Method for inhibiting the nitrification process in soil.

Description

1 / 21 METHOD FOR INHIBITING THE NITRIFICATION PROCESS IN SOIL Field of invention

[001] The invention relates to a method for inhibiting the nitrification process in soil, wherein one or more miRNAs are applied to the soil to inhibit the expression of one or more genes that participate in the nitrification process in said soil, such as genes encoding the AMO (Ammonia Monooxygenase) enzyme and / or the HAO (Hydroxylamine Oxidoreductase) enzyme. The invention also relates to a fertilizer composition comprising a fertilizer or an additive and one or more miRNAs. State of the Art

[002] In nature, due to biogeochemical processes, the oxidation state of nitrogen (N) varies considerably, ranging from -3 to +5, resulting in the formation of many nitrogen species, in N2 O5, HNO3 , HNO3 , NO2 , N2 O4 , HNO2 , HNO2 , NO, N2O, N2 , NH3 , NH4+, NH4 Cl and CH3NH2 [1].

[003] Nitrification is a biological process by which nitrates are produced in the environment. This occurs in several distinct stages, each under the action of different microorganisms:

[004] Step 1) Ammonia-oxidizing bacteria (i.e., AOB, such as Nitrosomonas spp. and Nitrosococcus spp. initiate the nitrification process by oxidizing ammonia (NH3) to hydroxylamine (NH2OH). This step is catalyzed by the enzyme AMO (Ammonia Monooxygenase).

[005] Step 2) AOBs oxidize NH2OH to nitrite (NO2-) via the enzyme HAO (hydroxylamine oxidoreductase). Petition 870250090381, dated 03 / 10 / 2025, pp. 75 / 101 2 / 21

[006] Step 3) Nitrite-oxidizing bacteria (i.e., NOB, such as Nitrobacter spp.) complete the nitrification process by producing nitrate (NO3-) through the enzyme HAO (hydroxylamine oxidoreductase).

[007] Nitrification results in the loss of about one fifth of the nitrogen applied to the soil through the leaching of NO3 and the emission of nitrous oxide (N2O) [2]. Nitrification leads to increased agricultural production costs, environmental pollution [3], human and animal diseases [4], ozone layer depletion and the emission of greenhouse gases, greenhouse gases that contribute to climate change [5]. About 97% of N2O emissions in cropping systems are attributed to the nitrification process [6].

[008] Therefore, controlling the nitrification process has become an important issue in agriculture in recent decades.

[009] Currently, the control of nitrification in the soil by the farmer is mainly carried out by the use of synthetic nitrification inhibitors. These comprise a wide range of compounds, such as dicyandiamide (DCD), 2-chloro-6-(trichloromethyl)-pyridine (Nitrapyrin), 3,4-dimethylpyrazole phosphate (DMPP) [7], allylthiourea [8], 2-amino-4-chloro6-methylpyrimidine [9], etc.

[010] However, the use of these synthetic inhibitors has been limited due to the high cost which limits their large-scale use, their limited availability

[10] , their non-targeted effect causing adverse effects on beneficial microorganisms present in the soil

[11] and due to the environmental pollution they cause, particularly in aquatic ecosystems [2]

[10] .

[011] In a context where environmental protection is an important social issue, it is important to develop natural and ecologically sound methods that can inhibit nitrification in the soil. Petition 870250090381, dated 03 / 10 / 2025, pp. 76 / 101 3 / 21

[012] The inventors then developed a new strategy to inhibit nitrification genes, showing that certain miRNAs had the property of inhibiting the nitrification process in the soil.

[013] The invention, which finds application in the field of agriculture, relates to the discovery of microRNAs (miRNAs) with the ability to inhibit mRNAs from different bacterial genera responsible for regulating the nitrification process in soils (hereinafter, the invention). In particular, miRNAs have been identified with the ability to inhibit mRNAs encoding the AMO and / or HAO enzymes, which would inhibit the nitrification process in soils. Summary of the invention

[014] A first object of the present invention relates to a method for inhibiting the nitrification process in soil, wherein one or more miRNAs of formula (I) are applied to the soil to inhibit the expression of one or more genes involved in the nitrification process in said soil: [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[015] A second object of the present invention relates to the use of a miRNA of formula (I) to inhibit the expression of one or more genes involved in the nitrification process: [Nucleotide]-[Central sequence]-[3' sequence] (I), Petition 870250090381, dated 03 / 10 / 2025, pp. 77 / 101 4 / 21 where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C, [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[016] A third object of the present invention relates to a composition comprising one or more isolated miRNA(s) of formula (I): [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[017] A fourth object of the present invention relates to a culture medium or a culture solution comprising one or more isolated miRNA(s) of formula (I) or a composition according to the invention. Detailed description

[018] Method or use for inhibiting the expression of one or more genes involved in the nitrification process.

