PEPTIDE, COSMETIC COMPOSITION TO IMPROVE HAIR LOSS OR PROMOTE HAIR GROWTH, PHARMACEUTICAL COMPOSITION TO PREVENT OR TREAT HAIR LOSS, FOOD COMPOSITION TO PREVENT HAIR LOSS OR PROMOTE HAIR GROWTH AND USE OF THE PEPTIDE

Description

1 / 29 Peptide, cosmetic composition to improve hair loss or promote hair growth, pharmaceutical composition to prevent or treat hair loss, food composition to prevent hair loss or promote hair growth. AND THE USE OF THE PEPTIDE FIELD OF TECHNIQUE

[0001] The present disclosure relates to a peptide that has hair growth promoting or hair loss inhibiting activity and the use thereof. BACKGROUND OF THE TECHNIQUE

[0002] Human hair is composed of approximately 150,000 strands, and each strand goes through a different hair cycle, repeating the process of growth and shedding. The hair growth cycle is broadly divided into three stages: the growth phase (anagen), in which the hair grows; the maintenance phase (catagen), in which hair growth is completed and the hair is maintained; and the resting phase (telogen), in which the dermal papilla shrinks and the hair follicle gradually shrinks, leading to hair shedding. These three stages are repeated periodically. The hair growth cycle varies depending on internal factors such as family history, genetics, constitution, and hormonal regulation, as well as external factors such as nutritional status, aging, surrounding environment, and stress.

[0003] Meanwhile, since the ends of the hair are exposed to the external environment for a longer period of time compared to the parts closer to the scalp, the hair damage caused by the external environment is more severe. The wear and tear caused by exposure to the external environment causes hair loss. Petition 870250104932, dated 11 / 17 / 2025, page 5 / 45 2 / 29 of hair cuticles, resulting in split ends and eventual breakage. A representative example of this damage is when hair is continuously exposed to high temperatures, such as those of a hair dryer, which reduces the hair's tensile strength and weakens it. In addition, various physical, chemical, or environmental factors, such as frequent perms and dyeing, cause the hair's proteins and lipids to be released, promoting hair porosity. As a result, the hair becomes rough and loses its shine, friction increases, brushing becomes difficult, and it breaks easily or develops split ends.

[0004] Additionally, as an aging society develops, the number of people concerned about hair loss is increasing, and while this has been a major problem for middle-aged men, recently interest in hair loss prevention, hair growth, etc., is increasing among younger generations and also among women. Meanwhile, hair loss has been recognized as a number of aging phenomena, but recently it has been revealed that hair loss progresses due to various causes such as genetic factors, stress, Westernized eating habits, nutritional imbalance, and changes in social activities. Currently, the drugs approved by the US FDA for hair growth effects are minoxidil (6-amino-1,2-dihydro-1-hydroxy-2-imino-4-phenoxypyrimidine) (US Patent No. 3,382,247) and finasteride (US Patent No. 5,215,894).In the case of minoxidil, it was developed in the early 1970s as a vasodilator. Petition 870250104932, dated 11 / 17 / 2025, page 6 / 45 3 / 29 for the treatment of hypertension, but since hypertrichosis has been reported as a side effect, it has been used as a hair growth promoter, exhibiting a hair thickening effect by increasing hair follicles and hair strand diameter. Additionally, in the case of finasteride, it was developed as a therapeutic agent for prostatic hypertrophy and is currently used as a therapeutic agent for hair loss, slowing the progression of hair loss and exhibiting effects on hair growth. However, in the case of minoxidil, side effects such as weight gain, edema, dermatitis, and increased heart rate have been reported, and in the case of finasteride, continuous administration is necessary, and side effects such as sexual dysfunction in men and birth defects in pregnant women occur; therefore, the development of a therapeutic agent for hair loss without side effects is still a demand.

[0005] In this technical context, multifaceted studies to improve damaged hair and prevent hair loss through mechanisms such as hormonal regulation and metabolic regulation are being conducted (Patent Publication open to public inspection No. KR 2002-0005332), but progress is still insufficient. DISCLOSURE OF THE INVENTION PROBLEM OF THE TECHNIQUE

[0006] One aspect is to provide a peptide consisting of the amino acid sequence of SEQ ID NO: 1.

[0007] Another aspect is to provide a cosmetic composition to improve hair loss or promote hair growth, which includes the above peptide as Petition 870250104932, dated 11 / 17 / 2025, page 7 / 45 4 / 29 active ingredient.

[0008] Another aspect is to provide a pharmaceutical composition to prevent or treat hair loss, which includes the above peptide as an active ingredient.

