, the nickase operates with a first guide oligonucleotide to cut one strand of genomic DNA and operates with a second guide oligonucleotide to cut the other strand of genomic DNA. The first and second guide oligonucleotides comprise spacer sequences complementary to the target sequences on opposite strands of genomic DNA. Such nickases are contrasted with nucleases (e.g., a Cas9 nuclease) that interact with a single guide RNA to catalyze double-stranded DNA cleavage. Petition 870250102047, dated 07 / 11 / 2025, page 103 / 460 96 / 272

[0210] The editing proteins described in this document may include, but are not limited to, a Cas nickase, such as a Cas9 variant of Streptococcus pyogenes, a Cas9 variant of Staphylococcus aureus, or a Cas12a / Cpf1 variant. The editing protein may be provided as a recombinant protein. The editing protein may be alternately transcribed and / or translated from a provided nucleotide, such as mRNA or plasmid DNA.

[0211] The guide nucleic acid may include, but is not limited to, a spacer sequence and a scaffold region. The guide nucleic acid components may be covalently linked together, may be assembled into a complex, or may be provided as individual strands. The nucleotide components may be transcribed alternately from a provided nucleic acid, such as plasmid DNA.

[0212] In one or more embodiments, the nucleotide components and the gene editor can be transcribed from a single nucleic acid, such as plasmid DNA or linear DNA. The protein components can then be translated from a transcript. In one or more embodiments, the nucleic acid encoding the gene editor is mRNA. In one or more embodiments, the mRNA generates the gene editor through translation in the target cell or subject after administration. In one or more embodiments, the gene editor forms a ribonucleoprotein (RNP) complex in the target cell or subject.

[0213] It should be appreciated that the edition of this disclosure may comprise one or more additional features. For example, in one or more embodiments, the gene editor may comprise cytoplasmic localization sequences, export sequences such as nuclear export sequences or other localization sequences, as well as sequence tags that are useful for solubilization, purification or detection of Petition 870250102047, dated 07 / 11 / 2025, p. 104 / 460 97 / 272 fusion proteins. Suitable protein tags provided in this document include, but are not limited to, biotin carboxylase carrier protein (BCCP) tags, myc-tags, calmodulin tags, FLAG-tags, hemagglutinin (HA) tags, polyhistidine tags, also referred to as histidine tags or Histags, maltose-binding protein (MBP) tags, nus-tags, glutathione S-transferase (GST) tags, green fluorescent protein (GFP) tags, thioredoxin tags, S-tags, Softags (e.g., Softag 1, Softag 3), strep-tags, biotin ligase tags, FIAsH tags, V5 tags, and SBP-tags. Additional suitable sequences will be apparent to those skilled in the art. In one or more embodiments, the gene editor comprises one or more His tags. VI. THERAPEUTIC APPLICATIONS

[0214] The guide nucleic acids and compositions described in this document may be administered to target cells or to a subject in need, in a therapeutically effective amount, to treat or prevent cardiovascular disease. In one or more embodiments, the subject has cardiovascular disease due, at least in part, to an elevated concentration of Lp(a) in the blood, which may be directly correlated with the concentration of apo(a) or may be inversely correlated with the size of the apo(a) protein. In one or more embodiments, the subject has atherosclerotic cardiovascular disease due, at least in part, to an elevated concentration of Lp(a) in the blood, which may be directly correlated with the concentration of apo(a) or may be inversely correlated with the size of the apo(a) protein.In one or more modalities, the subject has calcified aortic valve disease due, at least in part, to an elevated concentration of Lp(a) in the blood, which may be directly correlated with the concentration of apo(a) or inversely correlated with the size of the apo(a) protein.

[0215] With such administration, the guide nucleic acids direct Petition 870250102047, dated 07 / 11 / 2025, p. 105 / 460 98 / 272 The gene editor is used to modify the LPA gene to reduce the concentration of Lp(a) in the blood, which may be directly correlated with the concentration of apo(a) or inversely correlated with the size of the apo(a) protein in the subject. In one or more modes, the genetic alteration occurs in the liver cells (hepatocytes) of the subject.

[0216] For example, the gene editing system includes an editing protein and guide nucleic acids, which can be introduced and / or expressed in a cell where editing of the target gene is desired, such as, for example, a liver cell (or hepatocyte), thus allowing contact between the target gene and the guide nucleic acids, such as gRNAs, and the gene editing protein. In one or more embodiments, the binding of the editing protein to the target polynucleotide sequences in the target gene is directed by the guide nucleic acids, where the spacer sequence of each guide nucleic acid hybridizes with a complementary sequence on the target strand in the target gene. Thus, the nucleic acids guide the editing protein to edit a polynucleotide sequence in the target gene. In one or more embodiments, the guide nucleic acids are co-introduced into a cell where editing is desired with the editing protein or with a nucleic acid encoding the editing protein.

[0217] In one or more embodiments, the methods and compositions disclosed in this document impair the function of the apo(a) protein encoded by the LPA gene to constitute Lp(a) particles. The impairment of function can be measured by the concentration of Lp(a) in the blood of a subject to whom the method or composition disclosed in this document has been administered. For example, the methods and compositions disclosed in this document may reduce the concentration of Lp(a) in the blood by at least 10–95 percent compared to a control. For example, the methods and compositions disclosed in this document may reduce the concentration of Lp(a) in the blood by at least 10 percent, at least 15 percent, at least 20 percent, at least Petition 870250102047, dated 07 / 11 / 2025, p. 106 / 460 99 / 272 less 25 percent, at least 30 percent, at least 35 percent, at least 40 percent, at least 45 percent, at least 50 percent, at least 55 percent, at least 60 percent, at least 65 percent, at least 70 percent, at least 75 percent, at least 80 percent, at least 85 percent, at least 90 percent or at least 95 percent in relation to a control.

[0218] In one or more embodiments, the method for treating or preventing cardiovascular disease in a subject in need, as described in this document, includes administering (i) guide nucleic acids and (ii) a nucleic acid encoding an editing protein to the subject.

[0219] In one or more embodiments, the method for treating or preventing cardiovascular disease in a subject in need, as described in this document, includes administering a lipid nanoparticle (LNP) encapsulating or otherwise delivering (i) guide nucleic acids or nucleic acids encoding guide nucleic acids and / or (ii) an editing protein comprising a programmable DNA-binding domain or a nucleic acid encoding the same, as such guide nucleic acids and editing proteins or nucleic acids encoding the same are described in this document. In one or more aspects, the (i) guide nucleic acids or nucleic acids encoding the same and (ii) the editing protein comprising a programmable DNA-binding domain or a nucleic acid encoding the same are included in the same LNPs. In one or more aspects, they are included in separate LNPs. VII. Pharmaceutical Compositions

[0220] In one or more aspects, a pharmaceutical composition comprising the guide oligonucleotides or gene editing system as provided herein and a pharmaceutically acceptable carrier or excipient is provided in this document. In one or more aspects, it is Petition 870250102047, dated 07 / 11 / 2025, page 107 / 460 100 / 272 provided in this document is a gene-modifying pharmaceutical composition comprising guide nucleic acids, such as one or more gRNAs, as described in this document, and an editing protein or a nucleic acid sequence encoding the editing protein and a pharmaceutically acceptable carrier. The pharmaceutical compositions are conventionally formulated using one or more pharmaceutically acceptable inactive ingredients that facilitate the processing of the active compounds into preparations that can be used pharmaceutically. Suitable pharmaceutically acceptable additives are generally well known in the art. The appropriate formulation is dependent on the chosen route of administration. A summary of the pharmaceutical compositions described in this document can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pensilvânia 1975; Liberman, H.A. e Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, Nova York, NY, 1980; e Pharmaceutical Dosage Forms and Drug Delivery Systems, Sétima Ed. (Lippincott Williams e Wilkins 1999).

[0221] A pharmaceutical composition may comprise any suitable molar ratio of guide nucleic acids, such as gRNAs, as described in this document, or nucleic acid sequences encoding guide RNAs to each other. In embodiments, the weight ratio of one guide nucleic acid (or a nucleic acid sequence encoding a guide RNA) to the other guide nucleic acid (or a nucleic acid sequence encoding the other guide RNA) is 10:1 to 1:10, such as 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:2. In some embodiments, the weight ratio is 1:1 to 1:3. In some embodiments, the weight ratio is about 1:2. In some embodiments, the weight ratio is 1:1.5 to 1:2.5. Thus, for example, the weight ratio of a Petition 870250102047, dated 07 / 11 / 2025, p. 108 / 460 101 / 272 The guide RNA to other guide RNA ratios can range from 1:1 to 1:3 or 3:1.

[0222] A pharmaceutical composition may comprise any suitable molar ratio of guide nucleic acids, such as gRNAs, as described in this document, or nucleic acid sequences encoding guide RNAs for the editing protein, or a nucleic acid sequence encoding the editing protein. In embodiments, the weight ratio of the guide nucleic acids (or nucleic acid sequences encoding the guide nucleic acids) to the editing protein (or nucleic acid encoding the editing protein) is 10:1 to 1:10, such as 5:1 to 1:5, 3:1 to 1:3, or 2:1 to 1:2. In some embodiments, the weight ratio is 1:1 to 1:3. In some embodiments, the weight ratio is about 1:2. In some embodiments, the ratio is 1:1.5 to 1:2.5. Thus, for example, the weight ratio of guide RNAs to mRNA encoding the editing protein can be 1:1 to 1:3 or 3:1.

[0223] A pharmaceutical composition may be a mixture of guide nucleic acids, such as gRNAs, as described in this document, or nucleic acid sequences encoding guide RNAs and an editing protein or a nucleic acid sequence encoding the editing protein with one or more other chemical components (i.e., pharmaceutically acceptable ingredients), such as carriers, excipients, binders, bulking agents, suspending agents, flavoring agents, sweetening agents, disintegrating agents, dispersing agents, surfactants, lubricants, colorants, diluents, solubilizers, humectants, plasticizers, stabilizers, penetration enhancers, wetting agents, antifoaming agents, antioxidants, preservatives, or one or more combinations thereof. The pharmaceutical composition facilitates administration to an organism or to a subject in need thereof.

[0224] The pharmaceutical compositions of this disclosure may be administered to a subject using any appropriate methods. Petition 870250102047, dated 07 / 11 / 2025, page 109 / 460 102 / 272 known in the art. The pharmaceutical compositions described in this document can be administered to the subject in various ways, including parenterally, intravenously, intradermally, intramuscularly, colonically, rectally, or intraperitoneally. In one or more embodiments, the pharmaceutical compositions can be administered by intraperitoneal injection, intramuscular injection, subcutaneous injection, or intravenous injection to the subject. In one or more embodiments, the pharmaceutical compositions can be administered parenterally, intravenously, intramuscularly, or orally.In one embodiment, the pharmaceutical composition comprises a pharmaceutically acceptable solution comprising an LNP encapsulating one or more gRNAs and mRNAs encoding the editor proteins engineered to effect edits in the LPA gene, as described herein, which is administered intravenously to a subject in need; the LNP may or may not include GalNAc (e.g., a GalNAc-lipid) as described herein.

[0225] In one or more embodiments, a gene-modifying pharmaceutical composition includes an additional therapeutic agent. The additional therapeutic agent may modulate different aspects of the disease, disorder, or condition being treated and provide a greater overall benefit than administration of the therapeutic agent alone. Therapeutic agents include, but are not limited to, a chemotherapeutic agent, a radiotherapeutic agent, a hormonal therapeutic agent, and / or an immunotherapeutic agent. In one or more embodiments, the therapeutic agent may be a radiotherapeutic agent. In one or more embodiments, the therapeutic agent may be a hormonal therapeutic agent. In one or more embodiments, the therapeutic agent may be an immunotherapeutic agent. In one or more embodiments, the therapeutic agent is a chemotherapeutic agent.Preparation and dosage schedules for additional therapeutic agents may be used according to the manufacturer's instructions or as determined empirically. Petition 870250102047, dated 07 / 11 / 2025, page 110 / 460 103 / 272 someone versed in the technique. A. Lipid Nanoparticle (LNP) Compositions

[0226] The gene-modifying pharmaceutical compositions described in this document may be encapsulated in or comprise lipid nanoparticles (LNPs). As used in this document, a lipid nanoparticle (LNP) composition or a nanoparticle composition is a composition comprising one or more of the described lipids. LNP compositions or formulations, as contemplated in this document, are typically sized on the order of micrometers or smaller and may include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition or formulation, as contemplated in this document, may be a liposome with a lipid bilayer with a diameter of 500 nm or less.A LNP as described in this document may have a mean diameter of about 1 nm to about 2500 nm, from about 10 nm to about 1500 nm, from about 20 nm to about 1000 nm, from about 30 nm to about 150 nm, from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 50 nm to about 90 nm, from about 55 nm to about 85 nm, from about 55 nm to about 75 nm, from about 50 nm to about 80 nm, from about 60 nm to about 80 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about from 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, or from about 70 nm to about 80 nm.The LNPs described in this document may have an average diameter of approximately 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm or larger. Petition 870250102047, dated 07 / 11 / 2025, p. 111 / 460 104 / 272

[0227] In one embodiment, the average diameter of the LNP is about 70 nm + / - 20 nm, 70 nm + / - 10 nm, 70 nm + / - 5 nm. In one embodiment, the average diameter of the LNP is about 60 nm + / - 20 nm, 60 nm + / - 10 nm, 60 nm + / - 5 nm. In one embodiment, the average diameter of the LNP is about 50 nm + / - 20 nm, 50 nm + / - 10 nm, 50 nm + / - 5 nm. The LNPs described in this document may be substantially non-toxic.

[0228] Lipid nanoparticles (LNPs) employ a nonviral drug delivery mechanism that is able to pass through blood vessels and reach hepatocytes (Am. J. Pathol. 2010, 176, 1421). Apolipoprotein E (apoE) proteins are able to bind to LNPs after diffusion of PEG-lipid from the LNP surface with a near-neutral charge into the bloodstream and thus function as an endogenous ligand against hepatocytes that express the low-density lipoprotein receptor (LDLR) (Mol. Ther., 2010, 18, 1357-1364). The requirements for efficient hepatic LNP delivery include: 1) effective propagation of PEG-lipid from the LNP surface into the blood serum and 2) apoE binding to the LNP. The endogenous apoE-mediated LDLR-dependent LNP distribution pathway is either unavailable or a less efficient route for achieving LNP-based liver gene distribution in patient populations that are LDLR-deficient.

[0229] Efficient distribution to cells requires specific targeting and substantial protection from the extracellular environment, particularly serum proteins. One method to achieve specific targeting is to conjugate a targeting fraction to an active agent or pharmaceutical effector, such as a nucleic acid agent, thus targeting the active agent or pharmaceutical effector to specific cells or tissues, depending on the specificity of the targeting fraction. One way in which a targeting fraction can improve distribution is by activity Petition 870250102047, dated 07 / 11 / 2025, page 112 / 460 105 / 272 Receptor-mediated endocytosis. This uptake mechanism involves the movement of nucleic acid agents bound to membrane receptors into an area enclosed by the membrane through invagination of the membrane structure or by fusion of the delivery system with the cell membrane. This process is initiated by the activation of a cell surface or membrane receptor after the binding of a specific fragment, such as a ligand, to the receptor. Receptor-mediated endocytosis systems include those that recognize sugars such as galactose, mannose, mannose-6-phosphate, peptides, and proteins such as transferrin, asialoglycoprotein, vitamin B12, insulin, and epidermal growth factor (EGF).Lipophilic fractions, such as cholesterol or fatty acids, when linked to highly hydrophilic molecules, such as nucleic acids, can substantially enhance plasma protein binding and, consequently, the circulating half-life. Lipophilic conjugates can also be used in combination with targeting fractions to improve intracellular trafficking in the targeted delivery approach.

[0230] The asialoglycoprotein receptor (ASGPR) is a high-capacity receptor that is abundant in hepatocytes. ASGPR shows a 50-fold higher affinity for N-acetyl-D-galactosamine (GalNAc) than for D-galactose. LNPs comprising receptor targeting conjugates can be used to facilitate the targeted delivery of the pharmacological substances described in this document. LNPs may include one or more receptor targeting fractions on the surface or periphery of the particle at a specified or manipulated surface density ranging from relatively low to relatively high. The receptor targeting conjugate may comprise a targeting fraction (such as a ligand), a ligand, and a lipophilic fraction that is Petition 870250102047, dated 07 / 11 / 2025, p. 113 / 460 106 / 272 connected to the targeting fraction. In one or more embodiments, the receptor targeting fraction (such as a ligand) targets a lectin receptor. In one or more embodiments, the lectin receptor is the asialoglycoprotein receptor (ASGPR). In one or more embodiments, the receptor targeting fraction is GalNAc or a GalNAc derivative that targets ASGPR. In one aspect, the receptor targeting conjugate comprises a GalNAc fraction or a derivative thereof. In another aspect, the receptor targeting conjugate comprises two different GalNAc fractions or derivatives thereof. In another aspect, the receptor targeting conjugate comprises three different GalNAc fractions or derivatives thereof. In another aspect, the receptor targeting conjugate is lipophilic. In one or more embodiments, the receptor-targeting conjugate comprises one or more GalNAc fractions and one or more lipid fractions, i.e., GalNAc-Lipid.In one or more modalities, the receptor-targeting conjugate is a GalNAc-Lipid.

[0231] This document describes (i) LNP compositions comprising an amino lipid, a phospholipid, a PEG lipid, a cholesterol or a cholesterol derivative, a payload or any combination thereof and (ii) LNP compositions comprising an amino lipid, a phospholipid, a PEG lipid, a cholesterol, a GalNAc lipid or a derivative thereof, a payload or any combination thereof. Each component is described in more detail below.