[019] The present invention relates to a method for inhibiting the nitrification process in soil, wherein one or more miRNAs of formula (I) are applied to the soil to inhibit the expression of one or more genes involved in the nitrification process in said soil: Petition 870250090381, dated 03 / 10 / 2025, pp. 78 / 101 5 / 21 [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[020] The present invention also relates to the use of a miRNA of formula (I) to inhibit the expression of one or more genes that participate in the nitrification process: [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[021] The term soil refers to the substrate explored by the roots of cultivated plants. The term soil encompasses any type of substrate in which a plant can grow, such as artificial soil, cultivated agricultural soil, uncultivated agricultural soil, peat, potting soil, rockwool, or coconut fiber. The term soil, therefore, also encompasses growing media that can be used, in particular, for cultivation termed soilless, for example, in pots. Petition 870250090381, dated 03 / 10 / 2025, pp. 79 / 101 6 / 21

[022] The term “nitrification process inhibition” or “nitrification process inhibition” means a reduction of at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or at least 50% in the nitrification process compared to a reference condition. In the context of the invention, nitrification process inhibition is calculated by measuring the nitrification process in soil to which one or more miRNAs of formula (I) are applied and comparing it to soil to which one or more miRNAs of formula (I) have not been applied. A method for measuring the inhibition is detailed in the examples.

[023] The term inhibiting the expression of one or more genes or inhibition of the expression of one or more genes refers to the property of miRNAs to inhibit mRNAs of the gene(s) in question, thereby inhibiting the synthesis of proteins encoded by the inhibited genes in question. Advantageously, the inhibition is at least 2%, at least 3%, at least 4%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45% or at least 50% decrease in the expression of the gene(s) in question compared to a reference condition. In the context of the invention, the inhibition of the expression of one or more genes can be calculated by quantifying the proteins encoded by the inhibited genes and / or the corresponding mRNAs, implementing conventional techniques for the expert in the field, such as the ELISA method for protein quantification or RT-qPCR for mRNA quantification.The percentage of inhibition is calculated by measuring the inhibition of the expression of one or more genes in a soil to which one or more miRNAs of formula (I) are applied and comparing it with a soil to which one or more miRNAs of formula (I) were not applied. Petition 870250090381, dated 03 / 10 / 2025, pp. 80 / 101 7 / 21

[024] The term “microRNA” or “miRNA” refers to a short molecule of ribonucleic acid (RNA) that acts as a post-transcriptional regulator, regulating target mRNAs. A miRNA can be 20 to 24 nucleotides (nt) long, preferably 20 to 22 nt, for example, 20, 21 or 22 nt. The preparation of a miRNA does not present specific difficulties, for example, by conventional chemical synthesis.

[025] In specific embodiments, the miRNA of formula (I) is a synthetic miRNA, that is, it was synthesized in vitro, for example, by chemical synthesis. One can mention, for example, synthesis on a solid support by the phosphoramidite method. In vitro synthesis facilitates obtaining the desired quantities of miRNA of formula (I).

[026] In particular embodiments, the miRNA of formula (I) comprises 19 to 21 nucleotides, that is, 19 nucleotides, 20 nucleotides or 21 nucleotides.

[027] [Sequence 3'] corresponds to the 3' portion of the formula (I) miRNA sequence. This sequence may comprise 10, 11, 12, or 13 nucleotides. In specific embodiments, [Sequence 3'] comprises at least 80% homology with a nucleotide sequence selected from sequences SEQ ID NO: 9-16, preferably at least 85% homology, for example, at least 90% homology, at least 95% homology, at least 99% homology, or even 100% homology.