[0009] Other objectives and advantages of this application will be evident from the following detailed description, together with the accompanying claims and drawings. Any matter not described in this document will be sufficiently recognized and inferred by those skilled in the art of this application or similar art, and the description is hereby omitted. SOLUTION TO THE PROBLEM

[0010] Each of the descriptions and embodiments disclosed in this application may be applied to other descriptions and embodiments. Consequently, all combinations of the various elements disclosed in this application are covered by the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific description presented below.

[0011] One aspect provides a peptide consisting of the amino acid sequence SEQ ID NO: 1.

[0012] As used in this document, the term peptide may refer to a linear molecule formed by the combination of amino acid residues with each other by peptide bonds. The above peptide may be prepared according to chemical synthesis methods known in the art, particularly solid-phase synthesis techniques (Merrifield, J. Amer. Chem. Soc. 85:2149-54 (1963)) or liquid-phase synthesis techniques (US Patent No. 5,516,891).

[0013] As a result of diligent efforts to Petition 870250104932, dated 11 / 17 / 2025, page 8 / 45 5 / 29 To develop a peptide with biologically effective activity, the inventors of the present disclosure have identified a peptide consisting of the amino acid sequence SEQ ID NO: 1.

[0014] Here, the biologically effective activity may be a hair growth-promoting or hair loss-inhibiting activity. More specifically, the biologically effective activity may exhibit any one or more of the following selected characteristics: (a) promotion of proliferation of human hair follicle dermal papilla cells; (b) activation of β-catenin, for example, increased expression of β-catenin and / or translocation of β-catenin from the cytoplasm to the nucleus; (c) increased expression of Lef-1 (Lymphoid Enhancer-binding Factor-1), cyclin D1 or c-Myc; and (d) inhibition of DKK-1 (Dickkopf-related protein 1) expression. Therefore, the above peptide may be used for purposes such as improving hair loss or promoting hair growth, preventing or treating hair loss, and improving damaged hair.

[0015] The peptide may have a protecting group attached to the N- or C-terminal of the peptide to acquire chemical stability, improved pharmacological properties (half-life, absorption, titer, effect, etc.), altered specificity (e.g., broad spectrum of biological activity), or reduced antigenicity. Consequently, the peptide may be used to include either the peptide itself or a protected derivative thereof in which a protecting group is introduced. In one embodiment, an N-terminal of the peptide may be attached to any protecting group selected from the group consisting of an acetyl group, a fluoroylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a group Petition 870250104932, dated 11 / 17 / 2025, page 9 / 45 6 / 29 stearyl, a butoxycarbonyl group (Boc), an allyloxycarbonyl group (Alloc), and polyethylene glycol (PEG); and / or the C-terminal of the peptide may be linked to any protecting group selected from the group consisting of an amino group (NH2), a tertiary alkyl group, and an azide (-NHNH2). In addition, the peptide may optionally include a bleaching sequence, a label, labeled residues, or an amino acid sequence prepared for the specific purpose of increasing the half-life or stability of the peptide.

[0016] The peptide above is artificially synthesized or unnaturally occurring or genetically modified, and “unnaturally occurring or genetically modified” refers to a state that is not in its natural state but is created by artificial modification. Here, artificial modification may include the artificial synthesis of an amino acid sequence mimicking a plurality of amino acid structures or manipulating it to acquire chemical stability, enhanced pharmacological properties, altered specificity, or reduced antigenicity, as described above.

[0017] As used in this document, the term “stability” can refer not only to in vivo stability, which protects the peptide from attack by proteolytic enzymes in vivo, but also to storage stability (e.g., storage stability at room temperature).

[0018] Another aspect provides a cosmetic composition to prevent hair loss or promote hair growth, which includes a peptide consisting of Petition 870250104932, dated 11 / 17 / 2025, p. 10 / 45 7 / 29 amino acid sequence of SEQ ID NO: 1 as an active ingredient.

[0019] In the above description of the peptide, the terms or elements cited are the same as those already mentioned.

[0020] As used in this document, the term improve may refer to any act that at least reduces a parameter associated with the relief or treatment of a condition, for example, the severity of a symptom.

[0021] As used in this document, hair loss improvement can broadly refer to a process or effect of treating, relieving, or mitigating a hair loss condition and can refer to, for example, any actions that inhibit the progression of hair loss, such as promoting the proliferation or activation of dermal papilla cells of the hair follicle or inhibiting the expression of hair loss-inducing factors such as DKK-1, etc. The dermal papilla cells of the hair follicle above are cells that constitute the hair follicle and affect hair thickness and growth, and the activation of these cells affects the hair cycle and, through this mechanism, a hair loss improvement effect can be induced.

