PEPTIDE, COSMETIC COMPOSITION TO PROMOTE HAIR GROWTH OR IMPROVE HAIR LOSS, PHARMACEUTICAL COMPOSITION TO PREVENT OR TREAT HAIR LOSS, FOOD COMPOSITION TO PREVENT HAIR LOSS OR PROMOTE HAIR GROWTH AND USE OF THE PEPTIDE

Description

1 / 31 PEPTIDE, COSMETIC COMPOSITION TO PROMOTE GROWTH CAPILLARY OR TO IMPROVE HAIR LOSS, PHARMACEUTICAL COMPOSITION To prevent or treat hair loss, dietary composition to prevent hair loss or promote hair growth and use of peptides. FIELD OF TECHNIQUE

[0001] The present disclosure relates to a peptide that has hair growth promoting or hair loss inhibiting activity and the use thereof. FUNDAMENTALS OF THE TECHNIQUE

[0002] As an aging society develops, the number of people concerned about hair loss is increasing, and while this has been a major problem for middle-aged men, recently interest in hair loss prevention, hair growth, etc., is increasing among younger generations and also among women. Meanwhile, hair loss has been recognized as a number of aging phenomena, but recently it has been revealed that hair loss progresses due to various causes such as genetic factors, stress, Westernized eating habits, nutritional imbalance, and changes in social activities.

[0003] Currently, the drugs approved by the US FDA for hair growth effects are minoxidil (6-amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine) (US Patent No. 3,382,247) and finasteride (US Patent No. 5,215,894). In the case of minoxidil, it was developed in the early 1970s as a vasodilator for the treatment of hypertension, but hypertrichosis was reported. Petition 870250090466, dated 03 / 10 / 2025, page 14 / 64 2 / 31 as a side effect, it has been used as a hair growth promoter, exhibiting the effects of thickening hair by dilating pores and increasing the diameter of hair strands. Furthermore, in the case of finasteride, it was developed as a therapeutic agent for benign prostatic hypertrophy and is currently used as a therapeutic agent for hair loss, slowing the progression of hair loss and exhibiting effects on hair growth.

[0004] However, in the case of minoxidil, side effects such as weight gain, edema, dermatitis, and increased heart rate have been reported, and in the case of finasteride, continuous administration is required, and side effects such as sexual dysfunction in men and congenital defects in pregnant women occur, and therefore, the development of a therapeutic agent for hair loss without side effects is still a demand.

[0005] In this technical context, multifaceted studies to improve hair loss through mechanisms such as hormonal regulation and metabolic regulation are being conducted (Patent Publication open to public inspection No. KR 2002-0005332), but progress is still insufficient. DISCLOSURE OF THE INVENTION PROBLEM WITH THE TECHNIQUE

[0006] One aspect is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

[0007] Another aspect is to provide a cosmetic composition to improve hair loss or promote hair growth, which includes the peptide.

[0008] Another aspect is to provide a composition Petition 870250090466, dated 03 / 10 / 2025, p. 15 / 64 3 / 31 pharmaceutical product to prevent or treat hair loss, which includes the peptide.

[0009] Other objectives and advantages of this application will be evident from the following detailed description, together with the accompanying claims and drawings. Any matter not described in this document will be sufficiently recognized and inferred by those skilled in the art of this application or similar art, and the description is hereby omitted. SOLUTION TO THE PROBLEM

[0010] Each of the descriptions and embodiments disclosed in this application can be applied to other descriptions and embodiments. Consequently, all combinations of the various elements disclosed in this application are covered by the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific description presented below.

[0011] One aspect provides a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

[0012] As used in this document, the term peptide may refer to a linear molecule formed by the combination of amino acid residues with each other by peptide bonds. The peptide above can be prepared according to chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0013] As a result of diligent efforts to develop a peptide with biologically effective activity, the inventors of the present disclosure have identified a peptide Petition 870250090466, dated 03 / 10 / 2025, page 16 / 64 4 / 31 which consists of the amino acid sequence of SEQ ID NO: 1. More specifically, biologically effective activity may exhibit any one or more selected from the group consisting of: (a) promotion of proliferation of human hair follicle dermal papilla cells; (b) promotion of proliferation of human hair follicle outer root sheath cells; (c) promotion of proliferation of human hair follicle germinal matrix cells; (d) activation of β-catenin, for example, increased expression of β-catenin and / or translocation of β-catenin from the cytoplasm to the nucleus; (e) increased expression of Lef-1 (lymphoid enhancer-binding factor-1), cyclin D1 or c-Myc; (f) promotion of human hair follicle stem cell differentiation; and (g) inhibition of DKK-1 (Dickkopf-related protein 1) expression.

[0014] Therefore, the above peptide can be used for purposes such as promoting hair growth or improving hair loss, preventing or treating hair loss, and improving damaged hair.

