A polynucleotide encoding a transposon, vector, cell, pharmaceutical composition, transposons, and methods for treating a disease or disorder.

Description

1 / 53 “POLYNUCLEOTIDE ENCODING A TRANSPOSON, VECTOR, CELL, PHARMACEUTICAL COMPOSITION, TRANSPOSONS AND METHODS FOR TREATING A DISEASE OR DISORDER” Cross-reference to related orders

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 494,300, filed April 5, 2023, which is incorporated herein by reference in its entirety. Reference to the Electronically Submitted Sequence Listing

[0002] This application contains a Sequence Listing that was submitted in XML format via the Patent Center and is incorporated herein by reference in its entirety. The said XML copy, created on March 19, 2024, is named “POTH-081_001WO_SeqList” and is 101,935 bytes in size. Technical Field

[0003] This disclosure generally refers to superminimal transposon inverted repeat sequence (ITR) polynucleotides, compositions comprising the polynucleotides, and methods of using compositions comprising the polynucleotides for the ex vivo and in vivo delivery of nucleic acids to cells, in particular, in vivo delivery of therapeutic genes to treat genetic diseases or disorders. Background

[0004] Transposases can be used to introduce non-endogenous DNA sequences into genomic DNA and are, in many respects, advantageous compared to other gene editing methods. However, there is still an unmet need for improvements in transposon ITR design to enhance transposase integration and / or excision activity ex vivo or in vivo.

[0005] The piggyBac (PB) transposase contains two domains of Petition 870250091033, dated 06 / 10 / 2025, page 56 / 114 2 / 53 Distinct DNA binding sites interact with the inverted terminal repeat (ITR) sequences of a transposon. The DNA-binding and dimerizing domain (DDBD) binds to the sequence proximal to the TTAA sites flanking the transposon, while the Cysteine-Rich Domain (CRD) at the C-terminus of the protein binds to the sequence distal to the TTAA sites. After transposase dimerization, the DDBDs bind symmetrically to the ITRs, with the DDBD of one monomer binding to the left-end (LE) ITR and the DDBD of the second monomer binding to the right-end (RE) ITR, while the two CRDs of the dimer bind asymmetrically, with both binding to the LE ITR. Based on sequence homology, the ER ITR is predicted to comprise two CRD binding sites, suggesting that a second PB transposase dimer may bind distally to the first dimer.The proximal dimer is thought to catalyze the transposition reaction, while the distal dimer stabilizes the formation of the hairpin structure that links the LE and RE, a prerequisite for transposition to occur.

[0006] The DDBD and CRD of the PB transposase bind to ITRs in a sequence-specific manner. The LE ITR comprises approximately 35 bp of DNA, while the ER ITR is approximately 63 bp long. The DDBD interacts with about 10 bp of DNA located 6 bp away from the TTAA sequences flanking the transposon. DDBD binding is symmetrical, with the DDBD of one transposase monomer binding to the LE ITR and the DDBD of the second monomer binding to the ER ITR. The CRD domains of the dimer bind to a 19 bp sequence of the LE ITR found immediately distal to the DDBD binding site. CRD binding is asymmetrical, with both CRD domains of the dimer interacting only with the 19 bp sequence in the LE ITR. RE ITR comprises a second DDBD linker sequence followed by a 19 bp CRD linker sequence beginning 34 bp from TTAA, a potential binding site of Petition 870250091033, dated 06 / 10 / 2025, p. 57 / 114 3 / 53 PB transposase of the second dimer.

[0007] In nature, the 5' untranslated region (UTR) and the 3'UTR are found directly adjacent to the LE and RE ITRs, respectively, of the transposon, with the PB transposase coding sequence juxtaposed between the UTRs. The PB 5'UTR and 3'UTR are not required for transposition; however, the 5'UTR and 3'UTR, or at least a portion thereof, are frequently retained in recombinant transposon constructs for DNA delivery, as they are believed to increase the transposition rate through an undescribed mechanism. Based on sequence homology, the hypothesis is that the 5'UTR contains a sequence that shares a reasonable degree of similarity with a PB transposase binding site.

[0008] Generally, the LE ITR and 5'UTR together comprise 328 bp of DNA, while the RE ITR and 3'UTR together comprise 359 bp. In some transposon constructs, the 5'UTR end distal to the TTAA may be truncated, resulting in a length of 309 bp for the LE ITR+5'UTR. Similarly, the 3'UTR end distal to the TTAA has been truncated, resulting in a length of 238 bp for the RE ITR+3'UTR. The combined 309 bp LE ITR / 5'UTR and 238 bp RE ITR / 3'UTR are often referred to as Complete ITRs.

[0009] Transposon ITR sequences in which the 5'UTR has been deleted (generating a 35 bp LE ITR) and ITR sequences in which the 3'UTR has been deleted (generating a 63 bp RE ITR) are called Minimum LE PB ITRs and Minimum RE ITRs, respectively. Such minimum ITRs are provided in this document. Brief Description

[0010] In one aspect, a polynucleotide encoding a transposon comprising a right-end (RE) piggyBac inverted terminal repeat (ITR) sequence is provided in this document. Petition 870250091033, dated 06 / 10 / 2025, p. 58 / 114 4 / 53 superminimal and a minimal left-end (LE) ITR sequence, wherein the superminimal RE piggyBac ITR comprises the nucleic acid sequence established in any of the SEQ ID NOs: 3-9 and 46-67 and the LE ITR comprises the sequence of SEQ ID NO: 1. In some embodiments, the transposon is a piggyBac transposon or a piggyBac-like transposon.

[0011] In some embodiments, the polynucleotide additionally comprises at least one exogenous nucleic acid sequence. In some embodiments, at least one exogenous nucleic acid sequence encodes a non-naturally occurring antigen receptor. In some embodiments, at least one exogenous nucleic acid sequence encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide is the Factor VIII polypeptide, Factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.

[0012] In some embodiments, the polynucleotide additionally comprises a promoter sequence. In some embodiments, the RE ITR is in reverse orientation and / or the LE ITR is in reverse orientation.

[0013] In another aspect, a vector comprising a polynucleotide described in this document is provided herein.

[0014] In another aspect, a cell comprising a polynucleotide provided in this document is provided herein.

[0015] In another aspect, a pharmaceutical composition comprising a cell provided herein and a pharmaceutically acceptable vehicle is provided herein.

[0016] In another aspect, a transposon is provided in the present document, comprising, in the order of 5' to 3': (i) a left-end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) a Petition 870250091033, dated 06 / 10 / 2025, page 59 / 114 5 / 53 an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a superminimal right-end (RE) inverted terminal repeat (ITR) sequence.

[0017] In another aspect, a transposon is provided in the present document, comprising, in the order of 5' to 3': (i) a left-end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a superminimal right-end (RE) inverted terminal repeat (ITR) sequence.

[0018] In another aspect, a transposon is provided in the present document, comprising, in the order of 5' to 3': (i) a right-end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a superminimal left-end (LE) inverted terminal repeat (ITR) sequence.

[0019] In another aspect, a transposon is provided in the present document, comprising, in the order of 5' to 3': (i) a right-end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a superminimal left-end (LE) inverted terminal repeat (ITR) sequence.

[0020] In some embodiments, the therapeutic polypeptide is Factor VIII polypeptide, Factor IX polypeptide, phenylalanine hydroxylase (PAH), ornithine transcarbamylase (OTC) polypeptide, or methylmalonyl-CoA mutase (MUT1) polypeptide.

[0021] In another aspect, a method is provided in this document for treating a disease or disorder in an individual who needs it, comprising administering to the individual (i) at least one dose Petition 870250091033, dated 06 / 10 / 2025, pp. 60 / 114 6 / 53 therapeutically effective vector described herein, or transposon described herein, and (ii) a transposase or a nucleic acid or nucleic acid sequence encoding a transposase enzyme. In some embodiments, the transposase is an SPB transposase, a TAL-ss-SPB PBx transposase fusion protein, or a ZNF-ssSPB transposase fusion protein.

[0022] In another aspect, a method is provided in this document for treating a disease or disorder in an individual who needs it, comprising administering to the individual at least one therapeutically effective dose of a cell described in this document. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic disorder of the liver, or a hemophilia disease.

[0023] All documents cited in this document, including any patent or application referenced or related, are incorporated herein by reference in their entirety for all purposes, unless expressly excluded or otherwise limited. Citation of any document is not an admission that it pertains to the prior art with respect to any invention disclosed or claimed herein or that it alone, or in any combination with any other reference or references, teaches, suggests or discloses such invention. Detailed Description

[0024] This document provides superminimal PB transposon inverted terminal repeat (ITR) sequences, in particular, superminimal PB transposon right-end (RE) ITR polynucleotides, transposons comprising the superminimal PB ITR polynucleotides, and methods for using them. Minimal ITRs are believed to be advantageous because they improve transposition frequency. Without Petition 870250091033, dated 06 / 10 / 2025, pp. 61 / 114 7 / 53 While not limited by theory, it is believed that shorter sequences reduce the size of the transposon and plasmid, improving transposition. Furthermore, since the left and right ITRs are similar in sequence, superminimal ITRs reduce plasmid repeatability, which may improve its stability during production.

[0025] In addition, methods of treating a disease or disorder in an individual in need thereof are provided, comprising administering to the individual at least one therapeutically effective dose of a polynucleotide, transposon, vector, cell or composition described herein. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic liver disorder or a hemophilia disease. Transposition Systems Transpose

[0026] Any suitable transposase can be used to introduce the superminimal transposons described herein into a cell. In some embodiments, the transposase is a piggyBac transposase. In some embodiments, the transposase is a super piggyBac (SPB) transposase. In some embodiments, a PBx TALssSPB fusion protein is used, for example, a TAL-ssPBx fusion protein comprising a TAL array with DNA sequences flanking upstream and downstream of a TTAA integration site fused to a piggyBac transposase comprising an N-terminal deletion of amino acids 1-93 and further comprising four hyperactive SPB mutations, as well as mutations that render transposase integration deficient but maintain normal excision activity (PBx).

