Adeno-associated virus complex, use of the same for gene therapy and composition

Description

1 / 41 Adeno-associated virus complex, its use for gene therapy and composition. Technical Field

[001] The present disclosure relates to a modified complex platform of an adeno-associated virus and uses thereof. Technical Background

[002] An adeno-associated virus (AAV) is a single-stranded DNA virus with a genome size of approximately 4.6 kbp, which is a human parvovirus dependent on a helper vector. The genome consists of ITRs at both ends and two open reading frames (ORFs), rep and cap. The N-terminal region of the genome encodes a rep gene involved in viral replication and viral gene expression, and the C-terminal region encodes a cap gene that encodes a viral capsid protein. ITRs are involved in the replication of an AAV genome and the packaging of AAV particles.

[003] On the other hand, an AAV gene delivery vehicle is safe as a delivery vehicle from a non-pathogenic human virus and has a wide host range without inducing a cellular immune response. In addition, an AAV gene delivery vehicle is capable of delivering genes to undivided cells and dividing cells and, in particular, the expression of a gene delivered by an AAV gene delivery vehicle is characterized by long-term persistence in vivo.

[004] However, due to its inverted terminal repeat (ITR), AAV has a problem with low DNA packaging capacity, because a protein-coding sequence of up to about 4.4 kb can be encapsulated. In addition, there is also the problem of a reduced expression rate of the released gene, due to mutual competition between the two strands, when the gene inserted in the 3'^5' direction and the gene inserted in the 5'^3' direction are Petition 870250120586, dated 12 / 29 / 2025, page 13 / 101 2 / 41 expressed in a host cell genome. In addition, the released gene has the potential to cause cancer when inserted into the host cell genome.

[005] Therefore, there is a need to develop an AAV complex as a gene delivery vehicle, with improved DNA packaging capacity, a lower probability of insertion into the chromosome of infected cells, and improved productivity and expression efficiency, due to ITR modification, which is a characteristic of AAVs. Revealing the Invention Technical Problem

[006] One embodiment described in the present invention relates to an adeno-associated virus (AAV) comprising a polynucleotide sequence encoding a transgene between a first inverted terminal repeat (ITR) and a second ITR, wherein in either the first ITR and the second ITR, all or part of a stem-loop structure, which is formed by rep linking element (RBE) regions, RBE', A, A', B, B', C, C' and D, is modified. The adeno-associated virus complex may further comprise an operatively linked promoter, a polynucleotide sequence encoding a transgene and a polyadenylation sequence, between the first ITR and the second ITR. The AAV may be of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. In adeno-associated virus complexes, the first ITR may not be modified and the second ITR may be modified.The modification of the stem-loop structure can be at least one of an insertion, a deletion, or a substitution. In the adeno-associated virus complex, any of the first and second ITRs can be modified so as not to form a stem-loop structure. In the adeno-associated virus complex, in any of the first and second ITRs, all or part of... Petition 870250120586, dated 12 / 29 / 2025, page 14 / 101 3 / 41 A stem-loop structure, which is formed by the RBE, RBE', A, A', B, B', C, C', and D regions, can be deleted. In the adeno-associated virus complex, either the first ITR or the second ITR can comprise a terminal resolution site (trs) sequence and an RBE sequence, and exhibits deletions of all C, C', B', B, and RBE' sequences, as well as the A or A' region, whichever is closest to the 3' end of the (+) strand of the transgene or the 5' end of the (-) strand of the transgene after RBE. The promoter can be a tissue-specific promoter. In the adeno-associated virus complex, the transgene can be a therapeutic gene. In the adeno-associated virus, the transgene can be GFP, Luciferase, TP53, RPE65, TPP1, or FVIII.

[007] Another embodiment relates to a gene therapy method, comprising administering an effective amount of the adeno-associated virus complex described in this invention to an individual in need thereof.

[008] Yet another embodiment relates to a composition comprising the adeno-associated virus complex described in the present invention. The composition may further comprise a pharmaceutically acceptable carrier. The composition may be for delivering a therapeutic gene for gene therapy. Solution to the Problem

[009] Detailed reference will now be made to the embodiments, which are illustrated in the accompanying drawings, where similar reference numbers refer to similar elements throughout the document. In this sense, the present embodiments may have different forms and should not be interpreted as limited to the descriptions set forth in the present invention. Consequently, the embodiments are merely described below, with reference to the figures, to explain the described embodiments. As Petition 870250120586, dated 12 / 29 / 2025, page 15 / 101 4 / 41 used in the present invention, the term and / or includes any and all combinations of at least one of the associated listed items. Expressions such as at least one of, when preceding a list of elements, modify the entire list of elements and do not modify the individual elements of the list.

[010] One embodiment is related to an adeno-associated virus complex including a modified inverted terminal repeat.

[011] Another modality is related to a cell transformed by the adeno-associated virus complex.

[012] Yet another modality is related to a method of delivering a transgene, including administering an effective amount of the adeno-associated virus complex.

[013] Yet another modality is related to a gene therapy method, including the administration of an effective amount of the adeno-associated virus complex.

[014] Another modality is related to a method of treating an individual's disease, including administering the effective amount of adeno-associated virus complex according to an aspect of the individual who needs it.

[015] Another modality is related to a composition including the adeno-associated virus complex.

[016] Another approach is related to the use of adeno-associated virus complex for gene therapy.

[017] Additional modalities will be presented in part in the following description and, in part, will be apparent from the description or can be learned by practicing the presented modalities of revelation.

[018] In one embodiment, a complex is described in the present invention. Petition 870250120586, dated 12 / 29 / 2025, page 16 / 101 5 / 41 adeno-associated virus (AAV) including a modified inverted terminal repeat (ITR).

[019] The term adeno-associated virus (AAV), as used in the present invention, refers to a single-stranded DNA virus with a genome size of about 4.6 kbp, which is a human parvovirus dependent on a helper vector. The genome consists of ITRs at both ends and two open reading frames (ORFs), rep and cap. The N-terminal region of the genome encodes a rep gene involved in viral replication and viral gene expression, and the C-terminal region encodes a cap gene that encodes a viral capsid protein. The ITRs are involved in the replication of an AAV genome and the packaging of AAV particles. The ITR includes a rep linking element (RBE), RBE', A, A', B, B', C, C' and D regions that form a stem-loop structure. The structure of AAV ITRs is well described, for example in Goncalves, MA Virology Journal, 2(1):43 (2005), which is incorporated into the present invention by reference.

[020] The ITR sequence may be based on an ITR sequence of a virus belonging to the genus Dependovirus of the family Parvoviridae.

[021] The ITR sequence may be based on an AAV ITR sequence. The AAV ITR sequence is publicly known.

[022] Examples of AAV include AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, etc., and may also include other AAV serotypes currently known or to be discovered later. AAV may include derivatives of known AAV. AAV may include modified or artificial AAV.

[023] Thus, the ITR sequence can be based on an ITR sequence of an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. The ITR sequence Petition 870250120586, dated 12 / 29 / 2025, p. 17 / 101 6 / 41 can be based on an ITR sequence from an AAV serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, and AAV9. The first ITR and the second ITR can be based on ITR sequences from the same or different AAV serotypes.

[024] Alternatively, other types of viruses belonging to the genus Dependovirus of the family Parvoviridae may be used instead of AAV.

[025] The term AAV complex, used in the present invention, can be used interchangeably with AAV vector, AAV delivery vehicle, recombinant AAV and recombinant AAV vector.

[026] In one embodiment, the AAV complex includes a heterologous polynucleotide sequence between the first ITR and the second ITR.

[027] The heterologous polynucleotide sequence can be operationally organized between the first ITR and the second ITR.

[028] In one embodiment, an AAV complex genome includes a first ITR (5'-ITR), a polynucleotide sequence encoding a transgene, and a second ITR (3'-ITR) in a 5' to 3' direction.

