Microorganism with increased activity of the E1 subunit of the pyruvate dehydrogenase complex, and a method for producing O-acetylhomoserine or derivatives thereof using the same

Description

1 / 81 Microorganism with increased activity of the E1 subunit of the pyruvate dehydrogenase complex, and a method for producing it. O-ACETYL-HOMOSERINIC OR DERIVATIVES THEREOF USING THE SAME Technical Field

[001] The present description refers to a microorganism with an increased activity of the E1 subunit of the pyruvate dehydrogenase complex, and a method for producing O-acetyl-homoserine or a derivative thereof using the same. Fundamentals of the Technique

[002] A microorganism of the genus Corynebacterium is a Gram-positive microorganism that is widely used in the production of L-amino acids, and is widely used to produce L-homoserine, L-methionine, etc., which can be converted from O-acetyl-homoserine, in addition to O-acetylhomoserine, which is classified as a non-protein amino acid as well as a protein amino acid.

[003] For the production of L-amino acids and other useful materials, several studies are underway to develop microorganisms with high production efficiency. For example, specific approaches for the target material (e.g., increasing the expression of genes encoding enzymes involved in L-amino acid biosynthesis or removing unnecessary genes for L-amino acid biosynthesis, mainly in strains of the genus Petition 870250091575, dated 07 / 10 / 2025, page 19 / 104 2 / 81 Corynebacterium) are mainly used for the production of L-amino acids (US 9644009 B2). Description Technical Problem

[004] There is still a demand for research on methods to produce L-amino acids effectively and with a high yield. Technical Solution

[005] One objective of the present description is to provide a microorganism with increased activity of the E1 subunit of the pyruvate dehydrogenase complex (AceE).

[006] In one embodiment, the microorganism is a microorganism to produce O-acetyl-homoserine or a derivative thereof.

[007] In another embodiment, the microorganism exhibits activity of the E1 subunit of the pyruvate dehydrogenase complex (AceE), which is increased compared to the endogenous activity of the same.

[008] As the microorganism according to any of the modalities described above, the microorganism may be a microorganism of the genus Corynebacterium.

[009] As the microorganism according to any of the previously described modalities, the microorganism of the genus Corynebacterium may be Corynebacterium glutamicum.

[0010] As the microorganism according to any one Petition 870250091575, dated 07 / 10 / 2025, page 20 / 104 3 / 81 of the modalities described above, the E1 subunit of the pyruvate dehydrogenase complex can be derived from Corynebacterium glutamicum.

[0011] As the microorganism according to any of the embodiments described above, the E1 subunit of the pyruvate dehydrogenase complex may include an amino acid sequence of SEQ ID NO: 1.

[0012] As the microorganism according to any of the embodiments described above, the E1 subunit of the pyruvate dehydrogenase complex may be encoded by a polynucleotide with SEQ ID NO: 2 or SEQ ID NO: 3.

[0013] As the microorganism according to any of the embodiments described above, the microorganism may be that with the greatest capacity to produce O-acetylmoserine or a derivative thereof in comparison with an unmodified microorganism.

[0014] As the microorganism according to any of the embodiments described above, O-acetylhomoserine or a derivative thereof may be any one or more selected from O-acetylhomoserine, L-methionine and L-homoserine.

[0015] Another objective of the present description is to provide a method for the production of O-acetyl-homoserine or a derivative thereof, including: culturing a microorganism with increased activity of the E1 subunit of Petition 870250091575, dated 07 / 10 / 2025, page 21 / 104 4 / 81 pyruvate dehydrogenase complex in a medium.

[0016] In one embodiment, the method may additionally include a step to recover O-acetylmoserine or a derivative thereof from the microorganism being cultured, from a culture of the microorganism, from a fermented product of the microorganism, or from the culture medium.

[0017] Yet another objective of the present description is to provide a composition for the production of O-acetylmoserine or a derivative thereof, including: a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared with the endogenous activity thereof; a culture of the microorganism; a fermented product of the microorganism; or a combination of two or more thereof.

[0018] Yet another objective of the present description is to provide the use of a microorganism, in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared with the endogenous activity thereof, for the production of O-acetyl-homoserine or a derivative thereof.

[0019] Yet another objective of the present description is to provide a method for preparing a microorganism for the production of O-acetyl-homoserine or a derivative thereof, including: modifying the microorganism to have increased activity of the E1 subunit of the pyruvate dehydrogenase complex compared with the endogenous activity of Petition 870250091575, dated 07 / 10 / 2025, page 22 / 104 5 / 81 same. Advantageous Effects

[0020] O-acetyl-homoserine or a derivative thereof can be produced in high yield using the microorganism described herein. Detailed Description of Preferred Options

[0021] The present description will be described in detail below. However, each description and embodiment described in this description may also be applied to other descriptions and embodiments. That is, all combinations of various elements described in this description fall within the scope of this description. Additionally, the scope of this description is not limited to the specific description described below. Furthermore, several patent articles and documents are referenced and cited throughout this descriptive report. The descriptions of the cited patent articles and documents are incorporated herein by reference in their entirety to further clarify the level and scope of the subject matter to which this description refers. Definitions

[0022] As used in the descriptive report and attached claims, singular forms (a, an, and the) include plural referents, unless the context clearly indicates otherwise. Unless the context Petition 870250091575, dated 07 / 10 / 2025, p. 23 / 104 6 / 81 unless otherwise indicated, singular terms should include the plural and plural terms should include the singular. As used in the descriptive report and attached claims, unless otherwise indicated, the use of or may be used to include and / or.

[0023] As used in this document, the term "approximately" may be presented before a specific numerical value. The term "approximately" as used in this document includes not only the exact number quoted after the term, but also a range close to or near that number. Considering the context in which the number is presented, one can determine whether any number is close to or near the specific number presented. In one example, the term "approximately" may refer to a range of -10% to +10% of a numerical value. In another example, the term "approximately" may refer to a range of -5% to +5% of a given numerical value, but is not limited to that.

[0024] As used in this document, descriptions such as the terms first, second, third..., i), ii), iii)... or (a), (b), (c), (d)... may be used to distinguish respective constitutions. When the terms are used in reference to the steps of a method, use or trial, there is no limitation that these terms may be executed continuously or sequentially. For example, there may be no time interval between these steps, or they may be Petition 870250091575, dated 07 / 10 / 2025, p. 24 / 104 7 / 81 executed simultaneously, or they can be executed with several seconds, several minutes, several hours, several days, or several months in between.

[0025] As used in this document, the term “essentially consisting of” may mean that, where the characteristics of the object claimed in this document are not substantially affected by the presence of unspecified characteristics, the unspecified characteristics may be present.

[0026] As used in this document, the term “consisting of” means that the total ratio of specific component(s) cited after the term is 100%. The components or features cited after the term “consisting of” may be essential or mandatory. In some embodiments, in addition to the components or features cited after the term “consisting of”, any other components or features, or non-essential components or features, may be excluded.

[0027] As used in this document, the term “comprising / including” means the presence of features, steps or constituent elements mentioned after the term, and does not exclude the presence of one or more additional features, steps or constituent elements. The components or features mentioned after the term “comprising / including” in this document may Petition 870250091575, dated 07 / 10 / 2025, page 25 / 104 8 / 81 being essential or mandatory. However, in some modalities, the term may additionally include any other non-essential components or characteristics. Proteins, Polypeptides

[0028] As used in this document, the term protein or polypeptide refers to a polymer or oligomer of consecutive amino acid residues. In the present description, polypeptide, protein, and peptide may be used interchangeably with each other.

[0029] In some cases, a protein, polypeptide, or peptide that exhibits activity may be termed an enzyme. In the present description, unless otherwise indicated, amino acid sequences are described in the N-terminal to C-terminal direction.

[0030] As used in this document, the term mature polypeptide means a polypeptide in a form without a signal sequence or propeptide sequence. A mature protein / polypeptide / peptide may be a functional form of a protein / polypeptide / peptide. Mature polypeptide may refer to a polypeptide in a final form after translation or post-translational modification. Examples of post-translational modification include N- or C-terminal modification, glycosylation, phosphorylation, leader sequence removal, etc., but are not limited to these.

[0031] With regard to amino acid sequences in Petition 870250091575, dated 07 / 10 / 2025, page 26 / 104 9 / 81 present description, although described as a polypeptide or protein comprising / including an amino acid sequence described by a specific sequence number, a polypeptide or protein consisting of an amino acid sequence described by a specific sequence number, or a polypeptide or protein having an amino acid sequence described by a specific sequence number, it is evident that any polypeptide or protein with an amino acid sequence in which part(s) of the sequence(s) is / are deleted, modified, substituted, conservatively substituted or added may fall within the scope of the present description if it has identical or corresponding activity to that of the polypeptide or protein consisting of the amino acid sequence of the corresponding sequence number.For example, polypeptides or proteins with sequence additions or deletions that do not alter the protein's function, naturally occurring mutations, silent mutations, or conservative substitutions within, or upstream or downstream (N-terminal or C-terminal) of polypeptide or protein sequences may be included, provided they have identical or corresponding activity to the activity of the polypeptide or protein.