[0027] The transposon in this disclosure may be a piggyBac (PB) transposon. In certain respects, the transposon comprises a Petition 870250091033, dated 06 / 10 / 2025, p. 62 / 114 8 / 53 ITR superminimal transposon. In some respects, the transposon is delivered to a cell using nano transposons. Nano transposons are described, for example, in International Patent Application Publication No. WO2020132396, which is incorporated herein by reference in its entirety as examples of nano transposons that can be used to deliver the transposons described herein to a cell.

[0028] In one aspect, a polynucleotide encoding a transposon is provided in the present document, comprising a superminimal right-end (RE) piggyBac inverted terminal repeat (ITR) sequence and a left-end (LE) minimal ITR sequence.

[0029] It will be evident to a person skilled in the art that the ER ITR may be located 5' for LE ITRs or 3' for the LE ITR, provided that the 3' ITR sequence is a reverse complement of the 5' ITR sequence. Thus, in another aspect, a transposon is provided herein comprising, in the order of 5' to 3': (i) a left-end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or a non-naturally occurring antigen receptor; and (iv) a reverse complement of a superminimal right-end (ER) inverted terminal repeat (ITR) sequence.

[0030] In another aspect, a transposon is provided in the present document, comprising, in the order of 5' to 3': (i) a right-end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide or a non-naturally occurring antigen receptor; and (iv) a reverse complement of a superminimal left-end (LE) inverted terminal repeat (ITR) sequence.

[0031] In certain respects, the superminimal transposon ITR is Petition 870250091033, dated 06 / 10 / 2025, pp. 63 / 114 9 / 53 a superminimal right-end (RE) piggyBac ITR provided in this document. In some embodiments, the superminimal RE piggyBac ITR comprises the nucleic acid sequence established in either of the SEQ ID Nos.: 3-9 or 46-67.

[0032] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCA (SEQ ID NO: 9). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 9. In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATA (SEQ ID NO: 8).In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 8. In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTG (SEQ ID NO: 7). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 7. In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence. Petition 870250091033, dated 06 / 10 / 2025, pp. 64 / 114 10 / 53 CCCTAGAAAGATAATCATATTGTGACGTA (SEQ ID NO: 6). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 6. In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTA (SEQ ID NO: 5). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 5. In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGAT (SEQ ID NO. 4). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 4.In some embodiments, the RE PB PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCA (SEQ ID NO. 3). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least. Petition 870250091033, dated 06 / 10 / 2025, pp. 65 / 114 11 / 53 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 3.

[0033] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATC (SEQ ID NO: 46). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 46.

[0034] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCAT (SEQ ID NO: 47). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 47.

[0035] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATAT (SEQ ID NO: 48). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 48.

[0036] In some realizations, the ITR of PB of RE superminima Petition 870250091033, dated 06 / 10 / 2025, p. 66 / 114 12 / 53 comprises the nucleic acid sequence CCCTAGAAAGATAATCATATT (SEQ ID NO: 49). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 49.

[0037] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTG (SEQ ID NO: 50). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 50.

[0038] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGT (SEQ ID NO: 51). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 51.

[0039] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGA (SEQ ID NO: 52). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least Petition 870250091033, dated 06 / 10 / 2025, p. 67 / 114 13 / 53 less than 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 52.

[0040] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGAC (SEQ ID NO: 53). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 53.

[0041] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACG (SEQ ID NO: 54). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 54.

[0042] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGT (SEQ ID NO: 55). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least Petition 870250091033, dated 06 / 10 / 2025, pp. 68 / 114 14 / 53 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 55.

[0043] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTAC (SEQ ID NO: 56). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 56.

[0044] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACG (SEQ ID NO: 57). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 57.

[0045] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGT (SEQ ID NO: 58). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or Petition 870250091033, dated 06 / 10 / 2025, pp. 69 / 114 15 / 53 at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 58.

[0046] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTT (SEQ ID NO: 59). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 59.

[0047] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAA (SEQ ID NO: 60). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 60.

[0048] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAA (SEQ ID NO: 61). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence. Petition 870250091033, dated 06 / 10 / 2025, pp. 70 / 114 16 / 53 established in SEQ ID NO: 61.

[0049] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAG (SEQ ID NO: 62). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 62.

[0050] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGA (SEQ ID NO: 63). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 63.

[0051] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATA (SEQ ID NO: 64). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 64. Petition 870250091033, dated 06 / 10 / 2025, pp. 71 / 114 17 / 53

[0052] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAA (SEQ ID NO: 65). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 65.

[0053] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAAT (SEQ ID NO: 66). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 66.

[0054] In some embodiments, the superminimal RE PB ITR comprises the nucleic acid sequence CCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATC (SEQ ID NO: 67). In some embodiments, the superminimal RE PB ITR comprises a nucleic acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the nucleic acid sequence established in SEQ ID NO: 67.

[0055] In some embodiments, the transposon comprises Petition 870250091033, dated 06 / 10 / 2025, pp. 72 / 114 18 / 53 additionally a minimal left-end (LE) piggyBac ITR sequence, comprising the nucleic acid sequence SEQ ID NO: 1).

[0056] In some respects, when the transposon is a PB transposon, the transposase is a piggyBac® (PB) transposase, a piggyBac-like (PBL) transposase, or a Super piggyBac® (SPB) transposase. Preferably, the sequence encoding the SPB transposase is an mRNA sequence.

[0057] Non-limiting examples of PB transposons and PB, PBL, and SPB transposases are described in detail in U.S. Patent No. 6,218,182; U.S. Patent No. 6,962,810; U.S. Patent No. 8,399,643 and PCT Publication No. WO 2010 / 099296, each of which is incorporated herein by reference in its entirety for examples of transposases that may be used in conjunction with the transposons described herein.

[0058] Without wanting to limit ourselves to theory, it is believed that PB, PBL and SPB transposases recognize transposon-specific inverted terminal repeat (ITR) sequences at the transposon ends and then insert the nucleotide sequence located between the transposon ITRs into a target site. The target sequence of the PB or PBL transposon may comprise or consist of the sequence 5'-TTAT-3', 5'-TTAA-3', 5'-CTAA-3', 5'TTAG-3', 5'-ATAA-3', 5'-TCAA-3', 5'AGTT-3', 5'-ATTA-3', 5'-GTTA-3', 5'-TTGA3', 5'-TTTA-3', 5'-TTAC-3', 5'-ACTA-3', 5'-AGGG-3', 5'-CTAG-3', 5'-TGAA-3', 5'AGGT-3', 5'-ATCA-3', 5'-CTCC-3', 5'-TAAA-3', 5'-TCTC-3', 5'TGAA-3', 5'-AAAT3', 5'-AATC-3', 5'-ACAA-3', 5'-ACAT-3', 5'-ACTC-3', 5'-AGTG-3', 5'-ATAG-3', 5'CAAA-3', 5'-CACA-3', 5'-CATA-3', 5'-CCAG-3', 5'-CCCA-3', 5'-CGTA-3', 5'GTCC-3', 5'-TAAG-3', 5'-TCTA-3', 5'-TGAG-3', 5'-TGTT-3', 5'-TTCA-3', 5'-TTCT3' or 5'-TTTT-3'. In some embodiments, the transposon system is PB or PBL. Petition 870250091033, dated 06 / 10 / 2025, pp. 73 / 114 19 / 53 has no size limit for the genes of interest that can be included among the ITRs.

[0059] Illustrative amino acid sequences for one or more PB, PBL, and SPB transposases are disclosed in U.S. Patent No. 6,218,185; U.S. Patent No. 6,962,810 and U.S. Patent No. 8,399,643, each of which is incorporated herein by reference in its entirety for examples of transposases that may be used in conjunction with the transposons described herein.

[0060] A PB or PBL transposase may comprise or consist of an amino acid sequence with an amino acid substitution at two or more, at three or more, or at each of the positions 30, 165, 226, 282, or 538 of the sequence SEQ ID NO: 45 (with numbering beginning at the 12th amino acid of SEQ ID NO: 45). In some embodiments, the amino acid substitutions are hyperactive amino acid substitutions. The transposase may be an SPB transposase comprising or consisting of the amino acid sequence of the sequence SEQ ID NO: 45 with one, two, three, or all of the hyperactive amino acid substitutions I30V, G165S, M226F, M282V, and N538K, with numbering beginning at position 12 of SEQ ID NO: 45.In one aspect, the SPB transposase comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence established in SEQ ID NO: 45. In some embodiments, the SPB transposase comprises the amino acid sequence established in SEQ ID NO: 45 with one, two, three, four, or five conservative amino acid substitutions. In some embodiments, the SPB transposase comprises the amino acid sequence established in SEQ ID NO: 45. Formulations, Dosages and Methods of Administration

[0061] This disclosure provides formulations, dosages and Petition 870250091033, dated 06 / 10 / 2025, pp. 74 / 114 20 / 53 methods for administering the compositions and cells described herein. In one aspect, a pharmaceutical composition comprising a tandem dimer transposase described herein and a pharmaceutically acceptable carrier is provided herein. In another aspect, a pharmaceutical composition comprising a modified cell described herein and a pharmaceutically acceptable carrier is provided herein.