[029] In certain embodiments, the AAV complex includes a polynucleotide sequence that encodes a transgene between the first ITR and the second ITR, and in either the first ITR and the second ITR, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C' and D, may be modified.

[030] In certain embodiments, the AAV complex may include an operatively linked promoter, a polynucleotide sequence encoding a transgene, and a polyadenylation sequence between a first ITR and a second ITR.

[031] In certain embodiments, an AAV complex genome includes a first ITR (5'-ITR), a promoter, a polynucleotide sequence that Petition 870250120586, dated 12 / 29 / 2025, p. 18 / 101 7 / 41 encodes a transgene, a polyadenylation sequence, and a second ITR (3'ITR), in a 5' to 3' direction.

[032] In certain additional embodiments, the AAV complex includes an operatively linked promoter, a polynucleotide sequence encoding a transgene and a polyadenylation sequence, between the first ITR and the second ITR, and in either the first ITR and the second ITR, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C' and D, may be modified.

[033] In certain embodiments, the AAV complex may include an asymmetrically modified ITR. In one embodiment, the AAV complex may have either a first ITR and a second ITR modified. In another embodiment, the AAV complex may have a first ITR modified and a second ITR unmodified. In another embodiment, the AAV complex may have a first ITR unmodified and a second ITR modified. In another embodiment, the AAV complex may have a 5'-ITR from a (+) strand of an unmodified transgene and a 3'-ITR from a (+) strand modified. In another embodiment, the AAV complex may have a 5'-ITR from the (-) strand of the transgene modified and a 3'-ITR from an unmodified (-) strand. In other words, the fact that the second ITR is modified may mean that the 3'-ITR from the (+) strand and / or the 5'-ITR from the (-) strand of the transgene are modified.

[034] Because the AAV complex described in the present invention can have higher AAV complex productivity, higher transgene expression rate, and reduced genotoxicity by including an asymmetrically modified ITR, the AAV complex can be used as an AAV delivery vehicle platform to release multiple genes into target cells. In addition, the AAV complex described in the present invention can be used as a delivery vehicle to express a transgene with high efficiency for a short period of time. Petition 870250120586, dated 12 / 29 / 2025, page 19 / 101 8 / 41 while simultaneously suppressing the long-term expression of the transgene in a host cell.

[035] Between the first ITR and the second ITR, the unmodified ITR may be a wild-type ITR. Between the first ITR and the second ITR, the unmodified ITR may be a wild-type ITR of AAV.

[036] In certain embodiments, between the first ITR and the second ITR, the unmodified ITR may be a functional derivative having substantially the same functional properties as a wild-type ITR (e.g., wild-type ITR of AAV).

[037] The term functional derivative, as used in the present invention, may mean a derivative that has substantially the same functional properties. The derivative refers to a similar compound obtained by chemically altering a part of the structure of a compound. The derivative may refer to a compound in which a hydrogen atom or a specific atomic group in a compound is replaced with another atom or atomic group. A method for preparing derivatives of a compound while maintaining substantially the same functional properties is known in the art.

[038] In certain embodiments, in either of the first ITR and the second ITR, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C' and D, can be modified.

[039] In one embodiment, the modification of the stem-loop structure can be selected from an insertion, a deletion, and a replacement.

[040] In one embodiment, modification of the stem-loop structure includes modification to include a single stem and a single loop. For example, the modified ITR may include the deletion of a B-arm. Petition 870250120586, dated 12 / 29 / 2025, page 20 / 101 9 / 41 B' so that arm CC' remains, or the deletion of arm CC' so that arm BB' remains.

[041] In one embodiment, the modification of the stem-loop structure includes modification to include a single stem instead of two loops. For example, a modified ITR may include the deletion of a BB' arm and a C-C' arm.

[042] In one embodiment, the modified ITR may include a deletion of a C' region so that a truncated C-loop and a BB' arm remain. Similarly, the modified ITR may include a deletion of a B region so that a truncated B-loop and a CC' arm remain.

[043] In one embodiment, the modified ITR may include a deletion of a base pair in at least one portion selected from a C portion, a C' portion, a B portion, or a B' portion, so that a single arm can be formed, as complementary base pairs occur between a C portion and a B' portion and between a C' portion and a B portion.

[044] In one embodiment, the modified ITR may include a modification (e.g., deletion, substitution, or addition) of 1, 2, 3, 4, 5, or 6 nucleotides in at least one region selected from A' and C, between C and C', between C' and B, between B and B', and between B' and A.

[045] In one embodiment, modification of the stem-loop structure may include modification of the structure of a structural element. Specifically, modification of the structure of a structural element may include altering the height of a stem and / or altering the number of nucleotides in a loop. For example, the stem height may be about 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides or more, or any range of nucleotides contained therein. In another example, the loop may have about 3, 4, 5, 6, 7, 8, 9, 10 nucleotides or more, or any range of Petition 870250120586, dated 12 / 29 / 2025, page 21 / 101 10 / 41 nucleotides contained in it.

[046] In another embodiment, by altering (for example, increasing or decreasing) a distance between two elements (such as, as a non-limiting example, RBE and a hairpin), the functional interaction with a large Rep protein can be altered. For example, the distance can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides or more, or any range of nucleotides contained therein.

[047] In one embodiment, either of the first ITR and the second ITR can be modified so as not to form a stem-loop structure. In another embodiment, the first ITR can be modified so as not to form a stem-loop structure. In another embodiment, the second ITR can be modified so as not to form a stem-loop structure. In another embodiment, the first ITR may not be modified, and the second ITR can be modified so as not to form a stem-loop structure.

[048] The expression 'modified to not form a stem-loop sequence' may mean that an ITR structure is modified to exist as an open or free end without forming a stem-loop structure, due to a modification of an ITR sequence. In certain embodiments, an AAV complex is modified so that neither the first ITR nor the second ITR forms a stem-loop structure, to suppress the formation of a circular dimer and a circular concatemer in infected cells, and to suppress integration into the host genome, which is observed in AAV. In addition, the productivity of the AAV complex and the expression rate of the transgene may be increased by the modification.

[049] In one embodiment, either of the first ITR and the second ITR can be modified to a blind end. In another embodiment, Petition 870250120586, dated 12 / 29 / 2025, page 22 / 101 11 / 41 Either of the first and second ITRs can be modified to an adhesive end. In another embodiment, the second ITR can be modified to a blunt end or a sticky end. In another embodiment, the second ITR can be modified to a blunt end. The modification to a blunt end or a sticky end can be performed using a method known to a person skilled in the art.

[050] In one embodiment, in either the first ITR or the second ITR, all or part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C', and D, may be deleted. In another embodiment, in either the first ITR or the second ITR, part of a stem-loop structure, which is formed by the regions RBE, RBE', A, A', B, B', C, C', and D, may be deleted. In another embodiment, either the first ITR or the second ITR may include a terminal resolution site (trs) sequence and an RBE sequence, and may exhibit deletions of all sequences C, C', B', B, and RBE', as well as the A or A' region, whichever is closest to the 3' end of the (+) strand of the transgene or the 5' end of the (-) strand of the transgene after RBE.In another embodiment, the first ITR may not be modified, and the second ITR may include a trs sequence and an RBE sequence, and may exhibit deletions of all C, C', B', B and RBE' sequences, as well as the A or A' region, whichever is closest to the 3' end of the (+) strand of the transgene or the 5' end of the (-) strand of the transgene after RBE.

[051] In another embodiment, either of the first ITR and the second ITR may include, consist essentially of, or consist of any nucleotide sequence selected from sequences of SEQ ID NOs: 1 to 9, or a sequence complementary to it. In another embodiment, the first ITR may not be modified, and the second ITR may include, consist essentially of Petition 870250120586, dated 12 / 29 / 2025, p. 23 / 101 12 / 41 in, or consist of any nucleotide sequence selected from sequences with SEQ ID numbers 1 to 9, or a sequence complementary to it.

[052] The sequence with SEQ ID NO: 1 may be based on an ITR sequence from AAV2.