[0015] The peptide may have a protecting group attached to the N- or C-terminal of the peptide to acquire chemical stability, improved pharmacological properties (half-life, absorption, titer, effect, etc.), altered specificity (e.g., broad spectrum of biological activity), or reduced antigenicity. Consequently, the peptide may be used to include either the peptide itself or a protected derivative thereof in which a protecting group is introduced. In one embodiment, an N-terminal of the peptide may be attached to any protecting group selected from the group consisting of an acetyl group, a fluoroylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a group Petition 870250090466, dated 03 / 10 / 2025, page 17 / 64 5 / 31 stearyl, a butoxycarbonyl group, an allyloxycarbonyl group, and polyethylene glycol (PEG); and / or the C-terminal of the peptide may be linked to any protecting group selected from the group consisting of an amino group (-NH2), a tertiary alkyl group, and an azide (-NHNH2). In addition, the peptide may optionally include a bleaching sequence, a label, labeled residues, or an amino acid sequence prepared for the specific purpose of increasing the half-life or stability of the peptide.

[0016] The peptide above is artificially synthesized or unnaturally occurring or genetically modified, and “unnaturally occurring or genetically modified” refers to a state that is not in its natural state but is created by artificial modification. Here, artificial modification may include the artificial synthesis of an amino acid sequence mimicking a plurality of amino acid structures or manipulating it to acquire chemical stability, enhanced pharmacological properties, altered specificity, or reduced antigenicity, as described above.

[0017] As used in this document, the term stability can refer not only to in vivo stability, which protects the peptide from attack by proteolytic enzymes in vivo, but also to storage stability (e.g., storage stability at room temperature).

[0018] Another aspect provides a cosmetic composition to promote hair growth or improve hair loss that includes, as an active ingredient, a peptide consisting of the amino acid sequence SEQ ID NO: 1. Petition 870250090466, dated 03 / 10 / 2025, p. 18 / 64 6 / 31

[0019] In the description of the peptide above, the terms or elements mentioned are the same as those already mentioned.

[0020] As used in this document, the term improve may refer to any act that at least reduces a parameter associated with the relief or treatment of a condition, for example, the severity of a symptom.

[0021] As used in this document, hair loss improvement can broadly refer to a process or effect of treating, relieving, or mitigating a hair loss condition and can refer to, for example, any actions that inhibit the progression of hair loss, such as promoting the proliferation or activation of dermal papilla cells of the hair follicle or inhibiting the expression of hair loss-inducing factors such as DKK-1, etc. The dermal papilla cells of the hair follicle above are cells that constitute the hair follicle and affect hair thickness and growth, and the activation of these cells affects the hair cycle and, through this mechanism, a hair loss improvement effect can be induced.

[0022] As used in this document, the term hair growth promotion may refer to any action that increases hair growth from a hair follicle and may refer to any action that increases the total amount of hair, for example, the effect of promoting hair follicle cell proliferation, hair follicle cell activation, or hair follicle cell growth, etc. Specifically, the hair cycle can be divided into the growth phase (anagen), in which the hair grows; the regression phase (catagen), in which growth ends and the hair bulb shrinks; the resting phase (telogen), Petition 870250090466, dated 03 / 10 / 2025, page 19 / 64 7 / 31, in which the dermal papilla ceases activity and the hair remains on the scalp; and the active phase, in which the dermal papilla initiates activity or produces new hairs, causing old hairs to fall out. In the hair cycle described above, dermal papilla cells are connected to capillaries and sensory nerves, which supply oxygen and nutrients to the germinal matrix cells, and the germinal matrix cells surround the dermal papilla cells, playing a role in determining the rate of the anagen phase through continuous cell division and proliferation. Furthermore, the outer root sheath cells are located in the area that is in contact with the basal layer of the epidermis and play a role in protecting the hair until keratinization is complete.

[0023] Although previous functional peptides have effective biological activity, they have had disadvantages, such as not being able to effectively enter the target tissue or cell due to the size of the peptide itself, or disappearing from the body in a short period of time due to their short half-life. In contrast, the cosmetic composition according to one example includes, as an active ingredient, a peptide consisting of 10 or fewer amino acids and, consequently, the penetration rate, etc., of the active ingredient into the skin is very excellent, and hair growth can be promoted and hair loss can be effectively inhibited, for example, when applied topically to the skin.

[0024] According to one example, it has been shown to promote the proliferation or activation of dermal papilla cells of hair follicles; promote the proliferation or activation of outer root sheath cells of hair follicles; promote the proliferation or activation of matrix cells. Petition 870250090466, dated 03 / 10 / 2025, page 20 / 64 8 / 31 germinative of hair follicle; activate β-catenin; increase the expression of Lef-1, Cyclin D1 or c-Myc; promote the differentiation of hair follicle stem cells; and inhibit the expression of hair loss-inducing factors, such as DKK1, etc. Thus, the above peptide can be used as an active ingredient in a cosmetic composition to promote hair growth and improve hair loss.

[0025] The cosmetic composition may include a cosmetically effective amount of the peptide; and / or a cosmetically acceptable carrier, but without limitation to the same.

[0026] As used in this document, the term cosmetically effective quantity may refer to a quantity sufficient to achieve the effect of improving hair loss or promoting hair growth of the cosmetic composition.

[0027] The weight ratio between the peptide and a cosmetically acceptable carrier may be, for example, 500:1 to 1:500, for example, the weight ratio may be 450:1 to 1:450, 400:1 to 1:400, 350:1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1:6, 4:1 to 1:4 or 2:1 to 1:2, but without limitation to the same.