[0022] As used in this document, the term hair growth promotion may refer to any action that increases hair growth from a hair follicle and may refer to any action that increases the total amount of hair, for example, the effect of promoting hair follicle cell proliferation, hair follicle cell activation, or hair follicle cell growth, etc. Specifically, the hair cycle can be divided into the growth phase (anagen), in which the hair Petition 870250104932, dated 11 / 17 / 2025, page 11 / 45 8 / 29 growth; regression (catagen) phase, in which growth ends and the hair bulb shrinks; resting (telogen) phase, in which the dermal papilla ceases activity and the hair remains on the scalp; and active phase, in which the dermal papilla becomes active or produces new hairs, causing old hairs to fall out. In the hair cycle described above, dermal papilla cells are connected to capillaries and sensory nerves, which supply oxygen and nutrients to the germinal matrix cells, and the germinal matrix cells surround the dermal papilla cells, playing a role in determining the rate of the anagen phase through continuous cell division and proliferation. Furthermore, the outer root sheath cells are located in the area that is in contact with the basal layer of the epidermis and play a role in protecting the hair until keratinization is complete.

[0023] Although previous functional peptides have effective biological activity, they have had disadvantages, such as not being able to effectively enter the target tissue or cell due to the size of the peptide itself, or disappearing from the body in a short period of time due to their short half-life. In contrast, the cosmetic composition according to one example includes, as an active ingredient, a peptide consisting of 10 or fewer amino acids and, consequently, the penetration rate, etc., of the active ingredient into the skin is very excellent, and it can effectively prevent hair loss and promote hair growth, for example, when applied topically to the skin.

[0024] According to one example, the peptide showed effects of promoting the proliferation or activation of dermal papilla cells of hair follicles; activating beta-catenin; Petition 870250104932, dated 11 / 17 / 2025, page 12 / 45 9 / 29 increase the expression of Lef-1, Cyclin D1 or c-Myc; and inhibit the expression of hair loss-inducing factors, such as DKK1, etc. Thus, the above peptide can be used as an active ingredient in a cosmetic composition to improve hair loss or promote hair growth.

[0025] The cosmetic composition may include a cosmetically effective amount of the peptide; and / or a cosmetically acceptable carrier, but without limitation to the same.

[0026] As used in this document, the term “cosmetically effective quantity” may refer to a quantity sufficient to achieve the effect of improving hair loss or promoting hair growth of the cosmetic composition.

[0027] The weight ratio between the peptide and a cosmetically acceptable carrier may be, for example, 500:1 to 1:500, for example, the weight ratio may be 450:1 to 1:450, 400:1 to 1:400, 350:1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1:6, 4:1 to 1:4 or 2:1 to 1:2, but without limitation to the same.

[0028] The cosmetic composition may be prepared in any formulation commonly prepared in the art, for example, it may be formulated as a solution, a suspension, an emulsion, a paste, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder base, an emulsion base, a wax base, and a spray, etc., but without limitation thereto. For example, the cosmetic composition may be prepared in the form of a softening lotion, Petition 870250104932, dated 11 / 17 / 2025, page 13 / 45 10 / 29 nourishing lotion, nourishing cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, mask, spray or powder.

[0029] If the cosmetic composition formulation is a paste, cream or gel, the carrier component may be an animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc.

[0030] If the cosmetic composition formulation is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component and, for example, if the formulation is a spray, it may additionally include a propellant such as chlorofluorohydrocarbon, propane / butane or dimethyl ether.

[0031] If the cosmetic composition formulation is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component and may include, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, aliphatic glycerol esters, polyethylene glycol or sorbitan fatty acid esters.

[0032] If the cosmetic composition formulation is a suspension, the carrier component may include a liquid diluent, such as water, ethanol or propylene glycol, a suspending agent, such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline cellulose, aluminum meta-hydroxide, bentonite, agar or tragacanth, etc.

[0033] If the formulation of the cosmetic composition is Petition 870250104932, dated 11 / 17 / 2025, page 14 / 45 11 / 29 a surfactant-containing cleaner, the carrier component may include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanolin derivative or ethoxylated glycerol fatty acid ester, etc.

[0034] The peptide can be incorporated into a nanosome or nanoparticle to further improve skin penetration or solve stability problems. For example, the nanosome can be prepared by a microfluidizer using lecithin as a raw material and can be incorporated into lecithin particles. Any method of nanosome preparation can be used, provided it is known. The nanosome particle size is preferably 30 to 200 nm. If the nanosome particle size is smaller than 30 nm, skin penetration may progress too rapidly, resulting in side effects on the skin, and if the size is larger than 200 nm, skin penetration may not be easy, hindering the achievement of the effect of using the nanosome structure.

[0035] The ingredients included in the cosmetic composition include, in addition to peptides and carrier components as active ingredients, components commonly used in cosmetic compositions and may include, for example, common adjuvants such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances.

[0036] The peptide content as an active ingredient in the cosmetic composition can be selected Petition 870250104932, dated 11 / 17 / 2025, page 15 / 45 12 / 29 appropriately without limitation depending on the product form, intended use, etc., and may be added, for example, from 0.01 to 15% by weight of the total weight of the cosmetic composition. Furthermore, for example, the cosmetic composition may include the peptide in an amount of 1.0% by weight to 3.0% by weight, preferably 2.0% by weight to 3.0% by weight, based on the total weight.