[0032] In one specific example, polypeptides (proteins) that can be conjugated with a signal (or leader) sequence at the N-terminus involved in translocation of Petition 870250091575, dated 07 / 10 / 2025, page 27 / 104 10 / 81 Polypeptides (proteins) that are cotranslationally or posttranslationally conjugated, or polypeptides (proteins) that can be conjugated with another sequence or ligand to identify, purify, or synthesize polypeptides (proteins), may also fall within the scope of the polypeptide of the amino acid sequence described by the specific number.

[0033] As used in this document, the term "conservative substitution" refers to the substitution of one amino acid for another amino acid with similar structural and / or chemical properties. Such amino acid substitution can generally occur based on the similarity of polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of a residue. Amino acids can be classified into the following groups: For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartic acid; amino acids with nonpolar side chains (nonpolar amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; amino acids with polar or hydrophilic side chains (polar amino acids) include serine, threonine, cysteine, tyrosine, asparagine, and glutamine.In another example, amino acids with electrically charged side chains. Petition 870250091575, dated 07 / 10 / 2025, p. 28 / 104 Electrically charged amino acids (11 / 81) include arginine, lysine, histidine, glutamic acid, and aspartic acid; and amino acids with uncharged side chains (uncharged amino acids; also called neutral amino acids) include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, proline, serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Aromatic amino acids include phenylalanine, tryptophan, and tyrosine. Branched-chain amino acids include valine, leucine, and isoleucine.In another example, the 20 amino acids can be classified according to their size into 5 groups, starting with the groups of amino acids with a relatively small volume, namely glycine, alanine, serine; cysteine, proline, threonine, aspartic acid, asparagine; valine, histidine, glutamic acid, glutamine; isoleucine, leucine, methionine, lysine, arginine; and phenylalanine, tryptophan, and tyrosine, but the classification of amino acids is not limited to these. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide. Polynucleotides

[0034] As used in this document, the term gene means a polynucleotide encoding a polypeptide and a polynucleotide, including upstream and downstream regions of the coding region. In some embodiments, a gene may Petition 870250091575, dated 07 / 10 / 2025, page 29 / 104 12 / 81 present a sequence (intron) inserted between each coding region (exon).

[0035] As used in this document, the term polynucleotide, nucleic acid or “nucleic acid molecule, which is a polymer of nucleotides composed of nucleotide monomers connected in a long chain by a covalent bond, is a strand of DNA (e.g., cDNA or genomic DNA) or RNA (e.g., mRNA) of at least a given length. Homology, Identity

[0036] As used in this document, the term homology or identity refers to the degree of relatedness between two amino acid sequences or nucleotide sequences, and can be expressed as a percentage. The terms homology and identity can often be used interchangeably.

[0037] The homology or sequence identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms and can be used in conjunction with a standard gap penalty established by the program used. Substantially, homologous or identical sequences are expected to hybridize with all or at least about 50%, 50%, 60%, 70%, 80%, or 90% of the entire sequence length under moderate or highly stringent conditions. Polynucleotides containing codons Petition 870250091575, dated 07 / 10 / 2025, p. 30 / 104 13 / 81 degenerate codons instead of codons in hybridizing polynucleotides can also be considered.

[0038] Whether any two polynucleotide or polypeptide sequences exhibit homology, similarity, or identity can, for example, be determined by a known computer algorithm, such as the FASTA program (Pearson et al., (1988) [ Proc. Natl. Acad. Sci. USA 85]: 2444) using standard parameters. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), which is performed using the Needleman program from the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (preferably version 5.0.0 or later) (GCG program package (Devereux, J., et al., Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [et al., J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994 and [CARILLO ETA / .](1988) SIAM J Applied Math 48: 1073).For example, homology, similarity, or identity can be determined using BLAST or ClustalW from the National Center for Biotechnology Information (NCBI).

[0039] The homology, similarity, or identity of polynucleotides or polypeptides can be determined, for example, by comparing sequence information using, Petition 870250091575, dated 07 / 10 / 2025, page 31 / 104 14 / 81 for example, the GAP computer program, as Needleman et al. (1970), J Mol Biol. 48: 443, in the manner described in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines homology, similarity, or identity as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter sequence of the two. Standard parameters for the GAP program may include (1) unitary matrices (containing a value of 1 for identities and 0 for non-identities), PAM matrix as described in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation (1978), and the weighted comparison matrix of Gribskov et al. (1986), Nucl. Acids Res. 14:6745 (or EDNAFULL substitution matrix (EMBOSS version of NCBI NUC4).4)); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

[0040] Additionally, whether any two polynucleotide sequences exhibit homology, similarity, or identity can be determined by comparing sequences through Southern hybridization experiments under rigorously defined conditions, and the conditions of Petition 870250091575, dated 07 / 10 / 2025, p. 32 / 104 15 / 81 appropriate hybridizations to be defined can be determined by means of a method within the scope of the present description, which is known to those skilled in the art (e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York), but is not limited to these.

[0041] “Strict conditions” refers to the conditions under which specific hybridization between polynucleotides is permitted. Such conditions are specifically described in the literature (Sambrook et al., supra, 9.50-9.51, 11.7-11.8).For example, stringent conditions may include conditions under which polynucleotides with high homology or identity, i.e., polynucleotides with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity, hybridize with each other, while polynucleotides with lower homology or identity than above do not hybridize with each other; or they may include common Southern hybridization washing conditions, i.e., washing once, specifically two or three times, at a salt concentration and temperature corresponding to 60 °C, 1 x SSC, 0.1% SDS, specifically 60 °C, 0.1 x SSC, 0.1% SDS and, more specifically, 68 °C, 0.1 x SSC, 0.1%. Petition 870250091575, dated 07 / 10 / 2025, p. 33 / 104 16 / 81 SDS.

[0042] Hybridization requires that two nucleic acids have complementary sequences, although base mismatches are possible depending on the severity of the hybridization. The term complementary is used to describe a relationship between nucleotide bases that can hybridize with each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Therefore, the polynucleotide of the present description may also include an isolated nucleotide fragment of acid complementary to the complete sequence, as well as a nucleic sequence substantially similar to it.

[0043] For example, polynucleotides with homology or identity to the polynucleotide of the present description can be detected using the hybridization conditions, including a hybridization step at a Tm value of 55 °C under the conditions described above. In addition, the Tm value can be 60 °C, 63 °C or 65 °C, but is not limited to these, and can be adjusted appropriately by those skilled in the art, depending on the purpose.

[0044] The appropriate stringent condition for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementation, and these variables are well known in the art (e.g., Sambrook et al.). Petition 870250091575, dated 07 / 10 / 2025, page 34 / 104 17 / 81 Nucleic Acid Construction, Vector and Transformation

[0045] As used in this document, the term “nucleic acid construct” refers to a single- or double-stranded nucleic acid molecule that includes one or more regulatory sequences and that is artificially synthesized or engineered to include a specific sequence in a way that does not exist in nature or is isolated from nature.

[0046] As used in this document, the term “Vector” refers to a DNA construct for delivering a target polynucleotide to a suitable host or host cell. In one example, the vector may contain the nucleotide sequence of a polynucleotide encoding the target polypeptide operationally linked to a suitable expression regulatory region (expression regulatory sequence) so as to be able to express the target polypeptide in a suitable host cell, but is not limited to this.

[0047] The expression regulatory sequence may include a promoter capable of initiating transcription, any operator sequence to regulate transcription, a sequence encoding an appropriate mRNA ribosome binding site, and a sequence to regulate transcription and translation termination. Once transformed into a suitable host cell, the vector may replicate itself or Petition 870250091575, dated 07 / 10 / 2025, page 35 / 104 18 / 81 can function independently of the host genome, or it can integrate into the host genome.

[0048] The vector used in this description is not particularly limited, and any vector known in the art may be used. Examples of vectors typically used may include natural or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, as a phage vector or cosmid vector, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A, etc., may be used; and as plasmid vectors, those based on pDZ, pDC, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET, etc., may be used. Specifically, the following vectors can be used: pDZ, pDC, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pDCM2(WO2021-187781 A1), etc.

[0049] In one example, a target polynucleotide can be inserted into the chromosome using a vector for intracellular chromosome insertion. The insertion of the polynucleotide into the chromosome can be performed by any method known in the art, for example, by homologous recombination, but is not limited to this. The vector may also include a selection marker to confirm insertion into the chromosome. The selection marker serves to select the cells transformed with the vector, that is, to confirm whether the target nucleic acid molecule was inserted, and markers that provide selectable phenotypes, such as drug resistance, Petition 870250091575, dated 07 / 10 / 2025, page 36 / 104 19 / 81 Auxotrophy, resistance to cellular toxic agents, or expression of surface polypeptides can be used. Only cells expressing the selection marker are able to survive or exhibit different phenotypes in the environment treated with the selective agent, and therefore, the transformed cells can be selected.