[053] The sequence with SEQ ID NO: 2 may be based on an ITR sequence from AAV1.

[054] The sequence with SEQ ID NO: 3 may be based on an ITR sequence from AAV3.

[055] The sequence with SEQ ID NO: 4 may be based on an ITR sequence from AAV4.

[056] The sequence with SEQ ID NO: 5 may be based on an ITR sequence from AAV6.

[057] The sequence with SEQ ID NO: 6 may be based on an ITR sequence from AAV7.

[058] The sequence with SEQ ID NO: 7 may be based on an ITR sequence from AAV5.

[059] The SEQ ID NO: 8 sequence may be based on an ITR sequence of AAV8.

[060] The SEQ ID NO: 9 sequence may be based on an ITR sequence of AAV9.

[061] In certain embodiments, the SEQ ID NOs: 1 to 9 sequences may have a portion of an AAV ITR sequence deleted. The SEQ ID NOs: 1 to 9 sequences may include a trs sequence and an RBE sequence between the AAV ITR sequences. The SEQ ID NOs: 1 to 9 sequences may exhibit deletions of all C, C', B', B and RBE' regions, as well as the A or A' region, whichever is closest to the 3' end of the (+) strand of the transgene or the 5' end of the (-) strand of the transgene after RBE. Petition 870250120586, dated 12 / 29 / 2025, p. 24 / 101 13 / 41

[062] In general, an RNA polymerase generates mRNA having a sequence complementary to a target gene in a promoter region. The process is called transcription, and transcription occurs in the 5' to 3' direction. Meanwhile, when a target gene is inserted into an AAV complex, the gene is inserted in the 5' to 3' direction and in the 3' to 5' direction, respectively, relative to the DNA double helix of the AAV complex. Therefore, while transcription of the target gene is underway, transcription of the target gene occurs in both directions due to the DNA double helix of the AAV complex, and thus there is a problem that the efficiency of target gene expression is reduced due to interference.However, an AAV complex described in the present invention can enhance the expression efficiency of a target gene by avoiding interference from the double helix structure of the AAV complex's DNA during target gene transcription, through a modification of the stem-loop structure, specifically, by deleting all or part of the stem-loop structure.

[063] For example, in an AAV complex including an asymmetrically modified ITR, a first ITR may not be modified, and a second ITR may be modified so as not to form a stem-loop structure. Consequently, the 5'-ITR of the (-) strand of a transgene does not form a hairpin structure, and transcription of the transgene proceeds complementarily to the corresponding strand in the 5' to 3' direction. Meanwhile, on the (+) strand of the transgene, the 3'-ITR does not form a hairpin structure, and transcription of the transgene does not occur on the corresponding strand. That is, since only transcription in the 5' to 3' direction of the released gene proceeds, and a competitor in the 3' to 5' direction is removed, gene expression efficiency can be increased.

[064] In one example, in an AAV vector including multiple transgenes, an AAV complex (pAAV-GC ITR vector) including an asymmetrically modified ITR was prepared by partially modifying a structure in Petition 870250120586, dated 12 / 29 / 2025, page 25 / 101 14 / 41 hairpin of a second ITR between wild-type AAV ITRs included in the vector. Comparing the prepared AAV complex with an AAV complex in which one hairpin structure is not modified (pAAV-WT ITR vector) and an AAV complex modified so that both ends of a hairpin structure are symmetrical (pAAV-BC del. ITR vector), the respective productivity, transgene expression rate, and genotoxicity were confirmed. As a result, it was confirmed that the AAV complex including an asymmetrically modified ITR (pAAV-GC ITR vector), compared to the AAV complex without ITR modification (pAAV-WT ITR vector) and the AAV complex including a symmetrically modified ITR (pAAV-BC del. ITR vector), showed significantly increased viral productivity and transgene expression rate, and very low genotoxicity.

[065] The term promoter, as used in the present invention, refers to a region that regulates gene transcription. The promoter may be operatively linked to a coding sequence of a transgene. The promoter may be a tissue-specific promoter or an inducible promoter. The tissue-specific promoter is not limited in its type, provided that the promoter induces gene expression specifically in a specific cell or tissue type in vivo. For the tissue-specific promoter, a promoter specific to a target tissue may be appropriately selected so that a corresponding transgene is expressed according to a type of transgene.Non-limiting examples of tissue-specific promoters include the liver-specific thyroxine-binding globulin (TBG) promoter, the insulin promoter, the glucagon promoter, the somatostatin promoter, the pancreatic polypeptide (PPY) promoter, the synapsin-1 (Syn) promoter, the creatine kinase (MCK) promoter, the mammalian desmin (DES) promoter, the α-myosin heavy chain (α-MHC) promoter, and the cardiac troponin T promoter. Petition 870250120586, dated 12 / 29 / 2025, page 26 / 101 15 / 41 (cTnT), the promoter of surfactant protein C (SPC) and related substances.

[066] A heterologous polynucleotide can encode a transgene.

[067] The term transgene, as used in the present invention, refers to a gene transferred from one organism to another naturally or by various genetic manipulation techniques. The term transgene can be used interchangeably with transferred gene and target gene.

[068] The transgene is not limited to a specific type, as long as it is a gene targeted to be introduced into a host cell. In certain embodiments, since an AAV complex has advantages of improved AAV productivity, an improved transgene expression rate and reduced genotoxicity, regardless of the transgene type, the AAV complex can be used as an AAV delivery vehicle platform to deliver multiple transgenes.

[069] In one embodiment, the transgene can be a therapeutic gene. When the transgene is a therapeutic gene, the AAV complex according to one aspect can be used as a gene therapy agent. Therefore, the AAV complex can be an AAV vector for gene therapy.

[070] In one embodiment, the transgene may be GFP, luciferase, TP53, RPE65, TPP1, or FVIII, but is not limited to these. When the transgene is TP53, the transgene-releasing AAV complex may be used as a gene therapy agent for anticancer treatment. When the transgene is RPE65, the transgene-releasing AAV complex may be used as a gene therapy agent to treat hereditary retinal diseases (IRDs). When the transgene is TPP1(CLN2), the transgene-releasing AAV complex may be used as a gene therapy agent to treat Batten disease. When the transgene is FVIII, the transgene-releasing AAV complex may be used as a gene therapy agent to treat hemophilia. Petition 870250120586, dated 12 / 29 / 2025, page 27 / 101 16 / 41

[071] The transgene can be derived from a human or an animal.

[072] In one embodiment, the AAV complex may additionally include posttranscriptional regulatory elements. The AAV complex may include a first ITR, a promoter sequence, a polynucleotide sequence encoding a transgene, posttranscriptional regulatory elements, a polyadenylation sequence, and a second ITR in the 5' to 3' direction.

[073] The post-transcriptional regulatory element may include a post-transcriptional regulatory element of the marmot hepatitis virus (WPRE).

[074] In one embodiment, the AAV complex may additionally include a genetic junction between the promoter and the polynucleotide sequence encoding a transgene.

[075] The term gene junction, as used in the present invention, refers to a sequence that is not defined and is located between the end of a promoter and the beginning of a target gene sequence. Specifically, a promoter is a site where the transcription machinery is intricately linked to regulate genes, and a boundary, between the end of a known promoter sequence and the initial region of a gene whose expression is to be controlled, is generally ambiguous. Thus, optimization of the junction may be necessary to construct a successful relationship between promoter and gene expression. A sequence of the gene junction may be appropriately selected by a person skilled in the art according to a method in the art.

[076] The AAV complex can be manipulated to encode selectable markers or reporters that provide means for selecting or identifying cells that have incorporated them. Selectable markers or reporters are Petition 870250120586, dated 12 / 29 / 2025, page 28 / 101 17 / 41 known in the state of the art. Non-limiting examples of selectable markers include genes that confer resistance to ampicillin, streptavidin, kanamycin, hygromycin, and the like. Non-limiting examples of reporters include luciferase, green fluorescent protein (GFP), and the like.