[0062] The disclosed pharmaceutical compositions and formulations may include at least one of any suitable excipients, such as, but not limited to, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservatives, adjuvants or the like. Pharmaceutically acceptable excipients are preferred. Non-limiting examples and methods of preparing such sterile solutions are well known in the art, such as, but not limited to, Gennaro, Ed., Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Co. (Easton, Pa.) 1990 and in the “Physician's Desk Reference”, 52nd edition, Medical Economics (Montvale, NJ) 1998. Pharmaceutically acceptable vehicles may be routinely selected that are suitable for the mode of administration, solubility and / or stability of the protein structure, fragment composition or variants, as well known in the art or as described herein.

[0063] Non-limiting examples of pharmaceutical excipients and additives suitable for use include proteins, peptides, amino acids, lipids and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra- and oligosaccharides; derivatized sugars, such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which may be present individually or in combination, comprising alone or in combination from 1-99.99% by weight or volume. Non-limiting examples of protein excipients include serum albumin, such as Petition 870250091033, dated 06 / 10 / 2025, pp. 75 / 114 21 / 53 Human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and similar components. Representative amino acid / protein components, which may also act as buffers, include alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and similar components. Glycine is a preferred amino acid.

[0064] Non-limiting examples of carbohydrate excipients suitable for use include monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, sorbose and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose and the like; polysaccharides, such as raffinose, melezitose, maltodextrins, dextrans, starches and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol (glucitol), myo-inositol and the like. Preferably, the carbohydrate excipients are mannitol, trehalose and / or raffinose.

[0065] The compositions may also include a buffer or pH adjusting agent; typically, the buffer is a salt prepared from an organic acid or base. Representative buffers include salts of organic acids, such as salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine hydrochloride, or phosphate buffers. Preferred buffers are salts of organic acids, such as citrate.

[0066] In addition, the disclosed compositions may include polymeric excipients / additives such as polyvinylpyrrolidones, ficolls (a polymeric sugar), dextrates (e.g., cyclodextrins, such as 2-hydroxypropyl-cyclodextrin), polyethylene glycols, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, surfactants (e.g., polysorbates, such as TWEEN 20 and TWEEN 80), lipids (e.g., phospholipids, fatty acids), steroids (e.g., cholesterol) and Petition 870250091033, dated 06 / 10 / 2025, pp. 76 / 114 22 / 53 chelating agents (e.g., EDTA).

[0067] Many known and developed methods can be used to administer therapeutically effective amounts of the compositions or pharmaceutical compositions disclosed in this document. Non-limiting examples of administration methods include bolus, buccal, infusion, intra-articular, intrabronchial, intra-abdominal, intracapsular, intracartilaginous, intracavitary, intracerebellar, intracerebroventricular, intracolic, intracervical, intragastric, intrahepatic, intralesional, intramuscular, intramyocardial, intranasal, intraocular, intraosseous, intrapelvic, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrarectal, intrarenal, intraretinal, intraspinal, intrasynovial, intrathoracic, intrauterine, intratumoral, intravenous, intravesical, oral, parenteral, rectal, sublingual, subcutaneous, transdermal, or vaginal.In preferred embodiments, a composition comprising a modified cell described herein is administered intravenously, for example, by intravenous infusion.

[0068] A composition disclosed herein may be prepared for parenteral use (subcutaneous, intramuscular or intravenous) or any other administration, particularly in the form of liquid solutions or suspensions. For parenteral administration, a composition disclosed herein may be formulated as a solution, suspension, emulsion, particle, powder or lyophilized powder in combination, or supplied separately, with a pharmaceutically acceptable parenteral vehicle.

[0069] Formulations for parenteral administration may contain as common excipients water or sterile saline solution, polyalkylene glycols such as polyethylene glycol, vegetable oils, hydrogenated naphthalenes and the like. Aqueous or oily suspensions for injection may be prepared using an appropriate emulsifier or wetting agent. Petition 870250091033, dated 06 / 10 / 2025, pp. 77 / 114 23 / 53 of suspension, according to known methods. The agents for injection or infusion may be a non-toxic diluent that is not orally administered, such as an aqueous solution, a sterile injectable solution, or a suspension in a solvent.

[0070] As a usable vehicle or solvent, water, Ringer's solution, isotonic saline solution, etc. are permitted; as a common solvent or suspension solvent, sterile volatile oil may be used. For these purposes, any type of volatile oil and fatty acid may be used, including natural, synthetic, or semi-synthetic fatty oils or fatty acids; natural, synthetic, or semi-synthetic mono-, di-, or triglycerides. Parenteral administration is known in the art and includes, among others, conventional means of injection, a needleless injection device under gas pressure, as described in U.S. Patent No. 5,851,198, and a laser-piercing device, as described in U.S. Patent No. 5,839,446.

[0071] It may be desirable to deliver the disclosed compounds to the individual for extended periods, for example, for periods of one week to one year from a single administration. Various slow-release, depot, or implantable pharmaceutical forms may be used.For example, a dosage form may contain a pharmaceutically acceptable non-toxic salt of compounds that have a low degree of solubility in body fluids, for example, (a) an acid addition salt with a polybasic acid, such as phosphoric acid, sulfuric acid, citric acid, tartaric acid, tannic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalene mono- or disulfonic acids, polygalacturonic acid and the like; (b) a salt with a polyvalent metallic cation, such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium and the like, or with an organic cation formed from, for example, N,N'-dibenzyl-ethylenediamine or ethylenediamine; or (c) combinations of (a) and (b), for example, a zinc tannate salt. Furthermore. Petition 870250091033, dated 06 / 10 / 2025, pp. 78 / 114 24 / 53 In addition, the disclosed compounds or, preferably, a relatively insoluble salt, such as those described above, can be formulated into a gel, for example, an aluminum monostearate gel with, for example, sesame oil, suitable for injection. Particularly preferred salts are zinc salts, zinc tannate salts, pamoate salts and the like.

[0072] Another type of slow-release depot formulation for injection would contain the compound or salt dispersed for encapsulation in a slow-degrading, non-toxic, and non-antigenic polymer, such as a polylactic acid / polyglycolic acid polymer, for example, as described in U.S. Patent No. 3,773,919. The compounds, or preferably relatively insoluble salts, as described above, may also be formulated in silastic pellets with a cholesterol matrix, particularly for use in animals. Additional slow-release, depot, or implant formulations, for example, gaseous or liquid liposomes, are known in the literature (U.S. Patent No. 5,770,222 and Sustained and Controlled Release Drug Delivery Systems, J.R. Robinson ed., Marcel Dekker, Inc., NY, 1978). Treatment Methods

[0073] The disclosure provides the use of a disclosed composition or pharmaceutical composition for the treatment of a disease or disorder in a cell, tissue, organ, animal or individual, as known in the art or as described herein, using the disclosed compositions and pharmaceutical compositions, for example, by administering or bringing into contact the cell, tissue, organ, animal or individual with a therapeutically effective amount of the composition or pharmaceutical composition. In one aspect, the individual is a mammal. Preferably, the individual is human. The terms individual and patient are used interchangeably herein.

[0074] In some respects, the treatment of a disease or Petition 870250091033, dated 06 / 10 / 2025, pp. 79 / 114 25 / 53 disorder comprises adoptive cell therapy. For example, in one aspect, the disclosure provides modified cells that express a chimeric antigen receptor (CAR). The transposons described herein can be used to generate such modified cells. The modified cells can be allogeneic or autologous to the patient. In some preferred embodiments, the modified cell is an allogeneic cell. In some embodiments, the modified cell is an autologous T cell or a modified autologous CAR T cell. In some preferred embodiments, the modified cell is an allogeneic T lymphocyte or a modified allogeneic CAR T lymphocyte.

[0075] In some embodiments, the disease or disorder treated according to the methods described in this document is cancer. Non-limiting examples of cancer include leukemia, acute leukemia, acute lymphoblastic leukemia (ALL), acute lymphocytic leukemia, B-cell, T-cell or FAB ALL, acute myeloid leukemia (AML), acute myeloid leukemia, chronic myelocytic leukemia (CML), chronic lymphocytic leukemia (CLL), hairy cell leukemia, myelodysplastic syndrome (MDS), lymphoma, Hodgkin's disease, malignant lymphoma, non-Hodgkin's lymphoma, Burkitt's lymphoma, multiple myeloma, Kaposi's sarcoma, colorectal carcinoma, pancreatic carcinoma, nasopharyngeal carcinoma, malignant histiocytosis, paraneoplastic syndrome / hypercalcemia of malignancy, solid tumors, bladder cancer, breast cancer, colorectal cancer, endometrial cancer, head cancer, neck cancer, hereditary nonpolyposis cancer, Hodgkin's lymphoma, liver cancer, lung cancer,Non-small cell lung cancer, ovarian cancer, pancreatic cancer, prostate cancer, renal cell carcinoma, testicular cancer, adenocarcinomas, sarcomas, malignant melanoma, hemangioma, metastatic disease, cancer-related bone resorption, cancer-related bone pain, and similar conditions.

[0076] In another non-limiting example, the present disclosure provides methods for treating a hepatic metabolic disorder in an individual, Petition 870250091033, dated 06 / 10 / 2025, pp. 80 / 114 26 / 53 comprising administering to the individual: a) at least a therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least a therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some respects, the hepatic metabolic disorder may be Ornithine Transcarbamylase (OTC) Deficiency and at least one therapeutic protein may comprise the ornithine transcarbamylase (OTC) polypeptide. In some respects, the hepatic metabolic disorder may be methylmalonic acidemia (MMA) and at least one therapeutic protein may comprise a methylmalonyl-CoA mutase (MUT1) polypeptide.