[0028] The cosmetic composition may be prepared in any formulation commonly prepared in the art, for example, it may be formulated as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder base, an emulsion base, a wax base, and a spray, etc., Petition 870250090466, dated 03 / 10 / 2025, page 21 / 64 9 / 31 but without limitation to the same. For example, the cosmetic composition may be prepared in the form of a soothing lotion, nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, mask, spray or powder.

[0029] If the cosmetic composition formulation is a paste, cream or gel, the carrier component may be an animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc.

[0030] If the cosmetic composition formulation is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component and, for example, if the formulation is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether.

[0031] If the cosmetic composition formulation is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component and may include, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, aliphatic glycerol esters, polyethylene glycol or sorbitan fatty acid esters.

[0032] If the cosmetic composition formulation is a suspension, the carrier component may include a liquid diluent, such as water, ethanol or propylene glycol, a suspending agent, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum meta-hydroxide, Petition 870250090466, dated 03 / 10 / 2025, page 22 / 64 10 / 31 bentonite, agar or tragacanth, etc.

[0033] If the cosmetic composition formulation is a surfactant-containing cleanser, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative, or ethoxylated glycerol fatty acid ester, etc.

[0034] The peptide can be incorporated into a nanosome or nanoparticle to further improve skin penetration or solve stability problems. For example, the nanosome can be prepared by a microfluidizer using lecithin as a raw material and can be incorporated into lecithin particles. Any method of nanosome preparation can be used, provided it is known. The nanosome particle size is preferably 30 to 200 nm. If the nanosome particle size is smaller than 30 nm, skin penetration may progress too rapidly, resulting in side effects on the skin, and if the size is larger than 200 nm, skin penetration may not be easy, hindering the achievement of the effect of using the nanosome structure.

[0035] The ingredients included in the cosmetic composition include, in addition to peptides and carrier components as active ingredients, components commonly used in cosmetic compositions and may include, for example, common adjuvants such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances. Petition 870250090466, dated 03 / 10 / 2025, page 23 / 64 11 / 31

[0036] The peptide content as an active ingredient in the cosmetic composition may be appropriately selected without limitation depending on the product form, intended use, etc., and may be added, for example, from 0.01 to 15% by weight of the total weight of the cosmetic composition. In addition, for example, the cosmetic composition may include the peptide in an amount of 1.0% by weight to 3.0% by weight, preferably from 2.0% by weight to 3.0% by weight, based on the total weight.

[0037] Another aspect provides a method for improving hair loss or promoting hair growth, which involves applying a cosmetic composition that includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient to a subject's skin.

[0038] In the description above of the cosmetic composition, the terms or elements cited are the same as those already mentioned.

[0039] As used in this document, the terms apply, administer and apply are used interchangeably and may refer to causing at least the partial localization of a composition according to an example in a desired location, or to placing a composition according to an example on a subject by way of administration.

[0040] Another aspect provides a pharmaceutical composition to prevent or treat hair loss, which includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0041] In the above description of the peptide, the terms or elements cited are the same as those already mentioned.

[0042] As used in this document, the term prevention refers to any act of suppressing or delaying Petition 870250090466, dated 03 / 10 / 2025, p. 24 / 64 12 / 31 the appearance of a disease from administering the composition.

[0043] As used in this document, the term treatment refers to any form of treatment that provides an effect to a subject suffering from a disease or at risk of developing a disease, which includes improving the subject's condition (e.g., one or more symptoms), slowing the progression of the disease, delaying the onset of symptoms, or slowing the progression of symptoms, etc. Therefore, the treatment and prevention mentioned above are not intended to refer to a cure or the complete elimination of symptoms.

[0044] The subject above refers to a target that requires treatment for a disease and, more specifically, a mammal, such as a human or non-human primate, mouse, dog, cat, horse, cow, and the like.

[0045] Hair loss, which is a condition that should be prevented or treated by pharmaceutical composition, refers to a state where there is an absence of hair in an area where hair should normally exist and, specifically, it can refer to terminal hair loss (thick, black hair) on the scalp. The causes of hair loss are not limited and can be induced by various genetic factors, hormonal imbalances, psychological stress, exposure to air pollution, dietary habits such as consumption of processed foods, and other environmental influences. For example, hair loss can be caused by hereditary androgenetic alopecia (baldness), alopecia areata, tinea capitis caused by fungal infection, telogen effluvium, trichotillomania, and hair growth disorders, etc., and cicatricial alopecia can include hair loss due to lupus, lichen planus pilaris, folliculitis decalvans, burns, or trauma. Petition 870250090466, dated 03 / 10 / 2025, page 25 / 64 13 / 31

[0046] According to one example, the peptide showed effects of promoting the proliferation or activation of dermal papilla cells of hair follicles; promoting the proliferation or activation of outer root sheath cells of hair follicles; promoting the proliferation or activation of germinal matrix cells of hair follicles; activating β-catenin; increasing the expression of Lef-1, Cyclin D1 or c-Myc; promoting the differentiation of hair follicle stem cells; and inhibiting the expression of hair loss-inducing factors such as DKK1, etc. Thus, the above peptide can be used as an active ingredient in a pharmaceutical composition to prevent or treat hair loss.