[0037] Another aspect provides a method for improving hair loss or promoting hair growth, which involves applying a cosmetic composition that includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient to a subject's skin.

[0038] In the description above of the cosmetic composition, the terms or elements cited are the same as those already mentioned.

[0039] As used in this document, the terms apply, administer and apply are used interchangeably and may refer to causing at least the partial localization of a composition according to an example in a desired location, or to placing a composition according to an example on a subject by way of administration.

[0040] Another aspect provides a pharmaceutical composition to prevent or treat hair loss, which includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0041] In the above description of the peptide, the terms or elements cited are the same as those already mentioned.

[0042] As used in this document, the term prevention refers to any act of suppressing or delaying the onset of a disease by administering the composition.

[0043] As used in this document, the term Petition 870250104932, dated 11 / 17 / 2025, p. 16 / 45 13 / 29 Treatment refers to any form of treatment that provides an effect to a subject suffering from a disease or at risk of developing a disease, which includes improving the subject's condition (e.g., one or more symptoms), slowing the progression of the disease, delaying the onset of symptoms, or slowing the progression of symptoms, etc. Therefore, the treatment and prevention above are not intended to refer to a cure or the complete elimination of symptoms.

[0044] The subject above refers to a target that requires treatment for a disease and, more specifically, a mammal, such as a human or non-human primate, mouse, dog, cat, horse, cow, and the like.

[0045] Hair loss, which is a condition that should be prevented or treated by pharmaceutical composition, refers to a state where there is an absence of hair in an area where hair should normally exist and, specifically, it can refer to terminal hair loss (thick, black hair) on the scalp. The causes of hair loss are not limited and can be induced by various genetic factors, hormonal imbalances, psychological stress, exposure to air pollution, dietary habits such as the consumption of processed foods, and other environmental influences. For example, hair loss can be caused by hereditary androgenetic alopecia (baldness), alopecia areata, tinea capitis caused by fungal infection, telogen effluvium, trichotillomania, and hair growth disorders, etc., and cicatricial alopecia can include hair loss due to lupus, lichen planus pilaris, folliculitis decalvans, burns, or trauma.

[0046] According to one example, the peptide showed effects of promoting the proliferation or activation of cells of Petition 870250104932, dated 11 / 17 / 2025, page 17 / 45 14 / 29 dermal papilla of the hair follicle; activate beta-catenin; increase the expression of Lef-1, Cyclin D1 or c-Myc; and inhibit the expression of hair loss-inducing factors such as DKK1, etc. Thus, the above peptide can be used as an active ingredient in a pharmaceutical composition to prevent or treat hair loss.

[0047] The pharmaceutical composition may include a pharmaceutically effective amount of the peptide; and / or a pharmaceutically acceptable carrier, but without limitation to the same.

[0048] As used in this document, the term “pharmaceutically effective quantity” refers to a quantity sufficient to achieve the effectiveness of the pharmaceutical composition in preventing or treating hair loss.

[0049] Pharmaceutically acceptable carriers are commonly used in formulations and include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0050] The weight ratio between the peptide and a pharmaceutically acceptable carrier may be, for example, 500:1 to 1:500, for example, the weight ratio may be 450:1 to 1:450, 400:1 to 1:400, 350:1 to 1:350, 300:1 to 1:300, 250:1 to 1:250, 200:1 to 1:200, 150:1 to 1:150, 100:1 to 1:100, 80:1 to Petition 870250104932, dated 11 / 17 / 2025, page 18 / 45 15 / 29 1:80, 60:1 to 1:60, 40:1 to 1:40, 20:1 to 1:20, 10:1 to 1:10, 8:1 to 1:8, 6:1 to 1:6, 4:1 to 1:4 or 2:1 to 1:2, but without limitation to the same.

[0051] In addition to the above ingredients, the pharmaceutical composition may also include, but is not limited to, lubricants, humectants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc.

[0052] The pharmaceutical composition can be administered orally or parenterally, preferably parenterally, and if administered parenterally, it can be administered by, but not limited to, intramuscular injection, intravenous injection, subcutaneous injection, intraperitoneal injection, topical administration, transdermal administration, etc.

[0053] The dosage of the pharmaceutical composition may be, but is not limited to, 0.0001 to 1000 μg (micrograms), 0.001 to 1000 μg, 0.01 to 1000 μg, 0.1 to 1000 μg or 1.0 to 1000 μg per day, and may be varied by factors such as formulation method, mode of administration, patient age, weight, sex, medical condition, diet, administration time, route of administration, excretion rate and sensitivity response.