[028] When [Main Sequence] is SEQ ID NO: 1, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 9. When [Main Sequence] is SEQ ID NO: 2, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 10. When [Main Sequence] is SEQ ID NO: 3, [Sequence 3'] comprises Petition 870250090381, dated 03 / 10 / 2025, pages 81 / 101 8 / 21 preferably at least 80% homology with the nucleotide sequence SEQ ID NO: 11. When [Main Sequence] is SEQ ID NO: 4, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 12. When [Main Sequence] is SEQ ID NO: 5, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 13. When [Central Sequence] is SEQ ID NO: 6, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 14. When [Central Sequence] is SEQ ID NO: 7, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 15. When [Sequence [Central] is SEQ ID NO: 8, [Sequence 3'] preferably comprises at least 80% homology with the nucleotide sequence SEQ ID NO: 16.

[029] In specific embodiments, the formula miRNA (I) may be selected from sbi-miR162 (SEQ ID NO: 17), sbi-miR394a (SEQ ID NO: 18), sbi-miR397-5p (SEQ ID NO: 19), sbi-miR5386 (SEQ ID NO: 20), sbi-miR5388 (SEQ ID NO: 21), sbi-miR5568d-3p (SEQ ID NO: 22), sbimiR5568d-5p (SEQ ID NO: 23) and sbi-miR6232a-5p (SEQ ID NO: 24).

[030] A mixture of several formula (I) miRNAs, each with a distinct [Center Sequence], can be applied to the soil. In specific embodiments, two to eight formula (I) miRNAs, each with a distinct [Center Sequence], are applied to the soil. For example, a mixture of two, three, four, five, six, seven, or eight formula (I) miRNAs, each with a distinct [Center Sequence], is applied to the soil. For example, it could be a mixture comprising sbi-miR162 (SEQ ID NO: 17), sbi-miR394a (SEQ ID NO: 18), sbi-miR397-5p (SEQ ID NO: 19), sbimiR5386 (SEQ ID NO: 20), sbi-miR5388 (SEQ ID NO: 21), sbi-miR5568d Petition 870250090381, dated 03 / 10 / 2025, pp. 82 / 101 9 / 21 3p (SEQ ID NO: 22), sbi-miR5568d-5p (SEQ ID NO: 23) and sbi-miR6232a5p (SEQ ID NO: 24).

[031] The miRNA of formula (I) inhibits the expression of a gene encoding the enzyme Ammonia Monooxygenase (AMO) and / or inhibits the expression of a gene encoding the enzyme Hydroxylamine Oxidoreductase (HAO). In particular, the miRNA of formula (I) is capable of targeting one or more mRNAs encoding AMO and / or one or more mRNAs encoding AHO, thereby inhibiting the translation of target mRNAs into proteins. Thus, in a preferred embodiment, the aforementioned gene(s) participating in the nitrification process in the aforementioned soil encode(s) the enzyme Ammonia Monooxygenase (AMO) and / or the enzyme Hydroxylamine Oxidoreductase (HAO).

[032] In the context of the present invention, one or more genes that participate in the nitrification process in the soil are expressed by one or more bacteria present in the soil, in particular ammonia-oxidizing bacteria (AOB) and / or nitrite-oxidizing bacteria (NOB), preferably one or more soil bacteria selected from Nitrosomonas spp., Nitrosospira spp. and Nitrosococcus spp., for example selected from Nitrosomonas europaea, Nitrosomonas eutropha C-91, Nitrosomonas communis Nm2, Nitrosospira multiformis and Nitrosospira lacus APG3. The miRNA of formula (I) therefore has the property of inhibiting the nitrification activity of microorganisms involved in the nitrification process in the soil, in particular ammonia-oxidizing bacteria (AOB) and / or nitrite-oxidizing bacteria (NOB).

[033] The formula miRNA (I) can be applied to the soil in an amount ranging from 1 g / ha to 1000 g / ha.

[034] In a specific embodiment, the formula miRNA (I) can be applied to the soil with a fertilizing agent, for example, a solid or liquid fertilizer, an additive and / or a biostimulant. This can be, for example, Petition 870250090381, dated 03 / 10 / 2025, pp. 83 / 101 10 / 21 example, a nitrogen fertilizer. The formula (I) miRNA can inhibit the nitrification of a nitrogen fertilizer applied to the soil, for example, a nitrogen fertilizer applied to the soil before, concurrently with, or after the miRNA. Thus, the formula (I) miRNA and the nitrogen fertilizer can be applied to the soil simultaneously or sequentially. For example, the formula (I) miRNA can be applied to the soil during a first treatment, and the nitrogen fertilizer can be applied to the soil during a second treatment. Thus, several successive soil treatments can be carried out. Generally, the person skilled in the art adapts the number of treatments and the nature of the treatment, for example, depending on the nature of the soil and / or the plant cultivated in the soil.