[0232] In the preparation of LNP compositions comprising amino lipid, phospholipid, PEG-lipid and cholesterol excipients, a desired molar ratio of the four excipients is dissolved in a water-miscible organic solvent, for example, ethanol. The homogeneous lipid solution is then rapidly mixed in-line with an aqueous buffer with an acidic pH ranging from 4 to 6.5 containing nucleic acid payload to form the nanoparticle. Petition 870250102047, dated 07 / 11 / 2025, page 114 / 460 107 / 272 lipid (LNP) encapsulating nucleic acid payloads. After rapid in-line mixing, the LNPs thus formed undergo further downstream processing, including concentration and buffer exchange, to achieve the final LNP pharmaceutical composition with a near-neutral pH for administration into a cell line or animal disease model for evaluation, or for administration to human subjects.

[0233] For the preparation of the GalNAcLNP pharmaceutical composition, GalNAc-Lipid is mixed with the four lipid excipients in the water-miscible organic solvent before the preparation of GalNAc-LNP. The preparation of the GalNAc-LNP pharmaceutical composition then follows the same steps described for the LNP pharmaceutical composition. The mol% of GalNAcLipid in the preparation of GalNAc-LNP varies from 0.001 to 2.0 of the total excipients.

[0234] For the preparation of LNP and GalNAc-LNP, the payload comprises guide nucleic acids, such as guide RNAs, targeting the LPA gene and an mRNA encoding a gene-editing protein. In one or more embodiments, the weight ratio of guide nucleic acid to mRNA in the aqueous acidic buffer and in the final formulation is 6:1, 5:1, 4:1, 3:1, 2.5:1, 2:1, 1.5:1, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:5 or 1:6 by weight.

[0235] In one or more embodiments, an LNP composition may be prepared as described in U.S. Patent Application No. 17 / 192,709, entitled COMPOSITIONS AND METHODS FOR TARGETED RNA DELIVERY, filed March 4, 2021, claiming the benefit of U.S. Provisional Patent Applications No. 2020) and 63 / 078,982 (filed September 16, 2020), naming Kallanthottathil G. Rajeev as the inventor and Verve Therapeutics, Inc., as the applicant, the application for which is incorporated herein by reference in its entirety. Petition 870250102047, dated 07 / 11 / 2025, p. 115 / 460 108 / 272 1. Amino Lipids a) Formula (I)

[0236] In one or more embodiments, the LNP composition comprises an amino lipid. In one aspect, an amino lipid having the structure of Formula (I), or a pharmaceutically acceptable salt or solvate thereof, is disclosed in this document. wherein each of R1 and R2 is independently C3-C22 alkyl, C3-C22 alkenyl, Tyx C3-C8 cycloalkyl, -C2-C10 alkylene-L-R6 or R L, wherein each of the alkyl, alkylene, alkenyl and cycloalkyl groups is independently substituted or unsubstituted; each of -NR4C(=S)-, -0(=0)0-, -OC(=S)-, OC(=S)O-, NR4C(=S)O-, -OC(=S)NR4-, -NR4C(=S)NR4-, -C(=O)S-, -SC(=O)-, -OC(=O)S-, NR4C(=O)S-. -SC(=O)NR4- , -C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR4C(=S)S-, SC(=S)NR4-, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR4C(=S)S-, SC(=S)NR4- O, S or a link; each of L is independently -C(=O)NR4-, -NR4C(=O)-, -0(=0)0-. -00(=0)0-, -NR4C(=O)O-, -OC(=O)NR4-, -NR4C(=O)NR4-, -NR4C(=NR4)NR4-, C(=S)NR4-, -NR4C(=S)-, -0(=0)0-, -OC(=S)-, OC(=S)O-, -NR4C(=S)O-, OC(=S)NR4-, -NR4C(=S)NR4-, -C(=O)S-, SC(=O)-, -OC(=O)S-, -NR4C(=O)S-, SC(=O)NR4-, -C(=S)S-, -SC(=S)-, -SC(=S)O-, - NR4C(=S)S-, -SC(=S)NR4-, Petition 870250102047, dated 07 / 11 / 2025, p. 116 / 460 109 / 272 C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR4C(=S)S-, - SC(=S)NR4-, O, S, C1-C10 alkylene-O-, -C1-C10 alkylene-C(=O)O-, -C1-C10 alkylene-OC(=O)- or a bond, where the alkylene is substituted or unsubstituted; R3 is -C0-C10 alkylene-NR7R8, -C0-C10 alkylene-heterocycloalkyl or -C0C10 alkylene-heterocycloaryl, wherein alkylene, heterocycloalkyl and heterocycloaryl is independently substituted or unsubstituted; each of R4 is independently hydrogen or C1-C6 alkyl substituted or unsubstituted; R5 is hydrogen or C1-C6 alkyl substituted or unsubstituted; each of R6 is independently substituted or unsubstituted C3-C22 alkyl or substituted or unsubstituted C3-C22 alkenyl; Each of R7 and R8 is independently hydrogen or C1-C6 alkyl, substituted or unsubstituted, or R7 and R8 taken together with the nitrogen to which they are attached form a C2-C6 heterocyclyl, substituted or unsubstituted; p is an integer selected from 1 to 10; and each of n, meq is independently 0, 1, 2, 3, 4, or 5.

[0237] In one or more embodiments of Formula (I), if the structure carries more than one asymmetric C atom, each asymmetric C atom independently represents a chirally pure racemic R isomer and / or a chirally pure S isomer or a combination thereof.

[0238] In one or more modalities, each of n, in eq in Formula (I) is independently 0, 1, 2, or 3. In one or more modalities, each of n, meq in Formula (I) is 1. b) Formula (Ia)

[0239] In one or more embodiments, the compound of Formula (1) has a structure of Formula (Ia), or a pharmaceutically acceptable salt or pharmaceutically acceptable solvate thereof: Petition 870250102047, dated 07 / 11 / 2025, p. 117 / 460 110 / 272 Formula (la) in which each of R1 and R2 is independently C3-C22 alkyl, C3-C22 alkenyl, R6— IM C3-C8 cycloalkyl, -C2-C10 alkylene-L-R6 or R L, wherein each of the alkyl, alkylene, alkenyl and cycloalkyl groups is independently substituted or unsubstituted; each of X, Y and Z is independently C(=O)NR4-, -NR4C(D)-, C(=O)O-, -OC(=O)-, -OC(=O)O-, -NR4C(=O)O-, -OC(=O)NR4-, -NR4C=O)NR4-, -NR4C(=NR4)NR4-. -C(=S)NR4-, -NR4C(=S)-, -C(E)O-, -OC(=S)-, OC(=S)O-, NR4C(=S)O-, -OC(=S)NR4-, -NR4C(=S)NR4-, -C(=O)S-, -SC(=O)-, -OC(=O)S-, NR4C(=O)S-, -SC(=O)NR4- -C(=S)S-, -SC(=S)-, -SC(=S)O-, - NR4C(=S)S-, SC(=S)NR4-, -C(=S)S-. -SC(=S)-, -SC(=O)S-, -SC(=S)S-. -NR4C(=S)S-, SC(=S)NR4-, O, S, -C1-C10 alkylene-O- or a linkage, where the alkylene is substituted or unsubstituted; each of L is independently -C(=O)NR4-, -NR4C(=O)-, -C(=O)O-, -00(=0)-, -00(=0)O-, - NR4C(=O)O-, -OC(=O)NR4-, -NR4C(=O)NR4-, NR4C(=NR4)NR4-. -C(=S)NR4-, -NR4C(=S)-, -0(=0)0-, -OC(=S)-, OC(=S)O-, NR4C(=S)O-, -OC(=S)NR4-, -NR4C(=S)NR4-, -C(=O)S-, -SC(=O)-, -OC(=O)S-, NR4C(=O)S-, -SC(=O)NR4- -C(=S)S-, -SC(=S)-, -SC(=S)O-, -NR4C(=S)S-, SC(=S)NR4-, -C(=S)S-, -SC(=S)-, -SC(=O)S-, -SC(=S)S-, -NR4C(=S)S-, SC(=S)NR4-, O, S. -C1-C10 alkylene-O-, -C1-C10 alkylene-C(=O)O-, -C1-C10 alkylene-OC(=O)- or a bond in which the alkylene is substituted or unsubstituted; R3 is -C0-C10 alkylene-NR7R8, -C0-C10 alkylene-heterocycloalkyl or -Co Petition 870250102047, dated 07 / 11 / 2025, p. 118 / 460 111 / 272 Alkylene-heterocycloaryl compounds, wherein alkylene, heterocycloalkyl and heterocycloaryl are independently substituted or unsubstituted; each of R4 is independently hydrogen or substituted or unsubstituted C1-C1e alkyl; R5 is hydrogen or substituted or unsubstituted C1-C1e alkyl; each of R6 is independently substituted or unsubstituted C3-C22 alkyl or substituted or unsubstituted C3-C22 alkenyl; Each of R7 and R8 is independently hydrogen or C1-Oθ alkyl, substituted or unsubstituted, or R7 and R8 taken together with the nitrogen to which they are attached form a substituted or unsubstituted C2-C6 heterocyclyl; ep is an integer selected from 1 to 10.

[0240] In one or more embodiments of Formula (Ia), if the structure carries more than one asymmetric C atom, each asymmetric C atom independently represents a chirally pure racemic R isomer and / or a chirally pure S isomer or a combination thereof. c) Variations of Formula (I) and (Ia)

[0241] In one or more embodiments, R1 and R2 in Formula (I) and Formula (Ia) are independently C3-C22 alkyl, C3-C22 alkenyl, C2-C10 R6— 1 m alkylene-L- R6 or R6— 1 M wherein each of the alkyl, alkylene, alkenyl and cycloalkyl is independently substituted or unsubstituted. In one or more embodiments, R1 and R2 in Formula (I) and Formula (Ia) are independently C10-C20 alkyl, C10-C20 alkenyl, C5-C10 alkylene-L- R6 or R6— 1 M X^yR Lem that each of the alkyl, alkylene, alkenyl, and cycloalkyl groups is independently substituted or unsubstituted. In one or more Petition 870250102047, dated 07 / 11 / 2025, p. 119 / 460 112 / 272 R6— L m modalities, R1 in Formula (I) and Formula (la) is R L

[0242] In one or more embodiments, each of L in Formula (I) and Formula (Ia) is independently O, S, -C1-C10 alkylene-O-, -C1-C10 alkylene-C(=O)O-, -C1-C10 alkylene-OC(=O)- or a linkage, wherein the alkylene is substituted or unsubstituted. In one or more embodiments, each of L in Formula (I) and Formula (Ia) is independently O, S, -C1-C3 alkylene-O-, -C1-C3 alkylene-C(=O)O-, -C1-C3 alkylene-OC(=O)- or a linkage, wherein the alkylene is substituted or unsubstituted. In one or more embodiments, each of L in Formula (I) and Formula (Ia) is independently O, S, -C1-C3 alkylene-O-, -C1-C3 alkylene-C(=O)O-, -C1-C3 alkylene-OC(=O) or a linkage, wherein the alkylene is unsubstituted linear or branched alkylene.

[0243] In one or more embodiments, each of R6 in Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C3-C22 alkyl or substituted or unsubstituted linear C3-C22 alkenyl. In one or more embodiments, each of R6 in Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C3-C20 alkyl or substituted or unsubstituted C3-C20 alkenyl. In one or more embodiments, each of R6 in Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C3-C10 alkyl or substituted or unsubstituted C3-C10 alkenyl. In one or more embodiments, each of R6 in Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C3-C10 alkyl. In one or more embodiments, each of R6na Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C3-C10 alkyl.In one or more embodiments, each of R6na Formula (I) and Formula (Ia) is independently substituted or unsubstituted n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, or n-dodecyl. In one or more embodiments, each. Petition 870250102047, dated 07 / 11 / 2025, pp. 120 / 460 113 / 272 one of R6na Formula (I) and Formula (Ia) is independently n-octyl substituted or unsubstituted. In one or more embodiments, each of R6na Formula (I) and Formula (Ia) is n-octyl.

[0244] In one or more embodiments, each of L in Formula (I) and Formula (Ia) is independently -0(=0)0-, -00(=0)-, -C1-C10 alkylene-O or O. In one or more embodiments, each of L in Formula (I) and Formula (Ia) is O. In one or more embodiments, each of L in Formula (I) and Formula (Ia) is -C1-C3 alkylene-O-. In one or more embodiments, p in Formula (I) and Formula (Ia) is 1, 2, 3, 4 or 5. In one or more embodiments, p in Formula (I) and Formula (Ia) is 2.

[0245] In one or more modalities, R1 in Formula (I) and Formula (1a) is Petition 870250102047, dated 07 / 11 / 2025, p. 121 / 460 114 / 272

[0246] In one or more modes, R1 in Formula (I) and Formula (Ia) is R2.

[0247] In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is independently H or substituted or unsubstituted C1-C4 alkyl. In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is independently substituted or unsubstituted linear C1-C4 alkyl. In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is H. In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is independently H, -CH3, -CH2CH3, -CH2CH2CH3 or CH(CH3)2. In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is independently H or -CH3. In one or more embodiments, each of R4 in Formula (I) and Formula (Ia) is -CH3.

[0248] In one or more embodiments, X in Formula (I) and Formula (Ia) is -C(=O)O- or -OC(=O))-. In one or more embodiments, X in Formula (I) and Formula (Ia) is -C(=O)NR4- or -NR4C(=O)-. In one or more embodiments, X in Formula (I) and Formula (Ia) is -C(=O)N(CH3)-, -N(CH3)C(=O)-, -C(=O)NH- or NHC(=O)-. In one or more embodiments, X in Formula (I) and Formula (Ia) is C(=O))NH-, -C(=O)N(CH3)-. -00(=O))-, -NHC(=O)-, -N(CH3)C(=O))-, -0(=O)0-, Petition 870250102047, dated 07 / 11 / 2025, p. 122 / 460 115 / 272 -00(=0)0-, -NHC(=O)O-, -N(CH3)C(=O)O-, -OC(=O))NH-, -OC(=O)N(CH3)-, NHC(=O)NH-, -N(CH3)C(=O))NH-, -NHC(=O)N(CH3)-, -N(CH3)C(=O)N(CH3)-, NHC(=NH)NH-, -N(CH3)C(=NH)NH-, -NHC(=NH)N(CH3)-, N(CH3)C(=NH)N(CH3)-, NHC(=NMe)NH-, -N(CH3)C(=NMe)NH-, NHC(=NMe)N(CH3)- or -N(CH3)C(=NMe)N(CH3)-.

[0249] In one or more embodiments. R2 in Formula (I) and Formula R6—L m (Ia) is C3-C22 alkyl, C3-C22 alkenyl, -C2-C10 alkylene-L- R6 or where each of alkyl, alkylene, alkenyl and cycloalkyl is independently substituted or unsubstituted. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is C7-C22 substituted or unsubstituted alkyl or C3-C22 substituted or unsubstituted alkenyl. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is C7-C22 linear substituted or unsubstituted alkyl or C3-C22 linear substituted or unsubstituted alkenyl. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is C10-C20 substituted or unsubstituted alkyl or C10-C20 substituted or unsubstituted alkenyl. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is unsubstituted C10-C20 alkyl. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is unsubstituted C10-C20 alkenyl.In one or more embodiments, R2 in Formula (I) and Formula (Ia) is -C2-C10 alkylene-L-R6. In one or more embodiments, R2 in Formula (I) and Formula (Ia) is -C2-C10 alkylene-O(=O)O-R6 or -C2-C10 alkyleneO0O(=O)-R6.

[0250] In one or more modes, R2 in Formula (I) and Formula Petition 870250102047, dated 07 / 11 / 2025, p. 123 / 460 116 / 272

[0251] In one or more modes, R1 in Formula (I) and Formula (1a) is R1.

[0252] In one or more embodiments, Y in Formula (I) and Formula (Ia) is -0(=0)0- or -00(=0)-. In one or more embodiments, Y in Formula (I) and Formula (Ia) is -C(=O)NR4- or -NR4C(=O)-. In one or more embodiments, Y in Formula (I) and Formula (Ia) is -C(=O)N(CH3)-, -N(CH3)C(=O)-, -C(=O)NH- or NHC(=O)-. In one or more embodiments, Y in Formula (I) and Formula (Ia) is 00(=0)0-, -NR4C(=O)O-, -OC(=O)NR4- or -NR4C(=O)NR4-. In one or more embodiments, Y in Formula (I) and Formula (Ia) is - 00(=0)0-, -NHC(=O)O-, OC(=O)NH-, -NHC(=O)NH-, -N(CH3)C(=O)O-. -OC(=O)N(CH3)-, N(CH3)C(=O)N(CH3)- or -N(CH3)C(=O)NH-. In one or more embodiments, Y in Formula (I) and Formula (Ia) is -OOOOO, -NHC(=O)OO-, -OC(=O)NH- or NHC(=O)NH-.

[0253] In one or more embodiments, R3 in Formula (I) and Formula (Ia) is -C0-C10 alkylene-NR7R8 or -C0-C10 alkylene-heterocycloalkyl, wherein alkylene and heterocycloalkyl is independently substituted or not. Petition 870250102047, dated 07 / 11 / 2025, pp. 124 / 460117 / 272 replaced. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C0-C10 alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C1-C6 alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C1-C4 alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C1-alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C2-alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is C3-alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is -C4-alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is -C5-alkylene-NR7R8. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is -C0-C10 alkylene-heterocycloalkyl. In one or more embodiments, R3 in Formula (I) and Formula (Ia) is -C1-C6 alkylene-heterocycloalkyl, wherein the heterocycloalkyl comprises 1 to 3 nitrogen and 0-2 oxygen.In one or more embodiments, R3na Formula (I) and Formula (1a) is -C1C6 alkylene-heterocycloaryl.