[0054] The pharmaceutical composition may be formulated, with a pharmaceutically acceptable carrier and / or excipient, according to a method that can be easily practiced by a person skilled in the art to which the present disclosure pertains, and the composition may be prepared in a unit dose form or may be contained in a multidose container.

[0055] The formulation may be in the form of a Petition 870250104932, dated 11 / 17 / 2025, page 19 / 45 16 / 29 solution, suspension or emulsion in an oily or aqueous medium, or in the form of an extract, powder, granule, tablet or capsule, and may additionally include a dispersant and / or stabilizer.

[0056] Another aspect provides a method for preventing or treating hair loss, which involves administering to a subject a pharmaceutical composition that includes a therapeutically effective amount of a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0057] In the description above of the pharmaceutical composition, the terms or elements cited are the same as those already mentioned.

[0058] Another aspect provides a food composition to prevent hair loss or promote hair growth, which includes a peptide consisting of the amino acid sequence SEQ ID NO: 1 as an active ingredient.

[0059] In the above description of the peptide, the terms or elements cited are the same as those already mentioned.

[0060] The peptide content as an active ingredient in the food composition can be appropriately selected without limitation depending on the food form, intended use, etc., and can be added, for example, from 0.01 to 15% by weight of the total weight of the food. Furthermore, for example, the composition of the healthy drink can be added at a rate of 0.02 to 10 g, preferably 0.3 to 1 g, based on 100 ml. ADVANTAGEOUS EFFECTS OF THE INVENTION

[0061] According to one aspect, the peptide can be applied to promote hair growth, etc., Petition 870250104932, dated 11 / 17 / 2025, page 20 / 45 17 / 29 promoting the proliferation of dermal papilla cells of the human hair follicle, activating beta-catenin or increasing the expression of Lef-1, Cyclin D1 or c-Myc, thus promoting the proliferation or activity of hair follicle cells.

[0062] According to another aspect, the peptide may exhibit the ability to inhibit the expression of hair loss factors and may be applied to suppress hair loss, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 is a graph illustrating the results of measuring the effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in promoting the growth of hair follicle cells.

[0064] Figure 2 shows the results of measuring the effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in promoting the proliferation mechanism of hair follicle cells.

[0065] Figure 3 shows the results that confirm that a peptide consisting of the amino acid sequence SEQ ID NO: 1 increases the expression of Lef-1, Cyclin D1 and cMyc, which are factors related to the activity and growth of hair follicle cells.

[0066] Figure 4 shows the results of measuring the inhibitory effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, on the expression of factors related to hair loss in hair follicle cells.

[0067] Figure 5 shows the results of a comparative measurement of the proliferative effect on hair follicle cells of a peptide consisting of the sequence of Petition 870250104932, dated 11 / 17 / 2025, page 21 / 45 18 / 29 amino acids from SEQ ID NO: 1 and a peptide consisting of the amino acid sequence from SEQ ID NO: 10.

[0068] Figure 6 shows the results of a comparative measurement of the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 10, in promoting the proliferation mechanism of hair follicle cells.

[0069] Figure 7 shows the results of a comparative measurement of the inhibitory effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 10, on the expression of factors related to hair loss. METHOD FOR THE INVENTION

[0070] Hereafter in this document, the present disclosure will be described in more detail with reference to examples. However, these examples are intended to illustrate the present disclosure by way of example, and the scope of the present disclosure is not limited to these examples. EXAMPLE 1: PEPTIDE SYNTHESIS

[0071] A peptide with the amino acid sequence of SEQ ID NO: 1 listed in Table 1 below was synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA), and the synthesized peptide was purified by reverse-phase C18 high-performance liquid chromatography (HPLC) (Waters Associates, USA). The column used was an ACQUITY UPLC BEH300 C18 (2.1 mm Y 100 mm, 1.7 µm, Waters Co, USA). TABLE 1 Petition 870250104932, dated 11 / 17 / 2025, page 22 / 45 19 / 29 SEQ ID NO: Sequence (N terminal ^ C terminal) 1 AERRREKCRC EXAMPLE 2: CONFIRMATION OF THE EFFECT OF PROLIFERATION OF HAIR FOLLICLE CELLS

[0072] To confirm the effect of a peptide consisting of the amino acid sequence SEQ ID NO: 1, in promoting the proliferation of hair follicle cells. Specifically, human hair follicle dermal papilla cells were seeded in a 96-well plate at a density of 4x10³ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The above peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 72 hours. As a positive control group, 1 μM of Minoxidil, a drug for the treatment of hair loss, was administered. After completion of the culture, the culture supernatant was removed and the cells were fixed using ethanol. After washing with PBS, staining was performed by treatment with SRB solution.After washing with 1% acetic acid, the cells were observed under a microscope and decolorized by treatment with 20 mM Tris solution. Cell viability was measured by measuring absorbance at a wavelength of 560 nm using a spectrophotometer (SpectraMax iD3, Molecular Devices (USA, CA)).