[035] The method or use according to the invention finds application in the treatment of soils in which a wide variety of plants can be planted. Among these plants, mention will be made, in particular: - large-scale crops, such as cereals (wheat, corn, barley), - protein crops (peas), - oilseeds (soybeans, sunflowers), - solanaceous crops (potatoes), - Amaranthaceae crops (beetroot), - specialized crops, such as horticulture (lettuce, spinach, onion, shallot, tomato, melon), vines, arboriculture (pear, apple, nectarine) or horticulture.

[036] In particular, the plant may belong to the order of Monocotyledons, preferably within the Poaceae family. Poaceae, commonly called grasses, includes most species commonly referred to as grasses and cereals. Cereals are widely cultivated, primarily for their grains, and are used in... Petition 870250090381, dated 03 / 10 / 2025, pp. 84 / 101 11 / 21 human and animal feed. Advantageously, the plant is a Poaceae, preferably selected from wheat, rice, barley, oats, rye, sugar cane, meadow or corn, preferably wheat.

[037] In specific embodiments, miRNA is an isolated miRNA.

[038] Thus, in particular embodiments, the invention relates to a method for inhibiting the nitrification process in soil, wherein one or more isolated miRNAs of formula (I) are applied to the soil to inhibit the expression of one or more genes that participate in the nitrification process in said soil: [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from the sequences SEQ ID NO: 1-8.

[039] Likewise, in particular embodiments, the present invention relates to the use of an isolated miRNA of formula (I) to inhibit the expression of one or more genes that participate in the nitrification process: [Nucleotide]-[Central sequence]-[3' sequence] (I), where: [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and Petition 870250090381, dated 03 / 10 / 2025, pp. 85 / 101 12 / 21 [Central sequence] corresponds to a nucleotide sequence selected from the sequences SEQ ID NO: 1-8.

[040] An isolated miRNA corresponds to a miRNA isolated from its natural environment. For example, the miRNA can be isolated from a living organism that contains said miRNA, such as a plant or an alga, for example, by implementing an extraction method. Methods for microRNA extraction are described in the literature and their implementation does not present specific difficulties for the specialist in the area. One can mention, for example, extraction with a solvent, such as water, a hydrophilic solvent, or a combination of these.

[041] Isolated miRNA can also be synthesized chemically. This is known as synthetic miRNA. Methods for the chemical synthesis of nucleic acids are widely described in the literature, and their implementation does not present specific difficulties for specialists in the field.

[042] miRNA (or miRNA alone) may be in the form of a composition, for example, a composition comprising said miRNA and an excipient. The excipient may be chosen for its ability to stabilize the miRNA in the soil, thereby reducing miRNA degradation in the soil. The composition may comprise from 0.01% to 99% by weight of said miRNA. When the miRNA is isolated from a plant or algae, the composition may be in the form of a plant extract or algae extract. Composition and culture medium

[043] The invention also relates to a composition comprising one or more isolated miRNA(s) of formula (I): [Nucleotide]-[Central sequence]-[3' sequence] (I), where: Petition 870250090381, dated 03 / 10 / 2025, pp. 86 / 101 13 / 21 [Nucleotide] corresponds to a nucleotide selected from A, U, G, or C. [sequence 3'] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8.

[044] In specific embodiments, the composition according to the invention further comprises a fertilizing agent. The fertilizing agent may be a fertilizer, an additive and / or a biostimulant.

[045] In particular embodiments, [Sequence 3'] comprises at least 80% homology with a nucleotide sequence selected from sequences SEQ ID NO: 9-16, preferably at least 85% homology, for example, at least 90% homology, at least 95% homology, at least 99% homology or even 100% homology.

[046] In specific embodiments, the miRNA is selected from sbi-miR162 (SEQ ID NO: 17), sbi-miR394a (SEQ ID NO: 18), sbi-miR3975p (SEQ ID NO: 19), sbi-miR5386 (SEQ ID NO: 20), sbi-miR5388 (SEQ ID NO: 21), sbi-miR5568d-3p (SEQ ID NO: 22), sbi-miR5568d-5p (SEQ ID NO: 23) and sbi-miR6232a-5p (SEQ ID NO: 24).