[0050] As used in this document, the term transformation refers to the introduction of a vector containing a target polynucleotide into a host cell to alter the host cell's genetic characteristics. The transformed polynucleotide may be integrated into the host cell's chromosome and localized there, or located extrachromosomally. Furthermore, the polynucleotide may include DNA and / or RNA. The polynucleotide may be introduced in a suitable form depending on the purpose of the introduction. For example, the polynucleotide to express the target polypeptide may be introduced into the host cell in the form of an expression cassette, which is a gene construct that includes all the elements necessary for its autonomous expression. The expression cassette may commonly include a promoter operationally linked to the polynucleotide, a transcription terminator, a ribosome binding site, or a translation terminator.The expression cassette can be in the form of a self-replicating expression vector. Furthermore, Petition 870250091575, dated 07 / 10 / 2025, page 37 / 104 20 / 81 The polynucleotide can be introduced into the host cell as is and operationally linked to the sequences necessary for expression in the host cell, but it is not limited to that.

[0051] As used in this document, the term “operationally linked” refers to the constitution of a regulatory sequence positioned in an appropriate location to regulate the expression of a coding sequence. Thus, the term “operationally linked” includes a linkage or connection between a regulatory region of a functional domain with a known or desired activity, such as a promoter, a stop codon, a signal sequence, or an enhancer, and a target (gene or polypeptide) such that the expression, secretion, or function of the target can be regulated according to the known or desired activity. For example, it may mean that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates the transcription of the polynucleotide encoding the polypeptide.

[0052] As used in this document, the term “expression” includes any step involved in the production of a polypeptide, for example, transcription, post-transcriptional modification, translation, post-translational modification and secretion, etc., but is not limited to these.

[0053] As used in this document, the term vector Petition 870250091575, dated 07 / 10 / 2025, page 38 / 104 "21 / 81 expression" refers to a linear or circular nucleic acid molecule that includes a target polynucleotide sequence and an operationally linked regulatory sequence for its expression.

[0054] As used in this document, the term “regulatory sequence” refers to a polynucleotide sequence required for the expression of a target polynucleotide sequence. Each regulatory sequence may be native (derived from the same origin) or foreign (derived from different genes) to the coding sequence, or it may be a mutant sequence of this or other artificial sequences. Examples of regulatory sequences may include a leader sequence, a polyadenylation sequence, a propeptide sequence, a promoter, a signal peptide sequence, an operator sequence, a sequence encoding a ribosome binding site, and a sequence to regulate transcription and translation termination. The smallest units of the regulatory sequence may include a promoter and a sequence to terminate transcription and translation.

[0055] As used in this document, the term “recombinant,” in relation to a cell, polynucleotide, polypeptide, or vector, means that the cell, polynucleotide, polypeptide, or vector has been modified by the introduction of a heterologous nucleic acid or polypeptide or by the alteration of a polynucleotide or polypeptide. Petition 870250091575, dated 07 / 10 / 2025, page 39 / 104 22 / 81 native, or that the cell is derived from a cell that has been modified in this way. Therefore, for example, recombinant cells may express genes that are not found in the native (non-recombinant) form of the cells, or they may express native genes that are otherwise abnormally expressed, underexpressed, or not expressed at all. Microorganisms

[0056] As used in this document, the term microorganism (or strain) includes all wild microorganisms, or prokaryotic or eukaryotic microorganisms in which natural or artificial genetic modifications occur, and may be a microorganism in which a specific mechanism is weakened or enhanced due to the insertion of a foreign gene, or the increase or inactivation of the activity of an endogenous gene, etc., and may be a microorganism that includes genetic modification to produce a desired polypeptide, protein or product. In the present description, the terms microorganism and strain may be used interchangeably.

[0057] For example, the microorganism described herein may be a microorganism (e.g., recombinant strain) in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity of the same, but is not limited to this.

[0058] As used in this document, the term Petition 870250091575, dated 07 / 10 / 2025, page 40 / 104 23 / 81 “A microorganism capable of producing O-acetylhomoserine or a derivative thereof, which is a microorganism capable of producing O-acetylhomoserine or a derivative thereof in an organism, may include all microorganisms to which the ability to produce O-acetylhomoserine or a derivative thereof has been conferred, which did not endogenously possess the ability to produce O-acetylhomoserine or a derivative thereof, or microorganisms that endogenously possess the ability to produce O-acetylhomoserine or a derivative thereof. The ability to produce O-acetylhomoserine or a derivative thereof may be conferred or enhanced by species breeding.”

[0059] As used in this document, the term “unmodified microorganism (strain)” does not exclude a microorganism (strain) containing a mutation that may occur naturally and may refer to a wild-type microorganism (strain) or a naturally occurring microorganism (strain), or a microorganism (strain) before its characteristic is altered due to genetic modification caused by natural or artificial factors. As used in this document, the term “unmodified microorganism (strain)” may be used interchangeably with “microorganism (strain) before modification,” “non-mutant microorganism (strain),” “parental microorganism,” “parental strain,” “wild-type microorganism (strain),” “microorganism (strain) of Petition 870250091575, dated 07 / 10 / 2025, page 41 / 104 24 / 81 reference” or “standard microorganism (strain)”. In the present description, the unmodified microorganism may be a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is not increased compared to the endogenous activity of the same, or a microorganism before its increase.

[0060] Additionally, in the present description, the unmodified microorganism may be a microorganism that includes a polynucleotide consisting of an amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, but is not limited to this. Increased Polypeptide Activity

[0061] As used in this document, the term “increase” in polypeptide activity means that the activity of a polypeptide is increased in a host cell, compared to the endogenous activity of the same cell. The increase can be used interchangeably with terms such as activation, upregulation, overexpression, enhancement, etc. The host cell can be a prokaryotic or eukaryotic microorganism.

[0062] Increased polypeptide activity can include both cases where polypeptide activity not endogenously possessed by a host cell is exhibited, and cases where polypeptide activity is increased compared to endogenous activity or to Petition 870250091575, dated 07 / 10 / 2025, page 42 / 104 25 / 81 activity before modification.

[0063] For example, the description “exhibiting an activity of a non-endogenously possessed polypeptide” may be caused by the “introduction of a polypeptide,” but is not limited to this. As used in this document, the term “introduction” of a polypeptide means that a gene not originally possessed by a microorganism is expressed in the microorganism and, therefore, the microorganism exhibits the activity of a specific polypeptide, or the activity of a polypeptide is increased or intensified compared to the endogenous activity of the corresponding polypeptide or to the activity before the modification. For example, it may be a case where a polynucleotide encoding a specific polypeptide is introduced into the chromosome of a microorganism, or a vector containing a polynucleotide encoding a specific polypeptide is introduced into a microorganism, thus exhibiting its activity.

[0064] “Endogenous activity” refers to the activity of a specific polypeptide originally possessed by a microorganism before transformation or of an unmodified microorganism when a characteristic is altered by genetic variation due to a natural or artificial factor. Endogenous activity can also be used interchangeably with “activity before modification”.

[0065] The increase in the activity of a polypeptide in Petition 870250091575, dated 07 / 10 / 2025, page 43 / 104 26 / 81 Comparison with endogenous activity means that the activity and / or concentration (expression level) of a microorganism's polypeptide is enhanced, compared to the activity and / or concentration (expression level) of the polypeptide originally possessed by a microorganism before transformation or an unmodified microorganism.

[0066] In one example, the increase may mean that the activity of a corresponding protein / polypeptide not originally displayed is displayed, or that the activity or concentration thereof is increased generally by about 1% or more, about 10% or more, about 25% or more, about 50% or more, about 75% or more, about 100% or more, about 150% or more, about 200% or more, about 300% or more, about 400% or more, or about 500% or more, at most about 1000% or about 2000% or more, based on the activity or concentration of the initial microbial strain, but not limited to that.

[0067] Increased polypeptide activity can be achieved by introducing a foreign polypeptide or by increasing the activity of an endogenous polypeptide. Whether or not polypeptide activity is increased can be confirmed by the activity level of the corresponding polypeptide, its expression level, or by an increase in the amount of products produced from the corresponding polypeptide. Petition 870250091575, dated 07 / 10 / 2025, page 44 / 104 27 / 81

[0068] Increasing polypeptide activity can be achieved by several well-known methods in the art and is not limited, provided it can increase the activity of a target polypeptide compared to that of a microorganism before modification. Specifically, genetic engineering and / or protein engineering, well-known to those skilled in the art, which is a common method in molecular biology, can be used, but the method is not limited to them (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).