[077] Also described in the present invention is a cell transformed by an adeno-associated virus complex.

[078] Details of the adeno-associated virus complex are described above.

[079] The term transformation, as used in the present invention, means that the genetic properties of an organism are altered by DNA introduced from outside. Transformation is a phenomenon in which DNA enters a cell and alters hereditary characteristics when DNA, a type of nucleic acid extracted from a cell line of one organism, is injected into a living cell of another cell line. That is, transformation means introducing a gene into a host cell so that it can be expressed in it.

[080] A method of transforming a cell line by introducing an AAV complex described in the present invention may be a method known in the prior art, for example, transient transfection using lipofectamine, etc., microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE-mediated dextran transfection, polybrene-mediated transfection, electroporation, etc., but is not limited to these, and preferably, the lipofectamine 2000 reagent may be used for transformation.

[081] In another embodiment, the present invention describes a method for delivering a transgene to an individual, including the delivery of an effective amount of an adeno-associated virus complex according to a Petition 870250120586, dated 12 / 29 / 2025, page 29 / 101 18 / 41 aspect to the individual who needs it.

[082] Yet another modality is related to a gene therapy method, including administering an effective amount of an adeno-associated virus complex to an individual who needs it.

[083] Yet another modality relates to a method of treating an individual's disease, including administering an effective amount of the adeno-associated virus complex to the individual who needs it.

[084] In the methods described, specific details of the adeno-associated virus complex are as described above.

[085] In the methods described, the AAV complex may be administered to an individual by itself, or the AAV complex may be formulated in a form manageable for an individual and administered to the individual. In one embodiment, the AAV complex may be administered to an individual in the form of a composition including an AAV complex. For example, the AAV complex may be formulated in a composition including the AAV complex and a pharmaceutically acceptable carrier and administered to an individual.

[086] The individual may need the expression of a transgene released by the AAV complex. The individual may suffer from, or be highly likely to suffer from, a disease to which gene therapy is applicable. The individual may suffer from, or be highly likely to suffer from, a disease that can be treated by the expression of a transgene released by an AAV complex. The individual may be a mammal, such as a human, a cow, a horse, a pig, a dog, a sheep, a goat, or a cat.

[087] The term gene therapy, as used in the present invention, refers to treatment that uses genes to treat or prevent a disease. AAV vectors for the delivery of therapeutic genes into cells can be used as Petition 870250120586, dated 12 / 29 / 2025, page 30 / 101 19 / 41 Gene therapy agents. Diseases to which gene therapy can be readily applied include, but are not limited to, diseases caused by defects in a single gene. Non-limiting examples of diseases to which gene therapy is applicable include cancer; cardiovascular disease; genetic diseases such as hereditary retinal dystrophy (IRD), Batten disease, hemophilia, cystic fibrosis, muscular dystrophy, thalassemia, and sickle cell anemia; cranial nervous system disease; infectious disease (acquired immunodeficiency syndrome, etc.); joint disease, etc.

[088] Cancer can be a type of cancer in which a cancer suppressor gene is inactivated. The cancer can be, for example, a cancer with a KRAS mutation. The cancer can be, for example, a solid cancer with a KRAS mutation. The cancer can be, for example, a lung cancer with a KRAS mutation. In certain modalities, when the activity of the cancer suppressor gene is restored, as cancerous cells are removed and normal cells remain, lung cancer with a KRAS mutation can be treated. The cancer suppressor gene can be, for example, sPD-1, VHL, MMAC1, DCC, p53, NF1, WT1, Rb, BRAC1, BRAC2, or RUNX3.

[089] In one modality, lung cancer can be non-small cell lung cancer or small cell lung cancer. Non-small cell lung cancer includes, for example, squamous cell carcinoma, large cell carcinoma, lung adenocarcinoma, and the like.

[090] Therefore, in certain modalities, an AAV complex can prevent or treat a disease by activating a corresponding gene in a disease caused by a decrease in the activity of a specific gene and, thus, can be used for gene therapy.

[091] The term prevention, as used in the present invention, refers to Petition 870250120586, dated 12 / 29 / 2025, p. 31 / 101 20 / 41 all actions that suppress or delay the onset of a disease by administering the AAV complex. The term treatment refers to all actions that improve or beneficially alter the symptoms of a disease by administering the AAV complex.

[092] In certain embodiments, the method may additionally include the administration of a second active ingredient to the individual. The second active ingredient may be an active ingredient to prevent or treat a disease being treated. The active ingredient may be administered concomitantly, separately, or sequentially with the AAV complex.

[093] In certain embodiments, the AAV complex may be formulated into an injectable formulation suitable for administration by any suitable route, such as intravenous, intra-arterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intra-articular or intrathecal, and may be administered to an individual. The AAV complex may be administered systemically or locally and may be administered alone or in combination with other pharmaceutically active compounds.

[094] A preferred dosage of the AAV complex may vary depending on the patient's condition and body weight, the severity of the disease, the formulation of the therapeutic agent, the route and duration of administration, etc., and may be appropriately selected by those skilled in the art. In one embodiment, a dosage of the AAV complex may be from approximately 1.0x10⁶ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10⁸ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10¹⁰ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10¹⁰ vg / kg to approximately 1.0x10¹⁴ vg / kg, approximately 1.0x10¹² vg / kg to approximately 1.0x10¹⁴ vg / kg, for example, approximately 1.0x10¹² vg / kg, approximately 1.0x10¹³ vg / kg or approximately 1.0x10¹⁴ vg / kg. In a certain embodiment, a dosage of the complex Petition 870250120586, dated 12 / 29 / 2025, p. 32 / 101 21 / 41 of AAV may be approximately 1.0 x 10¹³ g / kg. Administration may be performed once daily, several times daily, once weekly, once every 2 weeks, once every 3 weeks, or once every 4 weeks up to once a year.

[095] The term about, as used in the present invention, is used to include a range of ±10% of a designated numerical value.

[096] Another type is related to a composition that includes an adeno-associated virus complex.

[097] Yet another modality is related to the use of adeno-associated virus complex for gene therapy.

[098] Details of the adeno-associated virus complex and gene therapy are described above.

[099] In certain embodiments, the composition may be a composition for gene therapy. The composition may be a composition for delivering a therapeutic gene for gene therapy. The composition may be a pharmaceutical composition. The composition may additionally include a pharmaceutically acceptable carrier. The carrier includes an excipient, a diluent, or an auxiliary agent. As a carrier, a suitable carrier may be used to deliver the AAV complex into a living body. Specifically, for the carrier, a suitable carrier for formulation in a parenteral formulation (e.g., an injection formulation) may be selected. For example, for the carrier, a suitable carrier for formulation in an intravenous formulation may be selected. The carrier may be an aqueous solution, such as water or buffered saline solution and the like.

[100] In certain embodiments, the composition may be prepared in any formulation according to a method in the art. The composition may be formulated in a form suitable for delivery of an AAV vector to a Petition 870250120586, dated 12 / 29 / 2025, page 33 / 101 22 / 41 individual. The composition may be formulated in an aqueous solution, for example, in water or in a buffered saline solution. Alternatively, the composition may be formulated, for example, as a parenteral formulation (e.g., as an injection, for example, for bolus injection or continuous infusion). In one embodiment, the pharmaceutical composition may be formulated as an injectable formulation suitable for administration via any suitable route, such as intravenous, intra-arterial, subcutaneous, intradermal, intraperitoneal, intramuscular, intra-articular, or intrathecal. In a certain embodiment, the composition may be formulated for administration via intravenous injection or subcutaneous injection. In addition, the composition may be prepared as a systemic formulation or a topical formulation. The composition may be supplied as ampoules, pre-filled syringes, small injection containers, or a unit dosage form in multidose containers with added preservatives.

[101] In certain embodiments, when the composition is used for gene therapy of a specific disease, the composition may additionally include a second therapeutic agent effective in the prevention or treatment of the disease. The pharmaceutical composition may be a single composition or separate compositions.