[047] The composition according to the invention may be in solid form, for example, in the form of granules or powder, or in liquid form, for example, in the form of an aqueous solution. For example, the composition according to the invention may be in the form of granules impregnated or coated with miRNA of formula (I).

[048] miRNA can be a miRNA extracted from a living organism known to contain said miRNA or a synthetic miRNA, as described above. Petition 870250090381, dated 03 / 10 / 2025, pp. 87 / 101 14 / 21

[049] The composition may comprise an excipient that stabilizes the miRNA in the soil, thereby reducing miRNA degradation in the soil. The composition may comprise from 0.01% to 99% by weight of said miRNA.

[050] Fertilizer can be of natural or synthetic origin. In one type, the fertilizer is nitrogen-based. A nitrogen fertilizer must supply at least nitrogen (N) as a nutrient.

[051] In specific forms, nitrogen fertilizer contains ammonium, ammonia and / or urea. Examples of fertilizers containing ammonium are calcium ammonium nitrate, calcium ammonium nitrate, ammonium sulfate nitrate, ammonium sulfate and ammonium phosphate. An example of a fertilizer containing ammonia is ammonium nitrate.

[052] Nitrogen fertilizer can also supply other nutrients, such as potassium (K) and / or phosphorus (P). It can be an inorganic and / or organic fertilizer. For nitrogen fertilizers that supply N as well as P or K, one can mention the so-called NP or NK fertilizers, such as monoammonium phosphate or diammonium phosphate. For nitrogen fertilizers that supply N, P, and K, one can mention the so-called NPK fertilizers.

[053] The amendment can be an organic amendment or a mineral amendment, such as calcium carbonate.

[054] The composition according to the invention may also comprise micronutrients such as molybdenum, zinc, boron and copper. These elements are normally supplied in the form of water-soluble salts.

[055] The composition according to the invention may also comprise a solvent, a solid carrier, a dispersant or emulsifier, an organic or inorganic thickener, a pesticide, Petition 870250090381, dated 03 / 10 / 2025, pages 88 / 101 15 / 21 an antifreeze agent, an antifoaming agent, when appropriate, a dye, an adhesion agent or a binder.

[056] In specific embodiments, the composition according to the invention comprises a mixture of two to eight miRNAs of formula (I), each having a distinct [Central Sequence], for example, a mixture of two, three, four, five, six, seven or eight miRNAs of formula (I), each having a distinct [Central Sequence].

[057] In particular embodiments, the composition according to the invention is intended for culture media and / or culture solutions.

[058] Thus, another object of the present invention relates to a culture medium or a culture solution comprising one or more isolated miRNA(s) of formula (I) or a composition according to the invention.

[059] For the purposes of the present invention, the term “culture solution” means any solution that allows the cultivation of a plant, such as irrigation water, liquid solution intended for fertigation by sprinkling or drip irrigation, hydroponic bath or aeroponic solution. The term “culture medium” is defined above. Examples

[060] Example 1: miRNA to inhibit the biological nitrification process of Nitrosomonas europaea 25978

[061] Materials and methods

[062] The 8 miRNAs used in this example were prepared by chemical synthesis and correspond to the miRNAs shown in Table 1. Table 1: SEQ ID NO: miRNA Name Sequence 17 sbi-miR162 UCGAUAAACCUCUGCAUCCAG 18 sbi-miR394a UUGGCAUUCUGUCCACCUCC Petition 870250090381, dated 03 / 10 / 2025, pp. 89 / 101 16 / 21 23 sbi-miR397-5p sbi-miR5568d-5p UGGCUUUUCUAGAUACAUAGC 24 sbi-miR6232a-5p GUCGCUUUGACUUUUUUGG

[063] A liquid culture in a 500 mL flask containing 150 mL of Skinner and Walker (SW) medium

[12] was inoculated with Nitrosomonas europaea 25978 at a ratio of 1:100 (V / V) and cultured at 28 °C with agitation at 70 rpm until the OD 600 nm of the culture reached 0.3. The cell suspension was then dispensed into 20 mL volumes in 50 mL Falcon tubes.

[064] Subsequently, 1 qg of each of the 8 miRNAs in a volume of 15 liL of water was added to the bacterial cultures in three replicates and mixed gently. All cell suspensions, including control cells (treated with the same volume of deionized water without miRNA) and miRNA-treated cells, were cultured for 5 days with constant agitation at 28 °C.