[0077] In a non-limiting example, the present disclosure provides methods for treating a hemophilic disease in an individual, the methods comprising administering to the individual: a) at least a therapeutically effective amount of at least one composition comprising a transposon of the present disclosure comprising a sequence encoding a therapeutic polypeptide; and b) at least a therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase. In some aspects, the hemophilic disease may be hemophilia A and at least one therapeutic protein may comprise Factor VIII. In some aspects, the hemophilic disease may be hemophilia B and at least one therapeutic protein may comprise Factor IX.

[0078] In a non-limiting example, the present disclosure provides methods for treating phenylketonuria (PKU) in an individual, the methods comprising administering to the individual: at least a therapeutically effective amount of at least one composition comprising a Petition 870250091033, dated 06 / 10 / 2025, pp. 81 / 114 27 / 53 transposon of the present disclosure comprising a sequence encoding the phenylalanine hydroxylase gene; and b) at least a therapeutically effective amount of a composition comprising a nucleic acid sequence encoding at least one transposase.

[0079] In a non-limiting example, the present disclosure provides methods for treating a disease or disorder in an individual by administering to the individual in need thereof a therapeutically effective amount of an LNP composition comprising a DNA transposon encoding a therapeutic protein comprising a superminimal ITR and an mRNA encoding a piggyBac transposase. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic disorder of the liver, or a hemophilia disease.

[0080] In a non-limiting example, the present disclosure provides methods for treating a disease or disorder in an individual by administering to the individual in need thereof a therapeutically effective amount of a first LNP composition comprising a DNA transposon encoding a therapeutic protein comprising a superminimal ITR and a second LNP composition comprising an mRNA encoding a piggyBac transposase. In some embodiments, the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a metabolic disorder of the liver, or a hemophilia disease. In some embodiments, the disease or disorder is an autoimmune disease.In one realization, autoimmune disease includes autoimmune neutropenia, Guillain-Barré syndrome, epilepsy, autoimmune encephalitis, Isaacs syndrome, nevus syndrome, pemphigus vulgaris, pemphigus decidua, bullous pemphigoid, acquired epidermolysis bullosa, gestational pemphigoid, mucous membrane pemphigoid, antiphospholipid antibody syndrome, autoimmune anemia, myasthenia gravis, and other similar conditions. Petition 870250091033, dated 06 / 10 / 2025, pp. 82 / 114 28 / 53 Autoimmune Graves' disease, thyroid eye disease (TED), Goodpasture's syndrome, multiple sclerosis, rheumatoid arthritis, lupus, idiopathic thrombocytopenic purpura (ITP), warm autoimmune hemolytic anemia (WAIHA), chronic inflammatory demyelinating polyneuropathy (CIDP), lupus nephritis, or membranous nephropathy.

[0081] The dosage of a pharmaceutical composition to be administered to an individual may vary depending on known factors, such as the pharmacodynamic characteristics of the specific agent and its mode and route of administration; age, health and weight of the recipient; nature and extent of symptoms, type of concomitant treatment, frequency of treatment and the desired effect.

[0082] In aspects where the compositions to be administered to an individual require modified cells as disclosed in this document, between approximately 1x103 and approximately 1x104 cells; between approximately 1x104 and approximately 1x105 cells; between approximately 1x105 and approximately 1x106 cells; between approximately 1x106 and approximately 1x107 cells; between approximately 1x107 and approximately 1x108 cells; between approximately 1x108 and approximately 1x109 cells; between about 1x10⁹ and about 1x10¹⁰ cells, between about 1x10¹⁰ and about 1x10¹¹ cells, between about 1x10¹¹ and about 1x10¹² cells, between about 1x10¹² and about 1x10¹³ cells, between about 1x10¹³ and about 1x10¹⁴ cells, between about 1x10¹⁴ and about 1x10¹⁵ cells, between about 1x10¹⁵ and about 1x10¹⁶ cells, between about 1x10¹⁶ and about 1x10¹⁷ cells, between about 1x10¹⁷ and about 1x10¹⁸ cells, between about 1x10¹⁸ and about 1x10¹⁹ cells; Or between approximately 1x1019 and approximately 1x1020 cells can be administered.In some embodiments, the cells are administered in a dose of between approximately 5x10⁶ and approximately 25x10⁶ cells.

[0083] In other embodiments, the cell dosage may depend on the person's body weight, for example, between about 1x103 and about Petition 870250091033, dated 06 / 10 / 2025, pp. 83 / 114 29 / 53 of 1x10⁴ cells; between approximately 1x10⁴ and approximately 1x10⁵ cells; between approximately 1x10⁵ and approximately 1x10⁶ cells; between approximately 1x10⁶ and approximately 1x10⁷ cells; between approximately 1x10⁷ and approximately 1x10⁸ cells; between approximately 1x10⁸ and approximately 1x10⁹ cells; between approximately 1x10⁹ and approximately 1x10¹⁰ cells, between approximately 1x10¹⁰ and approximately 1x10¹¹ cells, between approximately 1x10¹¹ and approximately 1x10¹² cells, between approximately 1x10¹² and approximately 1x10¹³ cells, between approximately 1x10¹³ and approximately 1x10¹⁴ cells, between approximately 1x10¹⁴ and approximately 1x10¹⁵ cells, between approximately 1x10¹⁵ and approximately 1x10¹⁶ cells, between approximately 1x10¹⁶ and approximately 1x10¹⁷ cells, between approximately 1x10¹⁷ and approximately 1x10¹⁸ cells, between approximately 1x10¹⁸ and approximately 1x10¹⁹ cells; Between approximately 1x10¹⁹ and approximately 1x10²⁰ cells can be administered per kg of the individual's body weight.

[0084] A more detailed description of pharmaceutically acceptable excipients, formulations, dosages and methods of administration of the disclosed compositions and pharmaceutical compositions is published in PCT Publication No. WO 2019 / 049816, which is incorporated herein by reference in its entirety. Kits

[0085] In another aspect, a kit is provided herein comprising a cell line that has been engineered to include a modified target site for an SPB or a PBx provided herein within its genome, preferably in a highly expressed genomic region. The kit may further comprise a composition that includes one or more superminimal PB transposon inverted terminal repeat (ITR) sequences described herein. In some embodiments, the cell line is a T cell line. Definitions

[0086] As used throughout the disclosure, the singular forms a / an, eeo / a include plural referents, unless the Petition 870250091033, dated 06 / 10 / 2025, pp. 84 / 114 30 / 53 context clearly indicates the opposite. Thus, for example, reference to a method includes a plurality of such methods and reference to a dose includes reference to one or more doses and equivalents thereof known to those skilled in the art, and so on.

[0087] The term about or approximately means within an acceptable range of error for the specific value, as determined by a person skilled in the art, which will depend in part on how the value is measured or determined, for example, the limitations of the measuring system. For example, about may mean within 1 or more standard deviations. Alternatively, about may mean a range of up to 20%, or up to 10%, or up to 5%, or up to 1% of a given value.

[0088] Alternatively, particularly in relation to biological systems or processes, the term may mean within an order of magnitude, preferably within 5 times, and more preferably within 2 times, of a value. When specific values ​​are described in the application and claims, unless otherwise indicated, the term about means within an acceptable error range for the specific value to be assumed.

[0089] Disclosure provides compositions of isolated or substantially purified polynucleotides or proteins. An isolated or purified polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free of components that normally accompany or interact with the polynucleotide or protein as found in a naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Ideally, an isolated polynucleotide is free of sequences (ideally protein-coding sequences) that Petition 870250091033, dated 06 / 10 / 2025, pp. 85 / 114 31 / 53 naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in several respects, the isolated polynucleotide may contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flanks the polynucleotide in the genomic DNA of the cell from which the polynucleotide is derived. A substantially cellular material-free protein includes protein preparations with less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein. When the disseminating protein or its biologically active portion is produced recombinantly, the culture medium ideally contains less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors or non-protein chemicals of interest.

[0090] The disclosure provides fragments and variants of the disclosed DNA sequences and proteins encoded by those DNA sequences. As used throughout the disclosure, the term fragment refers to a portion of the DNA sequence or a portion of the amino acid sequence and therefore to the protein it encodes. Fragments of a DNA sequence comprising coding sequences may encode protein fragments that retain the biological activity of the native protein and therefore the DNA recognition or binding activity to a target DNA sequence as described herein. Alternatively, fragments of a DNA sequence that are useful as hybridization probes generally do not encode proteins that retain biological activity or that do not retain promoter activity.Thus, fragments of a DNA sequence can range from at least about 20 nucleotides, to about 50 nucleotides, to about 100 nucleotides, and up to the full length of the polynucleotide in the sequence.

[0091] The nucleic acids or proteins of the dissemination can be Petition 870250091033, dated 06 / 10 / 2025, pp. 86 / 114 32 / 53 constructed by a modular approach, including pre-assembly of monomeric units and / or repeat units in target vectors that can be subsequently assembled into a final target vector. Disclosure polypeptides may comprise repeat monomers of disclosure and may be constructed by a modular approach, pre-assembling repeat units in target vectors that can be subsequently assembled into a final target vector. Disclosure provides the polypeptide produced by this method as well as nucleic acid sequences encoding these polypeptides. Disclosure provides host organisms and cells comprising nucleic acid sequences encoding the polypeptides produced by this modular approach.

[0092] The term comprising is intended to mean that the compositions and methods include the elements mentioned, but do not exclude others. Consisting essentially of, when used to define compositions and methods, means excluding other elements of any essential significance to the combination when used for the intended purpose. Thus, a composition consisting essentially of the elements as defined herein would not exclude trace contaminants or inert carriers.

[0093] Consisting of means excluding more than trace elements of other substantial ingredients and steps of the method. The aspects defined by each of these transitional terms are within the scope of this disclosure.