[0254] In one or more embodiments, each of R7 and R8 in Formula (I) and Formula (Ia) is independently hydrogen or substituted or unsubstituted C1-C6 alkyl. In one or more embodiments, each of R7 and R8 is independently hydrogen or substituted or unsubstituted C1-C3 alkyl. In one or more embodiments, each of R7 and R8 is independently substituted or unsubstituted C1-C3 alkyl. In one or more embodiments, each of R7 and R8 is independently -CH3, -CH2CH3, CH2CH2CH3 or -CH(CH3)2. In one or more embodiments, each of R and R8 is CH3. In one or more embodiments, each of R7 and R8 is -CH2CH3.

[0255] In one or more embodiments, R7 and R8 in Formula (I) and Formula (Ia) taken together with the nitrogen to which they are attached form a substituted or unsubstituted C2-C6 heterocyclyl. In one or more embodiments, R7 and R8 taken together with the nitrogen to which they are attached Petition 870250102047, dated 07 / 11 / 2025, pp. 125 / 460 118 / 272 linked together form a substituted or unsubstituted C2-C6 heterocycloalkyl. In one or more embodiments, R7 and R8 taken together with the nitrogen to which they are attached form a substituted or unsubstituted 3-7 membered heterocycloalkyl.

[0256] In one or more modes, R3 in Formula (I) and Formula (la) is

[0257] In one or more modes. R3na Formula (I) and Formula (la) is

[0258] In one or more modalities. R3na Formula (1) and Formula (1a) is

[0259] In one or more forms, Z in Formula (I) and Formula (Ia) is -C(=O)O- or -OC(=O)-.

[0260] In one or more forms, Z in Formula (I) and Formula (Ia) is -C(=O)NR4- or -NR4C(=O)-.

[0261] In one or more embodiments, Z in Formula (I) and Formula (Ia) is -C(=O)N(CH3)-, -N(CH3)C(=O)-, -C(=O)NH- or -NHC(=O)-. Petition 870250102047, dated 07 / 11 / 2025, pp. 126 / 460 119 / 272

[0262] In one or more forms, Z in Formula (I) and Formula (Ia) is -OC(=O)O-, -NR4C(=O)O-, -OC(O)NR4- or -NR4C(=O)NR4-.

[0263] In one or more embodiments, Z in Formula (I) and Formula (Ia) is -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH-, -NHC(=O)NH-, -N(CHs)C(=O)O-, -OC(=O)N(CH3)-, -N(CH3)C(=O)N(CH3)-, -NHC(=O)N(CH3)- or N(CH3)C(=O)NH-.

[0264] In one or more embodiments, Y in Formula (I) and Formula (Ia) is -OC(=O)O-, -NHC(=O)O-, -OC(=O)NH- or -NHC(=O)NH-.

[0265] In one or more embodiments, R5na Formula (I) and Formula (Ia) is hydrogen or substituted or unsubstituted C1-C3 alkyl.

[0266] In one or more embodiments, R5na Formula (I) and Formula (Ia) is H, -CH3, -CH-)CH3, -CH2CH2CH3 or -CH(CH3)2.

[0267] In one or more modalities, R5na Formula (I) and Formula (la) is H. 2. LNP Compositions Comprising Different Amino Lipids

[0268] In one or more embodiments, LNP comprises a plurality of amino lipids with different formulas. For example, the LNP composition may comprise 2, 3, 4, 5, 6, 7, 8, 9, 10 or more amino lipids. For another example, the LNP composition may comprise at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10 or at least 20 amino lipids. For yet another example, the LNP composition may comprise at most 2, at most 3, at most 4, at most 5, at most 6, at most 7, at most 8, at most 9, at most 10, at most 20 or at most 30 amino lipids.

[0269] In one or more embodiments, the LNP composition comprises a first amino lipid. In one or more embodiments, the Petition 870250102047, dated 07 / 11 / 2025, p. 127 / 460 The LNP composition 120 / 272 comprises a first amino lipid and a second amino lipid. In one or more embodiments, the LNP composition comprises a first amino lipid, a second amino lipid, and a third amino lipid. In one or more embodiments, the LNP composition comprises a first amino lipid, a second amino lipid, a third amino lipid, and a fourth amino lipid. In one or more embodiments, the LNP composition does not comprise a fourth amino lipid. In one or more embodiments, the LNP composition does not comprise a third amino lipid. In one or more embodiments, the molar ratio between the first amino lipid and the second amino lipid is from about 0.1 to about 10. In one or more embodiments, the molar ratio between the first amino lipid and the second amino lipid is from about 0.20 to about 5. In one or more embodiments, the molar ratio between the first amino lipid and the second amino lipid is from about 0.25 to about 4.In one or more embodiments, the molar ratio between the first amino lipid and the second amino lipid is about 0.25, about 0.33, about 0.5, about 1, about 2, about 3, or about 4.

[0270] In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 4:1:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 1:1:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 2:1:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 2:2:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 3:2:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 3:1:1. In one or more Petition 870250102047, dated 07 / 11 / 2025, pp. 128 / 460 In 121 / 272 embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 5:1:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 3:3:1. In one or more embodiments, the molar ratio between the first amino lipid: the second amino lipid: the third amino lipid is about 4:4:1. 3. Types of Additional Amino Lipids

[0271] In one or more embodiments, the LNP composition comprises one or more amino lipids. In one or more embodiments, one or more amino lipids comprise from about 40 mol% to about 65 mol% of the total lipid present in the particle. In one or more embodiments, one or more amino lipids comprise about 40 mol%, about 41 mol%, about 42 mol%, about 43 mol%, about 44 mol%, about 45 mol%, about 46 mol%, about 47 mol%, about 48 mol%, about 49 mol%, about 50 mol%, about 51 mol%, about 52 mol%, about 53 mol%, about 54 mol%, about 55 mol%, about 56 mol%, about 57 mol%, about 58 mol%, about 59 mol%, about 60 mol%, about 61 mol%, about 62 mol%, approximately 63% by mole, approximately 64% by mole, or approximately 65% ​​by mole of the total lipid present in the particle.In one or more embodiments, the first amino lipid comprises from about 1 mol% to about 99 mol% of the total amino lipids present in the particle. In one or more embodiments, the first amino lipid comprises from about 16.7 mol% to about 66.7 mol% of the total amino lipids present in the particle. In one or more embodiments, the first amino lipid comprises from about 20 mol% to about 60 mol% of the total amino lipids present in the particle.

[0272] In one or more embodiments, an amino lipid is a lipid Petition 870250102047, dated 07 / 11 / 2025, pp. 129 / 460 122 / 272 Ionizable. An ionizable lipid may comprise one or more ionizable nitrogen atoms. In one or more embodiments, at least one of one or more ionizable nitrogen atoms is positively charged. In one or more embodiments, at least 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, 95 mol%, or 99 mol% of the ionizable nitrogen atoms in the LNP composition are positively charged. In one or more embodiments, the amino lipid comprises a primary amine, a secondary amine, a tertiary amine, an imine, an amide, a guanidine moiety, a histidine residue, a lysine residue, an arginine residue, or any combination thereof. In one or more embodiments, the amino lipid comprises a primary amine, a secondary amine, a tertiary amine, a guanidine moiety, or any combination thereof. In one or more embodiments, the amino lipid comprises a tertiary amine.

[0273] In one or more embodiments, the amino lipid is a cationic lipid. In one or more embodiments, the amino lipid is an ionizable lipid. In one or more embodiments, the amino lipid comprises one or more nitrogen atoms. In one or more embodiments, the amino lipid comprises one or more ionizable nitrogen atoms.Examples of cationic and / or ionizable lipids include, but are not limited to, 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N142-(didodecylamino)ethyl]-N1,N4,N4tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC 3DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2dioleyloxy-N,N-dimethylaminopropane (DODMA), 2-({8-[(3e)-cholest-5-en-3yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine. Petition 870250102047, dated 07 / 11 / 2025, pp. 130 / 460 123 / 272 (Octyl-CLinDMA), (2R)-2-({8-[(3e)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2R)) and (2S)-2-({8-[(3e)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca9,12-dien-1-yloxy]propan-1-amine (Octyl-CLinDMA (2S)).

[0274] In one or more embodiments, an amino lipid described in this document may take the form of a salt, such as a pharmaceutically acceptable salt. All pharmaceutically acceptable salts of the amino lipid are covered by this disclosure. As used in this document, the term amino lipid also includes its pharmaceutically acceptable salts and its diastereomeric, enantiomeric, and epimeric forms.

[0275] In one or more embodiments, an amino lipid described in this document has one or more stereocenters, and each stereocenter exists independently in the R or S configuration. The lipids presented in this document include all diastereomeric, enantiomeric, and epimeric forms, as well as appropriate mixtures thereof. The lipids provided in this document include all cis, trans, syn, anti, entgegen (E), and zusammen (Z) isomers, as well as appropriate mixtures thereof. In certain embodiments, the lipids described in this document are prepared as their individual stereoisomers by reacting a racemic mixture of the compound with an optically active resolving agent to form a pair of diastereomeric compounds / salts, separating the diastereomers and recovering the optically pure enantiomers. In one or more embodiments, enantiomer resolution is performed using covalent diastereomeric derivatives of the compounds described in this document.In another embodiment, diastereomers are separated by separation / resolution techniques based on solubility differences. In other embodiments, the separation of stereoisomers is performed by chromatography or by the formation of diastereomeric salts and separation by recrystallization, or... Petition 870250102047, dated 07 / 11 / 2025, page 131 / 460 124 / 272 chromatography, or any combination thereof. Jean Jacques, Andre Collet, Samuel H. Wilen, Enantiomers, Racemates and Resolutions, John Wiley and Sons, Inc., 1981. In one aspect, stereoisomers are obtained by stereoselective synthesis.

[0276] In one or more embodiments, lipids, such as amino lipids, are substituted based on the structures disclosed in this document. In one or more embodiments, lipids, such as amino lipids, are not substituted. In another embodiment, the lipids described in this document are labeled isotopically (e.g., with a radioisotope) or by other means, including, but not limited to, the use of chromophores or fluorescent fractions, bioluminescent markers, or chemiluminescent markers.

[0277] The lipids described in this document include isotopically labeled compounds, which are identical to those cited in the various formulas and structures presented in this document, but in that one or more atoms are replaced by an atom with an atomic mass or mass number different from the atomic mass or mass number generally found in nature. Examples of isotopes that can be incorporated into the present lipids include isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine, and chlorine, such as, for example, 2H, 3H, 13C, 14C, 15N, 18O, 17O, 35S, 18F, and 36Cl. In one aspect, the isotopically labeled lipids described in this document, for example, those in which radioactive isotopes such as 3H and 14C are incorporated, are useful in drug and / or substrate tissue distribution assays.In one respect, isotopic substitution, such as with deuterium, provides certain therapeutic advantages resulting from greater metabolic stability, such as, for example, increased in vivo half-life or reduced dosage requirements.

[0278] In one or more forms, the carbon atom Petition 870250102047, dated 07 / 11 / 2025, p. 132 / 460 The 125 / 272 asymmetric amino lipid is present in an enantiomerically enriched form. In certain embodiments, the asymmetric carbon atom of the amino lipid has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (S)- or (R)- configuration.

[0279] In one or more embodiments, the disclosed amino lipids can be converted into N-oxides. In one or more embodiments, the N-oxides are formed by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid and / or hydrogen peroxides). Consequently, N-oxide compounds of the described amino lipids are disclosed herein, where permitted by valence and structure, which may be designated as NO or N+-O. In one or more embodiments, the nitrogen in the disclosed compounds can be converted into N-hydroxy or N-alkoxy. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent, such as ra-CPBA. All nitrogen-containing compounds shown are also considered.Consequently, N-hydroxy and N-alkoxy derivatives (e.g., N-OR, where R is substituted or unsubstituted C1-C1e alkyl, C1-C1e alkenyl, C1-C1e alkynyl, 3-14 membered carbocycle or 3-14 membered heterocycle) of the described amino lipids are also disclosed in this document.

[0280] In one or more embodiments, one or more amino lipids comprise from about 40 mol% to about 65 mol% of the total lipid present in the particle. 4. PEG-Lipids

[0281] In one or more embodiments, the described LNP composition includes one or more PEG-lipids. As used in this document, a Petition 870250102047, dated 07 / 11 / 2025, pp. 133 / 460 126 / 272 PEG lipid or PEG-lipid refers to a lipid comprising a polyethylene glycol component. Examples of suitable PEG-lipids also include, but are not limited to, PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, one or more PEG-lipids may comprise PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, a PEG-DSPE lipid, or a combination thereof.

[0282] In one or more embodiments, the PEG-lipid comprises from about 0.1 mol% to about 10 mol% of the total lipid present in the particle. 5. Phospholipid

[0283] In one or more embodiments, the described LNP composition includes one or more phospholipids.

[0284] In one or more embodiments, the phospholipid comprises from about 5 mol% to about 15 mol% of the total lipid present in the particle. 6. Cholesterol

[0285] In one or more forms, the composition of LNP includes cholesterol or a derivative thereof. 7. GaINAc-Lipid

[0286] In one or more embodiments, the LNP composition includes a receptor-targeting conjugate comprising a compound formula (V), Petition 870250102047, dated 07 / 11 / 2025, pp. 134 / 460 127 / 272 THE HN^L10-L11-L12-R A-L1L2L3^^ a-l4-l5-l6NL9 A-L7'L8 Formula (V) wherein, a plurality of groups A collectively comprises a receptor targeting fraction; Each L1, L2, L3, L4, L5, L6, L7, L8, L9, L10 and L12 is independently C1-C12 substituted or unsubstituted alkylene, C1-C12 substituted or unsubstituted heteroalkylene, C2-C12 substituted or unsubstituted alkenylene, C2-C12 substituted or unsubstituted alkynylene, -(CH2CH2O)m-, -(OCH2CH2)m-, -O-, S-, -S(=O)-, -S(=O)2-, -S(=O)(=NR1)-, -C(=O)-, -C(=N-OR1)-, -C(=O)O-, OC(=O)-, -C(=O)C(=O)-, -C(=O)NR1-, -NR1C(=O)-, -OC(=O)NR1-, -NR1C(=O)O, -NR1C(=O)NR1-, -C(=O)NR1C(=O)-, -S(=O)2NR1-, -NR1S(=O)2-, -NR1- or N(OR1)-; L11 is -(CH2CH2O)n- substituted or unsubstituted, -(OCH2CH2)n substituted or unsubstituted, or -(CH2)n- substituted or unsubstituted; each R1 is independently H or C1-C6 alkyl substituted or unsubstituted; R is a lipid, nucleic acid, amino acid, protein, or lipid nanoparticle; m is an integer selected from 1 to 10; en is an integer selected from 1 to 200.

[0287] In one or more embodiments, each L1, L4 and L7 is independently a substituted or unsubstituted C1-C12 alkylene. In one or more embodiments, each L1, L4 and L7 is independently a C2-C6 alkylene. Petition 870250102047, dated 07 / 11 / 2025, pp. 135 / 460 128 / 272 substituted or unsubstituted. In one or more embodiments, each L1, L4 and L7 is C4 alkylene. In one or more embodiments, each L2, L5 and L8 is independently -C(=O)NR1-, -NR1C(=O)-, -OC(=O)NR1-, -NR1C(=O)O-, NR1C(=O)NR1- or -C(=O)NR1C(=O)-. In one or more embodiments, each L2, L5 and L8 is independently -C(=O)NR1- or -NR1C(=O)-. In one or more embodiments, each L2, L5 and L8 is -C(=O)NH-. In one or more embodiments, each L3, L6 and L9 is independently C1-C12 substituted or unsubstituted alkylene. In one or more embodiments, each L3 is C2-C6 substituted or unsubstituted alkylene. In one or more embodiments, L3 is C4 alkylene. In one or more embodiments, each L6 and L9 is independently substituted or unsubstituted C2-C10 alkylene. In one or more embodiments, each L6 and L9 is independently substituted or unsubstituted C2-C6 alkylene. In one or more embodiments, each L6 and L9 is C3 alkylene. In one or more embodiments, A binds to a lectin. In one or more embodiments, the lectin is an asialoglycoprotein receptor (ASGPR). In one or more embodiments, A is N-acetylgalactosamine (GalNAc). or a derivative thereof. A is N-acetylgalactosamine (GalNAc) or a derivative thereof.

[0288] Examples of such GalNAc lipids include the following: AcHN where each of the following is independently an integer from 1 to 5 and en is an integer from 1 to 50; Petition 870250102047, dated 07 / 11 / 2025, pp. 136 / 460 129 / 272 AcHN AcHN where n is an integer from 1 to 50; AcHN' Petition 870250102047, dated 07 / 11 / 2025, pp. 137 / 460 130 / 272 AcHN AcHN AcHN where each of peq is independently an integer from 1 to 5 and en is an integer from 1 to 50; AcHN Petition 870250102047, dated 07 / 11 / 2025, pp. 138 / 460 131 / 272 AcHN where n is an integer from 1 to 50; AcHN Petition 870250102047, dated 07 / 11 / 2025, pp. 139 / 460 132 / 272 AcHN AcHN AcHN AcHN where each of the following is independently an integer from 1 to 5 and en is an integer from 1 to 50; AcHN Petition 870250102047, dated 07 / 11 / 2025, pp. 140 / 460 133 / 272 where each of the following is independently an integer from 1 to 5 and en is an integer from 1 to 50; where each of peq is independently an integer from 1 to 5 and en is an integer from 1 to 50; where each of peq is independently an integer from a to 5 and en is an integer from 33 to 39; Petition 870250102047, dated 07 / 11 / 2025, pp. 141 / 460 134 / 272 o o o where n is an integer from 1 to 50; Petition 870250102047, dated 07 / 11 / 2025, pp. 142 / 460 135 / 272 O

[0289] In one or more embodiments, the receptor targeting conjugate comprises from about 0.001 mol% to about 20 mol% of the total lipid content present in the nanoparticle composition. 8. Phosphate Charge Neutralizer

[0290] In one or more embodiments, the LNP described in this document includes a phosphate charge neutralizer. In one or more embodiments, the phosphate charge neutralizer comprises arginine, asparagine, glutamine, lysine, histidine, cationic dendrimers, polyamines, or a combination thereof. In one or more embodiments, the phosphate charge neutralizer comprises one or more nitrogen atoms. In one or more embodiments, the phosphate charge neutralizer comprises a Petition 870250102047, dated 07 / 11 / 2025, pp. 143 / 460 136 / 272 polyamine.