[065] A nitrite test

[13] was performed on all samples at different intervals: 0h (immediately after the addition of miRNAs or deionized water) and 46h. For this purpose, the collected cells were centrifuged at 8,000 rpm for 10 minutes at 4°C and the supernatants were used for nitrite assay. Nitrite concentrations were measured colorimetrically at 540 nm using a microplate reader via Griess reagent

[13] . 100 μL of 30 mM sulfanilamide were added to each sample and mixed by pipetting up and down, then 100 μL of 12 mM N-(1-naphthyl)ethylenediamine dihydrochloride were added to the mixture. In parallel, standard nitrite samples between 0 and 100 μM using 1 mM NaNO2 were Petition 870250090381, dated 03 / 10 / 2025, pp. 90 / 101 17 / 21 prepared. The absorbance of all samples and standards was measured using a microplate reader (BMG labtech, Germany) at 540 nm.

[066] Results

[067] The results are presented in Table 2. Table 2: Time (hours) 0 46 Nitrite quantity (μM) Control 12.28 ± 0.13 47.24 ± 1.35 Treatment with miRNA mixture 12.28 ± 0.26 42.21 ± 3.88 References

[068] [1] Hanrahan, G., & Chan, G. (2005). NITROGEN. Encyclopedia of Analytical Science: Second Edition, 191-196. https: / / doi.org / 10.1016 / B0-12-369397-7 / 00401-5.

[069] [2] Lin, B. le, Sakoda, A., Shibasaki, R., & Suzuki, M. (2001). A modeling approach for global nitrate leaching caused by anthropogenic fertilization. Water Research, 35(8). https: / / doi.org / 10.1016 / S0043-1354(00)00484-X.

[070] [3] Anas, M., Liao, F., Verma, K.K., Sarwar, M.A., Mahmood, A., Chen, ZL, Li, Q., Zeng, XP, Liu, Y., & Li, YR (2020). Nitrogen fate in agriculture and the environment: agronomic, ecophysiological, and molecular approaches to improve nitrogen use efficiency. Biological Research 2020 53:1, 53(1), 1-20. https: / / doi.org / 10.1186 / S40659-020- 00312-4.

[071] [4] Ma, L., Hu, L., Feng, X., & Wang, S. (2018). Nitrate and nitrite in health and disease. Aging and Disease, 9(5), 938. https: / / doi.org / 10.14336 / AD.2017.1207. Petition 870250090381, dated 03 / 10 / 2025, pp. 91 / 101 18 / 21

[072] [5] Portmann, R.W., Daniel, J.S., & Ravishankara, A.R. (2012). Stratospheric ozone depletion due to nitrous oxide: influences of other gases. Philosophical Transactions of the Royal Society B: Biological Sciences, 367(1593), 1256. https: / / doi.org / 10.1098 / RSTB.2011.0377.

[073] [6] Coskun, D., Britto, D. T., Shi, W., & Kronzucker, H. J. (2017). Nitrogen transformations in modern agriculture and the role of biological inhibition of nitrification. Nature Plants 2017 3:6, 3(6), 1-10. https: / / doi.org / 10.1038 / nplants.2017.74.

[074] [7] Beeckman, F., Motte, H., & Beeckman, T. (2018). Nitrification in agricultural soils: impact, actors and mitigation. Current Opinion in Biotechnology, 50, 166-173. https: / / doi.org / 10.1016ZJ.COPBIO.2018.01.014.

[075] [8] Tatari, K., Gülay, A., Thamdrup, B., Albrechtsen, H.J., & Smets, BF (2017). Challenges in the use of allylthiourea and chlorate as specific nitrification inhibitors. Chemosphere, 182, 301-305. https: / / doi.org / 10.1016 / J.CHEMOSPHERE.2017.05.005.

[076] [9] Kumar, R., Parmar, B. S., Walia, S., & Saha, S. (2015). Nitrification inhibitors: classes and their use in nitrification management. In Nutrient use efficiency: from basic to advanced (pp. 103-122). Springer, New Delhi. https: / / doi.org / 10.1007 / 978-81-322-2169-2_8.