[102] In certain modalities, the composition may include an effective amount of the AAV complex. The term effective amount refers to an amount that is sufficient to bring about a desired preventive or therapeutic effect when administered to an individual who needs it. The effective amount may be selected by those skilled in the art depending on the cell or individual. The effective amount may be determined according to the severity of the disease, age, weight, health, sex and sensitivity to a therapeutic agent of a patient, time of administration, route of Petition 870250120586, dated 12 / 29 / 2025, page 34 / 101 23 / 41 administration, excretion rate, duration of treatment, factors including therapeutic agents used in combination with or concomitantly with the composition used, and other factors well known in the medical field. In one embodiment, the composition may include the AAV complex at a dosage of approximately 1.0x10⁶ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10⁸ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10¹⁰ vg / kg to approximately 1.0x10¹⁶ vg / kg, approximately 1.0x10¹⁰ vg / kg to approximately 1.0x10¹⁴ vg / kg, approximately 1.0x10¹² vg / kg to approximately 1.0x10¹⁴ vg / kg, for example, approximately 1.0x10¹² vg / kg, approximately 1.0x10¹³ vg / kg or approximately 1.0x10¹⁴ vg / kg. In one particular formulation, the composition may include the AAV complex at a dosage of approximately 1.0 x 10¹³ g / kg. Administration may be performed once daily, several times daily, once weekly, once every 2 weeks, once every 3 weeks, or once every 4 weeks up to once a year. Advantageous Effects of the Invention

[103] An AAV complex according to one aspect has advantages of higher productivity and expression efficiency of a transgene and lower genotoxicity, by having an asymmetric ITR in which either of the two ITRs is modified and therefore can be used as an AAV delivery vehicle platform.

[104] Specifically, an aspect-based AAV complex has the following advantages: 1. The AAV complex partially omits a self-replication process in a host cell (or a packaging cell) due to the deletion of any ITR between two ITRs, thus increasing the packaging efficiency into viral particles within the same production period. Consequently, self-replication efficiency is increased, and the productivity of the AAV complex is improved compared to other complexes. Petition 870250120586, dated 12 / 29 / 2025, page 35 / 101 24 / 41 of existing AAVs. 2. The expression rate (amount of expression) of a transgene is higher than that of a general wild-type (WT) AAV. 3. An AAV WT genome forms a concatemer structure that is essential for transgene recombination within infected cells. That is, it has been reported that a transgene is inserted into a host cell chromosome forming a concatemer structure in the form of a polymorph in which several identical genomes are linked. On the other hand, since the AAV complex according to one aspect has an asymmetrically modified ITR, it does not form a concatemer structure and thus suppresses the insertion (i.e., recombination) of the transgene into the host chromosome. Thus, there is an advantage of reduced genotoxicity. 4. An AAV complex having an ITR modified asymmetrically according to one aspect is an AAV delivery vehicle platform in which the productivity and expression rate of the transgene are enhanced and genotoxicity is reduced, and thus several genes can be delivered into target cells using the platform. Brief Description of the Figures

[105] The described features, attributes and advantages of certain modes of revelation will become more evident from the following description, taken together with the attached drawings.

[106] FIG. 1 shows a cleavage map of an adeno-associated virus (AAV) vector according to an example.

[107] FIG. 2 shows a structure of an AAV vector according to an example.

[108] FIG. 3A is a schematic diagram of an AAV vector genome including an asymmetrically modified ITR from Example 1. Petition 870250120586, dated 12 / 29 / 2025, page 36 / 101 25 / 41

[109] FIG. 3B is a schematic diagram of an AAV vector genome including an unmodified symmetric ITR from Comparative Example 1.

[110] FIG. 3C is a schematic diagram of an AAV vector genome including a symmetrically modified ITR from Comparative Example 2.

[111] FIG. 4 presents the Western blot results confirming the productivity of the AAVs from Example 1 (GC), Comparative Example 1 (WT) and Comparative Example 2 (BC-del) for GFP gene expression.

[112] FIG. 5 presents the results of qPCR viral genome quantification confirming the productivity of the AAVs from Example 1 (pAAV-GC), Comparative Example 1 (pAAV-WT) and Comparative Example 2 (pAAV-BC del) for GFP gene expression.

[113] FIG. 6 presents the results of qPCR viral genome quantification confirming the productivity of AAVs from the pAAV-GC vector, the pAAV-WT vector and the pAAV-BC del vector to express several genes (GFP, Luciferase, TP53, RPE65, TPP1 or FVIII).

[114] FIG. 7 presents the results of the confirmation of the expression of a transgene GFP in AAV complexes according to the ITR types (ITR WT, ITR BC del or ITR GC), by Western blot.

[115] FIG. 8 shows the relative expression rates (%) of a transgene in AAV complexes according to ITR types (pAAV-GC, pAAV-BC del or pAAV-WT).

[116] FIG. 9A shows the imaging results of GFP expression using a fluorescence microscope at passages number P3 and P10.

[117] FIG. 9B shows the results of the diagramming of Table 4 in which the proportions of cells expressing GFP are quantified. Petition 870250120586, dated 12 / 29 / 2025, p. 37 / 101 26 / 41

[118] FIG. 10 shows the results of the schematization of Table 5 in which the relative levels of gene expression in P7 are quantified.

[119] FIG. 11 shows the results of PCR amplification confirming the presence or absence of concatemer formation of a transgene in a host cell. Best Method for Implementing the Invention

[120] The following are preferred examples to aid understanding of the present revelation. However, the following examples are provided only to facilitate understanding of the present revelation, and the content of the present revelation is not limited by the following examples. EXAMPLES Example 1. Preparation of an adeno-associated virus complex including asymmetrically modified ITR, for GFP gene expression. 1-1. Preparation of recombinant adeno-associated virus vectors into which a GFP gene is introduced.

[121] Recombinant adeno-associated virus (AAV) vectors were prepared into which a GFP gene is introduced. Specifically, in order to clone a chicken beta-actin promoter GFP gene (CBA-GFP), which is cloned into CS4-GFP vectors (Chungbuk National University Tumor Research Center), into AAV2 vectors, PCR amplification was performed using the primers shown in Table 1 below. In this regard, the primers were prepared by synthesizing the restriction enzymes NdeI and HindIII. After treating the amplified CBA-GFP DNA with the restriction enzymes NdeI and HindIII, the amplified CBA-GFP DNA was cloned into an NdeI-HindIII site in a multicloning site (MCS) of an empty wild-type adeno-associated virus (AAV)2 vector using a T4 DNA ligase, to obtain AAV2-CBA-GFP plasmids. The genes for resistance to ampicillin were Petition 870250120586, dated 12 / 29 / 2025, p. 38 / 101 27 / 41 removed using BspHI restriction enzyme sites present at both ends of the ampicillin resistance gene of the AAV2-CBAGFP plasmids. A kanamycin resistance gene was inserted at the site where the ampicillin resistance gene was removed. The kanamycin resistance gene was then recombined using PCR primers as shown in Table 1 below. [Table 1] Gene SEQ ID NO: Direction Sequence CBA-GFP 10 Forward 5'- gtgtatcatatgccaagtacgcc-3' 11 Reverse 5'- atcgataagcttgatatcaccact-3' Kanamycin 12 Forward 5'- TGTATCCG CTCATGAGAG CTCG GTCATAGCTGTTTCCTG -3' 13 Reverse 5'- GGAII IIGGTCATGAGCATGCTTAGAAAAACTCATCGA GC-3' 1-2. ITR structure modification

[122] Site-directed mutagenesis was induced in order to modify a portion of a hairpin structure of a second ITR between wild-type AAV2 inverted terminal repeats (ITRs) included in the vectors prepared in Example 1-1. Specifically, between the wild-type AAV2 ITRs included in the vector, all or at least one of the C, C', B', B, RBE', and A sequences after RBE of the 5'-direction ITR of a GFP gene gene was deleted, using 5' phosphorylation primers from Table 2 below. For example, all B', B, C', C, RBE', and A sequences were deleted from RBE of the 5'-direction ITR of the GFP gene gene gene. Consequently, the second ITR was modified to not form a hairpin structure. As a result, an AAV complex for GFP gene expression was obtained including an asymmetrically modified ITR, in which the first ITR was not modified and the second ITR was modified.