[0291] Suitable phosphate charge neutralizers for use in LNP formulations, set forth below, include, but are not limited to, spermidine and 1,3-propanediamine. 9. Antioxidants

[0292] In one or more embodiments, the LNP described in this document includes one or more antioxidants. In one or more embodiments, one or more antioxidants function to reduce the degradation of cationic lipids, payload, or both. In one or more embodiments, one or more antioxidants comprise a hydrophilic antioxidant. In one or more embodiments, one or more antioxidants is a chelating agent, such as ethylenediaminetetraacetic acid (EDTA) or citrate. In one or more embodiments, one or more antioxidants comprise a lipophilic antioxidant. In one or more embodiments, the lipophilic antioxidant comprises a vitamin E isomer or a polyphenol. In one or more embodiments, one or more antioxidants are present in the LNP composition at a concentration of at least 1 mM, at least 10 mM, at least 20 mM, at least 50 mM, or at least 100 mM. In one or more embodiments, one or more antioxidants are present in the particle at a concentration of approximately 20 mM. 10. Other Lipids

[0293] In one or more embodiments, the disclosed LNP compositions may comprise an auxiliary lipid. In one or more embodiments, the disclosed LNP compositions comprise a neutral lipid. In one or more embodiments, the disclosed LNP compositions comprise a stealth lipid. In one or more embodiments, the disclosed LNP compositions comprise additional lipids. Neutral lipids may function to stabilize and improve the processing of LNPs.

[0294] Auxiliary lipids may refer to lipids that Petition 870250102047, dated 07 / 11 / 2025, pp. 144 / 460 137 / 272 enhance transfection (e.g., transfection of the nanoparticle (LNP) comprising the composition as provided herein, including the biologically active agent). The mechanism by which the auxiliary lipid enhances transfection includes enhancing particle stability. In one or more embodiments, the auxiliary lipid enhances membrane fusogenicity. Auxiliary lipids may include steroids, sterols, and alkyl resorcinols. Auxiliary lipids suitable for use in this disclosure may include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one or more embodiments, the auxiliary lipid is cholesterol. In one or more embodiments, the auxiliary lipid is cholesterol hemisuccinate.

[0295] Stealth lipids may refer to lipids that alter the length of time nanoparticles can exist in vivo (e.g., in blood). Stealth lipids can aid in the formulation process, for example, by reducing particle aggregation and controlling particle size. The stealth lipids used in this document can modulate the pharmacokinetic properties of LNP. Stealth lipids suitable for use in a lipid composition of the disclosure may include, but are not limited to, stealth lipids with a hydrophilic head group attached to a lipid moiety. Stealth lipids suitable for use in a lipid composition of the present disclosure and information on the biochemistry of such lipids can be found in Romberg et al, Pharmaceutical Research, Vol. 25, No. 1, 2008, pp. 55-71 and I-Toekstra et al, Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed, for example, in WO 2006 / 007712.

[0296] In one or more embodiments, the stealth lipid is a PEG lipid. In one embodiment, the hydrophilic core group of the stealth lipid comprises a polymer fraction selected from PEG-based polymers. Petition 870250102047, dated 07 / 11 / 2025, pp. 145 / 460 138 / 272 (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids and poly N-(2-hydroxypropyl)methacrylamide]. Stealth lipids may comprise a lipid fraction. In one or more embodiments, the lipid fraction of the stealth lipid may be derived from diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group with an alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, wherein the chain may comprise one or more functional groups, such as, for example, an amide or ester. The dialkylglycerol or dialkylglycamide group may further comprise one or more substituted alkyl groups.

[0297] The structures and properties of auxiliary lipids, neutral lipids, stealth lipids and / or other lipids are further described in W02017173054A1, W02019067999A1, US20180290965A1, US20180147298A1, US20160375134A1, US8236770, US8021686, US8236770B2, US7371404B2, US7780983B2, US7858117B2, US20180200186A1, US20070087045A1, W02018119514A1 and W02019067992A1, all of which are incorporated herein by reference in their entirety. 11. LNP Formulations

[0298] Particular formulations of a nanoparticle composition comprising one or more described lipids are described in this document.

[0299] The described nanoparticle compositions are capable of delivering a therapeutic agent, such as RNA, to a particular cell, tissue, organ, or system, or group thereof, in the body of a mammal. The physicochemical properties of the nanoparticle compositions can be altered in order to increase selectivity for specific body targets. By Petition 870250102047, dated 07 / 11 / 2025, pp. 146 / 460 139 / 272 For example, particle sizes can be adjusted based on the fenestration sizes of different organs. The therapeutic agent included in a nanoparticle composition can also be selected based on the desired delivery targets. For example, a therapeutic agent can be selected for a particular indication, condition, disease, or disorder and / or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., localized or specific delivery). In certain embodiments, a nanoparticle composition may include an mRNA encoding a polypeptide of interest capable of being translated within a cell to produce the polypeptide (e.g., gene editor) of interest. Such a composition is capable of having specificity or affinity for a particular organ or cell type to facilitate delivery of the drug substance, for example, the liver or hepatocytes.

[0300] The amount of a therapeutic agent or pharmacological substance (e.g., mRNA encoding for gene editor and guide nucleic acid, such as guide RNA) in an LNP composition may depend on the size, composition, target and / or desired application or other properties of the nanoparticle composition. For example, the amount of RNA in a nanoparticle composition may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of a therapeutic agent and other elements (e.g., lipids) in a nanoparticle composition may also vary. In one or more embodiments, the weight / weight ratio of the lipid component to a therapeutic agent in a nanoparticle composition may be from about 5:1 to about 60:1, such as about 5:1. 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1 and 60:1.For example, the weight / weight ratio of the lipid component for a therapeutic agent can be from about 10:1 to about 40:1. In certain modalities, Petition 870250102047, dated 07 / 11 / 2025, pp. 147 / 460 140 / 272 the weight / weight ratio is approximately 20:1. The amount of a therapeutic agent in a nanoparticle composition can be measured using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy).

[0301] In one or more embodiments, an LNP formulation comprises one or more nucleic acids, such as RNAs. In one or more embodiments, one or more RNAs, lipids, and amounts thereof may be selected to provide a specific N / P ratio. The N / P ratio can be selected from about 1 to about 30. The N / P ratio can be selected from about 2 to about 12. In one or more embodiments, the N / P ratio is from about 0.1 to about 50. In one or more embodiments, the N / P ratio is from about 2 to about 8. In one or more embodiments, the N / P ratio is from about 2 to about 15, from about 2 to about 10, from about 2 to about 8, from about 2 to about 6, from about 3 to about 15, from about 3 to about 10, from about 3 to about 8, from about 3 to about 6, from about 4 to about 15, from about 4 to about 10, from about 4 to about 8, or from about 4 to about 6.In one or more modalities, the N / P ratio is approximately 2, approximately 2.5, approximately 3, approximately 3.5, approximately 4, approximately 4.5, approximately 5, approximately 5.5, approximately 6, approximately 6.5, approximately 7, approximately 7.5, approximately 8, approximately 9, or approximately 10. In one or more modalities, the N / P ratio is from approximately 4 to approximately 6. In one or more modalities, the N / P ratio is approximately 4, approximately 4.5, approximately 5, approximately 5.5, or approximately 6.

[0302] As used in this document, the N / P ratio is the molar ratio of ionizable nitrogen atoms (e.g., in the physiological pH range) in a lipid (or lipids) to phosphate groups in a nucleic acid molecular entity (or nucleic acid molecular entities), for example, in a nanoparticle composition comprising a lipid component and an RNA. Ionizable nitrogen atoms may include, for example, nitrogen atoms that can be protonated at approximately Petition 870250102047, dated 07 / 11 / 2025, pp. 148 / 460 141 / 272 of pH 1, approximately pH 2, approximately pH 3, approximately pH 4, approximately pH 4.5, approximately pH 5, approximately pH 5.5, approximately pH 6, approximately pH 6.5, approximately pH 7, approximately pH 7.5, or approximately pH 8 or higher. The physiological pH range may include, for example, the pH range of different cellular compartments (such as organs, tissues, and cells) and body fluids (such as blood, cerebrospinal fluid, gastric juice, milk, bile, saliva, tears, and urine). In certain specific embodiments, the physiological pH range refers to the pH range of blood in a mammal, for example, from approximately 7.35 to approximately 7.45. Similarly, for phosphate charge neutralizers that have one or more ionizable nitrogen atoms, the N / P ratio can refer to a molar ratio of ionizable nitrogen atoms in the phosphate charge neutralizer to the phosphate groups in a nucleic acid.In one or more embodiments, ionizable nitrogen atoms refer to nitrogen atoms that are ionizable within a pH range between 5 and 14.

[0303] For payloads that do not contain a phosphate group, the N / P ratio may refer to a molar ratio of ionizable nitrogen atoms in a lipid to the total negative charge in the payload. For example, the N / P ratio of an LNP composition may refer to a molar ratio of the total ionizable nitrogen atoms in the LNP composition to the total negative charge in the payload that is present in the composition.

[0304] In one or more embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 50% to about 70%, from about 70% to about 90%, or from about 90% to about 100%. In one or more embodiments, LNPs are formed with an average encapsulation efficiency ranging from about 75% to about 98%.

[0305] In another aspect, a lipid nanoparticle (LNP) comprising the composition as provided herein is provided in this document. As used herein, a composition of Petition 870250102047, dated 07 / 11 / 2025, pp. 149 / 460 Lipid nanoparticles (LNPs) or a nanoparticle composition is a composition comprising one or more described lipids. LNP compositions are typically sized on the order of micrometers or smaller and may include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. In one or more embodiments, an LNP refers to any particle having a diameter smaller than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. In one or more embodiments, a nanoparticle can vary in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 40-100 nm, 50-100 nm, 50-90 nm, 50-80 nm, 50-70 nm, 55-95 nm, 55-80 nm, 55-75 nm, 60-100 nm, 60-90 nm, 60-80 nm, 60-70 nm, 25-100 nm, 25-80 nm, 40-80 nm, 45-75 nm, 60-75 nm, or 60-65 nm.

[0306] In one or more embodiments, an LNP can be made of cationic, anionic, or neutral lipids. In one or more embodiments, an LNP can comprise neutral lipids, such as the fusogenic phospholipid 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or membrane component cholesterol, as auxiliary lipids to enhance transfection activity and nanoparticle stability. In one or more embodiments, an LNP can comprise hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids. Any lipid or combination of lipids known in the art can be used to produce an LNP.Examples of lipids used to produce LNPs include, but are not limited to, DOTMA (N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride), DOSPA (N,N-dimethylN-([2-spermidocarboxamido]ethyl)-2,3-bis(dioleyloxy)-1-propaniminohydrochloride), DOTAP (1,2-dioleoyl-3-trimethylammonium propane), DMRIE (N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy-1-propanaminobromide), DC-cholesterol (3e-[N(N',N'-dimethylaminoethane)-carbamoyl]cholesterol), DOTAP-cholesterol, GAPDMORIE-DPyPE, and GL67A-DOPE-DMPE. (1,2-Bis(dimethylphosphine)ethane). Petition 870250102047, dated 07 / 11 / 2025, pages 150 / 460 143 / 272 polyethylene glycol (PEG). Examples of cationic lipids include, but are not limited to, 98N12-5, C12-200, DLin-KC2-DMA (KC2), DLin-MC3-DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids include, but are not limited to, DPSC, DPPC (Dipalmitoylphosphatidylcholine), POPC (1-palmitoyl-2-oleoyl-sn-glycero3-phosphocholine), DOPE, and SM (sphingomyelin). Examples of PEG-modified lipids include, but are not limited to, PEG-DMG (Dimiristoylglycerol), PEGCerC14, and PEG-CerC20. In one or more embodiments, lipids may be combined in any number of molar ratios to produce an LNP. In one or more embodiments, the polynucleotide can be combined with lipids in a wide range of molar ratios to produce an LNP.

[0307] The substituted term, unless otherwise indicated, refers to the substitution of one or more hydrogen radicals in a given structure by the radical of a specified substituent, including, but not limited to: halo, alkyl, alkenyl, alkynyl, aryl, heterocyclyl, thiol, alkylthio, oxo, thioxy, arylthio, alkylthioalkyl, arylthioalkyl, alkylsulfonyl, alkylsulfonylalkyl, arylsulfonylalkyl, alkoxy, aryloxy, aralkoxy, aminocarbonyl, alkylaminocarbonyl, alkylaminocarbonyl, alkoxycarbonyl, aryloxycarbonyl, haloalkyl, amino, trifluoromethyl, cyano, nitro, alkylamino, arylamino, alkylaminoalkyl, alkylaminoalkyl, aminoalkylamino, hydroxy, alkoxyalkyl, carboxyalkyl, alkoxycarbonylalkyl, aminocarbonylalkyl, acyl, aralkoxycarbonyl, carboxylic acid, sulfonic acid, sulfonyl, phosphonic acid, aryl, heteroaryl, heterocyclic and an aliphatic group. It is understood that the substituent may be additionally substituted.Exemplary substituents include amino, alkylamino, and the like.

[0308] As used in this document, the term substituent means positional variables on the atoms of a central molecule that are substituted at a designated atom position, replacing one or more hydrogens on the designated atom, provided that the normal valence of the designated atom is not exceeded and that the substitution results in a compound Petition 870250102047, dated 07 / 11 / 2025, pp. 151 / 460 144 / 272 stable. Combinations of substituents and / or variables are permitted only if such combinations result in stable compounds. One skilled in the art should note that any carbon, as well as heteroatom with valences that appear to be unsatisfied as described or shown in this document, is assumed to have a sufficient number of hydrogen atoms to satisfy the valences described or shown. In certain cases, one or more substituents with a double bond (e.g., oxo or =O) as the point bond may be described, shown, or listed in this document within a substituent group, where the structure may show only a single bond as the point bond to the central structure of Formula (I). One skilled in the art would understand that although only a single bond is shown, a double bond is intended for these substituents.

[0309] The term alkyl refers to a linear or branched hydrocarbon chain radical with one to twenty carbon atoms, and which is linked to the rest of the molecule by a single bond. An alkyl comprising up to 10 carbon atoms is referred to as a C1-C10 alkyl; similarly, for example, an alkyl comprising up to 6 carbon atoms is a C1-C6 alkyl. Alkyls (and other fractions defined in this document) comprising other numbers of carbon atoms are represented similarly. Alkyl groups include, but are not limited to, C1-C10 alkyl, C1-C9 alkyl, C1-C8 alkyl, C1-C7 alkyl, C1-C6 alkyl, C1-C5 alkyl, C1-C4 alkyl, C1-C3 alkyl, C1-C2 alkyl, C2-C8 alkyl, C3-C8 alkyl, and C4-C8 alkyl. Representative alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (i-propyl), n-butyl, i-butyl, s-butyl, n-pentyl, 1,1-dimethylethyl (t-butyl), 3-methylhexyl, 2-methylhexyl, 1-ethylpropyl, and the like. In one or more embodiments, the alkyl is methyl or ethyl.In one or more embodiments, the alkyl group is -CH(CH3)2 or -C(CH3)3. Unless otherwise specifically indicated in the descriptive report, an alkyl group may optionally be substituted as described below. Petition 870250102047, dated 07 / 11 / 2025, pp. 152 / 460 145 / 272 Alkylene or alkylene chain refers to a linear or branched divalent hydrocarbon chain that links the rest of the molecule to a radical group. In one or more embodiments, the alkylene is -CI-12-, -CH2CH2-, or -CH2CH2CH2. In one or more embodiments, the alkylene is -CH2-. In one or more embodiments, the alkylene is -CH2CH2-. In one or more embodiments, the alkylene is -CH2CH2CH2-.

[0310] The term alkenyl refers to a type of alkyl group in which at least one carbon-carbon double bond is present. In one embodiment, an alkenyl group has the formula -C(R)=CR2, where R refers to the remaining portions of the alkenyl group, which may be the same or different. In one or more embodiments, R is H or an alkyl. In one or more embodiments, an alkenyl is selected from ethenyl (i.e., vinyl), propenyl (i.e., allyl), butenyl, pentenyl, pentadienyl, and the like. Non-limiting examples of an alkenyl group include -CH=CH2, -C(CH3)=CH2, -CH=CHCH3, -C(CH3)=CHCH3, and CH2CH=CH2.

[0311] The term cycloalkyl refers to a non-aromatic monocyclic or polycyclic radical, in which each of the atoms forming the ring (i.e., skeleton atoms) is a carbon atom. In one or more embodiments, cycloalkyls are saturated or partially unsaturated. In one or more embodiments, cycloalkyls are spirocyclic or bridging compounds. In one or more embodiments, cycloalkyls are fused with an aromatic ring (in which case the cycloalkyl is linked through a carbon atom of the non-aromatic ring). Cycloalkyl groups include groups with 3 to 10 atoms in the ring. Representative cycloalkyls include, but are not limited to, cycloalkyls with three to ten carbon atoms, three to eight carbon atoms, three to six carbon atoms, or three to five carbon atoms. Monocyclic cycloalkyl radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. In one or more embodiments, the monocyclic cycloalkyl Petition 870250102047, dated 07 / 11 / 2025, pp. 153 / 460 146 / 272 is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl. In one or more embodiments, the monocyclic cycloalkyl is cyclopentenyl or cyclohexenyl. In one or more embodiments, the monocyclic cycloalkyl is cyclopentenyl 1. Polycyclic radicals include, for example, adamantil, 1,2-dihydronaphthalenyl, 1,4-dihydronaphthalenyl, tetrainyl, decalinyl, 3,4-dihydronaphthalenyl-1(2H)-one, spiro[2.2]pentyl, norbomyl, and bicycle[1.1.1]pentyl. Unless otherwise specifically indicated in the descriptive report, a cycloalkyl group may be optionally substituted. Depending on the structure, a cycloalkyl group may be monovalent or divalent (i.e., a cycloalkylene group).