[077]

[10] Sun, L., Lu, Y., Yu, F., Kronzucker, H.J., & Shi, W. (2016a). Inhibition of biological nitrification by rice root exudates and its relationship with nitrogen use efficiency. New Phytologist, 212(3), 646656. https: / / doi.org / 10.1111 / NPH.14057.

[078]

[11] Opoku, A., Chaves, B., & de Neve, S. (2014). Neem seed oil: a potent nitrification inhibitor to control nitrate leaching after incorporation of crop residues. Petition 870250090381, dated 03 / 10 / 2025, pp. 92 / 101 19 / 21 http: / / Dx.Doi.Org / 10.1080 / 01448765.2014.885394, 30(3), 145-152. https: / / doi.org / 10.1080 / 01448765.2014.885394.

[079]

[12] Skinner, FA and Walker, N. (1961). Growth of Nitrosomonas europaea in batch and continuous culture. Archives for Microbiology 1961 38:4, 38(4), 339-349.

[080]

[13] Keeney, DR, & Nelson, DW (1982). Nitrogen — Forms Inorganic. In: Methods of Soil Analysis Part 2: Chemical and Microbiological Properties, 2nd edition, Page AL, Miller R. H, Keeney DR(Eds) Agronomy 9 / 2, American Society of Agronomy, Madison, WI, 643-698. Petition 870250090381, dated 03 / 10 / 2025, pp. 93 / 101 20 / 21 Sequence listing Table 3: SEQ ID NO: Identification Sequence 1 sbi-miR162 (core) CGAUAAAC 2 sbi-miR394a (core) UGGCAUUC 3 sbi-miR397-5p (core) CAUUGAGU 4 sbi-miR5386 (core) GUCGCUGU 5 sbi-miR5388 (core) UCUUUGCC 6 sbi-miR5568d-3p (core) AAGUUGUG 7 sbi-miR5568d-5p (core) GGCUUUUC 8 sbi-miR6232a-5p (core) UCGCUUUG 9 sbi-miR162 (3') CUCUGCAUCCAG 10 sbi-miR394a (3') UGUCCACCUCC 11 sbi-miR397-5p (3') GCAGCGUUGAUG 12 sbi-miR5386 (3') CGCGCGCGCUG 13 sbi-miR5388 (3') GGGUGUCUCUGAC 14 sbi-miR5568d-3p (3') UAUCUAGAAAAG 15 sbi-miR5568d-5p (3') UAGAUACAUAGC 16 sbi-miR6232a-5p (3') ACUUUUUUGG 17 sbi-miR162 UCGAUAAACCUCUGCAUCCAG 18 sbi-miR394a UUGGCAUUCUGUCCACCUCC 19 sbi-miR397-5p UCAUUGAGUGCAGCGUUGAUG 20 sbi-miR5386 CGUCGCUGUCGCGCGCGCUG Petition 870250090381, dated 03 / 10 / 2025, pp. 94 / 101 21 / 21 21 sbi-miR5388 AUCUUUGCCGGGUGUCUCUGAC 22 sbi-miR5568d-3p AAAGUUGUGUAUCUAGAAAAG 23 sbi-miR5568d-5p UGGCUUUUCUAGAUACAUAGC 24 sbi-miR6232a-5p GUCGCUUUGACUUUUUUGG Petition 870250090381, dated 03 / 10 / 2025, pp. 95 / 101

Claims

1 / 4 CLAIMS 1. A method for inhibiting the nitrification process in soil, characterized by one or more miRNAs of formula (I) being applied to the soil to inhibit the expression of one or more genes that participate in the nitrification process in said soil: [Nucleotide]-[Central sequence]-[3' sequence] (I), wherein: [Nucleotide] corresponds to a nucleotide selected from A, U, G or C, [3' sequence] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a nucleotide sequence selected from sequences SEQ ID NO: 1-8, wherein one or more genes that participate in the nitrification process in soil are expressed by one or more bacteria present in said soil.

2. Use of a miRNA of formula (I) to inhibit the expression of one or more genes involved in the nitrification process in the soil: [Nucleotide]-[Central sequence]-[3' sequence] (I), wherein: [Nucleotide] corresponds to a nucleotide selected from A, U, G or C, [3' sequence] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a sequence of nucleotides selected from the sequences SEQ ID NO: 1-8, Petition 870250090381, dated 03 / 10 / 2025, page 96 / 101 2 / 4 characterized by one or more genes involved in the nitrification process in the soil being expressed by one or more bacteria present in said soil.