[0047] The pharmaceutical composition may include a pharmaceutically effective amount of the peptide; and / or a pharmaceutically acceptable carrier, but without limitation to the same.

[0048] As used in this document, the term pharmaceutically effective quantity refers to an amount sufficient to achieve the efficacy of the pharmaceutical composition in preventing or treating hair loss.

[0049] Pharmaceutically acceptable carriers are commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., Petition 870250090466, dated 03 / 10 / 2025, page 26 / 64 14 / 31 1995).

[0050] The weight ratio between the peptide and a pharmaceutically acceptable carrier may be, for example, 500:1 to 1:500, for example, the weight ratio may be 450:1 to 1:450, 400:1 to 1:400, 350:1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1:6, 4:1 to 1:4 or 2:1 to 1:2, but without limitation to the same.

[0051] In addition to the above ingredients, the pharmaceutical composition may also include, but is not limited to, lubricants, humectants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

[0052] The pharmaceutical composition can be administered orally or parenterally, preferably parenterally, and if administered parenterally, it can be administered by, but not limited to, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc.

[0053] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 to 1000 μg (micrograms), 0.001 to 1000 μg, 0.01 to 1000 μg, 0.1 to 1000 μg or 1.0 to 1000 μg per day, and may be varied by factors such as formulation method, mode of administration, patient age, weight, sex, medical condition, diet, administration time, route of administration, excretion rate and sensitivity response.

[0054] The pharmaceutical composition may be formulated, with a pharmaceutically acceptable carrier and / or excipient, Petition 870250090466, dated 03 / 10 / 2025, page 27 / 64 15 / 31 according to a method that can be easily practiced by a person skilled in the art to which the present disclosure pertains, and the composition can be prepared in a unit dose form or can be contained in a multidose container.

[0055] The formulation may be in the form of a solution, suspension or emulsion in an oily or aqueous medium, or in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant and / or stabilizer.

[0056] Another aspect provides a method for preventing or treating hair loss, which involves administering to a subject a pharmaceutical composition that includes a therapeutically effective amount of a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0057] In the description above of the pharmaceutical composition, the terms or elements cited are the same as those already mentioned.

[0058] Another aspect provides a food composition to prevent hair loss or promote hair growth, which includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0059] In the above description of the peptide, the terms or elements cited are the same as those already mentioned.

[0060] The peptide content as an active ingredient in the food composition can be appropriately selected without limitation depending on the food form, intended use, etc., and can be added, for example, from 0.01 to 15% by weight of the total weight of the food. Furthermore, for example, the composition of a healthy drink can be supplemented. Petition 870250090466, dated 03 / 10 / 2025, page 28 / 64 16 / 31 at a rate of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml. ADVANTAGEOUS EFFECTS OF THE INVENTION

[0061] According to one aspect, the peptide can be applied to hair growth promotion and the like by (a) promoting the proliferation of human hair follicle dermal papilla cells (HHFDPC), (b) promoting the proliferation of human hair follicle outer root sheath cells (HHFORSC), (c) promoting the proliferation of human hair follicle germinal matrix cells (HHFGMC), (d) activating β-catenin, (e) increasing the expression of Lef-1, Cyclin D1 or c-Myc, or (f) promote the differentiation of human hair follicle stem cells (HHFSCs), thereby promoting the proliferation or activation of hair follicle cells or promoting the expression of hair follicle stem cells.

[0062] According to another aspect, the peptide may exhibit the ability to inhibit the expression of hair loss factors and may be applied to inhibit hair loss, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 shows the results of measuring the proliferation-promoting effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in human hair follicle dermal papilla cells.

[0064] Figure 2 shows the results of measuring the proliferation-promoting effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in outer root sheath cells of human hair follicles.

[0065] Figure 3 shows the results of measuring the proliferation-promoting effect of a peptide consisting of Petition 870250090466, dated 03 / 10 / 2025, page 29 / 64 17 / 31 amino acid sequence of SEQ ID NO: 1, in human hair follicle germinal matrix cells.

[0066] Figure 4 shows the results of measuring the effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in promoting the proliferation mechanism of hair follicle cells.

[0067] Figure 5 shows the results that confirm that a peptide consisting of the amino acid sequence SEQ ID NO: 1 increases the expression of Lef-1, Cyclin D1 and cMyc, which are factors related to the activity and growth of hair follicle cells.

[0068] Figure 6 is a result that confirms that the expression of stem cell markers is reduced due to the induction of differentiation by a peptide consisting of the amino acid sequence SEQ ID NO: 1.

[0069] Figure 7 is a result that confirms that the expression of a differentiation marker increases due to the induction of differentiation by a peptide consisting of the amino acid sequence SEQ ID NO: 1.

[0070] Figure 8 shows the results of measuring the inhibitory effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, on the expression of factors related to hair loss in hair follicle cells.