[0312] The term heterocycle or heterocyclic refers to heteroaromatic (also known as heteroaris) and heterocycloalkys (also known as heteroalicyclic groups) rings that include at least one heteroatom selected from nitrogen, oxygen, and sulfur, wherein each heterocyclic group has from 3 to 12 atoms in its ring system, and with the condition that any ring does not contain two adjacent O or S atoms. A heterocyclyl is a univalent group formed by removing a hydrogen atom from any ring atoms of a heterocyclic compound. In one or more embodiments, heterocycles are monocyclic, bicyclic, polycyclic, spirocyclic, or bridging compounds. Non-aromatic heterocyclic groups (also known as heterocycloalkys) include rings with 3 to 12 atoms in their ring system, and aromatic heterocyclic groups include rings with 5 to 12 atoms in their ring system. Heterocyclic groups include benzofused ring systems.Exemplos de grupos heterocíclicos não aromaticos são pirrolidinil, tetra-hidrofuranil, di-hidrofuranil, tetra-hidrotienil, oxazolidinonil, tetra-hidropiranil, di-hidropiranil, tetra-hidrotiopiranil, piperidinil, morpholinil, tiomorfolinil, tioxanil, piperazinil, aziridinil, azetidinil, oxetanil, tietanil, homopiperidinil, oxepanil, tiepanil, oxazepinil, diazepinil, tiazepinil, 1,2,3,6-tetrahidropiridinil, pirrolin-2-il, pirrolina-3-il, indolinil, 2H-piranil, 4H-piranil, dioxanil,. Petition 870250102047, of 07 / 11 / 2025, pág. 154 / 460 147 / 272 1,3-dioxolanil, pirazolinil, ditianil, dithiolanil, di-hidropiranil, di-hidrotienil, dihidrofuranil, pirazolidinil, imidazolinil, imidazolidinil, 3-azabiciclo[3.1.0]hexanil, 3azabiciclo[4.1.0]heptanil, 3H-indolil, indolin-2-onil, isoindolin-l-onil, isoindolina1,3-dionil, 3,4-di-hidroisoquinolin-1(2H)-onil, 3,4-di-hidroquinolin-2(1H)-onil, isoindolina-1,3-ditionil, benzo[d]oxazol-2(3H)-onil, 1 H-benzo[d]imidazol-2(3H)onil, benzo[d]thiazol-2(3H)-onil e quinolizinil. Examples of heterocyclic aromatic groups are pyridinil, imidazolil, pirimidinil, pirazolil, triazolil, pirazinil, tetrazolil, futil, tienil, isoxazolil, tiazolil, oxazolil, isotiazolil, pyrrolil, quinolinil, isoquinolinil, indolil, benzimidazolil, benzofuranil, cinolinil, indazolil, indolizinil, ftalazinil, piridazinil, triazinil, isoindolil, pteridinil, purinil, oxadiazolil, tiadiazolil, furazanil, benzofurazanil, benzotiofenil, benzotiazolil, benzoxazolil, quinazolinil, quinoxalinil, naphthiridinil and furopiridinil.The preceding groups are C-attached (or C-linked) or N-attached where possible. For example, a pyrrole-derived group includes pyrrole-1-yl (N-attached) or pyrrole-3-yl (C-attached). Additionally, an imidazole-derived group includes imidazole-1-yl or imidazole-3-yl (both N-attached) or imidazole-2-yl, imidazole-4-yl, or imidazole-5-yl (all C-attached). Heterocyclic groups include benzofused ring systems. Non-aromatic heterocycles are optionally substituted with one or two oxo (=O) moieties, such as pyrrolidin-2-one. In one or more embodiments, at least one of the two rings of a bicyclic heterocycle is aromatic. In one or more embodiments, both rings of a bicyclic heterocycle are aromatic.

[0313] The term heterocycloalkyl refers to a cycloalkyl group that includes at least one heteroatom selected from nitrogen, oxygen, and sulfur. Unless otherwise specifically indicated in the descriptive report, the heterocycloalkyl radical may be a monocyclic or bicyclic ring system, which may include fused ring systems (when fused with an aryl or heterocycloalkyl ring, the heterocycloalkyl is linked through a non-aromatic ring atom) or bridging systems. The nitrogen, carbon, or sulfur atoms Petition 870250102047, dated 07 / 11 / 2025, pp. 155 / 460 148 / 272 sulfur in the heterocycloalkyl radical can be optionally oxidized. The nitrogen atom can be optionally quaternized. The heterocycloalkyl radical is partially or fully saturated. Examples of heterocycloalkyl radicals include, but are not limited to, dioxolanil, thienyl[1,3]ditianyl, tetrahydroquinolyl, tetrahydroisoquinolyl, decahydroquinolyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidinyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, tritianyl, tetrahydropyranil, thiomorpholinyl, thiamorpholinyl, 1-oxothiomorpholinyl, 1,1-dioxothiomorpholinyl. The term heterocycloalkyl also includes all ring forms of carbohydrates, including, but not limited to, monosaccharides, disaccharides, and oligosaccharides.Unless otherwise indicated, heterocycloalkyls have 2 to 12 carbons in the ring. In one or more embodiments, heterocycloalkyls have 2 to 10 carbons in the ring. In one or more embodiments, heterocycloalkyls have 2 to 10 carbons in the ring and 1 or 2 N atoms. In one or more embodiments, heterocycloalkyls have 2 to 10 carbons in the ring and 3 or 4 N atoms. In one or more embodiments, heterocycloalkyls have 2 to 12 carbons, 0-2 N atoms, 0-2 O atoms, 0-2 P atoms, and 0-1 S atoms in the ring. In one or more embodiments, heterocycloalkyls have 2 to 12 carbons, 1-3 N atoms, 0-1 O atoms, and 0-1 S atoms in the ring. It is understood that, when referring to the number of carbon atoms in a heterocycloalkyl group, the number of carbon atoms in the heterocycloalkyl group is not the same as the total number of atoms (including heteroatoms) that make up the heterocycloalkyl group (i.e., atoms of the heterocycloalkyl ring skeleton).Unless otherwise specifically indicated in the descriptive report, a heterocycloalkyl group may optionally be substituted. As used in this document, the term tetracycloalkylene may refer to a divalent heterocycloalkyl group. Petition 870250102047, dated 07 / 11 / 2025, pp. 156 / 460 149 / 272

[0314] The term heteroaryl refers to an aryl group that includes one or more heteroatoms in the ring selected from nitrogen, oxygen, and sulfur. The heteroaryl is monocyclic or bicyclic. Illustrative examples of monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, tienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl, furazanil, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinolin, quinoline, isoquinoline, cinnoligne, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. Illustrative examples of monocyclic heteroaryls include pyridinyl, imidazolyl, pyrimidinyl, pyrazolyl, triazolyl, pyrazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, thiazolyl, oxazolyl, isothiazolyl, pyrrolyl, pyridazinyl, triazinyl, oxadiazolyl, thiadiazolyl and furazanil.Illustrative examples of bicyclic heteroaryls include indolezine, indole, benzofuran, benzothiophene, indazole, benzimidazole, purine, quinoline, quinoline, isoquinoline, cinoline, phthalazine, quinazoline, quinoxaline, 1,8-naphthyridine, and pteridine. In one or more embodiments, a heteroaryl is pyridinyl, pyrazinyl, pyrimidinyl, thiazolyl, tienyl, thiadiazolyl, or furyl. In one or more embodiments, a heteroaryl contains 0-6 N atoms in the ring. In one or more embodiments, a heteroaryl contains 1-4 N atoms in the ring. In one or more embodiments, a heteroaryl contains 4-6 N atoms in the ring. In one or more embodiments, a heteroaryl contains 0-4 N atoms, 0-1 O atoms, 0-1 P atoms, and 0-1 S atoms in the ring. In one or more embodiments, a heteroaryl contains 1-4 N atoms, 0-1 O atoms, and 0-1 S atoms in the ring. In one or more embodiments, a heteroaryl is a C1-C9 heteroaryl. In one or more embodiments, a monocyclic heteroaryl is a C1-C5 heteroaryl.In one or more embodiments, a monocyclic heteroaryl is a 5-membered or 6-membered heteroaryl. In one or more embodiments, a bicyclic heteroaryl is a C6-C9 heteroaryl. In one or more embodiments, a heteroaryl group is partially reduced to form a heterocycloalkyl group as defined in this document. In one or more embodiments. Petition 870250102047, dated 07 / 11 / 2025, pp. 157 / 460 In 150 / 272 embodiments, a heteroaryl group is fully reduced to form a heterocycloalkyl group as defined in this document.

[0315] As used in this document, amino acid lipids may contain at least one primary, secondary, or tertiary amine moiety that is protonable (or ionizable) between the pH range of 4 and 14. In one or more embodiments, the amine moiety(ies) function as the major hydrophilic group of amino lipids. When most of the amine fractions of an amino lipid (or amino lipids in a nucleic acid-lipid nanoparticle formulation) are protonated at physiological pH, then the nanoparticles can be termed cationic lipid nanoparticles (cLNPs). When most of the amine fractions of an amino lipid (or amino lipids in a nucleic acid-lipid nanoparticle formulation) are not protonated at physiological pH, but can be protonated at acidic pH, endosomal pH for example, then the nanoparticles can be termed ionizable lipid nanoparticles (iLNPs).The amino lipids that make up cLNPs can generally be called cationic amino lipids (cLipids). The amino lipids that make up iLNPs can be called ionizable amino lipids (iLipids). An amino lipid can be either an iLipid or a cLipid at physiological pH.

[0316] As used in this document, LNP compositions or formulations are typically sized on the order of micrometers or smaller and may include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes, lipid vesicles, and lipoplexes. For example, a nanoparticle composition might be a liposome with a lipid bilayer with a diameter of 500 nm or less. The LNPs described in this document may have an average diameter of about 1 nm to about 2500 nm, about 10 nm to about 1500 nm, about 20 nm to about 1000 nm, about 30 nm to about 150 nm, of Petition 870250102047, dated 07 / 11 / 2025, pp. 158 / 460 151 / 272 from about 40 nm to about 150 nm, from about 50 nm to about 150 nm, from about 60 nm to about 130 nm, from about 70 nm to about 110 nm, from about 70 nm to about 100 nm, from about 80 nm to about 100 nm, from about 90 nm to about 100 nm, from about 70 to about 90 nm, from about 80 nm to about 90 nm, or from about 70 nm to about 80 nm. The LNPs described in this document may have an average diameter of approximately 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, 150 nm or larger. The LNPs described in this document may be substantially non-toxic.

[0317] As used in this document, a phospholipid may refer to a lipid that includes a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains. A phospholipid may include one or more multiple bonds (e.g., double or triple). In one or more embodiments, a phospholipid may facilitate fusion to a membrane. For example, a cationic phospholipid may interact with one or more negatively charged phospholipids of a membrane (e.g., a cell or intracellular membrane). The fusion of a phospholipid to a membrane may allow one or more elements of a LNP to pass through the membrane, i.e., distribution of one or more elements to a cell. 12. Payload

[0318] The LNPs described in this document may be designed to deliver a payload, such as one or more therapeutic agents or pharmacological substances, to a target cell or organ of interest. In one or more embodiments, an LNP described in this document involves one or more components of a gene-editing system as described in this document. For example, an LNP may involve one or more of a guide nucleic acid, such as a guide RNA, a nucleic acid that encodes the acid Petition 870250102047, dated 07 / 11 / 2025, pp. 159 / 460 152 / 272 guide nucleic acid, a vector encoding the guide nucleic acid, a gene editor fusion protein, a nucleic acid encoding the gene editor fusion protein, a programmable DNA binding domain, a nucleic acid encoding the programmable DNA binding domain, or any combination thereof. In one or more embodiments, the nucleic acid is DNA. In one or more embodiments, the nucleic acid is RNA, for example, mRNA and / or guide RNA. In one or more embodiments, the nucleic acids are chemically modified.

[0319] In one or more embodiments, the payload comprises one or more nucleic acids (i.e., one or more nucleic acid molecular entities). In one or more embodiments, the nucleic acid is a single-stranded nucleic acid. In one or more embodiments, the single-stranded nucleic acid is DNA. In one or more embodiments, the single-stranded nucleic acid is RNA. In one or more embodiments, the nucleic acid is a double-stranded nucleic acid. In one or more embodiments, the double-stranded nucleic acid is DNA. In one or more embodiments, the double-stranded nucleic acid is RNA. In one or more embodiments, the double-stranded nucleic acid is a DNA-RNA hybrid. In one or more embodiments, the nucleic acid is messenger RNA (mRNA), microRNA, asymmetric interfering RNA (aiRNA), small hairpin RNA (shRNA), an antisense oligonucleotide, or a Dicer-Substrate dsRNA.In one or more embodiments, single-stranded nucleic acids form a secondary structure, one or more stem-loops, for example. In one or more other embodiments, single-stranded nucleic acids contain one or more stem-loops and single-stranded regions within the molecule. 13. Illustrative LNP Formulations

[0320] The following are examples of LPA LNP formulations. Examples of Lipid Ratios (molar percentages): Petition 870250102047, dated 07 / 11 / 2025, pp. 160 / 460 153 / 272 LNP Component Formulation #1 Formulation #2 GalNAc Formulation #1 GalNAc Formulation #2 Lipid 40-60 50 + / - 10% 40-60 50 + / - 10% Cholesterol 28-48 38 + / - 10% 27.95-47.95 37.95 + / - 10% DSPC 5-13 9 + / - 10% 5-13 9 + / - 10% PEG-Lipid 2-5 3 + / - 10% 2-5 3 + / - 10% GalNAc-Lipid N / AN / A 0.02-0.09 0.05 + / - 10% The LNPs above can be formulated with an mRNA:gRNA weight ratio of 1:1 + / - 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of mRNA or gRNA, or any therapeutically effective ratio. Thus, for example, an mRNA:gRNA weight ratio of 1:1 + / - 10% gRNA would mean any mRNA:gRNA ratio between 1:0.9 and 1:1.1. The N / P ratio of the LNP can be from about 4 to about 7, about 4, about 4.5, about 5, about 5.5, or about 6, about 6.5, or about 7, with each ratio + / - 5-20%. LNPs may be contained in a pharmaceutically acceptable solution which may, for example, comprise a buffer with a pH of approximately 7.5 + / - 1.5 and including tris and / or sucrose. The gRNAs may comprise sequences substantially identical to those specified in Table 3. Thus, for example, one or more of the gRNA combinations set out in Figure 2 may comprise the LNP payload.The average diameter of LNPs can be about 70 nm + / - 20 nm, 70 nm + / - 10 nm, 70 nm + / - 5 nm; 60 nm + / 20 nm, 60 nm + / - 10 nm, 60 nm + / - 5 nm; 50nm + / - 20nm, 50nm + / - 10nm, 50nm + / - 5nm; 45 nm + / - 20 nm, 45 nm + / - 10 nm, 45 nm + / - 5 nm.

[0321] Although LNPs are described in this document as a Petition 870250102047, dated 07 / 11 / 2025, pp. 161 / 460 154 / 272 suitable delivery system, other systems may be employed to deliver gRNA / mRNA to a cell or subject. Some of these suitable systems include virus-like particle delivery systems, virus delivery systems such as AAV delivery systems, and any other delivery systems. VIII. KITS

[0322] It is contemplated in this document that the therapeutic agents or pharmacological substances disclosed in this document are part of a kit as described in this document. Consequently, one aspect of the disclosure refers to kits including compositions comprising guide nucleic acids, such as guide RNAs, as provided in this document, the gene editor or gene editor system as provided in this document, the compositions as provided in this document and / or the lipid nanoparticle formulations as provided in this document to treat or prevent a condition. The kits may additionally include one or more additional therapeutic regimens or agents to treat or prevent a condition.

[0323] Also disclosed in this document, in certain embodiments, are kits and articles of manufacture for use with one or more methods described in this document. Such kits include a carrier, packaging or container that is compartmentalized to receive one or more containers, such as bottles, tubes and the like, each container comprising one of the separate elements to be used in a method described in this document. Suitable containers include, for example, bottles, vials, syringes and test tubes. In one embodiment, the containers are formed from a variety of materials, such as glass or plastic.

[0324] The manufactured articles provided in this document contain packaging materials. Examples of pharmaceutical packaging materials Petition 870250102047, dated 07 / 11 / 2025, pp. 162 / 460 155 / 272 include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles and any packaging material (including instructions for use and / or disposal) suitable for a selected formulation and intended mode of administration and treatment.

[0325] For example, the containers include a composition as described in this document and, optionally, in addition to regimens or therapeutic agents disclosed in this document. Such kits optionally include an identifying description or label or instructions relating to their use in the methods described in this document.

[0326] A kit typically includes labels listing contents and / or instructions for use and package inserts with instructions for use. A set of instructions will also typically be included.