[0069] Specifically, the increase in polypeptide activity of the present description can be achieved by: 1) increase the number of intracellular copies of a polynucleotide that codes for the polypeptide; 2) modify the regulatory region of the expression of a gene that codes for the polypeptide on the chromosome (for example, inducing a modification in the regulatory region of expression, replacing it with a sequence with stronger activity, or inserting a sequence with stronger activity); 3) modify the nucleotide sequence that codes for the initiation codon or 5'-UTR of a gene transcript that codes for the polypeptide; 4) modify the amino acid sequence of the polypeptide so that the activity of the polypeptide is increased; Petition 870250091575, dated 07 / 10 / 2025, page 45 / 104 28 / 81 5) modify the polynucleotide sequence that codes for the polypeptide so that the activity of the polypeptide is increased (for example, modifying the polynucleotide sequence of the polypeptide gene to code for a polypeptide that has been modified to increase the activity of the polypeptide); 6) introduce a foreign polypeptide that exhibits polypeptide activity or a foreign polynucleotide that encodes it; 7) Codon optimization of a polynucleotide that codes for the polypeptide; 8) Analyze the tertiary structure of the polypeptide and thus select and modify the exposed site, or chemically modify it; 9) regulate the cellular location of the protein (polypeptide); or 10) a combination of two or more selected from items 1) to 9), but not limited to.

[0070] For example, Method 1) for increasing the number of intracellular copies of a polynucleotide encoding a polypeptide can be achieved by introducing a vector containing a polynucleotide encoding the polypeptide, which is operationally linked to a suitable regulatory sequence, into a host cell. The vector can be a vector Petition 870250091575, dated 07 / 10 / 2025, page 46 / 104 29 / 81 capable of replicating and functioning independently of the host cell. Alternatively, the method can be achieved by introducing one or two or more copies of polynucleotides encoding the polypeptide, which is operationally linked to a suitable regulatory sequence, into the host cell chromosome. The introduction into the chromosome can be accomplished by introducing a vector capable of inserting the polynucleotide into the host cell chromosome, but is not limited to this. The vector is as described above. The regulatory sequence can be native (derived from the same origin) or foreign (derived from different genes) to the coding polynucleotide sequences, or it can be a mutant sequence or other artificial sequences, and it can induce the expression of the polynucleotide in the host cell.

[0071] Method 2) for replacing the expression regulatory region (or expression regulatory sequence) of a gene encoding the polypeptide on the chromosome with a sequence with strong activity can be achieved, for example, by inducing a sequence modification through deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing the sequence with a sequence with strong activity. The expression regulatory region may include, but is not limited to, a promoter, Petition 870250091575, dated 07 / 10 / 2025, page 47 / 104 30 / 81 an operator sequence, a sequence that encodes a ribosome binding site, and a sequence that regulates transcription and translation termination, etc. In one example, the method may include replacing the original promoter with a strong promoter, but it is not limited to that.

[0072] Examples of known strong promoters may include promoters cj1 to cj7 (US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (US 10584338 B2), O2 promoter (US 10273491 B2), tkt promoter, yccA promoter, etc., but strong promoters are not limited to these.

[0073] Method 3) for modifying the nucleotide sequence that codes for the initiation codon or 5'-UTR of a gene that codes for the polypeptide can be achieved, for example, by replacing the initiation codon with another initiation codon with a higher expression rate of the polypeptide compared to the endogenous initiation codon, but is not limited to this.

[0074] Methods 4) and 5) for modifying the amino acid sequence or the polynucleotide sequence of the polypeptide can be achieved by inducing a sequence modification through deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the encoding polynucleotide sequence. Petition 870250091575, dated 07 / 10 / 2025, page 48 / 104 31 / 81 the polypeptide, or a combination thereof, to increase the activity of the polypeptide; or by replacing the sequence with an amino acid sequence or a polynucleotide sequence modified to exhibit stronger activity, or an amino acid sequence or a polynucleotide sequence modified to increase activity, but not limited to these. The substitution may be performed specifically by inserting the polynucleotide into the chromosome by homologous recombination, but not limited to these. The vector used in this document may additionally include a selection marker to confirm insertion into the chromosome. The selection marker is as described above.

[0075] Method 6) for introducing a foreign polynucleotide that exhibits the activity of the polypeptide can be achieved by introducing into a host cell a foreign polynucleotide that encodes a polypeptide exhibiting the same / similar activity to the polypeptide. The foreign polynucleotide can be used without limitation, regardless of its origin or sequence, as long as it exhibits the same / similar activity to the polypeptide. The introduction can be performed by those skilled in the art, appropriately selecting a transformation method known in the field, and the expression of the introduced polynucleotide in the host cell allows the production of Petition 870250091575, dated 07 / 10 / 2025, page 49 / 104 32 / 81 polypeptide, thus increasing its activity.

[0076] Method 7) for optimizing the codons of a polynucleotide encoding the polypeptide can be achieved by optimizing the codons of an endogenous polynucleotide to increase transcription or translation in a host cell, or by optimizing its codons so that optimized transcription and translation of a foreign polynucleotide can be achieved in the host cell.

[0077] Method 8) for analyzing the tertiary structure of the polypeptide and thus selecting and modifying the exposed site, or modifying it chemically, can be achieved, for example, by comparing the sequence information of the polypeptide to be analyzed with a database in which sequence information of known proteins is stored, to determine candidate template proteins according to the degree of sequence similarity and thus confirm the structure based on the information, selecting and transforming or modifying the exposed site to be modified or chemically modified.

[0078] Method 9) for regulating the cellular localization of the protein (polypeptide) can be achieved by targeting the protein (polypeptide) to a specific organelle or a specific space in the cell. For example, it can be achieved by targeting the protein (polypeptide) to the periplasm or cytoplasm through the addition or removal of a sequence. Petition 870250091575, dated 07 / 10 / 2025, pp. 50 / 104 33 / 81 leader that acts in the targeting of proteins (polypeptides), but is not limited to that.

[0079] Such intensification of polypeptide activity may mean that the activity or concentration of the corresponding polypeptide is increased relative to the activity or concentration of a polypeptide expressed in a wild-type microorganism or in a microorganism before modification, or that the amount of products produced from the corresponding polypeptide is increased, but is not limited to this. Weakening of Polypeptide Activity

[0080] As used in this document, the term weakening of the activity of a polypeptide (e.g., includes proteins specified by the name of each enzyme) is a broad concept that includes reduced activity or no activity compared to the endogenous activity of the same. Weakening can be used interchangeably with terms such as inactivation, deficiency, downregulation, decrease, reduction, attenuation, etc.

[0081] Weakening may also include a case where the activity of a polypeptide itself is diminished or removed compared to the activity of the polypeptide originally possessed by a microorganism due to mutation of a polynucleotide encoding the polypeptide, etc.; a case where the overall level of activity and / or concentration of Petition 870250091575, dated 07 / 10 / 2025, page 51 / 104 34 / 81 Intracellular polypeptide (expression level) is decreased compared to a natural strain due to inhibition of the expression of a polynucleotide gene encoding the polypeptide, or inhibition of translation into the polypeptide, etc.; a case where the polynucleotide is not expressed at all; and / or a case where no polypeptide activity is observed even when the polynucleotide is expressed. The expression that the activity of a polypeptide is “inactivated, deficient, decreased, negatively regulated, reduced or attenuated” compared to the endogenous activity of the same means that the activity of a polypeptide is decreased compared to the activity of a specific polypeptide originally possessed by a parental strain before transformation or an unmodified microorganism.

[0082] Weakening the activity of a polypeptide can be achieved by any method known in the art, but the method is not limited to it, and can be achieved by applying several well-known methods in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2):2773-2793, Sambrook et al. Molecular Cloning 2012, etc.).

[0083] Specifically, the weakening of the activity of a polypeptide of the present description can be achieved by: Petition 870250091575, dated 07 / 10 / 2025, page 52 / 104 35 / 81 1) delete part or all of a gene that codes for the polypeptide; 2) modify the regulatory region of expression (regulatory sequence of expression) so that the expression of a gene encoding the polypeptide is decreased; 3) modify the amino acid sequence that constitutes the polypeptide so that the polypeptide activity is removed or weakened (for example, deletion / substitution / addition of one or more amino acids in the amino acid sequence); 4) modify the genetic sequence that codes for the polypeptide so that the polypeptide activity is removed or weakened (for example, deletion / substitution / addition of one or more nucleotides in the nucleotide sequence of the polypeptide gene to encode a polypeptide that has been modified to remove or weaken the polypeptide activity); 5) modify the nucleotide sequence that codes for the initiation codon or 5'-UTR of a genetic transcript that codes for the polypeptide; 6) introduce an antisense oligonucleotide (e.g., antisense RNA), which binds complementarily to a genetic transcript that encodes the polypeptide; 7) Add a complementary sequence to the Shine-Dalgarno (SD) sequence at the leading end of the SD sequence. Petition 870250091575, dated 07 / 10 / 2025, pp. 53 / 104 36 / 81 of a gene that codes for the polypeptide to form a secondary structure, thus inhibiting ribosomal binding; 8) Reverse transcription engineering (RTE), which adds a promoter, to be reverse transcribed, to the 3' end of the open reading frame (ORF) of a genetic sequence that encodes the polypeptide; 9) regulate the cellular location of the protein (polypeptide); or 10) a combination of two or more selected from 1 to 9 above, but not limited to.