[0073] The results are illustrated in Figure 1. From the results in Figure 1, it can be confirmed that proliferation was induced in a concentration-dependent manner in the peptide treatment group, increasing Petition 870250104932, dated 11 / 17 / 2025, page 23 / 45 20 / 29 up to 155%. EXAMPLE 3: CONFIRMATION OF THE EFFECT OF PROMOTING THE MECHANISM OF HAIR FOLLICLE CELL PROLIFERATION

[0074] To confirm the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1, in promoting the proliferation mechanism of hair follicle cells. Specifically, human hair follicle dermal papilla cells were seeded in a 6-well plate at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 24 hours. As a positive control group, 10 ng / ml of recombinant human Wnt-3a protein was treated. After washing with PBS, nucleoproteins were isolated using a nucleoprotein extraction kit (Thermo Scientific, USA) and quantified with BCA to prepare equal amounts of protein samples. Proteins separated by electrophoresis using a 10% SDSPAGE gel were transferred to a PVDF membrane.Blocking was performed at room temperature for 30 minutes using 5% skim milk. β-catenin antibodies (Cell Signaling, USA) and HDAC1 (Santa Cruz, USA) were diluted 1:1000 in 3% BSA and reacted with the membrane at 4°C for 16 hours. The membrane was washed three times with 0.1% BSA. PBS-T (0.1% Tween-20 in PBS) was treated for 15 minutes each time. The secondary antibody was diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. After treatment with Petition 870250104932, dated 11 / 17 / 2025, page 24 / 45 In the 21 / 29 ECL solution (GE Healthcare, USA), the membrane was detected.

[0075] The results are illustrated in Figure 2. From the results in Figure 2, it can be confirmed that β-catenin expression increases when treated with peptide, and that the nuclear translocation of β-catenin from the cytoplasm to the nucleus increases up to 1.35 times by treatment with peptide. EXAMPLE 4: CONFIRMATION OF PROMOTION EFFECT OF HAIR FOLLICLE CELL ACTIVITY

[0076] To confirm the effect of a peptide consisting of the amino acid sequence of SEQ ID NO: 1 in promoting the activity of hair follicle cells. Human hair follicle dermal papilla cells were seeded in 6-well plates at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptide was treated at concentrations of 10 μM, 50 μM, or 100 μM, respectively, and incubated at 37 °C for 24 hours. As a positive control group, 10 ng / ml of recombinant human Wnt-3a protein was treated. After washing with PBS, RNA was isolated by treatment with 300 µl of easy blue (Intron, Korea). After RNA quantification, cDNA synthesis was performed using a cDNA synthesis kit (enzynomics, Korea). PCR was performed using PCR premix (enzynomics, Korea) using the primers Lef1, Cyclin D1, and c-Myc shown in Table 2.Electrophoresis was performed on a 1.5% agarose gel, and band detection was performed using a BioRad gel imaging system.

[0077] The results are illustrated in Figure 3. A Petition 870250104932, dated 11 / 17 / 2025, page 25 / 45 Based on the results in Figure 3, it was confirmed that the expression of Lef-1, c-Myc, and Cyclin D1, which are factors related to the activity and growth of HHFDPC cells, was increased by treatment with the peptide. In the case of Lef-1, expression increased up to 3 times compared to the control group, in the case of Cyclin D1 up to 1.96 times, and in the case of c-Myc up to 1.62 times. TABLE 2 Initiator Sequence SEQ ID NO: LEF-1 forward (5') CCAGCTATTGTAACACCTCA (3') 2 LEF-1 reverse (5') TTCAGATGTAGGCAGCTGTC (3') 3 c-Myc forward (5') ACCAGCAGCGACTCTGAGGAGGAAC (3') 4 c-Myc reverse (5') TGACCCTCTTGGCAGCAGGATAGTCC (3') 5 Cyclin D1 forward (5') ACCTTCGTTGCCCTCTGTGCCACAGATG (3') 6 Cyclin D1 reverse (5') AGGCCCGGAGGGCAGTCCGGGT (3') 7 GAPDH forward (5') GGAGCCAAAAGGGTCATCAT (3') 8 Petition 870250104932, dated 11 / 17 / 2025, p. 26 / 45 23 / 29 Reverse GAPDH (5') GTGATGGCATGGACTGTGGT (3') 9 EXAMPLE 5: CONFIRMATION OF THE EFFECT OF INHIBITING THE Expression of Factors Related to Hair Loss in Hair Follicle Cells