[0071] Figure 9 shows the results of a comparative measurement of the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 26, in promoting the proliferation mechanism of hair follicle cells.

[0072] Figure 10 shows the results of measuring the expression of stem cell markers after treatment with Petition 870250090466, dated 03 / 10 / 2025, page 30 / 64 18 / 31 a peptide consisting of the amino acid sequence from SEQ ID NO: 1 and a peptide consisting of the amino acid sequence from SEQ ID NO: 26.

[0073] Figure 11 shows the results of measuring the expression of differentiation markers after treatment with a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 26.

[0074] Figure 12 shows the results of measuring the inhibition effect on the expression of factors related to hair loss after treatment with a peptide consisting of the amino acid sequence SEQ ID NO: 1 and a peptide consisting of the amino acid sequence SEQ ID NO: 26. METHOD FOR THE INVENTION

[0075] Hereafter in this document, the present disclosure will be described in more detail with reference to examples. However, these examples are intended to illustrate the present disclosure by way of example, and the scope of the present disclosure is not limited to these examples. EXAMPLE 1: PEPTIDE SYNTHESIS

[0076] A peptide with the amino acid sequence of SEQ ID NO: 1 listed in Table 1 below was synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified by reverse-phase C18 high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was an ACQUITY UPLC BEH300 C18 (2.1 mm X 100 mm, 1.7 μm, Waters Co, USA). [Table 1] SEQ ID NO: Sequence (N terminal ^ C terminal) Petition 870250090466, dated 03 / 10 / 2025, page 31 / 64 19 / 31 1 RQTRVERSHS EXAMPLE 2: CONFIRMATION OF THE EFFECT OF PROLIFERATION OF HAIR FOLLICLE CELLS

[0077] To confirm the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, in promoting the proliferation of hair follicle cells. Specifically, human hair follicle dermal papilla cells (HHFDPC), human hair follicle root outer sheath cells (HHFORSC) and human hair follicle germinal matrix cells (HHFGMC) were seeded in a 96-well plate at a density of 4x103 cells / well and then cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The above peptide was treated at concentrations of 10 μM, 50 μM or 100 μM, respectively, and incubated at 37 °C for 72 hours. As a positive control group, 1 μM of minoxidil, which is used as a therapeutic agent for hair loss, 100 ng / ml of recombinant human Wnt-3a protein, and 100 ng / ml of recombinant human EGF protein were treated.After the culture was complete, the culture supernatant was removed and the cells were fixed using ethanol. After washing with PBS, staining was performed by treatment with SRB solution. After washing with 1% acetic acid, the cells were observed under a microscope and decolorized by treatment with 20 mM Tris solution. Cell viability was measured by measuring absorbance at a wavelength of 560 nm using a spectrophotometer (SpectraMax iD3, Molecular Devices (USA, CA)).

[0078] The results are illustrated in Figure 1 to Figure 3. Figure 1 shows the results of human hair follicle dermal papilla cell proliferation (HHFDPC), Petition 870250090466, dated 03 / 10 / 2025, page 32 / 64 Figure 2 shows the results of human hair follicle outer root sheath cell (HHFORSC) proliferation, and Figure 3 shows the results of human hair follicle germinal matrix cell (HHFGMC) proliferation, which confirms that proliferation was induced and increased in a concentration-dependent manner in the peptide treatment group. In the case of HHFDPC, an increase of up to approximately 46% was observed (Figure 1), in the case of HHFORSC, an increase of up to approximately 49% was observed (Figure 2), and in the case of HHFGMC, an increase of up to approximately 33% was observed (Figure 3). EXAMPLE 3: CONFIRMATION OF THE EFFECT OF PROMOTING THE MECHANISM OF HAIR FOLLICLE CELL PROLIFERATION

[0079] To confirm the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, in promoting the proliferation mechanism of hair follicle cells. Specifically, HHFDPCs were seeded in 6-well plates at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 24 hours. As a positive control group, 10 ng / ml of recombinant human Wnt-3a protein was treated. After washing with PBS, nucleoproteins were isolated using a nucleoprotein extraction kit (Thermo Scientific, USA) and quantified with BCA to prepare equal amounts of protein samples. Proteins separated by electrophoresis using a 10% SDSPAGE gel were transferred to a PVDF membrane.The blockade was performed at room temperature for 30 minutes using 5% skim milk. The antibodies were β-catenin. Petition 870250090466, dated 03 / 10 / 2025, page 33 / 64 21 / 31 (cell signaling, USA) and HDAC1 (Santa Cruz, USA) were diluted 1:1000 in 3% BSA and reacted with the membrane at 4°C for 16 hours. The membrane was washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. The secondary antibody was diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. After treatment with ECL solution (GE Healthcare, USA), the membrane was detected.