[0084] For example, Method 1) for deleting part or all of a gene encoding the polypeptide can be achieved by deleting the entire polynucleotide encoding the endogenous target polypeptide within the chromosome, or by replacing the polynucleotide with a polynucleotide containing a partially deleted nucleotide, or with a marker gene.

[0085] Method 2) for modifying the expression regulatory region (expression regulatory sequence) can be achieved by inducing a modification in the expression regulatory region (expression regulatory sequence) through deletion, insertion, non-conservative substitution or conservative substitution, or a combination thereof; or by replacing the sequence with a sequence with activity Petition 870250091575, dated 07 / 10 / 2025, pp. 54 / 104 37 / 81 weaker. The regulatory region of expression may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence to regulate transcription and translation termination, but is not limited to these.

[0086] Methods 3) and 4) for modifying the amino acid sequence or polynucleotide sequence can be achieved by inducing a sequence modification through deletion, insertion, non-conservative or conservative substitution of the polypeptide amino acid sequence or the polynucleotide sequence encoding the polypeptide, or a combination thereof, to weaken the polypeptide activity, or by replacing the sequence with an amino acid sequence or polynucleotide sequence modified to exhibit weaker activity, or an amino acid sequence or polynucleotide sequence modified to exhibit no activity, but not limited to, but not limited to. For example, gene expression can be inhibited or weakened by introducing a mutation in the polynucleotide sequence to form a stop codon, but not limited to, but.

[0087] Method 5) for modifying the nucleotide sequence encoding the initiation codon or 5'-UTR of a gene transcript encoding the polypeptide can be achieved, for example, by replacing the sequence of Petition 870250091575, dated 07 / 10 / 2025, page 55 / 104 38 / 81 nucleotides per nucleotide sequence that codes for another initiation codon with a lower polypeptide expression rate than the endogenous initiation codon, but not limited to that.

[0088] Method 6) for introducing an antisense oligonucleotide (e.g., antisense RNA), which binds complementarily to a gene transcript encoding the polypeptide, can be found in the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].

[0089] Method 7) for adding a complementary sequence to the Shine-Dalgarno (SD) sequence at the leading end of the SD sequence of a gene encoding the polypeptide to form a secondary structure, thereby inhibiting ribosome binding, can be achieved by inhibiting mRNA translation or by slowing its rate.

[0090] Reverse transcription engineering (RTE) 8), which adds a promoter, to be reverse transcribed, at the 3' end of the open reading frame (ORF) of a genetic sequence encoding the polypeptide, can be achieved by forming an antisense nucleotide complementary to the genetic transcript encoding the polypeptide to weaken the activity.

[0091] Additionally, method 9) for regulating the Petition 870250091575, dated 07 / 10 / 2025, pp. 56 / 104 39 / 81 The cellular localization of a protein (polypeptide) can be achieved by targeting the protein (polypeptide) to a specific organelle or a specific space within the cell. For example, this can be achieved by targeting the protein (polypeptide) to the periplasm or cytoplasm through the addition or removal of a leader sequence that acts in targeting the protein (polypeptide), but it is not limited to this.

[0092] Such weakening of polypeptide activity may mean that the activity or concentration of the corresponding polypeptide is weakened relative to the activity or concentration of a polypeptide expressed in a wild strain or in a microbial strain before modification, or that the amount of products produced from the corresponding polypeptide is reduced, but is not limited to this.

[0093] The modification of part or all of the polynucleotide in the microorganism of the present description (a) can be achieved by homologous recombination using a vector for chromosomal insertion into the microorganism or genome editing using an engineered nuclease (e.g., CRISPR-Cas9), and / or (b) can be induced by light, such as ultraviolet rays and radiation, etc., and / or treatments with chemical substances, but is not limited to these. Petition 870250091575, dated 07 / 10 / 2025, page 57 / 104 40 / 81 Culture

[0094] As used in this document, the term culture means that microorganisms are cultured under suitably controlled environmental conditions. The culture process described herein can be carried out in a suitable culture medium and under culture conditions known in the art. Such a culture process can be easily adapted for use by those skilled in the art, according to the microorganism to be selected. Specifically, the culture can be a batch culture, a continuous culture and / or a fed-batch culture, but is not limited to these.

[0095] As used in this document, the term medium refers to a mixture of materials containing nutrients necessary for the culture of microorganisms as the main ingredient, and provides nutrients and growth factors, along with water, essential for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism described herein may be any medium used for the conventional culture of microorganisms, without any specific limitation. However, the microorganism described herein may be cultured under aerobic conditions in a conventional medium containing a carbon source, a source of Petition 870250091575, dated 07 / 10 / 2025, pp. 58 / 104 41 / 81 nitrogen, phosphorus source, inorganic compound, amino acid and / or appropriate vitamin, etc., adjusting the temperature, pH, etc. For example, the culture medium for microorganisms of the genus Corynebacterium can be found in the literature [“Manual of Methods for General Bacteriology” of the American Society of Bacteriology (Washington DC, USA, 1981)].

[0096] In the present description, the carbon source may include carbohydrates such as glucose, sucrose, lactose, fructose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvic acid, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. In addition, the carbon source may include natural organic nutrients such as starch hydrolysate, molasses, cane molasses, rice bran, cassava, cane molasses, and corn steep liquor, etc. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted to reducing sugar) may be used, and in addition, various other carbon sources in appropriate amounts may be used without limitation. These carbon sources can be used individually or in a combination of two or more types, but are not limited to this.

[0097] The nitrogen source may include sources of Petition 870250091575, dated 07 / 10 / 2025, pp. 59 / 104 42 / 81 Inorganic nitrogen, such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; amino acids, such as glutamic acid, methionine, glutamine, etc.; and organic nitrogen sources, such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or its decomposition product, defatted soybean meal or its decomposition product, etc. These nitrogen sources may be used alone or in a combination of two or more types, but are not limited to this.

[0098] The phosphorus source may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts, etc. Examples of inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc. In addition, amino acids, vitamins, and / or appropriate precursors, etc., may be included. These constituent ingredients or precursors may be added to a medium in batches or continuously, but these phosphorus sources are not limited to this.

[0099] Additionally, the pH of the medium can be adjusted by adding a compound such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, acid Petition 870250091575, dated 07 / 10 / 2025, pages 60 / 104 43 / 81 sulfuric, etc. during the culture of the microorganism of the present description in an appropriate manner. Furthermore, bubble formation can be avoided during culture by using an antifoaming agent, such as fatty acid polyglycol ester. Additionally, oxygen gas or a gas containing oxygen can be injected into the medium to maintain aerobic conditions; or nitrogen gas, hydrogen gas, or carbon dioxide can be injected to maintain anaerobic or microaerobic conditions without gas injection, but gas is not limited to this.

[00100] The temperature during the culture of the present description may be in the range of 20 °C to 45 °C, specifically 25 °C to 40 °C, and the culture may be continued for about 10 to 160 hours, but is not limited to this.

[00101] As used in this document, the term culture means a culture solution, a concentrated culture solution, a dried product of a culture solution, a culture filtrate, a concentrated culture filtrate, or a dried product of a culture filtrate obtained by culturing a specific microorganism in a culture medium, and means that the culture solution may include the specific microorganism, while the culture filtrate does not substantially include the specific microorganism (in particular, it means substantially). Petition 870250091575, dated 07 / 10 / 2025, pp. 61 / 104 44 / 81 exclude a specific microorganism isolated by filtration, etc., but it does not mean that the microorganism is completely excluded from the filtrate). The culture formulation is not limited, and may be, for example, a liquid, an emulsion, or a solid.

[00102] As used in this document, the term fermentation means that the strains do not putrefy during the process of decomposition of organic matter using their own enzymes. The fermentation reaction and the decomposition reaction occur through similar processes, but when decomposition produces useful substances, it is called fermentation, and when odorous or harmful substances are produced, it is called decomposition.

[00103] In the present description, the method for obtaining a fermented product from the microorganism is not particularly limited, and may be obtained in accordance with a method commonly used in the art or in similar fields.