[0327] In embodiments, a label is attached or associated with the container. In an embodiment, a label is on a container when letters, numbers, or other characters that form the label are affixed, molded, or engraved on the container itself; a label is associated with a container when it is present within a receptacle or carrier that also contains the container, for example, as a package insert. In an embodiment, a label is used to indicate that the contents should be used for a specific therapeutic application. The label also indicates instructions for use of the contents, such as in the methods described in this document. IX. DOSAGE

[0328] Those skilled in the art will appreciate that certain factors may influence the dosage and frequency of administration necessary to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, prior treatments, the general characteristics of the subject, including the subject's health, sex, weight and / or age, and other present illnesses. Furthermore, treating a subject with a therapeutically sized amount Petition 870250102047, dated 07 / 11 / 2025, pp. 163 / 460 The effective dosage of the compositions may include a single treatment or, preferably, a series of treatments. It will also be appreciated that the effective dosage of the disclosure composition used for treatment may increase or decrease over the course of a particular treatment. Changes in dosage may result and become apparent from the results of diagnostic trials as described in this document. The therapeutically effective dosage will generally be dependent on the patient's condition at the time of administration. The precise amount may be determined by routine experimentation, but may ultimately be at the clinician's judgment, for example, by monitoring the patient for signs of illness and adjusting treatment accordingly.

[0329] The frequency of administration may be determined and adjusted throughout the course of therapy and is generally, but not necessarily, based on the treatment and / or suppression and / or improvement and / or delay of a disease. Alternatively, sustained-release formulations of a polypeptide or polynucleotide may be appropriate. Several formulations and devices for achieving sustained release are known in the art. In one or more modalities, the dosage is daily, every other day, every three days, every four days, every five days, or every six days. In one or more modalities, the dosage frequency is once a week, every 2 weeks, every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, or every 10 weeks; or once a month, every 2 months, every 3 months, or more.In one embodiment, the pharmaceutical composition comprising the gene-editing system for effecting edits to the LPA gene, as described in this document, is dosed once to a subject in need, without the need for additional dosing. In another embodiment, the pharmaceutical composition comprising the gene-editing system for... Petition 870250102047, dated 07 / 11 / 2025, pp. 164 / 460 157 / 272 to effect edits to the LPA gene, as described in this document, is dosed twice with the second dose following sequentially after the first. In another embodiment, the pharmaceutical composition comprising the gene editing system to effect edits to the LPA gene, as described in this document, is dosed sequentially multiple times until a sufficient amount of therapeutically effective editing of the LPA gene, as described in this document, is achieved, with the second dose following sequentially after the first. The progress of this therapy is easily monitored by conventional techniques and assays and can be determined by monitoring Lp(a) concentrations in the blood, which may be directly correlated with apo(a) concentrations or inversely correlated with apo(a) protein size.It should also be understood that the subject may be dosed with LNPs containing different components of the gene-editing system (e.g., mRNA encoding the gene editor in one LNP and gRNAs in another, a mixture of mRNA and gRNAs in the same LNP, or different gRNAs in different LNPs with or without mRNA).

[0330] The dosage regimen (including a composition disclosed in this document) may vary over time. In one or more embodiments, it is contemplated that, for a normal-weight adult subject, doses ranging from about 0.01 to 1000 mg / kg may be administered. In one or more embodiments, the dose is between 1 and 200 mg / kg of the subject's body weight. In one or more embodiments, the dosage may be between 0.03 mg / kg and 3 mg / kg, 0.1 and 2 mg / kg, 0.5 and 1.5 mg / kg, or anywhere in between any of the preceding ranges. The particular dosage regimen, i.e., dose, timing, and repetition, will depend on the particular subject and that subject's medical history, as well as the properties of the polypeptide or polynucleotide (such as the half-life of the polypeptide or polynucleotide and Petition 870250102047, dated 07 / 11 / 2025, pp. 165 / 460 158 / 272 other well-known considerations in the art).

[0331] The appropriate therapeutic dosage of a composition as described in this document will depend on the specific agent (or compositions thereof) employed, the formulation and route of administration, the type and severity of the disease, whether the polypeptide or polynucleotide is administered for preventive or therapeutic purposes, prior therapy, the subject's medical history and response to therapy, and at the discretion of the attending physician. Typically, the clinician may administer a therapeutic agent until a dosage is reached that achieves the desired result.

[0332] The administration of one or more compositions may be continuous or intermittent, depending, for example, on the physiological condition of the recipient, whether the aim of administration is therapeutic or preventive, and other factors known to those skilled in the art. The administration of a composition may be essentially continuous over a pre-selected period of time or may be in a series of spaced doses, for example, before, during or after the development of a disease.

[0333] The methods and compositions of the disclosure described in this document, including modalities thereof, may be administered with one or more additional therapeutic regimens or agents or treatments, which may be co-administered to the mammal. Co-administering means administering one or more additional therapeutic regimens or agents or treatments and the disclosure composition close enough in time to enhance the effect of one or more additional therapeutic agents, or vice versa. In this respect, the disclosure composition described in this document may be administered simultaneously with one or more additional therapeutic regimens or agents or treatments, at a different time or in a completely different therapeutic schedule (for example, the first treatment may be daily, while the additional treatment is weekly). For example, in Petition 870250102047, dated 07 / 11 / 2025, pp. 166 / 460 159 / 272 modalities, regimens or agents or secondary therapeutic treatments are administered simultaneously, before or after the composition of the disclosure. X. MEANS

[0334] This document describes, among other things, means for editing the LPA gene, means for inactivating an LPA gene, and means for treating a disease associated with the LPA gene, such as atherosclerotic cardiovascular disease (ASCVD) and / or calcified aortic valve disease, in a subject in need. In some embodiments, the means for editing the LPA gene, inactivating the LPA gene, or treating a disease include a gene editing system as described in this document. In some embodiments, the means for editing the LPA gene, inactivating the LPA gene, or treating a disease include a delivery system comprising the gene editing system as described in this document. In some embodiments, the means for editing the LPA gene, inactivating the LPA gene, or treating a disease include a composition comprising the gene editing system as described in this document.In some embodiments, the means to edit the LPA gene, inactivate the LPA gene, or treat a disease include a pharmaceutical composition comprising the gene-editing system as described in this document. In some embodiments, the means to edit the LPA gene, inactivate the LPA gene, or treat a disease include a lipid nanoparticle comprising the gene-editing system as described in this document. A delivery system, composition, or pharmaceutical composition may comprise the lipid nanoparticle.

[0335] The present invention is illustrated by the following examples. It should be understood that the examples, materials, quantities and procedures in particular should be interpreted broadly in accordance with the scope and spirit of the invention, as set forth herein. Petition 870250102047, dated 07 / 11 / 2025, pp. 167 / 460 160 / 272 XI. EXAMPLES EXAMPLE 1 Bioinformatics Analysis

[0336] The bioinformatics analysis included information on the MIT specificity score calculated in the CRISPOR implementation (http: / / crispor.tefor.net / ). This computational analysis is intended to predict gRNA specificity; the higher the score, the greater the predicted specificity. MIT scores for some spacer / protospacer sequences are provided in Tables 2 and 5. EXAMPLE 2 Evaluation of the efficiency of nickase-based editing using SpCas9-D10A and guide / template RNAs via transfection.

[0337] With this example, several guide RNAs targeting the LPA gene were designed, paired based on proximity to each other, synthetically manufactured / prepared, and transfected into primary human hepatocyte cells to determine if they were capable of editing and their respective editing efficiency. LPA gene guides

[0338] Examples of protospacer sequences to which gRNAs may have corresponding spacer sequences are shown in Table 2.

[0339] Table 7A (provided above in the Detailed Description) summarizes the dose-response curves in immortalized human hepatocellular carcinoma (HuH-7) cells for five (5) pairs of first and second guide RNAs using a gene-editing system comprising a Cas9 double nickase system. The sequences of the guide oligonucleotides are provided in Table 4. The Cas9 nickase is encoded within an mRNA (MS029) that was transfected into HuH-7 cells at a weight ratio of Petition 870250102047, dated 07 / 11 / 2025, pp. 168 / 460 161 / 272 total mRNA:total gRNA 1:1.

[0340] Additional guide oligonucleotide pairs were tested with a similar experimental design. The results are presented in Table 7B (provided above in the Detailed Description). RNA preparation

[0341] Among the potential guide RNAs with spacer sequences corresponding to the protospacer sequences in Table 2, 58 guide RNAs identified in Table 5 (provided above in the Detailed Description) were fabricated and used for further cellular analysis. The spacer sequences of some of the gRNAs and the hybridization location with the LPA gene for some of the guide oligonucleotides are shown in Figure 9. Cell transfection

[0342] For primary human hepatocytes: 96-well plates coated with collagen-I were seeded with primary human hepatocytes (BiolVT, lot: OQA) at a density of 5 χ 104 cells / well. The cells were plated in 100 pL of hepatocyte culture medium and placed in an incubator for 4 hours, until they had bound and formed a monolayer.

[0343] For HuH-7 cells: 96-well plates were seeded with HuH-7 cells (Sekisui Xeno Tech) at a density of 2 χ 104 cells / well. The cells were plated in 100 pL of DMEM + 10% FBS + 1% penicillin / streptomycin and placed in an incubator for 24 hours, until they had bound and formed a monolayer. Table 8. SpCas9-D10A and experimental conditions of guide RNA mRNA / gRNA used. Amount of RNA (dose of 2500 ng / ml). Guide RNA 1 (gRNA) 62.5 ng Petition 870250102047, dated 07 / 11 / 2025, pp. 169 / 460 162 / 272 Guide RNA 2 (gRNA) 62.5 ng SpCas9-D10A mRNA 125 ng

[0344] For one experimental setup, transfection reactions were prepared by combining RNA to a total dose of 2500 ng / ml, as listed in Table 8, and then adding Lipofectamine MessengerMax diluted with OPTI-MEM and incubating for 15 minutes at room temperature. For a second experimental setup, the transfection reagents were diluted 1:8, to a final dose of 312.5 ng / ml.

[0345] The hepatocyte culture medium was replaced with 90 pL of fresh hepatocyte culture medium and 10 pL of each prepared transfection reaction were added to cell wells in the 96-well plate for a total volume of 100 pL. The cells were incubated for a further 48 hours, after which they were lysed and the DNA extracted using Rapid Extraction Reagent (Lucigen) according to the manufacturer’s instructions; 10 ng of DNA were used for targeted amplicon sequencing. Next-generation sequencing and analytics

[0346] Genomic DNA was extracted from collected cells and subjected to next-generation sequencing with the Illumina MiSeq platform, generating paired-end reads of 151 bp.

[0347] To evaluate the efficiency of SpCas9-D10A and guide RNAs in causing indel variants, computational analysis was used to determine what fraction of the mapping of reads to the specific genomic region of targeted LPA contained the desired edits. The % of reads containing the desired edits was then used as a double-cut guide edit efficiency metric for each combination of SpCas9-D10A and guide RNAs. Edit quantifications were plotted as edit percentages.

[0348] Figure 2 shows the edits for tested combinations of Petition 870250102047, dated 07 / 11 / 2025, pp. 170 / 460 163 / 272 Guide RNAs were obtained with a higher dose (2500 ng / ml RNA; closed circles) and a lower dose (312.5 ng / ml RNA; open circles). More than half (31) of the guide pairs tested exceeded 50% editing at the higher dose (2500 ng / ml); fifteen of the guide pairs tested exceeded 80% editing at the higher dose; and two of the guide pairs tested exceeded 90% editing at the higher dose.

[0349] Some selected guide RNA pairs were further tested. Figure 3 shows the edits for tested guide RNA combinations obtained with a higher dose (10,000 ng / ml RNA) and 1:2 dose dilutions down to the lowest dose (78,125 ng / ml RNA). Guide RNA 1:guide RNA 2: the mRNA weight ratios used were 1:1:2. Each tested combination produced some level of editing. The highest level of editing observed with the highest RNA dose was 62% with the guide RNA pair GA1183 / GA1184. Each of the 5 guide RNA pairs demonstrated good potency, which was titratable relative to the dose used. Thus, all guide RNAs introduced indel variants and the edits were dose-dependent, validating the editing strategy. EXAMPLE 3 Evaluation of the efficiency of nickase-based editing using SpCas9-D10A and guide / template RNAs via LNPs

[0350] With this example, several guide RNAs targeting the LPA gene were designed, paired based on proximity to each other, synthetically manufactured / prepared, and administered to cells via lipid nanoparticles (LNPs) to determine if they were capable of editing and their respective editing efficiencies.

[0351] Figure 4A schematically illustrates the locations where guide nucleic acid spacer sequences bind to protospacer sequences in exon 20 of the LPA gene. The guide pairs tested in this example include GA1295 / GA1296 (corresponding to LNP1); Petition 870250102047, dated 07 / 11 / 2025, pp. 171 / 460 164 / 272 GA1297 / GA1296 (corresponding to LNP2); and GA1298 / GA1296 (corresponding to LNP3). The sequences of the guide oligonucleotides are provided in Table 4.

[0352] LNPs comprising a guide pair GA1295 / GA1296 (corresponding to LNP 1), GA1297 / GA1296 (corresponding to LNP 2) or GA1298 / GA1296 (corresponding to LNP 3) and comprising mRNA encoding SpCas9-D10A (MS029) were prepared with equal weights of each gRNA per guide pair and with a 1:1 weight ratio of total gRNA (guide 1 + guide 2) to mRNA.

[0353] The constituents of each of the LNPs were an ionizable amino lipid (iLipid), a neutral auxiliary lipid, a PEG-Lipid, and a sterol lipid, with the optional inclusion of a ligand-targeted lipid, such as GalNAc. Table 9 below describes the LNP formulations, excluding pharmacological substances (i.e., gRNA and mRNA). Petition 870250102047, dated 07 / 11 / 2025, pp. 172 / 460 165 / 272 Table 9. LNP Components LNP Component Lipid Names Lipid Structure Mol % Range Mol % Examples Amino lipid (iLipid) (9Z, 12Z)-octadeca-9,12-dienoate of 3-((4,4-bis(octyloxy)butanoyl)oxy)-2((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl* 0 0^ 0 40-60 45 47 50 52.4 Neutral auxiliary lipid 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) 2 0 ii 11 \ / \ / \ / ^ H θ' 0 4-20 9 9 9, 10 9, 10 PEG-lipid 1,2-dimyristoyl-rac-glycero-3methoxypolyethylene glycol-2000 (PEG2000- DMG) 0 1.5- 5 2 3 1.5, 3 2.5, 3 Petition 870250102047, dated 07 / 11 / 2025, pp. 173 / 460 166 / 272 Sterol lipid Cholesterol x^LA'-h ।( rh । \ \ Γ JLàTã HO H 30- 45 Said o de % em mol para faze r 100 % Said o de % em mol para faze r 100 % Said o de % em mol para faze r 100 % Said o de % em mol para faze r 100 % *described in International Patent Application Published WO 2021 / 178725 A1 Petition 870250102047, dated 07 / 11 / 2025, pp. 174 / 460 167 / 272

[0354] It should be understood that the lipids in Table 9 may be replaced by other suitable lipids in the listed class. In some embodiments, for example, LNP comprises the amino lipid VL422 described in Published International Patent Application WO 2022 / 060871 A1. For example, the amino lipid may be VL422 or a salt or solvate. It should be further understood that the example mol% of lipids in Table 9 may thus be adjusted and that the mol% included in Table 9 are targeted excipient percentages of the LNP, intended to represent the aggregate mol% of all LNPs formulated in a given batch, and that specific LNPs within a batch may have variable mol%. Thus, it is contemplated in this document that the mol% of one or more or all of the LNP components set out in Table 9 may be adjusted, for example, by + / - 1 to 5%, + / - 5 to 10% or + / - 10% to 20%. It is further contemplated in this document that the mol% of one or more or all of the LNP components established in Table 9 in relation to a specific LNP, formulated in a given batch of LNPs formulated according to the desired target excipient percentages, may vary from the target mol%, for example, by + / - 1 to 5%, + / - 5 to 10%, + / - 10 to 20%, or even greater than + / - 20%.Furthermore, it should be understood that additional LNP components, including non-lipid components, may be added to the LNP components established in Table 9. Thus, for example, lipids. Petition 870250102047, dated 07 / 11 / 2025, pp. 175 / 460 168 / 272 targeting the GaINAc ligand, such as those disclosed in Published International Patent Application WO 2021 / 178725 A1, can be added and the mol% cholesterol component reduced to account for the additional GaINAc-conjugated lipid. Thus, for example, if 0.05% GaINAc lipid is added to the formulation, the mol% cholesterol in the formulation would be reduced by 0.05%. Examples of GaINAc lipids used in LNP formulations include: AcHN where each of the following is independently an integer from 1 to 5, and en is an integer from 33 to 39; and

[0355] The average particle size of LNP can vary from 40-90 nm, 50-80 nm or 55-75 nm, + / -15 nm.

[0356] Human primary hepatocyte (PHH) cells were incubated with LNPs (LNP 1, LNP 2, LNP 3) at various concentrations ranging from 0 to 40,000 ng / mL of total RNA (guides and mRNA). The cells were harvested and the editing efficiency was evaluated as described in Example 2.

[0357] The results are shown in Figure 4B, which illustrates that an editing efficiency greater than 95% was observed for all three pairs. Petition 870250102047, dated 07 / 11 / 2025, pp. 176 / 460 169 / 272 at a dose of 10,000 ng (total RNA) / ml. The EC50 and EC90 values ​​were similar for all three guideline pairs.

[0358] This example illustrates that high levels of editing efficiency can be achieved through LNP distribution of the gene editing system. EXAMPLE 4 Reduction in LP(a) protein secreted in HuH-7 cells by gene editing system.

[0359] Lentiviruses containing an expression cassette comprising an LPA open reading frame (ORF) followed by an internal ribosome entry site (IRES) and puromycin N-acetyltransferase (puro), driven by a cytomegalovirus (CMV) promoter, were created. HuH-7 cells were transfected with the lentiviruses and selected for puromycin expression cassette integration.