[0080] The results are illustrated in Figure 4. From the results in Figure 4, it can be confirmed that β-catenin expression increases when treated with the peptide, and that the nuclear translocation of β-catenin from the cytoplasm to the nucleus increases up to 5.34 times by treatment with the peptide. EXAMPLE 4: CONFIRMATION OF PROMOTION EFFECT OF HAIR FOLLICLE CELL ACTIVITY

[0081] To confirm the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 in promoting the activity of hair follicle cells. HHFDPCs were seeded in 6-well plates at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 24 hours. As a positive control group, 10 ng / ml of recombinant human Wnt-3a protein was treated. After washing with PBS, RNA was isolated by treatment with 300 μl of easy blue (Intron, Korea). After RNA quantification, cDNA synthesis was performed using a cDNA synthesis kit (Enzynomics, Korea). PCR was performed using pre- Petition 870250090466, dated 03 / 10 / 2025, page 34 / 64 22 / 31 PCR mixture (enzynomics, Korea) using the primers Lef1, Cyclin D1 and c-Myc shown in Table 2. Electrophoresis was performed on a 1.5% agarose gel and band detection was performed using a BioRad gel imaging system.

[0082] The results are illustrated in Figure 5. From the results in Figure 5, it was confirmed that the expression of Lef-1, c-Myc, and Cyclin D1, which are factors related to the activity and growth of HHFDPC cells, was increased by treatment with the peptide. In the case of Lef-1, it was confirmed that the expression increased up to 1.53 times compared to the control group, in the case of Cyclin D1 up to 6.13 times, and in the case of c-Myc up to 4.86 times. [Table 2] Initiator Sequence SEQ ID NO: LEF-1 forward (5') CCAGCTATTGTAACACCTCA (3') 2 LEF-1 reverse (5') TTCAGATGTAGGCAGCTGTC (3') 3 c-Myc forward (5') ACCAGCAGCGACTCTGAGGAGGAAC (3') 4 c-Myc reverse (5') TGACCCTCTTGGCAGCAGGATAGTCC (3') 5 Cyclin D1 forward (5') ACCTTCGTTGCCCTCTGTGCCACAGATG (3') 6 Cyclin D1 reverse (5') AGGCCCGGAGGGCAGTCCGGGT (3') 7 GAPDH forward (5') GGAGCCAAAAGGGTCATCAT (3') 8 GAPDH reverse (5') GTGATGGCATGGACTGTGGT (3') 9 EXAMPLE 5: CONFIRMATION OF THE EFFECT OF INDUCING A Petition 870250090466, dated 03 / 10 / 2025, p. 35 / 64 23 / 31 STEM CELL DIFFERENTIATION

[0083] To confirm the differentiation-inducing effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 in stem cells. HHFSCs were seeded in well plates at a density of 1x10⁵ cells / well and cultured for hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 72 hours. As a positive control group, recombinant human Wnt-3a protein was treated at 10 ng / ml and 100 ng / ml, respectively. After washing with PBS, RNA was isolated by treatment with 300 μL of easy blue (Intron, Korea). After RNA quantification, cDNA synthesis was performed using a cDNA synthesis kit (enzynomics, Korea). PCR was performed using PCR premix (enzynomics, Korea) using the primers shown in Table 3.Electrophoresis was performed on a 1.5% agarose gel, and band detection was performed using a BioRad gel imaging system. [Table 3] Initiator Sequence SEQ ID NO: CD34 forward (5') CTGCATGCAAGAGTGACACC (3') 10 CD34 reverse (5') GACATTGCCCCTTCCCTTTG (3') 11 Lhx-2 forward (5') AAGCTGCAACGAAAACGACG (3') 12 Lhx-2 reverse (5') GGTGGGGCTAGTCAAGTTCTG (3') 13 Keratin 15- forward (5') CCAGCAAGACGGAGATCACA (3') 14 Petition 870250090466, dated 03 / 10 / 2025, p. 36 / 64 24 / 31 Keratin 15- Reverse (5') GAAGAGGCTTCCCTGATGGC (3') 15 Alpha-SMA forward (5') CCTATCCCCGGGACTAAGAC (3') 16 Alpha-SMA reverse (5') ATGCTCTTCAGGGGGCAACAC (3') 17 Corin direct (GCTGCCATGCCAT) (3') 18 Reverse corin (5') CAGCGATGCTCTGTTGTGG (3') 19 Direct versican (5') CCGTTCTCCCCAGGAAAACTT (3') 20 Reverse Versican (5') TGCAGCGATCAGGTCGTTTA (3') 21 Direct Vimentin (5'CCAGGAACCGAACCGA222) Reverse vimentin (5') GTCATTGTTCCGGTTGGCAG (3') 23 Direct Nexin-1 (5') CCCAGCCAACCTATGAGGAG (3') 24 Reverse Nexin-1 (5') CTTGAGGAGACCAGCACCAC (3') 25

[0084] Figure 6 shows the results of stem cell marker measurements and Figure 7 shows the results of differentiation marker measurements. From the results in Figure 6, it can be confirmed that the expression of the stem cell markers CD34, Lhx-2, and Keratin15 is clearly reduced. On the other hand, from the results in Figure 7, it can be confirmed that the expression of all differentiation markers, alpha-SMA, Corin, Versican, Vimentin, and Nexin-1, is significantly increased. It was then confirmed that the peptide has the Petition 870250090466, dated 03 / 10 / 2025, p. 37 / 64 The 25 / 31 amino acid sequence of SEQ ID NO: 1 induces stem cell proliferation and differentiation so that these cells can migrate to the hair roots, thus enabling the creation of new hair follicles. EXAMPLE 6: CONFIRMATION OF THE EFFECT OF INHIBITING THE Expression of Factors Related to Hair Loss in Hair Follicle Cells