[00104] As used in this document, the term fermented product may include not only the fermented material itself, but also all types of materials, including fermented products produced from the strain, such as a culture medium of the strain in which the strain and the culture coexist, a fermented product produced from the culture medium, a fermented product obtained by filtering the microorganism from the culture medium, a product Petition 870250091575, dated 07 / 10 / 2025, pp. 62 / 104 45 / 81 fermented product obtained by sterilizing the microorganism from the culture medium and filtering it, an extract obtained by extracting the fermented product or a culture medium containing it, a diluted solution obtained by diluting the fermented product or an extract thereof, a concentrated solution, a dry product obtained by drying the fermented product or an extract thereof, and a lysate obtained by collecting and lysing the cells of the microorganisms, etc. Detailed Description of the Present Description

[00105] The modalities of this description will be described in detail as follows: One aspect of the present description provides a microorganism in which the activity of the pyruvate dehydrogenase A subunit E1 of the complex is increased compared to the endogenous activity of the same.

[00106] In one example of the present description, the microorganism of the present description may exhibit the ability to produce O-acetyl-homoserine or a derivative thereof.

[00107] The increased activity of the E1 subunit of the pyruvate dehydrogenase complex can be defined as an increased capacity to produce O-acetylhomoserine or a derivative thereof by the microorganism of the present description, compared to the production capacity of a natural wild microorganism or a non-naturally occurring microorganism. Petition 870250091575, dated 07 / 10 / 2025, pp. 63 / 104 46 / 81 modified (for example, a microorganism that expresses a polypeptide with the activity of the E1 subunit of the pyruvate dehydrogenase complex (for example, a polypeptide of SEQ ID NO: 1), or a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is not increased compared to the endogenous activity of the same, or rather, the activity is increased but not limited to it.

[00108] For example, the activity of the E1 subunit of the pyruvate dehydrogenase complex is determined by measuring the production capacity or yield of O-acetylmoserine or a derivative thereof, but is not limited to this.

[00109] As used in this document, the term “pyruvate dehydrogenase complex E1 subunit”, which is a component of the pyruvate dehydrogenase complex, may be a polypeptide that includes an E1 active site that converts pyruvic acid to acetyl-CoA and CO2 in pyruvate dehydrogenase.

[00110] The E1 subunit of the pyruvate dehydrogenase complex of the present description can be used interchangeably with AceE. The E1 subunit of the pyruvate dehydrogenase complex is known in the art and can be specifically encoded by, but is not limited to, aceE. The amino acid and polynucleotide sequences of the E1 subunit of the pyruvate dehydrogenase complex can be Petition 870250091575, dated 07 / 10 / 2025, pp. 64 / 104 47 / 81 obtained from a known database, from NCBI's GenBank, etc., but are not limited to that.

[00111] In one example, the E1 subunit of the pyruvate dehydrogenase complex may include an amino acid sequence of SEQ ID NO: 1, or an amino acid sequence with 60% or more homology or identity to it, but not limited to, provided that they have the same activity as the E1 subunit of the pyruvate dehydrogenase complex. Specifically, any protein with the amino acid sequence of SEQ ID NO: 1, in which part of the sequence is deleted, modified, substituted, or added, may fall within the scope of the E1 subunit of the pyruvate dehydrogenase complex, provided that it exhibits an efficacy corresponding to that of the E1 subunit of the pyruvate dehydrogenase complex.Furthermore, any protein that has or includes the amino acid sequence SEQ ID NO: 1 or an amino acid sequence with at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity with SEQ ID NO: 1, which consists of the above amino acid sequences, or which consists essentially of the above amino acid sequences, and which exhibits an efficacy corresponding to that of the E1 subunit of the pyruvate dehydrogenase complex may fall within the scope of the E1 subunit of the pyruvate dehydrogenase complex. For example, the E1 subunit of the pyruvate dehydrogenase complex could be... Petition 870250091575, dated 07 / 10 / 2025, pp. 65 / 104 48 / 81 a foreign protein, or a protein endogenously present in a microorganism of the genus Corynebacterium or Corynebacterium glutamicum, but not limited to that. Specifically, it may be the E1 subunit of the pyruvate dehydrogenase complex, consisting of the amino acid sequence SEQ ID NO: 1, which is endogenously present in a microorganism of the genus Corynebacterium or Corynebacterium glutamicum, but not limited to that. Examples of this may include NCBI Reference number WP_011014985.1, etc.

[00112] Additionally, the polynucleotide encoding the E1 subunit of the pyruvate dehydrogenase complex, with the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence with 60% or more homology or identity, can be prepared, for example, based on codon information known in the art. In one example, the protein may be encoded by a polynucleotide that may feature or include the nucleotide sequence SEQ ID NO: 2 or SEQ ID NO: 3, or a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more and less than 100% homology or identity with the nucleotide sequence SEQ ID NO: 2 or SEQ ID NO: 3, which may consist of the above nucleotide sequence, or which may Petition 870250091575, dated 07 / 10 / 2025, pp. 66 / 104 49 / 81 essentially consists of the nucleotide sequence above, but is not limited to it. Additionally, the nucleotide sequence for SEQ ID NO: 2 or SEQ ID NO: 3 can be obtained from a known database, such as NCBI's GenBank, etc., but is not limited to that.

[00113] In the present description, the gene including a nucleotide sequence represented by a specific sequence number can be used interchangeably with a polynucleotide including the nucleotide sequence represented by a specific sequence number.

[00114] The polynucleotide of the present description may undergo various modifications in the coding region without altering the amino acid sequence of the E1 subunit of the pyruvate dehydrogenase complex of the present description, due to codon degeneracy or in consideration of preferred codons in an organism in which the E1 subunit of the pyruvate dehydrogenase complex of the present description is to be expressed. Therefore, based on codon degeneracy, it is evident that polynucleotides that can be translated into polypeptides consisting of the amino acid sequence of the E1 subunit of the pyruvate dehydrogenase complex of the present description or polypeptides with homology or identity to the same may also be included within the scope of the polynucleotide of the present description. For example, the polynucleotide of the present description may be SEQ ID NO: 2, Petition 870250091575, dated 07 / 10 / 2025, pp. 67 / 104 50 / 81 SEQ ID NO: 3 or a degenerate sequence thereof.

[00115] In another example, the polynucleotide of the present description may have or include a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with SEQ ID NO: 2 or SEQ ID NO: 3, or it may consist or consist essentially of a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more and less than 100% homology or identity with SEQ ID NO: 2 or SEQ ID NO: 3, but it is not limited to that.

[00116] Additionally, the polynucleotide of the present description may include a probe that can be prepared from a known genetic sequence, for example, any sequence that can hybridize with a sequence complementary to all or part of the polynucleotide sequence of the present description under stringent conditions to encode the E1 subunit of the pyruvate dehydrogenase complex of the present description, without limitation.

[00117] As used in this document, the term “O-acetylhomoserine or a derivative thereof” includes O-acetylhomoserine and products that can be produced using O-acetylhomoserine as a precursor. In one specific example, Petition 870250091575, dated 07 / 10 / 2025, pp. 68 / 104 51 / 81 O-acetyl-homoserine or a derivative thereof may be any one or more selected from O-acetyl-homoserine, L-methionine and L-homoserine.

[00118] For the purposes of this description, the microorganism described herein may include all microorganisms capable of producing the desired O-acetyl-homoserine or a derivative thereof by increasing the activity of the E1 subunit of the pyruvate dehydrogenase complex compared to its endogenous activity. For example, the microorganism described herein is distinguished by the fact that the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to its endogenous activity, thereby increasing its ability to produce O-acetyl-homoserine or a derivative thereof, and may be, but is not limited to, a genetically modified microorganism or a recombinant microorganism.Specifically, the recombinant microorganism with an increased capacity to produce O-acetyl-homoserine or a derivative thereof may be a microorganism with an increased capacity to produce O-acetyl-homoserine compared to a natural wild-type microorganism, or an unmodified microorganism with endogenous activity of the E1 subunit of the pyruvate dehydrogenase complex, but is not limited to this.

[00119] In one example, the microorganism with the ability Petition 870250091575, dated 07 / 10 / 2025, pp. 69 / 104 52 / 81 to produce O-acetyl-homoserine or a derivative thereof, which is a prokaryotic or eukaryotic microorganism capable of producing O-acetyl-homoserine or a derivative thereof in an organism, may include all microorganisms that endogenously have the ability to produce O-acetyl-homoserine or a derivative thereof, or microorganisms in which the ability to produce O-acetyl-homoserine or a derivative thereof has been conferred to a microorganism that does not endogenously have the ability to produce O-acetyl-homoserine or a derivative thereof. The ability to produce O-acetyl-homoserine or a derivative thereof may be conferred or enhanced by the activity of the E1 subunit of the pyruvate dehydrogenase complex or by species enhancement.