[0094] As used in this document, expression refers to the process by which polynucleotides are transcribed into mRNA and / or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a cell. Petition 870250091033, dated 06 / 10 / 2025, page 87 / 114 33 / 53 eukaryotic.

[0095] Gene expression refers to the conversion of the information contained in a gene into a gene product. A gene product can be the direct transcriptional product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, ribozyme, shRNA, microRNA, structural RNA, or any other type of RNA) or a protein produced by the translation of an mRNA. Gene products also include RNAs that are modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation.

[0096] Non-covalently linked components and methods of production and use of non-covalently linked components are disclosed. The various components can assume a variety of different forms, as described in this document. For example, non-covalently linked (i.e., operatively linked) proteins can be used to allow temporary interactions that avoid one or more problems in the art. The ability of non-covalently linked components, such as proteins, to associate and dissociate allows functional association only or primarily in circumstances where such association is necessary for the desired activity. The connection can last long enough to allow the desired effect.

[0097] A method for targeting proteins to a specific locus in an organism's genome is disclosed. The method may comprise the steps of providing a DNA localization component and providing an effector molecule, wherein the DNA localization component and the effector molecule are able to bind operatively via a non-covalent bond.

[0098] A target site or target sequence is a sequence of Petition 870250091033, dated 06 / 10 / 2025, pp. 88 / 114 34 / 53 nucleic acid that defines a portion of a nucleic acid to which a linker molecule will bind, provided there are sufficient conditions for binding.

[0099] The terms nucleic acid or oligonucleotide or polynucleotide refer to at least two nucleotides covalently linked together. The representation of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid may also encompass the complementary strand of a single strand shown. A nucleic acid disclosure also encompasses substantially identical nucleic acids and complements thereof that retain the same structure or encode the same protein.

[0100] Disclosure nucleic acids can be single-stranded or double-stranded. Disclosure nucleic acids can contain double-stranded sequences, even when most of the molecule is single-stranded. Disclosure nucleic acids can contain single-stranded sequences, even when most of the molecule is double-stranded. Disclosure nucleic acids can include genomic DNA, cDNA, RNA, or a hybrid thereof. Disclosure nucleic acids can contain combinations of deoxyribonucleotides and ribonucleotides. Disclosure nucleic acids can contain combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine, and isoguanine. Disclosure nucleic acids can be synthesized to comprise non-natural amino acid modifications. Disclosure nucleic acids can be obtained by chemical synthesis methods or by recombinant methods.

[0101] The nucleic acids in the disclosure, whether their complete sequence or any portion thereof, may be of unnatural occurrence. The nucleic acids in the disclosure may contain one or more unnatural mutations, substitutions, deletions, or insertions, making the entire nucleic acid sequence of unnatural occurrence. The nucleic acids in the disclosure may contain one or more duplicated, inverted, or Petition 870250091033, dated 06 / 10 / 2025, pp. 89 / 114 35 / 53 repeated nucleotides, the resulting sequence of which is unnatural, making the entire nucleic acid sequence unnatural. The nucleic acids disclosed may contain modified, artificial, or synthetic nucleotides that are unnatural, making the entire nucleic acid sequence unnatural.

[0102] Given the redundancy in the genetic code, a plurality of nucleotide sequences can code for any specific protein. All such nucleotide sequences are covered in this document.

[0103] As used throughout this disclosure, the term operationally linked refers to the expression of a gene that is under the control of a promoter to which it is spatially connected. A promoter may be positioned 5' (upstream) or 3' (downstream) from a gene under its control. The distance between a promoter and a gene may be approximately the same as the distance between that promoter and the gene it controls in the gene from which the promoter is derived. Variation in the distance between a promoter and a gene may be accommodated without loss of promoter function.

[0104] As used throughout the disclosure, the term promoter refers to a synthetic or naturally derived molecule that is capable of conferring, activating, or enhancing the expression of a nucleic acid in a cell. A promoter may comprise one or more specific transcriptional regulatory sequences to further enhance expression and / or alter the spatial and / or temporal expression thereof. A promoter may also comprise distal enhancer or repressor elements, which may be located up to several thousand base pairs from the transcription start site. A promoter may be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. A promoter may regulate the Petition 870250091033, dated 06 / 10 / 2025, pp. 90 / 114 36 / 53 Expression of a genetic component constitutively or differentially in relation to the cell, tissue, or organ in which the expression occurs, or in relation to the developmental stage in which the expression occurs, or in response to external stimuli such as physiological stresses, pathogens, metal ions, or inducing agents. Representative examples of promoters include the bacteriophage T7 promoter, the bacteriophage T3 promoter, the SP6 promoter, the lac operator-promoter, the tac promoter, the SV40 late promoter, the SV40 early promoter, the RSV-LTR promoter, the CMV IE promoter, the EF-1 Alpha promoter, the CAG promoter, the SV40 early promoter or the SV40 late promoter, and the CMV IE promoter.

[0105] As used throughout the disclosure, the term vector refers to a nucleic acid sequence containing an origin of replication. A vector can be a viral vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. A vector can be a DNA or RNA vector. A vector can be a self-replicating extrachromosomal vector and, preferably, is a DNA plasmid. A vector can comprise a combination of an amino acid with a DNA sequence, an RNA sequence, or a DNA and RNA sequence.

[0106] A conservative amino acid substitution, that is, the substitution of an amino acid for a different amino acid with similar properties (e.g., hydrophilicity, degree and distribution of charged regions), is recognized in the art as typically involving a small change. These small changes can be identified, in part, by considering the hydropathic index of the amino acids, as understood in the art. Kyte et al., J. Mol. Biol. 157: 105-132 (1982). The hydropathic index of an amino acid is based on consideration of its hydrophobicity and charge. Amino acids with similar hydropathic indices can be substituted and still maintain protein function. In one aspect, amino acids with similar indices Petition 870250091033, dated 06 / 10 / 2025, pp. 91 / 114 37 / 53 hydrophilic amino acids of ± 2 are substituted. The hydrophilicity of amino acids can also be used to reveal substitutions that would result in proteins retaining biological function. A consideration of amino acid hydrophilicity in the context of a peptide allows the calculation of the highest local average hydrophilicity of that peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity. U.S. Patent No. 4,554,101, incorporated in full herein by reference.

[0107] The substitution of amino acids with similar hydrophilicity values ​​can result in peptides retaining biological activity, for example, immunogenicity. Substitutions can be made with amino acids with hydrophilicity values ​​within ± 2 of each other. Both the hydrophobicity index and the hydrophilicity value of amino acids are influenced by the specific side chain of that amino acid. In line with this observation, it is understood that amino acid substitutions compatible with biological function depend on the relative similarity of the amino acids, and particularly of the side chains of these amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0108] As used in this document, conservative amino acid substitutions can be defined as presented in Table 1, Table 2, and Table 3 below. In some respects, conservative substitutions have been introduced by modifying polynucleotides that encode disseminating polypeptides. Amino acids can be classified according to their physical properties and contribution to the secondary and tertiary structure of the protein. A conservative substitution is the replacement of one amino acid by another amino acid with similar properties. Illustrative conservative substitutions are presented in Table 1. Petition 870250091033, dated 06 / 10 / 2025, pp. 92-114 38 / 53 Table 1: Conservative Substitutions I Side chain characteristics: Aliphatic amino acid: Nonpolar; GAPILVF: Polar - uncharged; CSTMNQ: Polar - charged; DEKR: Aromatic; HFWY: Other; NQDE

[0109] Alternatively, the conservative amino acids can be grouped as described in Lehninger, (Biochemistry, Second Edition; Worth Publishers, Inc. NY, NY (1975), pp. 71-77) as set out in Table 2. Table 2: Conservative Substitutions II Side chain characteristic Amino acid Nonpolar (hydrophobic) Aliphatic: ALIVP Aromatic: FWY Sulfur-containing: M Borderline: GY No polar charge Hydroxyl: STY Amides: NQ Sulfhydryl: C Borderline: GY Positively charged (basic): KRH Negatively charged (acidic): DE

[0110] Alternatively, illustrative conservative substitutions are presented in Table 3. Table 3: Conservative Substitutions III Residuo Original Substituição Ilustrativa Ala (A) Val Leu Ile Met Arg (R) Lys His Asn (N) Gln Asp (D) Glu Cys (C) Ser Thr Gln (Q) Asn Glu (E) Asp Gly (G) Ala Val Leu Pro His (H) Lys Arg Ile (I) Met Val Leu Met Ala (H) Lys (K) Arg His Met (M) Leu Ile Val Ala Phe (F) Trp Tyr Ile Petition 870250091033, of 06 / 10 / 2025, p. 93 / 114 39 / 53 Original Residue Illustrative Substitution Pro (P) Gly Ala Val Leu Ile Ser (S) Thr Thr(T) Ser Trp (W) Tyr Phe Ile Tyr (Y) Trp Phe Thr Ser Val (V) Ile Leu Met Ala

[0111] Disclosure polypeptides and proteins, whether their entire sequence or any portion thereof, may not be unnaturally occurring. Disclosure polypeptides and proteins may contain one or more unnaturally occurring mutations, substitutions, deletions, or insertions, making the entire amino acid sequence unnaturally occurring. Disclosure polypeptides and proteins may contain one or more duplicated, inverted, or repeated sequences, the resulting sequence of which is unnaturally occurring, making the entire amino acid sequence unnaturally occurring. Disclosure polypeptides and proteins may contain modified, artificial, or synthetic unnaturally occurring amino acids, making the entire amino acid sequence unnaturally occurring.

[0112] As used throughout the disclosure, the identity between two sequences can be determined using the stand-alone executable engine program BLAST for comparison of two sequences (bl2seq), which can be obtained from the National Center for Biotechnology Information (NCBI) ftp site, using the standard parameters (Tatusova and Madden, FEMS Microbiol Lett., 1999, 174, 247-250; which is incorporated herein by reference in its entirety).