[0085] To confirm the possibility of a peptide, consisting of the amino acid sequence of SEQ ID NO: 1, inhibiting the expression of DKK-1, a factor related to hair loss, in hair follicle cells. HHFDPCs were seeded in 6-well plates at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptides were treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and simultaneously treated with DHT, an inducer of the hair loss protein DKK-1, at a concentration of 100 nM. As a positive control group, 5 μM of finasteride, an androgen-inhibiting drug, was used. DHT is known as a hair loss hormone that increases the expression of DKK-1 (Dickkopf-related protein 1), a hair loss-inducing factor, by activating androgen receptors.After culturing at 37 °C for 24 hours, the cells were washed with PBS, treated with lysis buffer to prepare cell lysates, and equal amounts of protein samples were prepared by BCA quantification. Electrophoresis was performed using a 10% SDS-PAGE gel. The proteins separated by SDS-PAGE were transferred to a PVDF membrane. Blocking was performed at room temperature for 30 minutes using 5% skim milk. Petition 870250090466, dated 03 / 10 / 2025, page 38 / 64 26 / 31 DKK-1 antibody (cell signaling, USA) was diluted 1:1000 in 3% BSA and reacted with the membrane at 4°C for 16 hours. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each. The secondary antibody was diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each. After treatment with ECL solution (GE Healthcare, USA), protein band detection and densitometry were performed using ImageQuant 800 (Amersham, USA).

[0086] The results are illustrated in Figure 8. From the results in Figure 8, it was possible to confirm the effect of inhibiting DHT-induced DKK-1 expression after peptide treatment. In the high-concentration peptide treatment group, it was confirmed that the DKK-1 expression level was reduced by approximately 50% compared to the negative control group (DHT treatment group). EXAMPLE 7: COMPARISON OF THE EFFECTS OF PROMOTING MECHANISM OF HAIR FOLLICLE CELL PROLIFERATION

[0087] The proliferation-promoting effects of a novel peptide consisting of the amino acid sequence SEQ ID NO: 1 and a peptide consisting of the amino acid sequence SEQ ID NO: 26 disclosed in KR10-1209117 (Table 4) on hair follicle cell proliferation were compared. The experiment was conducted in the same manner described in Example 3, and the cell proliferation effect was measured after treatment of HHFDPC with peptides at different concentrations. [Table 4] Petition 870250090466, dated 03 / 10 / 2025, page 39 / 64 27 / 31 SEQ ID NO: Sequence (5'^3') 26 RQTRVQRSHS

[0088] The results are illustrated in Figure 9. From the results in Figure 9, it can be confirmed that both a peptide consisting of the amino acid sequence SEQ ID NO: 26 and a novel peptide consisting of the amino acid sequence SEQ ID NO: 1 promote the translocation of β-catenin from the cytoplasm to the nucleus in a concentration-dependent manner. Furthermore, by comparing the activities of the two peptides, it can be confirmed that the novel peptide exhibits significantly greater proliferation mechanism-promoting activity than the known peptide when treated at the same concentration. EXAMPLE 8: COMPARISON OF THE EFFECTS OF INDUCING STEM CELL DIFFERENTIATION

[0089] The differentiation-inducing effects of an innovative peptide consisting of the amino acid sequence SEQ ID NO: 1 and a peptide consisting of the amino acid sequence SEQ ID NO: 26 in stem cells were compared. The experiment was conducted in the same manner as described in Example 5, and the differentiation-inducing effect was confirmed by treating HHFSCs with peptides at different concentrations.

[0090] The results are illustrated in Figure 10 and Figure 11. Figure 10 shows the measurement results of stem cell markers and Figure 11 shows the measurement results of differentiation markers. From the results in Figure 10, it can be confirmed that the expression of the stem cell markers CD34, Lhx-2 and Keratin15 is significantly reduced when treated with both. Petition 870250090466, dated 03 / 10 / 2025, pp. 40 / 64 28 / 31 peptides. And by comparing the activities of the two peptides, it can be confirmed that the expression of stem cell markers is reduced more significantly by the innovative peptide than by the known peptide when treated at the same concentration. Furthermore, from the results in Figure 11, it can be confirmed that the expression of all differentiation markers, alpha-SMA, Corin, Versican, Vimentin, and Nexin-1, increases significantly when treated with both peptides. And by comparing the activities of the two peptides, it can be confirmed that the expression of differentiation markers is significantly increased in the innovative peptide compared to the known peptide when treated at the same concentration. Therefore, it can be confirmed that the innovative peptide induces stem cell proliferation and their differentiation into hair follicles more effectively than the known peptide, thus allowing the creation of new hair follicles. EXAMPLE 9: COMPARISON OF THE EFFECT OF INHIBITING THE EXPRESSION OF FACTORS RELATED TO HAIR LOSS IN HAIR FOLLICLE CELLS

[0091] The effect of inhibiting the expression of factors related to hair loss was compared between the innovative peptide consisting of the amino acid sequence of SEQ ID NO: 1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 26. The experiment was conducted in the same manner described in Example 6, and it was confirmed that the expression of DKK-1, a factor related to hair loss, could be inhibited after treatment of HHFDPC with peptides at different concentrations.