[00120] In one example, the recombinant microorganism with the ability to produce O-acetyl-homoserine or a derivative thereof may include all microorganisms that can be transformed by means of a vector and therefore capable of producing O-acetyl-homoserine or a derivative thereof, increasing the activity of the E1 subunit of the pyruvate dehydrogenase complex.

[00121] For example, the microorganism for the production of O-acetyl-homoserine or a derivative thereof may be a microorganism that endogenously includes a protein consisting of the amino acid sequence SEQ ID NO: 1, or a protein consisting of an amino acid sequence with Petition 870250091575, dated 07 / 10 / 2025, pp. 70 / 104 53 / 81 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7% or 99.9% or more of homology or identity with SEQ ID NO: 1.

[00122] For example, the microorganism for the production of O-acetyl-homoserine or a derivative thereof may be a microorganism that endogenously includes a polynucleotide sequence capable of encoding a protein that includes an amino acid sequence with at least 60% homology with SEQ ID NO: 1; or a polynucleotide including a nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3, or a nucleotide sequence with 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, or 98% or more homology or identity with the nucleotide sequence of SEQ ID NO: 2 or SEQ ID NO: 3.

[00123] The microorganism of the present description may include all microorganisms in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity of the same by various known methods.

[00124] In one embodiment, the microorganism, in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity of the same, may be a microorganism with increased activity due to the substitution of the sequence that regulates the Petition 870250091575, dated 07 / 10 / 2025, pp. 71 / 104 54 / 81 expression of the sequence encoding the E1 subunit of the pyruvate dehydrogenase complex by another sequence, by modifying the nucleotide sequence encoding the E1 subunit of the pyruvate dehydrogenase complex or by replacing the initiation codon, thus increasing protein expression, but not limited to this. In one embodiment, the microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity of the same, may be a microorganism with increased activity due to the replacement of the sequence that regulates the expression of the sequence encoding the E1 subunit of the pyruvate dehydrogenase complex by a sequence with stronger activity compared to the regulatory sequence of endogenous expression, thus increasing protein expression, but not limited to this.

[00125] In one example, the microorganism with increased capacity to produce O-acetyl-homoserine or a derivative of the present description may be, but is not limited to, an unmodified microorganism with increased capacity to produce O-acetyl-homoserine or a derivative thereof. In one example, the unmodified microorganism that is the target strain for comparing the increase in capacity to produce O-acetyl-homoserine or a derivative thereof may be, but is not limited to, the ATCC13032 strain. Petition 870250091575, dated 07 / 10 / 2025, pp. 72 / 104 55 / 81

[00126] In one example, a microorganism exhibiting an increased capacity to produce O-acetyl-homoserine or a derivative thereof may exhibit an increased capacity to produce O-acetyl-homoserine or a derivative thereof by about 1% or more, specifically, about 1% or more, about 2.5% or more, or about 5% or more, compared with the capacity to produce O-acetyl-homoserine or a derivative thereof of a parent microorganism (parent strain) before modification or of an unmodified microorganism, but is not limited to this, provided that it has an increased + value compared with the production capacity of a parent microorganism (parent strain) before modification or of an unmodified microorganism.In another example, the recombinant microorganism with an increased capacity to produce O-acetyl-homoserine or a derivative thereof may exhibit an increased capacity to produce O-acetyl-homoserine or a derivative thereof by approximately 1.01 times or more, approximately 1.02 times or more, approximately 1.03 times or more, approximately 1.04 times or more, approximately 1.05 times or more, approximately 1.06 times or more, approximately 1.07 times or more, approximately 1.08 times or more, approximately 1.09 times or more, or approximately 1.1 times or more, compared to that of a parent microorganism (parental strain) before modification or an unmodified microorganism, but is not limited to this. Petition 870250091575, dated 07 / 10 / 2025, pp. 73 / 104 56 / 81

[00127] In one example, the microorganism with the ability to produce O-acetyl-homoserine or a derivative thereof may be a prokaryotic cell or a eukaryotic cell, but it may specifically be a prokaryotic cell. The prokaryotic cell may include, for example, a microbial strain of the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, the genus Pseudomonas, the genus Leptospira, the genus Salmonella, the genus Brevibacteria, the genus Hypomononas, the genus Chromobacterium, and the genus Norcardia, or fungi or yeasts, but is not limited to these. Specifically, it may be a microbial strain of the genus Escherichia, the genus Corynebacterium, the genus Leptospira, and yeasts. More specifically, it may be a microorganism of the genus Corynebacterium.

[00128] As the microorganism according to any of the embodiments described above, the microorganism of the present description may be a microorganism of the genus Corynebacterium.

[00129] In an example, the microorganism of the present description may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Petition 870250091575, dated 07 / 10 / 2025, pp. 74 / 104 57 / 81 Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the microorganism described herein may be a microorganism of the genus Corynebacterium, more specifically, Corynebacterium glutamicum, but is not limited to this.

[00130] In addition, a microorganism of the genus Corynebacterium capable of producing O-acetylhomoserine or a derivative of the present description may include all of the following: a naturally occurring wild-type microorganism; a microorganism of the genus Corynebacterium in which the activity of a gene associated with the mechanism of production of O-acetylhomoserine or a derivative thereof is increased or decreased, thus exhibiting an increased capacity to produce O-acetylhomoserine or a derivative thereof; or a microorganism of the genus Corynebacterium in which the activity of a foreign gene is introduced or increased, thus exhibiting an increased capacity to produce O-acetylhomoserine or a derivative thereof.

[00131] The microorganism capable of producing O-acetyl-homoserine or a derivative thereof as described herein may additionally include a modification that increases the ability to produce the desired O-acetyl-homoserine or a derivative thereof.

[00132] In one example, the microorganism of the present Petition 870250091575, dated 07 / 10 / 2025, pp. 75 / 104 58 / 81 description may be a microorganism in which the activity of O-acetyl-homoserine transferase (MetX) is increased compared to the endogenous activity of the same.

[00133] In another example, the microorganism of the present description may include a modification of the inner membrane protein YjeH. The content of document WO2021125896 A1 may be incorporated into this document by reference.

[00134] In yet another example, the microorganism of the present description may include a modification in which the expression of aspartokinase (LysC) is enhanced and / or feedback inhibition is eliminated. In this regard, the content of US 10662450 B2 may be incorporated into this document by reference.

[00135] In yet another example, the microorganism described herein may be a microorganism in which the activity of cystathionine gamma synthase is weakened. For example, the microorganism described herein may be a microorganism in which the activity of the metB gene encoding cystathionine gamma synthase is weakened. For example, the microorganism may be a microorganism in which all or part of the metB gene is deleted.

[00136] In yet another example, the microorganism described herein may be a microorganism in which the activity of O-acetyl-homoserine (thiol)-lyase is Petition 870250091575, dated 07 / 10 / 2025, pp. 76 / 104 59 / 81 weakened. For example, the microorganism described herein may be a microorganism in which the activity of the metY gene encoding O-acetyl-homoserine (thiol)-lyase is weakened. For example, the microorganism may be a microorganism in which all or part of the metY gene is deleted.

[00137] In yet another example, the microorganism described herein may be a microorganism in which the activity of the endogenous protein Ncgl0616 is weakened. For example, the microorganism may be one in which all or part of the gene encoding Ncgl0616 has been deleted.

[00138] Another aspect of the present description provides a method for producing O-acetyl-homoserine or a derivative thereof, including: culturing a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared with the endogenous activity thereof, in a medium.

[00139] In the method described herein, the culture of the microorganism can be carried out using any culture conditions and culture methods known in the art. Such a culture process can be easily adjusted for use by those skilled in the art, according to the strain to be selected.

[00140] O-acetyl-homoserine or a derivative of Petition 870250091575, dated 07 / 10 / 2025, pp. 77 / 104 60 / 81 The same produced by the culture described herein can be released into the medium or remain in the cells.

[00141] In one embodiment, the method for producing Oacetyl-homoserine or a derivative thereof of the present description may additionally include a step of preparing the microorganism of the present description, a step of preparing a medium for culturing the strain, or a combination thereof (regardless of the order, in any order), for example, before the culturing step.

[00142] The method for producing O-acetyl-homoserine or a derivative of the present description may further include a step of recovering the desired substance, specifically O-acetyl-homoserine or a derivative thereof, from the microorganism being cultured, from a culture of the microorganism, from a fermented product of the microorganism or from the culture medium. The recovery step may also be included after the culture step.

[00143] In the recovery step, the desired O-acetyl-homoserine or a derivative thereof may be collected using the method for culturing the microorganism described herein, for example, using a suitable method known in the art, according to a batch culture, continuous culture or fed-batch culture method. For example, methods such as centrifugation, filtration, treatment with a protein crystallizing precipitant. Petition 870250091575, dated 07 / 10 / 2025, pp. 78 / 104 61 / 81 (crystallization method), extraction, ultrasonic disruption, ultrafiltration, dialysis, various types of chromatography, such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, etc., HPLC or a combination thereof may be used, and the desired substance, specifically, O-acetyl-homoserine or a derivative thereof, may be recovered from the medium or from microorganisms using suitable methods known in the art.