[0113] The terms identical or identity, when used in the context of two or more nucleic acid or polypeptide sequences, refer to a specified percentage of residues that are the same in a specific region of each of the sequences. In some embodiments, sequence identity is determined along the entire length of a sequence. The percentage can be calculated by ideally aligning Petition 870250091033, dated 06 / 10 / 2025, pp. 94 / 114 40 / 53 optimized the two sequences, comparing them in the specified region, determining the number of positions where the identical residue occurs in both sequences to produce the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region and multiplying the result by 100 to produce the percentage of sequence identity. In cases where the two sequences have different lengths or the alignment produces one or more staggered ends and the specified comparison region includes only a single sequence, the residues of the single sequence are included in the denominator, but not in the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identification can be performed manually or using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0114] In certain embodiments, if a sequence has a certain sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) with a given SEQ ID NO, the sequence and the sequence with SEQ ID NO have the same length. In certain embodiments, if a sequence has a certain sequence identity (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) with a given SEQ ID NO, the sequence and the sequence with SEQ ID NO differ only due to conservative amino acid substitutions.

[0115] As used throughout the disclosure, the term endogenous refers to the nucleic acid or protein sequence naturally associated with a target gene or a host cell into which it is introduced.

[0116] As used throughout the disclosure, the term exogenous refers to a nucleic acid or protein sequence not naturally associated with a target gene or host cell into which it is introduced, including unnaturally occurring multiple copies of a nucleic acid. Petition 870250091033, dated 06 / 10 / 2025, pages 95 / 114 41 / 53 natural, for example, a naturally occurring DNA sequence or nucleic acid sequence located at a non-naturally occurring genomic locus.

[0117] Disclosure provides methods for introducing a polynucleotide construct comprising a DNA sequence into a host cell. By introduction is meant presenting the polynucleotide construct to the cell in such a way that the construct gains access to the interior of the host cell. Disclosure methods do not depend on a specific method for introducing a polynucleotide construct into a host cell, only that the polynucleotide construct gains access to the interior of a host cell. Methods for introducing polynucleotide constructs into bacteria, plants, fungi, and animals are known in the art, including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods. Examples

[0118] The examples in this section are provided for illustration purposes only and are not intended to limit the invention. Example 1: Polynucleotide Construct of the Superminimal PiggyBac Inverted Terminal Repeat

[0119] A set of truncated superminimal ER ITR PB polynucleotides from the 63 bp right-end (RE) minimal piggyBac ITR (SEQ ID NO: 2) was constructed by sequential deletion of the 3' end of the minimal ER ITR sequence to generate superminimal piggyBac ER ITR variants. The superminimal ER ITR variants comprise the first 17 bp, 19 bp, 24 bp, 29 bp, 34 bp, 39 bp, or 44 bp of the 63 bp minimal ER ITR sequence established at SEQ ID NO: 2, resulting in nucleic acid sequences of SEQ ID NOs: 3-9, respectively.

[0120] In short, the nucleic acids that encode the Petition 870250091033, dated 06 / 10 / 2025, pp. 96 / 114 42 / 53 superminimal RE ITR variants were synthesized, purified, and used to generate transposons comprising superminimal RE ITR variants. Example 2: Effect of Superminimal PB ITR Polynucleotide Length on Super Piggybac Transposase (SPB) Excision Activity

[0121] Superminimal PB ITR polynucleotides prepared in Example 1 was initially tested using a luciferase transposon excision reporter. Briefly, the excision reporter contains a PGK promoter (SEQ ID NO: 10) followed by a broken nanoLuc luciferase coding sequence, followed by an SV40 late polyadenylation signal sequence (SEQ ID NO: 11). The nanoLuc sequence is broken at a TTAA so that the 5' end of nanoLuc (SEQ ID NO: 12) is separated from the 3' end of nanoLuc (SEQ ID NO: 13) by a PB transposon. The 5' to 3' transposon comprises a TTAA sequence, the 35 bp LE ITR (SEQ ID NO: 1), a 189 bp payload (SEQ ID NO: 14), the 63 bp ER reverse complement (SEQ ID NO: 2), or a truncated ER ITR comprising one of the SEQ ID NOs: 3-9, and a TTAA sequence. The reporter constructs were cotransfected into cells along with a plasmid expressing a Super piggyBac (SPB) transposase.If the superminimal ITRs are functional, excision of the transposon comprising the superminimal PB ER ITRs and continuous repair of the reporter coding sequence result in nanoLuc expression that can be detected by a luciferase assay.

[0122] In summary, on Day 0, 30,000 HEK293T cells were reverse transfected using 20 ng of reporter constructs, 10 ng of an SPB expression vector, and 20 ng of carrier DNA using 0.15 μL of Transit2020 transfection reagent according to the manufacturer's instructions, and the cells were plated in 100 μL of DMEM + 10% FBS medium in 96-well plates. The cells were incubated at 37°C and luciferase activity was Petition 870250091033, dated 06 / 10 / 2025, pp. 97 / 114 43 / 53 measured on Day 1. The results are shown in Table 4. Table 4 Luciferase Signal Replica 1 Replica 2 Average Minimum ITR 650235 713407 681821 Superminimum ITR 44 bp 797485 762120 779803 Superminimum ITR 39 bp 538296 542674 540485 Superminimum ITR 34 bp 681352 688176 684764 Superminimum ITR 29 bp 950922 958638 954780 Superminimum ITR 24 bp 491079 505393 498236 Superminimum ITR 19 bp 1362175 1526605 1444390 Superminimum ITR 17 bp 1018028 1025618 1021823

[0123] As shown in Table 4, luciferase activity was detected in cells transposed to all superminimal PB ER ITR variants with the highest signal observed using the superminimal 19 bp PB ER ITR.

[0124] In a second experiment, reporter constructs comprising the superminimal RE PB 17 bp ITR or the superminimal RE PB 19 bp ITR were tested in the luciferase excision assay, as well as a reporter construct comprising Complete PB ITRs comprising an intact PB 5'UTR sequence (SEQ ID NO: 15) and an intact 3'UTR sequence (SEQ ID NO: 16), as well as a reporter construct comprising minimal PB ITRs comprising the 35 bp LE ITR (SEQ ID NO: 1) and the 63 bp RE (SEQ ID NO: 2). The results are shown in Table 5. Table 5 Luciferase Signal Replicate 1 Replicate 2 Replicate 3 Average Minimum ITR 612325 483668 614112 570035 Superminimum ITR 17 bp 744409 755379 908710 802833 Superminimum ITR 19 bp 1101035 1190137 1256866 1182679 Complete ITR 382459 453890 415051 417133

[0125] As shown in Table 5, the ITR reporter Petition 870250091033, dated 06 / 10 / 2025, pp. 98 / 114 44 / 53 superminimum of RE PB 19 bp surpassed the ITR of RE 63 bp minimum, as well as a reporter ITR PB Complete which additionally comprised the PB 5'UTR and 3'UTR added back to the ITR of LE of PB and ITR of RE of PB superminimum, respectively. Example 3: Effect of Transposon DNA Payload Size on SPB Transposase Integration and Transposon Excision Activity Comprising Superminimal PB ER ITRs

[0126] A double excision / integration luciferase reporter system was used to test the effect of full ITRs, minimal ITRs, and superminimal ITRs on the SPB transposase activity of integrating or excising a larger transposon compared to the transposon in Example 2. The reporter system comprises an open reading frame of firefly luciferase interrupted by an SPB transposon. Initially, firefly luciferase is not expressed, but SPB-mediated transposon excision and continuous repair result in expression. The transposon itself expresses a destabilized nanoluc luciferase mRNA. NanoLuc expression from the episomal vector is unstable since the mRNA lacks a polyA tail and contains the 3' destabilizing element. Integration of the transposon into genomic DNA allows mRNA to utilize a genomic polyA sequence and splice the destabilizing element using a splice donor sequence in the transposon, leading to luciferase expression (SEQ ID NO: 17).

[0127] The transposon ITRs of this reporter plasmid were modified to prepare transposons comprising: complete ITRs, minimal ITRs, or superminimal RE 19 bp ITRs. Briefly, on Day 0, approximately 200,000 K562 cells were nucleofetated using 50 ng of one of the reporters and 500 ng of an SPB expression vector (or carrier DNA as a negative control) and plated in 600 µl of IMDM medium + 10% FBS in 24-well plates. The cells were incubated at 37°C, and luciferase activity was Petition 870250091033, dated 06 / 10 / 2025, pp. 99 / 114 45 / 53 measured on Day 2. The results are shown in Table 6. Table 6 Luciferase Firefly + Transposase Excision Signal Without transposase Rep. 1 Rep. 2 Rep. 3 Average Rep. 1 Rep. 2 Rep. 3 Average Complete ITR 9260 7918 8774 8651 103 85 161 116 Minimum ITR 5379 4874 4388 4880 277 147 196 207 Superminimum ITR 1599 1878 1283 1587 226 108 208 181 Without transposase 221 250 374 282 101 92 214 136 Luciferase NanoLuc + Transposase Integration Signal Without transposase Rep. 1 Rep. 2 Rep. 3 Average Rep. 1 Rep. 2 Rep. 3 Average ITR Complete 1139309 1090008 1068629 1099315 9687 12020 12125 11277 Minimum ITR 598288 595721 677798 623936 37532 41317 45237 41362 Superminimum ITR 98109 109296 115920 107775 43946 41632 46487 44022 Without transposon 355 91 100 182 307 328 186 274 Reply: Replica.