[0078] To confirm the possibility of a peptide, consisting of the amino acid sequence of SEQ ID NO: 1, inhibiting the expression of DKK-1, a factor related to hair loss, in hair follicle cells. Human hair follicle dermal papilla cells were seeded in 6-well plates at a density of 4x10⁵ cells / well and cultured for 24 hours. After replacement with serum-free mesenchymal stem cells, the cells were cultured for 24 hours. The peptides were treated at concentrations of 10 μM, 50 μM or Cells of 100 μM, respectively, were simultaneously treated with DHT, an inducer of the hair loss protein DKK-1, at a concentration of 100 nM. As a positive control group, cells were treated with 5 μM of finasteride, a drug that inhibits androgens. DHT is known as a hair loss hormone that increases the expression of DKK-1 (Dickkopf-related protein 1), a hair loss-inducing factor, by activating androgen receptors. After culturing at 37 °C for 24 hours, the cells were washed with PBS, treated with lysis buffer to prepare cell lysates, and equal amounts of protein samples were prepared by BCA quantification. Electrophoresis was performed using a 10% SDS-PAGE gel. The proteins separated by SDS-PAGE were transferred to a PVDF membrane. Blocking was performed at room temperature for 30 minutes using 5% milk. Petition 870250104932, dated 11 / 17 / 2025, page 27 / 45 24 / 29 skimmed milk. The DKK-1 antibody (cell signaling, USA) was diluted 1:1000 in 3% BSA and reacted with the membrane at 4°C for 16 hours. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. The secondary antibody was diluted 1:2000 in 5% skimmed milk and reacted at room temperature for 1 hour. The membrane was then washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. After treatment with ECL solution (GE Healthcare, USA), protein band detection and densitometry were performed using ImageQuant 800 (Amersham, USA).

[0079] The results are illustrated in Figure 4. From the results in Figure 4, it was possible to confirm the effect of inhibiting DHT-induced DKK-1 expression after peptide treatment. In the high-concentration peptide treatment group, it was confirmed that the DKK-1 expression level was reduced by approximately 50% compared to the negative control group (DHT treatment group). EXAMPLE 6: COMPARISON OF THE EFFECT OF HAIR FOLLICLE CELL PROLIFERATION

[0080] The proliferation effects of a novel peptide consisting of the amino acid sequence of SEQ ID NO: 1 and a peptide consisting of the amino acid sequence of SEQ ID NO: 10 disclosed in KR10-1285259 (Table 3) on hair follicle cell proliferation were compared. The experiment was conducted in the same manner described in Example 2, and the cell proliferation effect was measured after treatment of HHFDPC with peptides at different concentrations. TABLE 3 Petition 870250104932, dated 11 / 17 / 2025, page 28 / 45 25 / 29 SEQ ID NO: Sequence (N terminal ^ C terminal) 10 AERRRELCRC

[0081] The results are illustrated in Figure 5. From the results in Figure 5, it can be confirmed that both a peptide consisting of the amino acid sequence SEQ ID NO: 10 and a novel peptide consisting of the amino acid sequence SEQ ID NO: 1 exhibit a concentration-dependent proliferation effect on hair follicle cells. Furthermore, when comparing the effects of the two peptides, it can be confirmed that the novel peptide exhibits significantly greater hair follicle cell proliferation-promoting activity than the known peptide when treated at the same concentration. EXAMPLE 7: COMPARISON OF THE EFFECTS OF PROMOTING THE PROLIFERATION MECHANISM OF HAIR FOLLICLE CELLS

[0082] The proliferation-promoting effects of a novel peptide consisting of the amino acid sequence SEQ ID NO: 1 and a peptide consisting of the amino acid sequence SEQ ID NO: 10 in hair follicle cells were compared. The experiment was conducted in the same manner as described in Example 3, in which HHFDPC was treated with peptides at various concentrations and the translocation of β-catenin from the cytoplasm to the nucleus was measured.

[0083] The results are illustrated in Figure 6. From the results in Figure 6, it can be confirmed that both a peptide consisting of the amino acid sequence SEQ ID NO: 10 and an innovative peptide consisting of the amino acid sequence SEQ ID NO: 1 promote the translocation of β. Petition 870250104932, 11 / 17 / 2025, page 29 / 45 26 / 29 catenin from the cytoplasm to the nucleus in a concentration-dependent manner. Furthermore, when comparing the activities of the two peptides, it can be confirmed that the innovative peptide exhibits significantly greater proliferation-promoting activity than the known peptide when treated at the same concentration. EXAMPLE 8: COMPARISON OF THE EFFECT OF INHIBITING THE EXPRESSION OF FACTORS RELATED TO HAIR LOSS IN HAIR FOLLICLE CELLS

[0084] The effect of inhibiting the expression of factors related to hair loss was compared between the innovative peptide consisting of the amino acid sequence of SEQ ID NO: 1 and the peptide consisting of the amino acid sequence of SEQ ID NO: 10. The experiment was conducted in the same manner described in Example 5, and it was confirmed that the expression of DKK-1, a factor related to hair loss, could be inhibited after treatment of HHFDPC with peptides at different concentrations.