[0360] LNPs (LNP1) as described in Example 3 were administered to puromycin-resistant cells in which the expression cassette was integrated into the genome (the guide pair was GA1295 / 1296) at various concentrations ranging from 0 to 5,000 ng / ml (total RNA) and the levels of apo(a) secreted from the cells were evaluated. The concentration of Apo(a) protein was evaluated using a validated Lp(a) ELISA kit from Mercodia.

[0361] As shown in Figure 5, secreted apo(a) was reduced in a dose-dependent manner, illustrating that gene editing, as described in this document, can be used to reduce apo(a) levels. EXAMPLE 5 Evaluation of the off-target edition

[0362] Off-target analysis was performed and indicated a very favorable off-target profile (data not shown). Petition 870250102047, dated 07 / 11 / 2025, page 177 / 460 170 / 272 EXAMPLE 6 Gene editing in transgenic mice expressing the human LPA gene.

[0363] Transgenic mice expressing the human LPA gene (J:144538 Frazer KA, et al., The apolipoprotein(a) gene is regulated by sex hormones and acute-phase inducers in YAC transgenic mice. Nat Genet. April 1995;9(4):424-31) were obtained from The Jackson Laboratory. The transgenic mouse groups (two females and two males per group) were divided as follows: control vehicle (LNP), total dose RNA of 0.05 mg / kg, total dose RNA of 0.1 mg / kg, total dose RNA of 0.5 mg / kg, total dose RNA of 2 mg / kg, total dose RNA of 4 mg / kg and total dose RNA of 10 mg / kg.

[0364] The LNPs were prepared as described in Example 3 and included the GA1295 / GA1296 guide RNA pair and mRNA encoding SpCas9D10A (MS029) in a 1:1:2 ratio (or 1:1 based on the total guide RNA to mRNA). The sequences of the guide oligonucleotides are provided in Table 4.

[0365] LNP formulations were administered via retro-orbital injection.

[0366] Serum apo(a) protein concentrations were determined seven days before injection of mice with LNPs, seven days after injection, and fourteen days after injection. Serum apo(a) protein concentrations were assessed using a validated Lp(a) ELISA kit from Mercodia.

[0367] On day 14, livers were harvested from the mice and DNA extraction was performed as described above in Example 2.

[0368] The mean serum apo(a) protein concentration in female mice was approximately 50 ng / dL seven days before LNP injection. The mean concentration in male mice was approximately 1.25 Petition 870250102047, dated 07 / 11 / 2025, pp. 178 / 460 171 / 272 ng / dL seven days prior to LNP injection. Consequently, male serum apo(a) concentrations were approximately 40 times lower than female serum concentrations.

[0369] As shown in Figure 6A, the LPA gene editing efficiency was dose-dependent. The EC50 was determined to be 0.18 mg / kg and the EC90 was determined to be 0.67 mg / kg. Editing efficiency greater than 70% was achieved at a total RNA dose of 2.0 mg / kg. The experiment was repeated with slightly different doses and with LNPs with different average particle sizes (67 nm versus 77 nm for Figure 6A). The results are presented in Figure 6B, which illustrates results similar to those shown in Figure 6A.

[0370] As shown in Figures 7 and 8A, the distribution of the gene editing system lowered serum apo(a) levels in mice in a dose-dependent manner. Serum apo(a) was reduced by approximately 90% at the total RNA dose of 2.0 mg / kg.

[0371] These results indicate that in vivo delivery of a gene editing system, as described in this document, can introduce indels into the LPA gene, resulting in reduced serum levels of the apo(a) protein.

[0372] Gene editing systems comprising additional guide pairs were evaluated for their ability to reduce serum apo(a) concentrations in female transgenic mice when administered via LNPs at a concentration of 0.5 mg total RNA / kg. Experiments were generally performed as indicated above. Plasma apo(a) concentrations were determined at baseline (7 days) and 14 days after retro-orbital injection of the gene editing systems. The results are presented in Figure 8B.

[0373] The guide pair number shown in Figure 8B Petition 870250102047, dated 07 / 11 / 2025, pp. 179 / 460 172 / 272 corresponds to the guide pairs listed in Table 10. The gRNA sequences are listed in Table 4. Table 10. Guide pair designators for guide pair numbers shown in Figure 8B. Guide Pair No. Guide 1 Guide 2 1 GA1295 GA1296 2 GA1297 GA1296 4 GA1301 GA1302 6 GA1303 GA1304 7 GA1442 GA1448 8 GA1443 GA1449 9 GA1440 GA1446 10 GA1438 GA1444

[0374] The GA1303 / GA1304 guide pair is interesting because the guide pair targets Exon 2 of the LPA gene and exhibits high editing efficiency.

[0375] The subject matter described in this document and in the accompanying figures is done with sufficient detail and clarity to permit the inclusion of claims, at any time, in the means-plus-function format within 35 USC section 112, part (f). However, a claim shall be interpreted as invoking this means-plus-function format only if the phrase "means for" is explicitly quoted in that claim. XII. OTHER MODALITIES

[0376] From the preceding description, it will be evident that variations and modifications can be made to the disclosure described in this document to adapt it to various uses and conditions. Such modalities are also within the scope of the following claims. Petition 870250102047, dated 07 / 11 / 2025, pp. 180 / 460 173 / 272

[0377] The citation of a listing of elements in any definition of a variable in this document includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The citation of a modality in this document includes that modality as any single modality, any portion of the modality, or in combination with any other modalities or any portion thereof.

[0378] As set forth in this document, disclosure will be appreciated as comprising specific embodiments and examples of base editing systems for effecting a nucleobase alteration in a gene and methods of using them for the treatment of diseases, including compositions comprising such base editing systems, designs and modifications thereof; and specific examples and embodiments describing the synthesis, manufacture, use and efficacy of the foregoing individually and in combination, including pharmaceutical compositions for the treatment of diseases and for in vivo and in vitro delivery of active agents to mammalian cells under described conditions.

[0379] Although specific examples and numerous embodiments have been provided to illustrate aspects and combinations of aspects of the foregoing, it should be appreciated and understood that any aspect, or combination thereof, of an exemplary or disclosed embodiment may be excluded from it to constitute another embodiment without limitation and that it is contemplated that any such embodiment may constitute a separate and independent claim. Similarly, it should be appreciated and understood that any aspect or combination of aspects of one or more embodiments may also be included or combined with any aspect or combination of aspects of one or more embodiments and that it is contemplated in this document that all such combinations fall within the scope of this Petition 870250102047, dated 07 / 11 / 2025, pp. 181 / 460 174 / 272 disclosure and may be presented as separate and independent claims without limitation. Consequently, it should be appreciated that any appeal presented in one claim may be included in another claim; any appeal presented in one claim may be removed from the claim to constitute a claim without that appeal; and any appeal presented in one claim may be combined with any appeal in another claim, each of which is contemplated in this document. The following enumerated clauses are additional illustrative examples of aspects and combinations of aspects of the preceding modalities and examples:

[0380] Here is an example of enumerated clauses: 1. A pharmaceutical composition for in vivo editing of an LPA gene in a mammalian subject, comprising: (i) a system for editing manipulated, unnaturally occurring genes comprising: (a) one or more polynucleotides (mRNAs) encoding one or more CRISPR Cas nickases; (b) a first guide oligonucleotide (gRNA) comprising a first spacer sequence that is complementary to a first strand of the LPA gene at a first target sequence and a first scaffold region that serves as a binding scaffold for at least one of one or more Cas nickases; and (c) a second guide oligonucleotide (gRNA) comprising a second spacer sequence that is complementary to a second strand of the LPA gene at a second target sequence and a second scaffold region that serves as a binding scaffold for at least one of one or more Cas nickases, and (ii) a delivery system that is engineered to deliver one or Petition 870250102047, dated 07 / 11 / 2025, pp. 182 / 460 175 / 272 more mRNAs, the first gRNA and / or the second gRNA, individually or collectively, to the liver, wherein the first gRNA and at least one or more Cas nickases are manipulated to cause at least one or more Cas nickases to cut one or more of the first or second strands of the LPA gene at a first location on chromosome 6 from position 160,664,275 to 160,531,482 and wherein the second gRNA and at least one or more Cas nickases are manipulated to cause at least one or more Cas nickases to cut the other or one of the first or second strands of the LPA gene at a second location on chromosome 6 from position 160,664,275 to 160,531,482. 2. The pharmaceutical composition, according to clause 1, wherein the delivery system comprises lipid nanoparticles (LNPs), wherein the LNPs comprise: (a) one or more ionizable lipids, (b) cholesterol, (c) one or more PEG-lipids, (d) a phospholipid; and (e) optionally including a targeting fraction, such as a GalNAc lipid. 3. The pharmaceutical composition, according to clause 2, in which the LNPs are formulated to comprise: (a) 40 to 60 molar percent of one or more ionizable lipids, 28 to 48 molar percent of cholesterol, 5 to 13 molar percent of phospholipid and 2 to 5 molar percent of PEG-lipid, (b) 50 + / - 10 molar percent of one or more ionizable lipids, 38 + / - 10 molar percent of cholesterol, 9 + / - 10 molar percent of phospholipid and Petition 870250102047, dated 07 / 11 / 2025, pp. 183 / 460 176 / 272 + / - 10% molar percent of PEG-lipid, (c) 40 to 60 molar percent of one or more ionizable lipids, 27.95 to 47.95 molar percent of cholesterol, 5 to 13 molar percent of phospholipid, 2 to 5 molar percent of PEG-lipid and 0.02 to 0.09 molar percent of GalNAc-lipid; or (d) 50 + / - 10% molar percent of one or more ionizable lipids, 37.95 + / - 10% molar percent of cholesterol, 9 + / - 10% molar percent of phospholipid, 3 + / - 10% molar percent of PEG-lipid and 0.05 + / - 10% molar percent of GalNAc-lipid. 4. The pharmaceutical composition, according to any one of clauses 1 to 3, in which the gene editing system is manipulated to inactivate the LPA gene. 5. The pharmaceutical composition, according to clause 4, in which the inactivation of the LPA gene results in a lack of production of apo(a) protein or the production of non-functional apo(a) protein, resulting in a reduced concentration of Lp(a) in the blood. 6. A pharmaceutical composition, according to any one of clauses 1 to 5, in which at least one of one or more Cas nickases, when in operative interaction with the first or second guide oligonucleotide, is manipulated to cut the opposite strand of the LPA gene to which the operative guide oligonucleotide (gRNA) is hybridized. 7. The pharmaceutical composition, according to clause 6, in which at least one of one or more polynucleotides (mRNAs) encoding one or more Cas nickases encodes a Cas9 nickase from Streptococcus pyogenes carrying an H840A mutation. 8. The pharmaceutical composition, according to any one of clauses 1 to 5, in which at least one of one or more Cas nickases, when in operative interaction with the first or second oligonucleotide, is present. Petition 870250102047, dated 07 / 11 / 2025, pp. 184 / 460 The 177 / 272 guide (gRNA) is manipulated to cut the same strand of the LPA gene to which the guide is hybridized. 9. The pharmaceutical composition, according to clause 8, in which at least one of one or more polynucleotides (mRNAs) encoding one or more Cas nickases encodes a Cas9 nickase from Streptococcus pyogenes with a D10A mutation. 10. The pharmaceutical composition, according to any of clauses 1 to 9, in which the sequences of the first and second framework regions are the same. 11. The pharmaceutical composition, according to any one of clauses 1 to 10, wherein the first spacer sequence of the first guide oligonucleotide (gRNA) comprises about 15 to about 26 nucleotides and has a sequence that is identical or substantially identical to a first directed protospacer sequence adjacent to a protospacer-adjacent motif (PAM) sequence on the first strand of the LPA gene. 12. The pharmaceutical composition, according to any one of clauses 1 to 11, wherein the second spacer sequence of the second guide oligonucleotide (gRNA) comprises about 15 to about 26 nucleotides and has a sequence that is identical or substantially identical to a second directed protospacer sequence adjacent to a protospacer-adjacent motif (PAM) sequence on the second strand of the LPA gene. 13. A pharmaceutical composition, according to any of clauses 1 to 12, in which the gene editing system is manipulated to edit the LPA gene to effect an indel or non-synonymous variant. 14. The pharmaceutical composition, according to any of clauses 1 to 13, in which the first spacer sequence of Petition 870250102047, dated 07 / 11 / 2025, pp. 185 / 460 178 / 272 guide oligonucleotide (gRNA) has a sequence that is identical or substantially identical to a first protospacer sequence adjacent to a first protospacer-adjacent motif (PAM) sequence on the first strand of the LPA gene, and the second guide oligonucleotide (gRNA) spacer sequence has a sequence that is identical or substantially identical to a second protospacer sequence adjacent to a second protospacer-adjacent motif (PAM) sequence on the second strand of the LPA gene, and wherein one or more Cas nickases, operating with the first and second guide oligonucleotides, are manipulated to cut opposite strands of the LPA gene between the first and second protospacer-adjacent motifs (PAMs) in a PAM-out configuration. 15. A pharmaceutical com...

Claims

1. Pharmaceutical composition for in vivo editing of an LPA gene in a mammalian subject, characterized in that it comprises: (i) a non-naturally occurring manipulated gene editing system comprising: (a) one or more polynucleotides (mRNAs) encoding a nickase; (b) a first guide oligonucleotide (gRNA) comprising a first spacer sequence that includes a region that is complementary to a first strand of the LPA gene at a first target sequence and a first scaffold region that serves as a binding scaffold for the nickase;(c) a second guide oligonucleotide (gRNA) comprising a second spacer sequence that includes a region that is complementary to a second strand of the LPA gene at a second target sequence and a second scaffold region that serves as a binding scaffold for the nickase and (ii) lipid nanoparticles (LNPs) encapsulating the gene editing system, wherein the first and second strands are opposite strands and wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% similar or identical or is identical to the guide protospacer 1 listed in Table 2 or Table 5 and wherein the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% similar either identical or is identical to the guide protospacer 2 listed in Table 2 or Table 5.

2. Pharmaceutical composition, according to claim 1, characterized in that the first gRNA and nickase are manipulated to cause the nickase to cut one of the first or second strands of the LPA gene at a first location on chromosome 6 from position 160,664,275 to 160,531,482 and in that the second gRNA and nickase are manipulated to cause the nickase to cut the other of the first or second strands of the LPA gene at a second location on chromosome 6 from position 160,664,275 to 160,531,482.

3. Pharmaceutical composition, according to claim 1 or 2, characterized in that the first spacer comprises a sequence identical or substantially identical to a guide protospacer 1 listed in Table 2 or Table 5 and the second spacer comprises a sequence identical or substantially identical to a corresponding guide protospacer 2 (in the same row) listed in Table 2 or Table 5.