[0128] As shown in Table 6, the detected firefly luciferase excision signal and nanoLuc integration signals were higher for complete PB ITRs, lower for minimal PB ITRs, and lower for superminimal 19 bp ER ITRs. Transposons comprising larger DNA payloads result in the LE ITR and ER ITR being positioned further apart, suggesting that the absence of a second transposase dimer binding site in the superminimal ER ITR may reduce transposition efficiency for larger DNA payloads. Example 4: Integration of SPB Transposase and PB LE ITR Excision Activity between Spacer Length and PB RE ITR of Transposons Comprising Superminimal PB RE ITRs

[0129] Transposons are typically delivered to cells, ex vivo or in vivo, in circular DNA vectors. One strategy to approximate ITRs in circular vectors, even for large transposons, is to reduce the number of base pairs separating the ITRs outside the transposon (i.e., the plasmid backbone). Petition 870250091033, dated 06 / 10 / 2025, pages 100 / 114 46 / 53

[0130] The dual luciferase reporters prepared in Example 3 were modified to place the ITRs close to each other, essentially converting the entire vector into a transposon, to generate transposons comprising full PB ITRs (SEQ ID NO: 18), minimal PB ITRs (SEQ ID NO: 19), or superminimal PB ITRs (SEQ ID NO: 20) and a 221 bp sequence between the TTAAs outside the transposon. The firefly excision reporter was partially deleted in the process, but the nanoLuc integration reporter remained intact. These new integration-only luciferase reporters were tested for transposon integration in K562 cells, as described in Example 3, along with a positive control luciferase reporter comprising a full-length plasmid backbone. The results are shown in Table 7. Table 7 Luciferase Signal + Transposase No transposase Replication 1 Replication 2 Average Replication 1 Replication 2 Average Complete ITR distant 459720 448870 454295 13733 13335 13534 Complete ITR adjacent 1437067 1496970 1467019 9120 9445 9283 Minimum ITR adjacent 2097877 1734855 1916366 3072 2634 2853 Superminimum ITR adjacent 359589 418898 389244 2592 3428 3010

[0131] As shown in Table 7, the complete ITRs and the Minimal ITRs resulted in high transposition, while lower levels of transposition were observed using the superminimal 19 bp ITRs, suggesting that superminimal ITRs work best for SPB-mediated transposition of very small transposons. Example 5: Effect of ITR Polynucleotide Length of PB SUPERMINIMUM ER on Site-Specific TAL-SUPER PIGGYBAC Fusion Proteins (TAL-SS-SPB PBx) on Excision Transposase Excision Activity

[0132] The nanoLuc excision-only reporter system described in Petition 870250091033, dated 06 / 10 / 2025, pp. 101 / 114 47 / 53 Example 2 was employed to compare the excision activities of reporter plasmids comprising transposons containing full ITRs, minimal ITRs, or the superminimal ITR variants RE 44 bp, 34 bp, 19 bp, and 17 bp. Briefly, 30,000 HEK293T cells were reverse transfected, as described in Example 2, with a PBx TAL-ssSPB expression vector targeting left GFP (SEQ ID NO: 21) and with a PBx TAL-ssSPB expression vector targeting right GFP (SEQ ID NO: 22), along with each reporter. TAL-ssSPB PBx expression vectors with right-side GFP targets comprise a TAL array targeting DNA sequences flanking upstream and downstream of a TTAA integration site fused to a piggyBac transposase, comprising an N-terminal deletion of amino acids 1-93 and additionally comprising four hyperactive SPB mutations, as well as mutations that render transposase integration deficient but maintain normal excision activity (PBx).The TAL arrays of SPB transposase fusion proteins GFP1 Right PBx TAL-ssSPB and GFP1 Left PBx TAL-ssSPB targeting specific sequences 10 bp to the right and 10 bp to the left in the coding region of the GFP gene were prepared as described in Examples 14 and 18 of the co-owned International Patent Application Publication No. PCT / 2022 / 22549, the contents of which are incorporated by reference in full.

[0133] Luciferase signals were measured from cells transfected with transposons comprising the various ITR sequences. The results are shown in Table 8. Table 8 Luciferase Signal GFP1L TAL-ssSPB GFP1R TAL-ssSPB Replicate 1 Replicate 2 Average Replicate 1 Replicate 2 Average Complete ITR 2556812 1997313 2277063 2892092 2532898 2712495 Minimum ITR 3050627 2562406 2806517 2260078 1918567 2089323 Superminimum ITR 44 bp 2790164 2137331 2463748 3021131 2352675 2686903 Petition 870250091033, dated 06 / 10 / 2025, pages 102 / 114 48 / 53 Luciferase Signal GFP1L TAL-ssSPB GFP1R TAL-ssSPB Replicate 1 Replicate 2 Average Replicate 1 Replicate 2 Average ITR Superminimum 34 bp 4283716 2900951 3592334 4777177 3704723 4240950 ITR Superminimum 19 bp 4617430 3482804 4050117 4724253 3935542 4329898 ITR Superminimum 17 bp 4477759 3212069 3844914 5073659 4371134 4722397

[0134] As shown in Table 8, transfected cells comprising any of the reporter constructs resulted in the production of a luciferase signal, indicating excision of the reporter transposon and restoration of a full-length luciferase coding sequence. Transposons comprising complete ITRs, minimal ITRs, or 44 bp superminimal ITRs (which retain a portion of the distal transposase binding site) all performed similarly. Transposons comprising the 34 bp, 19 bp, and 17 bp superminimal ITRs, which completely deleted the distal transposase dimer binding site, exhibited higher excision signals than transposons comprising complete ITRs or larger ITR variants thereof. Example 6: Effect of ITR Polynucleotide Length of PB SUPERMINIMUM ER on Site-Specific TAL-SUPER PIGGYBAC Fusion Proteins (TAL-SS-SPB PBx) on Excision Transposase Excision Activity

[0135] Polynucleotides comprising complete ITRs, minimal ITRs, or superminimal ITRs 19 bp were examined to accommodate the transposition of a large transposon using the double excision / integration luciferase reporter and SPB transposase and PBx fusion proteins TALssSPB by transfection of HEK293T as described above in Example 3. Only the excision signal of the double excision / integration luciferase reporter was monitored, since TAL-ssSPB consists only of the delta 1-93 PBx excision transposase sequence and the target integration sites for the TAL-ssSPBs GFP are not present in the genome. The assay results of Petition 870250091033, dated 06 / 10 / 2025, pages 103 / 114 49 / 53 excisions are shown in Table 9. Table 9 Luciferase Signal ITR Complete ITR Minimal ITR Superminimal GFP1L TAL-ssSPB 6784 6421 7414 GFP1R TAL-ssSPB 6585 7885 10375 SPB 11052 7260 3997 SPB Catalytic Dead 486 468 334

[0136] As shown in Table 9, the highest excision activity was observed for the SPB transposase using reporter constructs comprising complete ITRs, with the lowest excision activity using minimal ITRs and the lowest excision activity using superminimal ITRs. This trend, however, was partially reversed using PBx TAL-ssSPB fusion proteins, where reporter constructs comprising superminimal ITRs exhibited the highest excision activity compared to reporter constructs comprising complete or minimal ITRs, which performed similarly but to a lesser extent. As a negative control for the assay, catalytically killed SPB exhibited background levels of luciferase activity. Example 7: TAL-binding ITR construct and use with PBx TAL-ssSPB fusion proteins for site-specific transposition.

[0137] A series of superminimal ER ITR variants were constructed by extending the superminimal ER ITR sequence using spacers of various lengths followed by the reporter plasmid target site for the second distal TAL-ssSPB R GFP1, which includes the TAL binding site (SEQ ID NO: 23), a spacer, and then the binding sites for the DBD PBx and CRD domains. Several TAL ER ITR variants with different spacer lengths between the ER ITR and the TAL Array (“TAL-binding ER ITRs”) were constructed: no spacer (SEQ ID NO: 24); a +5 bp spacer (SEQ ID NO: 25), a +10 bp spacer (SEQ ID NO: Petition 870250091033, dated 06 / 10 / 2025, pp. 104 / 114 50 / 53 26); a +15 bp spacer (SEQ ID NO: 27), a +20 bp spacer (SEQ ID NO: 28), and a +25 bp spacer (SEQ ID NO: 29). The increased spacer length further separates the binding site for the first left proximal PBx TAL-ssSPB dimer and the second right distal PBx TAL-ssSPB dimer.

[0138] Similarly, a series of superminimal LE ITR variants were constructed for the second distal TAL-ssSPB dimer. Several TAL LE ITR variants with different spacer lengths between the LE ITR and the TAL Array (TAL Linkage LE ITRs) were constructed: no spacer (SEQ ID NO: 30); a +5 bp spacer (SEQ ID NO: 31), a +10 bp spacer (SEQ ID NO: 32); a +15 bp spacer (SEQ ID NO: 33), a +20 bp spacer (SEQ ID NO: 34) and a +25 bp spacer (SEQ ID NO: 35). To avoid potential recombination between these superminimal RE and LE ITRs, the spacer sequences for the RE and LE ITR pairs were modified to reduce sequence repeatability and homology.