3. A method or use according to any of the preceding claims, characterized by one or more genes that participate in the nitrification process in the soil encoding the enzyme Ammonia Monooxygenase (AMO) and / or the enzyme Hydroxylamine Oxidoreductase (HAO).

4. A method or use according to any of the preceding claims, characterized in that one or more genes that participate in the nitrification process in the soil are expressed by one or more bacteria present in the soil selected from Nitrosomonas spp., Nitrosospira spp. and Nitrosococcus spp., for example, selected from Nitrosomonas europaea, Nitrosomonas eutropha C-91, Nitrosomonas communis Nm2, Nitrosospira multiformis and Nitrosospira lacus APG3.

5. Method or use according to any of the preceding claims, characterized in that the miRNA comprises 19 to 21 nucleotides.

6. A method or use according to any of the preceding claims, characterized in that the miRNA inhibits the nitrification of a nitrogen fertilizer applied to the soil, for example, a nitrogen fertilizer that is applied to the soil before, concurrently with, or after one or more miRNAs.

7. Method or use according to any of the preceding claims, characterized in that the [Sequence 3'] comprises at least 80% homology with a nucleotide sequence selected from sequences SEQ ID NO: 9-16, preferably at least 85% homology, for example at least 90% homology, Petition 870250090381, dated 10 / 03 / 2025, page 97 / 101 3 / 4 at least 95% homology, at least 99% homology or up to 100% homology.

8. Method or use according to any of the preceding claims, characterized in that the miRNA is selected from sbi-miR162 (SEQ ID NO: 17), sbi-miR394a (SEQ ID NO: 18), sbimiR397-5p (SEQ ID NO: 19), sbi-miR5386 (SEQ ID NO: 20), sbimiR5388 (SEQ ID NO: 21), sbi-miR5568d-3p (SEQ ID NO: 22), sbimiR5568d-5p (SEQ ID NO: 23) and sbi-miR6232a-5p (SEQ ID NO: 24).

9. Method or use according to any of the preceding claims, characterized by a mixture of two to eight miRNAs of formula (I), each having a distinct [Central Sequence], being applied to the soil, for example, a mixture of two, three, four, five, six, seven or eight miRNAs of formula (I), each having a distinct [Central Sequence].

10. Composition characterized by comprising one or more isolated miRNA(s) of formula (I): [Nucleotide]-[Central sequence]-[3' sequence] (I), wherein: [Nucleotide] corresponds to a nucleotide selected from A, U, G or C, [3' sequence] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a sequence of nucleotides selected from sequences SEQ ID NO: 1-8.

11. Composition according to claim 10, characterized by [Sequence 3'] comprising at least 80% homology with a nucleotide sequence selected from sequences SEQ ID NO: 9-16, preferably at least 85% homology, for example at least 90% homology, at least 95% homology, at least 99% homology or up to 100% homology.

12. Composition according to claim 10 or 11, characterized in that the miRNA is selected from sbi-miR162 (SEQ ID NO: 17), sbi-miR394a (SEQ ID NO: 18), sbi-miR397-5p (SEQ ID NO: 19), sbi-miR5386 (SEQ ID NO: 20), sbi-miR5388 (SEQ ID NO: 21), sbimiR5568d-3p (SEQ ID NO: 22), sbi-miR5568d-5p (SEQ ID NO: 23) and sbimiR6232a-5p (SEQ ID NO: 24).

13. Composition according to any one of claims 10 to 12, characterized by comprising a mixture of two to eight miRNAs of formula (I), each having a distinct [Central Sequence], for example, a mixture of eight miRNAs of formula (I), each having a distinct [Central Sequence].

14. Composition according to any one of claims 10 to 13, characterized by further comprising a fertilizing agent, for example, a fertilizer, an additive and / or a biostimulant.

15. Culture medium or culture solution characterized by comprising one or more isolated miRNA(s) of formula (I) or a composition according to any one of claims 10 to 14, [Nucleotide]-[Central sequence]-[3' sequence] (I), wherein: [Nucleotide] corresponds to a nucleotide selected from A, U, G or C, [3' sequence] corresponds to a sequence of 10 to 13 nucleotides, and [Central sequence] corresponds to a sequence of nucleotides selected from sequences SEQ ID NO: 1-8. Petition 870250090381, dated 10 / 03 / 2025, p. 99 / 101