[123] The AAV vector including an asymmetrically modified ITR Petition 870250120586, dated 12 / 29 / 2025, page 39 / 101 28 / 41 as in Example 1 was designated pAAV-GC ITR (abbreviated as pAAV-GC).

[124] FIG. 1 shows a cleavage map of an AAV vector according to an example.

[125] FIG. 2 shows a structure of an AAV vector according to an example.

[126] FIG. 3A is a schematic diagram of an AAV vector genome including an asymmetrically modified ITR from Example 1. [Table 2] Name SEQ ID NO: Direction Sequence 5'-Phosphorylation 14 Forward 5'-P- cactgactcgctgcgctcggtcgtt-3' 15 Reverse 5'-P- agcgagtcagtgagcgagcgagcgc-3' Example 2. Preparation of an AAV vector including asymmetrically modified ITR for luciferase gene expression.

[127] An AAV complex, including an asymmetrically modified ITR, to express a luciferase gene was prepared in the same manner as in Example 1, except that the luciferase gene (2,387 bp; GenBank accession number M15077.1) was introduced instead of the GFP gene. Example 3. Preparation of an AAV vector including an asymmetrically modified ITR for TP53 gene expression.

[128] An AAV complex, including an asymmetrically modified ITR, to express a TP53 gene was prepared in the same manner as in Example 1, except that the TP53 gene (2,512 bp; GenBank accession number NM_000546.6) was introduced instead of the GFP gene. Example 4. Preparation of an AAV vector including an asymmetrically modified ITR, for RPE65 gene expression.

[129] An AAV complex, including an asymmetrically modified ITR, to express an RPE65 gene was prepared from the same Petition 870250120586, dated 12 / 29 / 2025, p. 40 / 101 29 / 41 in the same way as in Example 1, except that the RPE65 gene (2,605 bp; GenBank accession number NM_000329.3) was introduced instead of the GFP gene. Example 5. Preparation of an AAV vector including an asymmetrically modified ITR for TPP1 gene expression.

[130] An AAV complex, including an asymmetrically modified ITR, to express a TPP1(CLN2) gene was prepared in the same manner as in Example 1, except that the TPP1(CLN2) gene (1,693 bp; GenBank accession number NM_000391.4) was introduced instead of the GFP gene. Example 6. Preparation of an AAV vector including an asymmetrically modified ITR, for FVIII gene expression.

[131] An AAV complex, including an asymmetrically modified ITR, to express an FVIII gene was prepared in the same manner as in Example 1, except that the FVIII gene (673 bp; GenBank accession number NM_000132.4) was introduced instead of the GFP gene. Comparative Examples Comparative Example 1. Preparation of an AAV complex including symmetrically unmodified ITR, for GFP gene expression.

[132] An AAV complex including an unmodified symmetric ITR was prepared in the same manner as in Example 1-1, except that one clamp structure of the ITR was not modified.

[133] The AAV vector including an unmodified symmetric ITR as in Comparative Example 1 was named pAAV-WT ITR (abbreviated as pAAV-WT).

[134] FIG. 3B is a schematic diagram of an AAV vector genome including unmodified symmetric ITR from Comparative Example 1. Comparative Example 2. Preparation of an AAV complex including symmetrically modified ITR, for GFP gene expression. Petition 870250120586, dated 12 / 29 / 2025, page 41 / 101 30 / 41

[135] An AAV complex to express a GFP gene, including an ITR modified so that both ends are symmetrical to each other, was prepared in the same manner as in Example 1-2, except that a C-C'-B'-RBE sequence was deleted from both ends of the ITR of the AAV complex prepared in Example 1-1.

[136] The AAV vector including a symmetrically modified ITR as in Comparative Example 2 was named pAAV-BC del. ITR (abbreviated as pAAV-BC del).

[137] FIG. 3C is a schematic diagram of an AAV vector genome including a symmetrically modified ITR from Comparative Example 2. Comparative Example 3. Preparation of an AAV complex including unmodified symmetric ITR for luciferase gene expression.

[138] An AAV complex to express a luciferase gene, including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that a luciferase gene was introduced instead of a GFP gene. Comparative Example 4. Preparation of an AAV complex including symmetrically modified ITR for luciferase gene expression.

[139] An AAV complex to express a luciferase gene, including a symmetrically modified ITR, was prepared in the same manner as in Comparative Example 2, except that a luciferase gene was introduced instead of a GFP gene. Comparative Example 5. Preparation of an AAV complex including unmodified symmetric ITR, for TP53 gene expression.

[140] An AAV complex to express a TP53 gene, including an unmodified symmetric ITR, was prepared in the same way as in Example Petition 870250120586, dated 12 / 29 / 2025, p. 42 / 101 31 / 41 Comparison 1, except that a TP53 gene was introduced instead of a GFP gene. Comparative Example 6. Preparation of an AAV complex including symmetrically modified ITR, for TP53 gene expression.

[141] An AAV complex to express a TP53 gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that a TP53 gene was introduced instead of a GFP gene. Comparative Example 7. Preparation of an AAV complex including unmodified symmetric ITR, for RPE65 gene expression.

[142] An AAV complex to express an RPE65 gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that an RPE65 gene was introduced instead of a GFP gene. Comparative Example 8. Preparation of an AAV complex including symmetrically modified ITR, for RPE65 gene expression.

[143] An AAV complex to express an RPE65 gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that an RPE65 gene was introduced instead of a GFP gene. Comparative Example 9. Preparation of an AAV complex including unmodified symmetric ITR, for TPP1 gene expression.

[144] An AAV complex to express a TPP1 gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that a TPP1 gene was introduced instead of a GFP gene. Comparative Example 10. Preparation of AAV complex including ITR Petition 870250120586, dated 12 / 29 / 2025, p. 43 / 101 32 / 41 symmetrically modified, for TPP1 gene expression.

[145] An AAV complex to express a TPP1 gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that a TPP1 gene was introduced instead of a GFP gene. Comparative Example 11. Preparation of an AAV complex including unmodified symmetric ITR, for FVIII gene expression.

[146] An AAV complex to express an FVIII gene, the AAV complex including an unmodified symmetric ITR, was prepared in the same manner as in Comparative Example 1, except that an FVIII gene was introduced instead of a GFP gene. Comparative Example 12. Preparation of an AAV complex including symmetrically modified ITR, for FVIII gene expression.

[147] An AAV complex to express an FVIII gene, the AAV complex including a symmetrically modified ITR was prepared in the same way as in Comparative Example 2, except that an FVIII gene was introduced instead of a GFP gene. Experimental Examples Experimental Example 1. Confirmation of AAV complex productivity.

[148] The productivity of a recombinant AAV complex according to an embodiment was confirmed.

[149] Specifically, the AAV complexes prepared in Examples 1 to 6 and Comparative Examples 1 to 12 were transfected into 293T cells, which are human embryonic kidney cells (HEKs). In this regard, a molar ratio of the HEK293 cell line: REP / CAP plasmid (Agilent): The AAV complex was established as 1:1:1, and a commonly used method of AAV production Petition 870250120586, dated 12 / 29 / 2025, page 44 / 101 The 33 / 41 method used in the technique was followed. AAV produced from HEK293 lysate was obtained by ultracentrifugation, and then the amounts of viral proteins (VPs) and viral genomes were quantified by Western blot (WB) and qPCR, respectively. #1, #2, and #3 of the qPCR are biological replicates.

[150] FIG. 4 presents the Western blot results confirming the AAV productivity of Example 1 (GC), Comparative Example 1 (WT) and Comparative Example 2 (BC-del) for GFP gene expression.