4. Pharmaceutical composition, according to claim 1, characterized in that the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CUGUCACCAGGCAUUGUGUC-3' and the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-UGUCCUUGCAACUCUCACGG-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'GUAGUAGCAGUCCUGUACCC-3' and the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-CAUUAUGGACAGAGUUACCG-3',where the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least Petition 870250084728, dated 09 / 19 / 2025, p. 21 / 41 3 / 21 approximately 90%, at least approximately 95% identical or is identical to 5'AGGACACUCGAUUCUGUCA-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or is identical to 5'-CACAACUCCCACAGUGGCCC-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or is identical to 5'CUGUCACUGGACAUUGUGUC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-AAGUGUCCUUGCGACGUCCA-3',wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'GGAGCAAAGCCCCACAGUCC-3' and the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GUUGGUGCUGAAAUUCAAAG-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'GGAGCAAAGCCCCGGGGUCC-3' and the second spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% identical or is identical to 5'-GUUGGUGCUGAAAUUCAAAG-3', where the first spacer has a sequence that is at least about 75%,at least approximately 80%, at least approximately 85%, at least Petition 870250084728, dated 09 / 19 / 2025, p. 22 / 41 4 / 21 approximately 90%, at least approximately 95% identical or identical to 5'CUGGAACUGGGACCACCGU-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-ACAGAGCUUCCUUCUGAAGA-3', where the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'AUGCCAGUGUGGUGUCAUAG-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least about 95% identical or is identical to 5'-ACCACAGAAUACUACCCAAA -3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%,at least approximately 85%, at least approximately 90%, at least approximately 95% identical or is identical to 5'GGAGCCAGAAUAACAUUCGG -3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or is identical to 5'-CUAGAGGCUUUUUUUGAACA -3', where the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or is identical to 5'CAGAUGCUGAGAUUAGUCCU-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least about 95% identical or is identical to 5'-UGGAUUCCUGCAGUAGUUCC-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least Petition 870250084728, dated 19 / 09 / 2025,page. 23 / 41 5 / 21 approximately 90%, at least approximately 95% identical or identical to 5'UGACACCACAUUGGCAUCGG-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-ACAUGUUCUUCCUGUGAUAG-3', where the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'CAUAGAUGACCAAGAUUGAC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least about 95% identical or identical to 5'-UGAUACCACACUGGCAUCAG-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%,at least approximately 95% identical or identical to 5'CCAUCACUGGACAUUGCGUC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-AACUCUCCUCACAACUCCCA-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'CUGCAUCUGAGCAUCGUGUC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-CGUCCUCCGAAUGUUAUUC-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least Petition 870250084728, dated 19 / 09 / 2025, p. 24 / 41 6 / 21 about 90%,at least approximately 95% identical or identical to 5'AAACAGCCGUGGACGUCGCA-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-UGAACAAGGUAAGAAGUCUC-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'ACAGAGGCUCCUUCUGAACA-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-GCUUGGAACCGGGGCCACUG-3', where the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%,at least approximately 95% identical or identical to 5'AUGCCAGUGUGGUGUCAUAG-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-ACAACAGAAUAUUAUCCAAA-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'CUAUGACACCACAUUGGCAU-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-ACAUGUUCUUCCUGUGAUAG-3', wherein the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least Petition 870250084728, dated 19 / 09 / 2025, p. 25 / 41 7 / 21 about 90%,at least approximately 95% identical or identical to 5'AAUAACAUUCGGAGGGACGA-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-UAUUCUGGCUCCAAGCCUAG-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'GUAGCAGUCCUGUACCCCGG-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-CAUUAUGGACAGAGUUACCG-3', where the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least about 90%,at least approximately 95% identical or identical to 5'AGUAGCAGUCCUGUACCCCG-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-CAUUAUGGACAGAGUUACCG-3', wherein the first spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'UAGUAGCAGUCCUGUACCCC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-CAUUAUGGACAGAGUUACCG-3' or where the first spacer has a sequence that is at least about 75%, at least about 80%, at least about 85%, at least Petition 870250084728, dated 09 / 19 / 2025, p. 26 / 41 8 / 21 about 90%,at least approximately 95% identical or identical to 5'UGGACCACAUGGCUUUGCUC-3' and the second spacer has a sequence that is at least approximately 75%, at least approximately 80%, at least approximately 85%, at least approximately 90%, at least approximately 95% identical or identical to 5'-ACGUACUCCACCACUGUCAC-3'., 5. Pharmaceutical composition, according to claim 1, wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CUGUCACCAGGCAUUGUGUC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGUCCUUGCAACUCUCACGG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-GUAGUAGCAGUCCUGUACCC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAUUAUGGACAGAGUUACCG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-AGGACACUCGAUUCUGUCA-3' and the second spacer has a sequence comprising nucleotides 6 to 20,5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CACAACUCCCACAGUGGCCC-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CUGUCACUGGACAUUGUGUC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-AAGUGUCCUUGCGACGUCCA-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following Petition 870250084728, dated 09 / 19 / 2025, page 27 / 41 9 / 21 sequence 5'-GGAGCAAAGCCCCACAGUCC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-GUUGGUGCUGAAAUUCAAAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20,The first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-GGAGCAAAGCCCCGGGGUCC-3', and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-GUUGGUGCUGAAAUUCAAAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CUGGAACUGGGACCACCGU-3', and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CUGGAACUGGGACCACCGU-3'. 20 of the following sequence 5'-ACAGAGCUUCCUUCUGAAGA-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-AUGCCAGUGUGGUGUCAUAG-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-ACCACAGAAUACUACCCAAA-3',wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-GGAGCCAGAAUAACAUUCGG -3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CUAGAGGCUUUUUUUGAACA -3'; wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAGAUGCUGAGAUUAGUCCU-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGGAUUCCUGCAGUAGUUCC-3', Petition 870250084728, dated 09 / 19 / 2025, p. 28 / 41 10 / 21 where the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGACACCACAUUGGCAUCGG-3' and the second spacer has a sequence comprising nucleotides 6 to 20,5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-ACAUGUUCUUCCUGUGAUAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAUAGAUGACCAAGAUUGAC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGAUACCACACUGGCAUCAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, The first spacer has a sequence comprising nucleotides 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CCAUCACUGGACAUUGCGUC-3', and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-AACUCUCCUCACAACUCCCA-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20,The first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CUGCAUCUGAGCAUCGUGUC-3', and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CGUCCCUCCGAAUGUUAUUC-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-AAACAGCCGUGGACGUCGCA-3', and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-AAACAGCCGUGGACGUCGCA-3'. a 20 of the following sequence 5'-UGAACAAGGUAAGAAGUCUC-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-ACAGAGGCUCCUUCUGAACA-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-GCUUGGAACCGGGGCCACUG-3',wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-AUGCCAGUGUGGUGUCAUAG-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-ACAACAGAAUAUUAUCCAAA-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20, or 1 to 20 of the following sequence 5'-CUAUGACACCACAUUGGCAU-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-ACAUGUUCUUCCUGUGAUAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-AAUAACAUUCGGAGGGACGA-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20,2 to 20 or 1 to 20 of the following sequence 5'-UAUUCUGGCUCCAAGCCUAG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-GUAGCAGUCCUGUACCCCGG-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAUUAUGGACAGAGUUACCG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-AGUAGCAGUCCUGUACCCCG-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAUUAUGGACAGAGUUACCG-3', wherein the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, or 1 to 20 of the following sequence 5'-CAUUAUGGACAGAGUUACCG-3', wherein the first spacer has a sequence comprising Petition 870250084728, dated 09 / 19 / 2025, page 30 / 41 12 / 212 to 20 or 1 to 20 of the following sequence 5'-UAGUAGCAGUCCUGUACCCC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-CAUUAUGGACAGAGUUACCG-3' or where the first spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGGACCACAUGGCUUUGCUC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 to 20 of the following sequence 5'-UGGACCACAUGGCUUUGCUC-3' and the second spacer has a sequence comprising nucleotides 6 to 20, 5 to 20, 4 to 20, 3 to 20, 2 to 20 or 1 a 20 of the following sequence 5'-ACGUACUCCACCACUGUCAC-3'., 6. Pharmaceutical composition, according to any one of claims 1 to 5, characterized in that the first spacer and / or the second spacer comprise a modified nucleotide.

7. Pharmaceutical composition, according to claim 6, characterized in that one or more nucleotides within five nucleotides of the 5' end of the first spacer and / or the second spacer are modified nucleotides.

8. Pharmaceutical composition, according to claim 6 or 7, characterized in that each of the nucleotides within three nucleotides at the 5' end of the first spacer and / or the second spacer are modified nucleotides.

9. Pharmaceutical composition, according to any one of claims 6 to 8, characterized in that the modified nucleotide comprises a modification with 2'-OMe and / or a phosphorothioate group.

10. Pharmaceutical composition, according to any one of claims 1 to 9, characterized in that one or more nickases comprise a CRSPR Cas nickase. Petition 870250084728, dated 09 / 19 / 2025, pp. 31 / 41 13 / 21 11. Pharmaceutical composition, according to any one of claims 1 to 10, characterized in that at least one of one or more Cas nickases, when in operative interaction with the first or second guide oligonucleotide, is manipulated to cut the opposite strand of the LPA gene to which the operative guide oligonucleotide (gRNA) is hybridized.

12. Pharmaceutical composition, according to claim 11, characterized in that at least one of one or more polynucleotides (mRNAs) encoding one or more Cas nickases encodes a Cas9 nickase from Streptococcus pyogenes carrying an H840A mutation.

13. Pharmaceutical composition, according to any one of claims 1 to 10, characterized in that at least one of one or more Cas nickases, when in operative interaction with the first or second guide oligonucleotide (gRNA), is engineered to cut the same strand of the LPA gene to which the operative guide is hybridized.

14. Pharmaceutical composition, according to claim 13, characterized in that at least one of one or more polynucleotides (mRNAs) encoding one or more Cas nickases encodes a Cas9 nickase from Streptococcus pyogenes with a D10A mutation.

15. Pharmaceutical composition, according to any one of claims 1 to 14, characterized in that at least one of one or more polynucleotides (mRNAs) comprises: (a) a 5' untranslated region (UTR); (b) a 3' UTR region; (c) a poly(A) tail adjacent to the 3' UTR compared to the 5' UTR, said poly(A) tail comprising a chain of 80-150 nucleotides in length comprising adenine nucleotides; and (d) a gene editor coding region encoding a CRISPR-committed endonuclease domain and a polymerase domain, said gene editor coding region extending between the 5' UTR and the 3' UTR.

16. Pharmaceutical composition, according to any one of claims 1 to 15, characterized in that at least one of one or more polynucleotides is selected from any of the mRNA sequences listed in Table 1 or an mRNA with at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity or at least about 99% identity with any of the mRNA sequences listed in Table 1.

17. Pharmaceutical composition, according to any one of claims 1 to 15, characterized in that at least one of one or more polynucleotides comprises a coding sequence of any of the mRNA sequences listed in Table 1 or comprises a coding sequence with at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity or at least about 99% identity with any of the coding sequences of the nickase mRNA sequences listed in Table 1.

18. Pharmaceutical composition, according to any one of claims 1 to 17, characterized in that the LNPs comprise: Petition 870250084728, dated 09 / 19 / 2025, p. 33 / 41 15 / 21 (a) one or more ionizable lipids, (b) cholesterol, (c) one or more PEG-lipids, (d) a phospholipid; and (e) optionally including a targeting fraction, such as a GalNAc lipid.

19. Pharmaceutical composition according to claim 18, characterized in that the LNPs are formulated to comprise: (a) 40 to 60 molar percent of one or more ionizable lipids, 28 to 48 molar percent of cholesterol, 5 to 13 molar percent of phospholipid and 2 to 5 molar percent of PEG-lipid, (b) 50 + / - 10 molar percent of one or more ionizable lipids, 38 + / - 10 molar percent of cholesterol, 9 + / - 10 molar percent of phospholipid and 3 + / - 10 molar percent of PEG-lipid, (c) 40 to 60 molar percent of one or more ionizable lipids, 27.95 to 47.95 molar percent of cholesterol, 5 to 13 molar percent of (d) 50 + / - 10% of one or more ionizable lipids, 37.95 + / - 10% of cholesterol, 9 + / - 10% of phospholipid, 3 + / - 10% of PEG-lipid and 0.05 + / - 10% of GalNAc-lipid.

20. Pharmaceutical composition, according to any one of claims 1 to 19, characterized in that the sequences of the first and second scaffold regions are the same.

21. Pharmaceutical composition, according to any one of claims 1 to 20, characterized in that the scaffold region sequences of the first and second guide oligonucleotides (gRNAs) Petition 870250084728, dated 09 / 19 / 2025, p. 34 / 41 and 16 / 21 are each independently selected as either a sequence to follow or a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% similarity or identity with one of the following sequences: 5'GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGC -3' and 5'GUUUGAGAGCUAUGCUGGAAACAGCAUAGCAAGUUCAAAUAAGGCUAG UCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC -3'.

22. Pharmaceutical composition, according to any one of claims 1 to 21, characterized in that the first scaffold and / or the second scaffold comprise a modified nucleotide.

23. Pharmaceutical composition, according to any one of claims 1 to 22, characterized in that the scaffold comprises one or more of the modified nucleotides in the following nucleotide sequence: 5' - mGUUUUAGmAmGmCmUmAGmAmAmAmUmAmGmCmAmAGUUmAAmAA mUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmA mAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmC 3', where m of mN is 2'-O-methyl ribose.

24. Pharmaceutical composition, according to any one of claims 1 to 23, characterized in that the scaffold comprises the following sequence or a sequence with at least about 75%, at least about 80%, at least about 85%, at least about 90% or at least about 95% identity with the following sequence: 5' mGUUUUAGmAmGmCmUmAGmAmAmAmUmAmGmCmAmAGUUmAAmAA Petition 870250084728, dated 09 / 19 / 2025, p. 35 / 41 17 / 21 mUAmAmGmGmCmUmAGUmCmCGUUAmUmCAAmCmUmUGmAmAmAmA mAmGmUmGGmCmAmCmCmGmAmGmUmCmGmGmUmGmC 3', where m in mN is 2-O-methyl ribose.

25. Pharmaceutical composition, according to any one of claims 1 to 24, characterized in that the first guide oligonucleotide and / or the second guide oligonucleotide comprise an RNA motif at the 3' end of the guide oligonucleotide.

26. Pharmaceutical composition, according to claim 25, characterized in that the RNA motif comprises, consists essentially of, or consists of 5'-UUU-3'.

27. Pharmaceutical composition, according to claim 25, characterized in that the RNA motif comprises, consists essentially of, or consists of 5'- *mU*mU *mU -3', where mU* indicates a phosphorothiolated 2'-O-methyl uracil base and mU indicates a 2'-O-methyl uracil base.

28. Pharmaceutical composition, according to any one of claims 1 to 27, characterized in that the weight ratio of the total weight of the first and second guide oligonucleotides to the weight of the mRNA is 1:1 + / - 25%.

29. Pharmaceutical composition, according to any one of claims 1 to 27, characterized in that the weight ratio of the first guide oligonucleotide to the second guide oligonucleotide is 1:1 + / - 25%.

30. Gene editing system according to claim 2 or any one of claims 3 to 29, which are dependent on claim 2, characterized in that the first location and the second location are spaced less than 200 nucleotides apart.

31. Gene editing system, according to claim 30, Petition 870250084728, dated 09 / 19 / 2025, pp. 36 / 41 18 / 21, characterized in that the first location and the second location are spaced by a distance of 20 to 50 nucleotides.

32. Pharmaceutical composition, according to any one of claims 1 to 31, characterized in that administration of the composition to hepatocytes results in 40% or more editing efficiency.

33. Pharmaceutical composition, according to claim 32, characterized in that the hepatocytes are primary hepatocytes.

34. Pharmaceutical composition, according to claim 32 or 33, characterized in that the hepatocytes are human hepatocytes.

35. Method for inactivating the LPA gene in vivo in a mammalian subject to treat and prevent cardiovascular diseases, characterized in that it comprises the step of: administering to the subject a pharmaceutical composition, as defined in any one of claims 1 to 34.

36. Method for reducing the concentration of Lp(a) in the blood of a mammalian subject for treating and preventing cardiovascular disease, characterized in that it comprises the step of: administering to the subject a pharmaceutical composition, as defined in any one of claims 1 to 34.

37. A method for treating and / or preventing cardiovascular diseases associated with the LPA gene in a mammalian subject, characterized in that it comprises the step of: administering to the subject a pharmaceutical composition, as defined in any one of claims 1 to 34.

38. Method for in vivo editing of an LPA gene in a mammalian subject, characterized in that it comprises the step of: administering to the subject a pharmaceutical composition, as defined in any one of claims 1 to 34.

39. Method for in vivo editing of an LPA gene in a mammalian subject characterized in that it comprises: Petition 870250084728, dated 09 / 19 / 2025, page 37 / 41 19 / 21 administering to the subject a pharmaceutical composition comprising: (i) one or more polynucleotides (mRNAs) encoding one or more CRISPR Cas nickases, (ii) a first guide oligonucleotide (gRNA) comprising a first spacer sequence and a scaffold region;and (iii) a second guide oligonucleotide (gRNA) comprising a second spacer sequence and a scaffold region and (iv) a delivery system that is engineered to deliver one or more mRNAs, the first gRNA and / or the second gRNA, individually or collectively, to the liver, wherein the first gRNA and at least one or more Cas nickases are engineered to cause at least one or more Cas nickases to cut one of the first or second strands of the LPA gene at a first location on chromosome 6 from position 160,664,275 to 160,531,482, and wherein the second gRNA and at least one or more Cas nickases are engineered to cause at least one or more Cas nickases to cut the other of the first or second strands of the LPA gene at a second location on chromosome 6 from position 160,664,275 to 160,531,482.; 40. Gene editing system characterized in that it is for editing the LPA gene produced by expression in a cell of one or more exogenous polynucleotides (mRNAs) encoding one or more CRISPR Cas nickases and by introducing first and second gRNAs into the cell, wherein the first guide oligonucleotide (gRNA) comprises (i) a first spacer sequence that is complementary to a first strand of the LPA gene at a first target sequence and (ii) a first scaffold region that serves as a binding scaffold for at least one of one or more Petition 870250084728, dated 09 / 19 / 2025, p.38 / 41 20 / 21 Cas nickases, wherein the second guide oligonucleotide (gRNA) comprises (i) a second spacer sequence that is complementary to a second strand of the LPA gene at a second target sequence and (ii) a second scaffold region that serves as a binding scaffold for at least one of one or more Cas nickases, wherein the first gRNA and at least one of one or more Cas nickases are manipulated to cause at least one of one or more Cas nickases to cut either the first or second strand of the LPA gene at a first chromosome 6 location from position 160,664,275 to 160,531,482 and wherein the second gRNA and at least one of one or more Cas nickases are manipulated to cause at least one of one or more Cas nickases to cut either the first or second strand of the LPA gene at a second chromosome 6 location from position 160,664,275 to 160,531,482.

41. Gene editing system characterized in that it comprises: a means for expressing one or more CRISPR Cas nickases in a cell; and a means for targeting one or more Cas nickases to the first and second locations in the LPA gene and causing one or more Cas nickases to introduce a cut in a first strand of the LPA gene and introduce a cut in a second strand of the LPA gene.

42. Pharmaceutical composition characterized in that it comprises a gene editing system, as defined in claim 41, and a delivery system.

43. Pharmaceutical composition, according to claim 42, Petition 870250084728, dated 09 / 19 / 2025, pp. 39 / 41 21 / 21, characterized in that the delivery system comprises means for delivering to the cell the means for expressing one or more CRISPR Cas nickases and the means for targeting one or more Cas nickases to the first and second locations in the LPA gene.

44. Gene editing system for editing the LPA gene characterized in that it comprises: a Cas nickase or a nucleic acid encoding the Cas nickase; a first guide oligonucleotide comprising (i) a first spacer sequence that is complementary to a first strand of the LPA gene at a first target sequence and (ii) a first scaffold region that serves as a binding scaffold for the nickase;a second guide oligonucleotide comprising (i) a second spacer sequence that is complementary to a second strand of the LPA gene at a second target sequence and (ii) a second scaffold region that serves as a binding scaffold for Cas nickase, wherein the first guide oligonucleotide and Cas nickase are manipulated to cause Cas nickase to cut one between the first or second strand of the LPA gene at a first location, wherein the second guide oligonucleotide and Cas nickase are manipulated to cause Cas nickase to cut the other between the first or second strand of the LPA gene at a second location, and wherein the first location and the second location are spaced by a distance of 1 to 200 nucleotides.

45. Gene editing system, according to claim 44, characterized in that the first location and the second location are spaced by a distance of 20 to 50 nucleotides.

Images