[0092] The results are illustrated in Figure 12. A Petition 870250090466, dated 03 / 10 / 2025, page 41 / 64 29 / 31 From the results in Figure 12, it can be confirmed that both a peptide consisting of the amino acid sequence of SEQ ID NO: 26 and an innovative peptide consisting of the amino acid sequence of SEQ ID NO: 1 exhibit a concentration-dependent inhibitory effect on DKK-1 expression. Furthermore, when comparing the inhibitory effects of the two peptides, it can be confirmed that the innovative peptide has a significantly greater ability to inhibit DKK-1 expression than the known peptide when treated with the same concentration. EXAMPLE OF FORMULATION 1. PREPARATION OF PEPTIDE NANOSOMES

[0093] 50 mg of the peptide from Example 1 above were dissolved in 500 ml of distilled water by sufficient stirring. The composite solution was mixed with 5 g of lecithin, 0.3 ml of sodium oleate, 50 ml of ethanol and a small amount of oil, and the total quantity was adjusted to 1 l with distilled water, and the mixture was then emulsified using a high-pressure microfluidizer to produce peptide nanosomes with a size of approximately 100 nm. EXAMPLE OF FORMULATION 2. LOTION

[0094] A lotion containing the peptide according to an example and consisting of the following composition was prepared using a method known in the art. [Table 5] Component | Content (% by weight) | Peptide | 1.0 | 1,3-butylene glycol | 6.0 | Glycerin | 4.0 | PEG 1500 | 1.0 Petition 870250090466, dated 03 / 10 / 2025, pp. 42 / 64 30 / 31 Sodium hyaluronate 1.0g, Polysorbate 20 0.5g, Ethanol 8.0g, Benzophenone-9 0.05g, Preservatives, colorants as needed, Fragrance as needed, Purified water remaining, Total 100ml EXAMPLE OF FORMULATION 3. NOURISHING CREAM

[0095] A nourishing cream that includes the peptide according to an example and that consists of the following composition, was prepared using a method known in the art. [Table 6] Component | Content (% by weight) | Peptide | 2.0 | Glycerin | 10.0 | 1,3-Butylene Glycol | 5.0 | PEG 1500 | 2.0 | Allantoin | 0.1 | DL-Panthenol | 0.3 | EDTA-2Na | 0.02 | Hydroxyethylcellulose | 0.1 | Sodium Hyaluronate | 8.0 | Carboxvinyl Polymer | 0.2 | Triethanolamine | 0.18 | Octyldodeceth-16 | 0.4 | Ethanol | 6 | Preservatives, colorants | As needed | Fragrance | As needed Petition 870250090466, dated 03 / 10 / 2025, pp. 43 / 64 31 / 31 Purified water Remaining Total 100

[0096] The preceding description of the present disclosure is for illustrative purposes only, and anyone of ordinary skill in the art to which the present disclosure pertains will understand that it can be easily adapted to other specific forms without altering the essential technical ideas or features of the present disclosure. Therefore, the examples described above should be understood in all respects as illustrative and not restrictive. Petition 870250090466, dated 03 / 10 / 2025, pages 44 / 64

Claims

1 / 2 CLAIMS 1. PEPTIDE characterized by consisting of the amino acid sequence of SEQ ID NO:

1.

2. A PEPTIDE, according to claim 1, characterized in that an N-terminal of the peptide is linked to any protective group selected from the group consisting of an acetyl group, a fluoroylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, a butoxycarbonyl group, an allyloxycarbonyl group, and polyethylene glycol (PEG).

3. PEPTIDE, according to claim 1, characterized in that a C-terminal of the peptide is linked to any protecting group selected from the group consisting of an amino group (-NH2), a tertiary alkyl group and an azide group (-NHNH2).

4. PEPTIDE, according to claim 1, characterized in that the peptide exhibits one or more features selected from the following: (a) promotion of proliferation of dermal papilla cells of human hair follicles; (b) promotion of proliferation of outer root sheath cells of human hair follicles; (c) promotion of proliferation of germinal matrix cells of human hair follicles; (d) activation of β-catenin; (e) increased expression of lymphoid enhancer-binding factor-1 (LEF-1), cyclin D1 or c-Myc; (f) promotion of differentiation of human hair follicle stem cells; and Petition 870250090466, dated 10 / 03 / 2025, page 45 / 64 2 / 2 (g) inhibition of Dickkopf-related protein 1 (DKK-1) expression.

5. COSMETIC COMPOSITION TO PROMOTE HAIR GROWTH OR IMPROVE HAIR LOSS characterized by comprising the peptide, as defined in any one of claims 1 to 4, as the active ingredient.

6. PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING HAIR LOSS, characterized by comprising the peptide, as defined in any one of claims 1 to 4, as the active ingredient. Petition 870250090466, dated 03 / 10 / 2025, pp. 46 / 64

Images