[151] FIG. 5 presents the results of qPCR viral genome quantification confirming AAV productivity of Example 1 (pAAV-GC), Comparative Example 1 (pAAV-WT) and Comparative Example 2 (pAAV-BC del) for GFP gene expression.

[152] FIG. 6 presents the results of qPCR viral genome quantification confirming the productivity of AAV from the pAAV-GC vector, the pAAV-WT vector and the pAAV-BC del vector to express several genes (GFP, Luciferase, TP53, RPE65, TPP1 or FVIII).

[153] As a result, as shown in FIGS. 4 to 6, it was confirmed that the pAAV-GC vector had remarkably high AAV productivity even when several genes were introduced, compared with the pAAVWT vector and the pAAV-BC del vector.

[154] Therefore, it was found that, as the pAAV-GC vector, including the asymmetrically modified ITR, partially omits a self-replication process in the host cell, the packaging efficiency into viral particles increases within the same production period and, therefore, the productivity of the pAAV-GC vector was improved compared to existing AAV delivery vehicles, due to the increased self-replication efficiency. Experimental Example 2. Confirmation of gene expression rate of Petition 870250120586, dated 12 / 29 / 2025, page 45 / 101 34 / 41 AAV complex 2-1. Confirmation of GFP gene expression rate

[155] An expression rate of a target gene of a recombinant AAV complex was confirmed according to one modality. Specifically, HEK293, a cell line derived from normal fetal kidney, was infected respectively with the same amount of AAV complexes (Example 1, Comparative Example 1 or Comparative Example 2). After 72 hours, the GFP signals expressed by the cells were photographed using an inverted fluorescence microscope. Then, each cell was disrupted to purify the proteins, the samples were loaded onto an SDS page gel, and the GFP gene expression rates were confirmed by Western blotting. The Western blot band intensities were quantified using ImageJ software. The degree of detection of the GFP protein in the sample treated with pAAV-GC vectors having the strongest band intensity was established as 100%, and each gene expression rate was quantified as a relative value.Two biological replicates were used for each group.

[156] FIG. 7 presents the results of the confirmation of the expression of a transgene GFP in AAV complexes according to the ITR types (ITR WT, ITR BC del or ITR GC), by Western blot.

[157] Table 3 shows the results of the quantification of the relative expression rates (%) of the GFP transgene in AAV complexes according to the ITR types. [Table 3] Type of ITR Relative Expression Rate (%) pAAV-WT (Comparative Example 1) 29.52 pAAV-WT (Comparative Example 1) 30.02 pAAV-BC del (Comparative Example 2) 35.85 pAAV-BC del (Comparative Example 2) 43.63 pAAV-GC (Example 1) 97.68 pAAV-GC (Example 1) 100 Petition 870250120586, dated 12 / 29 / 2025, page 46 / 101 35 / 41

[158] As a result, as shown in FIG. 7 and Table 3, it was confirmed that the expression rate of the GFP gene was remarkably high when the pAAV-GC vector (Example 1) was used, compared to when the pAAV-WT vector (Comparative Example 1) and the pAAV-BC del vector (Comparative Example 2) were used. 2-2. Confirmation of expression rates of various genes

[159] Experiments were performed to confirm the expression rates of several GFP transgenes, luciferase, TP53, RPE65, TPP1 and FVIII using Examples 1 to 6 and Comparative Examples 1 to 12 in the same manner as in Experimental Example 2-1.

[160] For the GFP and luciferase genes, the same cell line used in Experimental Example 2-1 was used. For the TP53, TPP1, RPE65, and FVIII genes, HEK293 cells in which each gene was knocked out using CRISPR / Cas9 (Synthego, USA) were used to eliminate the effects of endogenous genes present exclusively in target cells.

[161] After confirming that endogenous gene expression did not occur in the cell line, the cells were cultured in a 6-well cell culture plate. The concentration of a viral solution was adjusted so that 1.0 X 108 viral particles were treated per 1.0 X 105 cells, and the viral solution was applied to the cells. Two days after treatment with AAV, the proteins expressed from each introduced gene were detected by Western blot (WB). In this regard, the antibodies used were the following: GFP (Invitrogen A-11122), luciferase (Invitrogen PA1-179), TP53 (MA5-14067), TPP1 (PA5-102819), RPE65 (MA1-16578) and FVIII (PA5-104451). The WB band intensities were quantified using ImageJ software. The resulting pAAV-GC band was considered 100%, and the pAAV-WT and pAAV-BC del bands were quantified as relative values. Three biological replicates were... Petition 870250120586, dated 12 / 29 / 2025, page 47 / 101 36 / 41 used for each group.

[162] Table 4 presents the results of the quantification of the relative expression rates (%) of a transgene in AAV complexes according to the ITR types (pAAV-GC, pAAV-BC del or pAAV-WT).

[163] FIG. 8 shows the relative expression rates (%) of a transgene in AAV complexes according to ITR types (pAAV-GC, pAAV-BC del or pAAV-WT). [Table 4] GFP Luciferase TP53 RPE65 TPP1 FVIII pAAV-GC 100 100 100 100 100 100 pAAV-GC 97.7 98.2 97.5 98.4 99.8 98.5 pAAV-GC 99.4 92.4 96.5 98.6 97.1 95.8 pAAV-BC del 35.9 11.4 22.3 7.8 17.4 19.5 pAAV-BC del 37.8 14.5 19.5 8.8 16.6 17.4 pAAV-BC del 43.6 12.7 18.9 7.9 18.9 17.1 pAAV-WT 29.5 4.8 23.4 5.7 21.5 13.8 pAAV-WT 30.1 4.5 11.8 6.8 19.8 11.1 pAAV-WT 28.9 7.4 19.4 4.9 23.5 16.4

[164] As a result, as shown in Table 4 and FIG. 8, the expression rates of all transgenes were approximately 2 times to approximately 10 times higher when the pAAV-GC vector including the asymmetrically modified ITR was used, compared to when the pAAV-WT vector including the unmodified symmetric ITR and the symmetrically modified pAAV-BC del vector were used.

[165] Consequently, the pAAV-GC vector including the asymmetrically modified ITR was found to be usable as a delivery vehicle platform with significantly increased transgenic expression efficiency for delivering multiple transgenes into target cells. Experimental Example 3. Confirmation of AAV complex genotoxicity 3-1. Confirmation of transgene GFP insertion into the chromosome Petition 870250120586, dated 12 / 29 / 2025, page 48 / 101 37 / 41 host

[166] An experiment was performed to confirm that a transgene is not recombined with a target cell chromosome when the recombinant AAV complex according to an embodiment is used.

[167] Specifically, H460 cells were infected with pAAV-GC (Example 1), pAAV-WT (Comparative Example 1) and pAAV-BC del (Comparative Example 2) carrying a GFP gene, respectively. GFP-expressing cells were isolated and the same number of cells were inoculated into a culture plate. The cells were subcultured by dilution at a rate of 1 / 3 every 3 days, and the genetic transmission of the GFP gene to the next generation was confirmed by monitoring the expression rates of the GFP gene.

[168] FIG. 9A shows the results of obtaining images of GFP expression using a fluorescence microscope at passages number P3 and P10.

[169] Table 5 presents the results of the confirmation of the ratios of cells expressing GFP in cultures with subculture passage numbers from P1 to P10. [Table 5] P1 P2 P3 P4 P5 P6 P7 P8 P9 P10 pAAV-GC (Example 1) 99.000% 32.870% 11.230% 3.760% 1.040% 0.230% 0.014% 0.005% 0.002% 0.001% pAAV-BC del. (Comparative Example 2) 99.000% 33.020% 10.990% 3.880% 1.100% 0.180% 0.190% 0.250% 0.350% 0.530% pAAV-WT ITR (Comparative Example 1) 99.000% 32.960% 11.340% 3.650% 1.080% 0.220% 0.210% 0.310% 0.410% 0.580%

[170] FIG. 9B presents the results of the schematization of Table 4 in which the ratios of cells expressing GFP are quantified. Petition 870250120586, dated 12 / 29 / 2025, page 49 / 101 38 / 41

[171] As a result, as shown in FIGS. 9A and 9B and in Table 5, the expression of GFP, a transgene, was very rarely observed in cells infected with the pAAV-GC vector (Example 1) after P7. On the other hand, it was confirmed that GFP, a transgene, was continuously observed in cells infected with the pAAV-WT vector (Comparative Example 1) or the pAAV-BC del vector (Comparative Example 2).