[0085] The results are illustrated in Figure 7. From the results in Figure 7 it can be confirmed that both a peptide consisting of the amino acid sequence of SEQ ID Both NO:10 and an innovative peptide consisting of the amino acid sequence of SEQ ID NO:1 exhibit a concentration-dependent inhibitory effect on DKK-1 expression. Furthermore, when comparing the inhibitory effects of the two peptides, it can be confirmed that the innovative peptide has a significantly greater capacity to inhibit DKK-1 expression than the known peptide when treated with the same concentration. EXAMPLE OF FORMULATION 1. PREPARATION OF PEPTIDE NANOSOMES Petition 870250104932, dated 11 / 17 / 2025, page 30 / 45 27 / 29

[0086] 50 mg of the peptide from Example 1 above were dissolved in 500 ml of distilled water by sufficient stirring. The composite solution was mixed with 5 g of lecithin, 0.3 ml of sodium oleate, 50 ml of ethanol and a small amount of oil, and the total quantity was adjusted to 1 l with distilled water, and the mixture was then emulsified using a high-pressure microfluidizer to produce peptide nanosomes with a size of approximately 100 nm. EXAMPLE OF FORMULATION 2. LOTION

[0087] A lotion containing the peptide according to an example and consisting of the following composition was prepared using a method known in the art. TABLE 4 Component | Content (% by weight) | Peptide | 1.0 | 1,3-butylene glycol | 6.0 | Glycerin | 4.0 | PEG 1500 | 1.0 | Sodium hyaluronate | 1.0 | Polysorbate 20 | 0.5 | Ethanol | 8.0 | Benzophenone-9 | 0.05 | Preservatives, colorants | As needed | Fragrance | As needed | Purified water | Remaining | Total | 100 Petition 870250104932, dated 11 / 17 / 2025, page 31 / 45 28 / 29 EXAMPLE OF FORMULATION 3. NOURISHING CREAM

[0088] A nourishing cream that includes the peptide according to an example and that consists of the following composition, was prepared using a method known in the art. TABLE 5 Component | Content (% by weight) | Peptide | 2.0 | Glycerin | 10.0 | 1,3-Butylene Glycol | 5.0 | PEG 1500 | 2.0 | Allantoin | 0.1 | DL-Panthenol | 0.3 | EDTA-2Na | 0.02 | Hydroxyethylcellulose | 0.1 | Sodium Hyaluronate | 8.0 | Carboxvinyl Polymer | 0.2 | Triethanolamine | 0.18 | Octyldodeceth-16 | 0.4 | Ethanol | 6 | Preservatives, Colorants | As needed | Fragrance | As needed | Purified Water | Remaining | Total | 100 Petition 870250104932, dated 11 / 17 / 2025, page 32 / 45 29 / 29

[0089] The preceding description of the present disclosure is for illustrative purposes only, and anyone of ordinary skill in the art to which the present disclosure pertains will understand that it can be easily adapted to other specific forms without altering the essential technical ideas or features of the present disclosure. Therefore, the examples described above should be understood in all respects as illustrative and not restrictive. Petition 870250104932, dated 11 / 17 / 2025, pp. 33 / 45

Claims

1 / 2 CLAIMS 1. Peptide characterized by consisting of the amino acid sequence of SEQ ID NO:

1.

2. Peptide, according to claim 1, characterized in that an N-terminal of the peptide is linked to any protecting group selected from the group consisting of an acetyl group, a fluoroeonylmethoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, a butoxycarbonyl group, an allyloxycarbonyl group and polyethylene glycol (PEG).

3. Peptide, according to claim 1, characterized in that a C-terminal of the peptide is linked to any protecting group selected from the group consisting of an amino group (-NH2), a tertiary alkyl group and an azide group (-NHNH2).

4. Peptide, according to claim 1, characterized in that the peptide exhibits one or more features selected from the following: (a) promotion of proliferation of human hair follicle dermal papilla cells; (b) activation of β-catenin; (c) increased expression of lymphoid enhancer-binding factor-1 (LEF-1), cyclin D1 or c-Myc; and (d) inhibition of DKK-1 (Dickkopf-related protein 1) expression.

5. Cosmetic composition to improve hair loss or promote hair growth, characterized by comprising the peptide, as defined in any one of claims 1 to 4, as the active ingredient. Petition 870250090816, dated 06 / 10 / 2025, page 13 / 19 2 / 2 6. Pharmaceutical composition for preventing or treating hair loss, characterized by comprising the peptide, as defined in any one of claims 1 to 4, as the active ingredient. Petition 870250090816, dated 06 / 10 / 2025, page 14 / 19

Images