[0139] TAL-binding RE and LE ITRs were initially tested using the luciferase transposon excision reporter on HEK293T, as described above in Example 2. Each reporter plasmid was cotransfected with either PBx TAL-ssSPB R GFP1 (SEQ ID NO: 22), which binds to ITRs, or with PBx TAL-ssSPB L PAH2 (SEQ ID NO: 36), which does not bind to ITRs. PBx TAL-ssSPB L PAH2 was prepared as described in the co-owned International Patent Application Publication No. PCT / 2022 / 22549. PBx TAL-ssSPB R GFP1 resulted in a higher excision signal with all TAL-binding ITR reporters than PBx ssSPB TAL L PAH2. As controls, reporter constructs comprising minimal and superminimal ITRs were transfected, in which case both PBx TAL-ssSPB fusion proteins resulted in a similar excision signal. The results are shown in Figure 1. Petition 870250091033, dated 06 / 10 / 2025, pp. 105 / 114 51 / 53 Table 10. Table 10 Luciferase Signal GFPIR TAL-ssSPB PBx PAH2L TAL-ssSPB PBx Replicate 1 Replicate 2 Average Replicate 1 Replicate 2 Average TAL ITR+25bp Linkage 9921443 9129146 9525295 5494391 5729109 5611750 TAL ITR+20bp Linkage 8079110 8537733 8308422 5506535 5243049 5374792 TAL ITR+15bp Linkage 7350781 8428584 7889683 6011447 5671538 5841493 TAL ITR+10bp Linkage 5787803 6541725 6164764 5393845 5496607 5445226 TAL ITR+5bp connection 9586499 8519096 9052798 6699984 6224914 6462449 TAL ITR connection 6630131 6208129 6419130 6017608 6026622 6022115 ITR superminimum 11369627 11068956 11219292 11646813 11118015 11382414 ITR Minimum 3623991 3607151 3615571 4549196 3866228 4207712

[0140] As shown in Table 10, the highest signal using TAL link ITRs was seen with the version containing the longer 25 bp spacer sequence. Example 8: TAL-binding ITR construct with LINE1 element target and use with PBx TAL-ssSPB fusion proteins targeting LINE1 for site-specific transposition. A. Small Transposons

[0141] In the first experiment, the various TAL Linkage ITR designs were compared for site-specific transposition of small transposons in the human genome at a target site found in LINE1 repeats (SEQ ID NO: 37) catalyzed by TAL-ssSPB LINE1 comprising PBx ss-SPB L1 LINE (SEQ ID NO: 38) and PBx ss-SPB R1 LINE (SEQ ID NO: 39). The PBx TAL-ssSPB L1 LINE1 and PBx ss-SPB R1 LINE were prepared as described in the co-owned International Patent Application Publication No. PCT / 2022 / 22549. A 610 bp transposon with full ITRs (SEQ ID NO: 40), a 392 bp transposon with TAL linkage ITRs with a 25 bp spacer (SEQ ID NO: 41), a 365 bp transposon with minimum ITRs (SEQ ID NO: 42), and a 321 bp transposon with superminimal ITRs of Petition 870250091033, dated 06 / 10 / 2025, pages 106 / 114 52 / 53 bp (SEQ ID NO: 43) were cloned into a 4.5 kb donor vector. 450 ng of each transposon donor was cotransfected into 120,000 HEK293T cells (plated one day prior) along with a total of 50 ng of the TAL-ssSPB LINE1 pair using 1 μL of JetPrime transfection reagent according to the manufacturer's instructions. Two days later, genomic DNA was collected, and site-specific transposon integration at target sites in both forward and reverse orientations was quantified by ddPCR. The results are shown in Table 11. Table 11 Integrations by Haploid Genome Direct Integration Reverse Integration Complete ITR 2.82 2.82 TAL Linkage ITR 4.89 5.05 Minimal ITR 4.25 4.04 Superminimal ITR 5.68 5.03

[0142] As shown in Table 11, the superminimal ITR transposon resulted in the highest level of site-specific integration of the four ITR designs tested; however, the TAL Link ITR demonstrated good activity in the LINE1 elements. B. Large Transposons

[0143] In a second experiment, the various ITR designs were compared for site-specific transposition of large transposons in the human genome at a target site found in TAL-ssSPB LINE1 repeats (SEQ ID NO: 37) comprising PBx ss-SPB L1 LINE (SEQ ID NO: 38) and PBx ss-SPB R1 LINE (SEQ ID NO: 39). The donor transposon nanoplasmid contained a PiggyBac transposon containing, from the 5' to 3' direction: TTAA, a 309 bp fragment containing the 5' ITR of PiggyBac and part of the UTR, a payload composed of an EF1a promoter, a puromycin resistance gene, a 2A peptide, and a GFP reporter, followed by a 238 bp fragment containing the 3' ITR of PiggyBac and part of the UTR, and TTAA (SEQ ID NO: 44). The donor DNA transposon was modified to replace complete ITRs with Petition 870250091033, dated 06 / 10 / 2025, pp. 107 / 114 53 / 53 TAL-linking ITRs with a 25 bp spacer, minimal ITRs, or superminimal 19 bp ITRs were used. Each transposon donor was co-transfected into HEK293T cells along with TAL-ssSPB LINE1 expression vectors. One or three days later, genomic DNA was collected, and site-specific integration of the transposon into target sites in the direct orientation was quantified by ddPCR. The results are shown in Table 12. Table 12 Integrations by Haploid Genome Day 1 Day 3 Rep 1 Rep 2 Rep 3 Average Rep 1 Rep 2 Rep 3 Average Complete ITR 0.21 0.18 0.18 0.19 0.83 1.1 1.09 1.01 TAL Linkage ITR 0.24 0.24 0.26 0.25 0.97 1.41 1.18 1.19 Minimum ITR 0.24 0.22 0.41 0.29 0.78 0.88 1.07 0.91 Superminimal ITR 0.52 0.52 0.54 0.53 1.34 2.05 1.9 1.76

[0144] As shown in Table 12, similar to the first experiment using small transposons, the superminimal ITR transposon resulted in the highest level of site-specific integration of large transposons in LINE1 element repeats. Petition 870250091033, dated 06 / 10 / 2025, pages 108 / 114

Claims

1 / 4 Claims 1. POLYNUCLEOTIDE ENCODING A TRANSPOSON, characterized by comprising a piggyBac superminimal right-end (RE) inverted terminal repeat (ITR) sequence and a left-end (LE) minimal ITR sequence, wherein the piggyBac superminimal RE ITR comprises the nucleic acid sequence set out in SEQ ID NO: 8 and the LE ITR comprises the sequence in SEQ ID NO:

1.

2. A POLYNUCLEOTIDE, according to claim 1, characterized in that the transposon is a piggyBac transposon or a piggyBac-like transposon.

3. POLYNUCLEOTIDE, according to any one of claims 1 to 2, characterized in that the polynucleotide additionally comprises at least one exogenous nucleic acid sequence.

4. A POLYNUCLEOTIDE, according to claim 3, characterized in that at least one exogenous nucleic acid sequence encodes a non-naturally occurring antigen receptor.

5. POLYNUCLEOTIDE, according to claim 3, characterized by at least one exogenous nucleic acid sequence encoding a therapeutic polypeptide.

6. POLYNUCLEOTIDE, according to claim 5, characterized in that the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, phenylalanine hydroxylase (PAH) polypeptide, an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.

7. POLYNUCLEOTIDE, according to any one of claims 3 to 6, characterized by further comprising a promoter sequence. Petition 870250091033, dated 06 / 10 / 2025, pp. 109 / 114 2 / 4 8. POLYNUCLEOTIDE, according to any one of claims 1 to 7, characterized in that the ITR of RE is in the reverse orientation and / or the ITR of LE is in the reverse orientation.

9. VECTOR, characterized by comprising the polynucleotide, as defined in any one of claims 1 to 8.

10. CELL, characterized by comprising the polynucleotide, as defined in any one of claims 1 to 8, or the vector, as defined in claim 9.

11. PHARMACEUTICAL COMPOSITION, characterized by comprising the cell, as defined in claim 10, and a pharmaceutically acceptable carrier.

12. TRANSPOSON, characterized by comprising, in the order of 5' to 3': (i) a left-end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a superminimal right-end (RE) inverted terminal repeat (ITR) sequence.

13. TRANSPOSON, characterized by comprising, in the order of 5' to 3': (i) a left-end (LE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a superminimal right-end (RE) inverted terminal repeat (ITR) sequence.

14. TRANSPOSON, characterized by comprising, in the order of 5' to 3': (i) a right-end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a non-naturally occurring antigen receptor; and (iv) a reverse complement of a left-end (LE) superminimal inverted terminal repeat (ITR) sequence.

15. TRANSPOSON, characterized by comprising, in the order of 5' to 3': (i) a right-end (RE) inverted terminal repeat (ITR) sequence; (ii) a promoter; (iii) an exogenous nucleic acid sequence encoding a therapeutic polypeptide; and (iv) a reverse complement of a superminimal left-end (LE) inverted terminal repeat (ITR) sequence.

16. TRANSPOSON, according to any one of claims 13 to 15, characterized in that the therapeutic polypeptide is a Factor VIII polypeptide, a Factor IX polypeptide, phenylalanine hydroxylase (PAH), an ornithine transcarbamylase (OTC) polypeptide, or a methylmalonyl-CoA mutase (MUT1) polypeptide.

17. METHOD FOR TREATING A DISEASE OR DISORDER in an individual in need thereof, characterized by comprising administering to the individual (i) at least one therapeutically effective dose of the vector, as defined in claim 9, or of the transposon, as defined in any of claims 13 to 15, and (ii) a transposase or a nucleic acid or nucleic acid sequence encoding a transposase enzyme.

18. METHOD, according to claim 17, characterized in that the transposase is an SPB transposase, a TAL-ss-SPB PBx transposase fusion protein, or a ZNFssSPB transposase fusion protein.

19. A METHOD FOR TREATING A DISEASE OR DISORDER in an individual in need thereof, characterized by comprising administering to the individual at least one therapeutically effective dose of the cell, as defined in claim 10.

20. METHOD, according to any one of claims 17 to 19, characterized in that the disease or disorder is cancer, a liver disease or disorder, a urea cycle disorder, a hepatic metabolic disorder, or a hemophilic disease.