[172] Consequently, it was confirmed that the genotoxicity of the genes transferred to the next generation was significantly reduced in the AAV complex of Example 1 compared to the AAV complexes of Comparative Examples 1 and 2. 3-2. Confirmation of the insertion of multiple transgenes into the host chromosome.

[173] Experiments were performed to confirm the insertion of several GFP transgenes, luciferase, TP53, RPE65, TPP1 and FVIII into a host chromosome using Examples 1 to 6 and Comparative Examples 1 to 12 in the same manner as in Experimental Example 3-1.

[174] For the GFP and luciferase genes, the same cell line used in Experimental Example 3-1 was used. For the TP53, TPP1, RPE65, and FVIII genes, HEK293 cells in which each gene was knocked out using CRISPR / Cas9 (Synthego, USA) were used to eliminate the effects of endogenous genes present exclusively in the target cells.

[175] After confirming that endogenous gene expression did not occur in the cell line, the proteins expressed from each gene introduced by the AAV were detected by Western blotting. In this sense, the following antibodies were used: GFP (Invitrogen A-11122), luciferase (Invitrogen PA1179), TP53 (MA5-14067), TPP1 (PA5-102819), RPE65 (MA1-16578) and FVIII (PA5104451). The WB band intensities were quantified using the software Petition 870250120586, dated 12 / 29 / 2025, page 50 / 101 39 / 41 Image J. The resulting pAAV-WT band was considered 100%, and the pAAV-GC and pAAV-BC del bands were quantified as relative values.

[176] Table 6 shows the results (%) of the relative gene expression levels in a subculture passage number P7. [Table 6] GFP Luciferase TP53 RPE65 TPP1 FVIII pAAV-GC 1.4 0 7.4 5.1 2.2 2.4 pAAV-BC del 94.7 88.2 92.4 74.1 81.7 95.4 pAAV-WT 100 100 100 100 100 100

[177] FIG. 10 presents the result of the schematization of Table 5 quantifying the relative levels of gene expression in P7.

[178] As a result, as shown in Table 6 and FIG. 10, transgene expression was very rarely observed in cells infected with the pAAV-GC vector in P7. On the other hand, it was confirmed that transgene expression was continuously observed in cells infected with the pAAV-WT vector or the pAAV-BC del vector.

[179] Therefore, it was confirmed that the pAAV-GC vector including an asymmetrically modified ITR had significantly reduced genotoxicity in the transfer of a transgene to the next generation compared to the pAAV-WT vector including an unmodified symmetric ITR and the symmetrically modified pAAV-BC del vector. 3-3. Determining whether the transgene forms concatemers in target cells

[180] An experiment was performed to determine whether a concatemer, found when a transgene is inserted into a host chromosome, is formed when the transgene is released to the host cell using an AAV vector.

[181] Specifically, in P7 of Experimental Example 3-1, DNA was extracted from each of the cells expressing GFP. The extracted DNA was amplified by PCR and subjected to electrophoresis to identify a form Petition 870250120586, dated 12 / 29 / 2025, page 51 / 101 40 / 41 remaining DNA transferred to the host cell.

[182] FIG. 11 shows the results of PCR amplification confirming the presence or absence of concatemer formation of a transgene in the host cell.

[183] ​​As a result, as shown in FIG. 11, it was confirmed that the pAAV-GC vector (Example 1), in which a hairpin structure was absent in an ITR, failed to form a concatemer, which is a well-known characteristic of AAV vectors. On the other hand, in the cases of the pAAVWT vector (Comparative Example 1) and the pAAV-BC del vector (Comparative Example 2), in which both ITRs have a hairpin structure, the transgenes were observed in various polymer forms, such as monomers, dimers, or concatemers.

[184] Consequently, it was confirmed that when pAAV-GC vectors were used, the transgenes did not form a concatemer structure in the host cell and thus integration into the host cell chromosome was suppressed.

[185] Overall, it was observed that the pAAV-GC vector including an asymmetrically modified ITR is suitable as a delivery vehicle for high-efficiency expression of a transgene in a short period of time, while suppressing long-term expression of the transgene in the host cell.

[186] The above description of the present disclosure is for illustrative purposes, and those skilled in the art to which the present disclosure pertains will be able to understand that the examples and embodiments can be easily modified without altering the technical idea or the essential attributes of the disclosure. Therefore, it should be understood that the above examples are not limiting, but illustrative in all respects. Petition 870250120586, dated 12 / 29 / 2025, page 52 / 101 41 / 41

[187] It should be understood that the embodiments described in the present invention are to be considered only in a descriptive sense and not for purposes of limitation. Descriptions of attributes or aspects within each embodiment should typically be considered as available to other similar attributes or aspects in other embodiments. Although one or more embodiments have been described with reference to the figures, it will be understood by those skilled in the art that various alterations in form and detail may be made without departing from the spirit and scope of the disclosure, as defined by the following claims. Petition 870250120586, dated 12 / 29 / 2025, p. 53 / 101

Claims

1 / 2 CLAIMS 1. Adeno-associated virus (AAV) complex, characterized in that it comprises a polynucleotide sequence encoding a transgene between a first inverted terminal repeat (ITR) and a second ITR, wherein, in either of the first and second ITRs, all or part of a stem-loop structure, which is formed by rep linking element (RBE) regions, RBE', A, A', B, B', C, C' and D, is modified.

2. Adeno-associated virus complex according to claim 1, characterized in that it further comprises an operatively linked promoter, a polynucleotide sequence encoding a transgene, and a polyadenylation sequence between the first ITR and the second ITR.

3. Adeno-associated virus complex according to claim 1, characterized in that the AAV is of an AAV serotype selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12.

4. Adeno-associated virus complex according to claim 1, characterized in that the first ITR is not modified and the second ITR is modified.

5. Adeno-associated virus complex according to claim 1, characterized in that the stem-loop structure modification is at least one of an insertion, a deletion, or a substitution.

6. Adeno-associated virus complex according to claim 1, characterized in that either of the first ITR and the second ITR is modified so as not to form a stem-loop structure.

7. Adeno-associated virus complex according to claim 1, characterized in that in either of the first and second ITRs, all regions B, B', C, C' and RBE' are deleted, as well as region A or A', whichever is closest to the 3' end of the (+) strand of the transgene or the 5' end of the (-) strand of the transgene is deleted.

8. Adeno-associated virus complex according to claim 1, characterized in that either of the first ITR and the second ITR comprises a terminal resolution site (trs) sequence and an RBE sequence.

9. Adeno-associated virus complex according to claim 2, characterized in that the promoter is a tissue-specific promoter.

10. Adeno-associated virus complex according to claim 1, characterized in that the transgene is a therapeutic gene.

11. Adeno-associated virus complex according to claim 1, characterized in that the transgene is GFP, Luciferase, TP53, RPE65, TPP1 or FVIII.

12. Use of the adeno-associated virus complex defined in claim 1, characterized by the fact that it is for the manufacture of a gene therapy drug.

13. Composition, characterized in that it comprises the adeno-associated virus complex defined in claim 1.

14. Composition according to claim 13, characterized in that it further comprises a pharmaceutically acceptable carrier.

15. Composition according to claim 13, characterized in that it is for delivering a therapeutic gene for gene therapy. Petition 870250120586, dated 12 / 29 / 2025, pp. 96 / 101

Images