[00144] Additionally, the method for producing O-acetyl-homoserine or a derivative thereof of the present description may further include a purification step, which may be carried out using an appropriate method known in the art. In one example, when the method for producing O-acetyl-homoserine or a derivative of the present description includes both a recovery step and a purification step, the recovery step and the purification step may be carried out continuously or intermittently, regardless of the order, or simultaneously, or may be integrated into a single step, but the method is not limited to this.

[00145] In the method of the present description, the increase in the activity of the E1 subunit of the pyruvate dehydrogenase complex and O-acetyl-homoserine or a derivative thereof, etc., are in the manner described in other aspects. Petition 870250091575, dated 07 / 10 / 2025, pp. 79 / 104 62 / 81 previously.

[00146] Yet another aspect of the present description provides a composition for producing O-acetyl-homoserine or a derivative thereof, including: a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared with the endogenous activity thereof; a culture of the microorganism; a fermented product of the microorganism; or a combination of two or more of these.

[00147] The composition of the present description may additionally include any suitable excipient commonly used in compositions for the production of O-acetylmoserine or a derivative thereof, and such excipients may include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers or isotonic agents, etc., etc., but are not limited to these.

[00148] In one embodiment, each component present in the composition of the present description may be contained in a microbiologically effective amount or in an amount that may be appropriately present in the composition for production.

[00149] In the composition of the present description, the increased activity of the E1 subunit of the pyruvate dehydrogenase complex and of O-acetyl-homoserine or a derivative of Petition 870250091575, dated 07 / 10 / 2025, pages 80 / 104 63 / 81 same, etc., is in the manner described in other aspects previously.

[00150] Yet another aspect of the present description provides for the use of a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared with the endogenous activity thereof, for the production of O-acetyl-homoserine or a derivative thereof.

[00151] In the use of the present description, the increase in the activity of the E1 subunit of the pyruvate dehydrogenase complex and of O-acetyl-homoserine or a derivative thereof, etc., is in the manner described in other aspects above.

[00152] Yet another aspect of the present description provides a method for preparing a microorganism for the production of O-acetyl-homoserine or a derivative thereof, including modifying the microorganism to have increased activity of the E1 subunit of the pyruvate dehydrogenase complex compared with the endogenous activity thereof.

[00153] In the method for preparing a microorganism of the present description, the increase in the activity of the E1 subunit of the pyruvate dehydrogenase complex and of O-acetyl-homoserine or a derivative thereof, etc., is in the manner described in other aspects previously. Petition 870250091575, dated 07 / 10 / 2025, pages 81 / 104 64 / 81 Method for Carrying Out the Invention Example 1. Preparation of Strains to Produce O-Acetylmoserine or Homoserine

[00154] The strains were prepared for use in evaluating their ability to produce O-acetyl-homoserine and homoserine. Example 1-1. Deletion of metB

[00155] The metB gene encoding cystathionine γsynthase involved in an O-acetylmomoserine degradation pathway was obtained by PCR using chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template. Nucleotide sequence information for the metB gene (NCBI number Ncgl2360, SEQ ID NO: 4) was obtained from GenBank of the National Institutes of Health (United States), and primers (SEQ ID NO: 6 and 7), including the N-terminal of the metB gene and a linker, were synthesized based on them (SEQ ID NOS: 8 and 9), including the C-terminal and the linker were synthesized based on these. The primer sequences are shown in Table 1 below. [Table 1] SEQ ID NO: Sequence Name Sequences 6 metB N del F GGCTTCGGAGTTGGAGCG 7 metB N del R GCCAAATAGTTTcccgggGGTAGATCAACTCCTGTAATCA 8 metB C del F CAGGAGTTGATCTACCcccgggAAACTATTTGGCGGCAAG 9 metB C del R TCGCGTCTGGGTGCGCATC

[00156] PCR was performed based on DNA Petition 870250091575, dated 07 / 10 / 2025, pp. 82 / 104 The 65 / 81 chromosome of ATCC13032 was used as a template, using primers SEQ ID NOS: 6 and 7 and SEQ ID NOS: 8 and 9. The high-fidelity DNA polymerase PfuUltra™ (Stratagene) was used as the polymerase, and PCR was performed by repeating 30 cycles of denaturation at 96 °C for 30 seconds, annealing at 53 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result, an amplified gene (558 bp) containing the N-terminal of the metB gene and the ligand and an amplified gene (527 bp) containing the C-terminal of the metB gene and the ligand were obtained, respectively. PCR was performed using the two amplified genes obtained as described above as templates, repeating 10 cycles of denaturation at 96 °C for 60 seconds, annealing at 50 °C for 60 seconds, and polymerization at 72 °C for 1 minute, followed by the addition of primers with SEQ IDs NOS: 6 and 9, followed by repeating 20 polymerization cycles.As a result, an inactivation cassette (1064 bp) including the N-terminal-C-terminal ligand of the metB gene was obtained.

[00157] The pDCM2 vector was treated with the restriction enzyme SmaI, and the resulting PCR product (1064 bp) was cloned by fusion with the SmaI-treated pDCM2 vector using an In-Fusion® HD cloning kit (Clontech). The cloned vector was transformed with E. coli DH5a, and the transformed E. coli was seeded on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the Petition 870250091575, dated 07 / 10 / 2025, pages 83 / 104 66 / 81 plasmids in LB medium were selected, and the plasmid was obtained using a plasmid extraction method (US5981235 A). Finally, the recombinant pDCM2-AmetB vector cloned with the metB gene deletion cassette was prepared.

[00158] The pDCM2-AmetB vector thus prepared was transformed with the ATCC13032 ANCgl2335::PCJ7yjeH(eco,F351L) strain (KCCM12634P; WO2021-125896 A1) using an electric pulse method and subjected to a secondary crossover process to obtain ATCC13032 ANCgl2335::PCJ7yjeH(eco,F351L) AmetB, in which the metB gene was inactivated on the chromosome. The inactivation of the metB gene was finally confirmed by comparison with ATCC13032, in which the metB gene was not inactivated after performing PCR using primers with SEQ IDs NOS: 6 and 9. Example 1-2. Deletion of metY

[00159] The metY gene, which encodes O-acetylhomosserine (thiol)-lyase involved in the O-acetylhomosserine degradation pathway, was obtained by PCR using chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template. Nucleotide sequence information for the metY gene (NCBI number Ncgl0625, SEQ ID NO: 19) was obtained from GenBank of the National Institutes of Health (USA), and primers (SEQ ID NO: 20 and 21), including the N-terminus of the metY gene and a linker, and primers (SEQ ID NO: 22 and 23), including the C-terminus and the linker, were synthesized with Petition 870250091575, dated 07 / 10 / 2025, pp. 84 / 104 67 / 81 base them. The primer sequences are shown in Table 2 below. [Table 2] SEQ ID NO: Sequence name Sequences 20 metY N del F CCAAAGACAAGGAGACCA 21 metY N del R AGTCTATTTAAAGcccgggTTGGAGGTCCTTAAGAGTTTT 22 metY C del F TAAGGACCTCCAAcccgggCTTTAAATAGACTCACCCCAG 23 metY C del R ATGCCGAGTGCGTCGAGG

[00160] PCR was performed using chromosomal DNA from ATCC13032 as a template, using primers SEQ ID NOS: 20 and 21 and SEQ ID NOS: 22 and 23. The high-reliability DNA polymerase PfuUltra™ (Stratagene) was used as the polymerase, and PCR was performed by repeating 30 cycles of denaturation at 96 °C for 30 seconds, annealing at 53 °C for 30 seconds, and polymerization at 72 °C for 1 minute. As a result, an amplified gene (548 bp) containing the N-terminal of the metY gene and the ligand and an amplified gene (550 bp) containing the C-terminal of the metY gene and the ligand were obtained, respectively. PCR was performed using the two amplified genes obtained as described above as templates, repeating 10 cycles of denaturation at 96 °C for 60 seconds, annealing at 50 °C for 60 seconds, and polymerization at 72 °C for 1 minute, followed by the addition of primers with SEQ IDs NOS: 20 and 23, followed by repeating 20 polymerization cycles.As a result, an inactivation cassette (1077 bp) was obtained including the NPedition 870250091575, dated 07 / 10 / 2025, page 85 / 104. 68 / 81 terminal-C-terminal ligand of the metY gene.

[00161] The pDCM2 vector was treated with the restriction enzyme SmaI, and the resulting PCR product (1077 bp) was cloned by fusion with the SmaI-treated pDCM2 vector using an In-Fusion® HD cloning kit (Clontech). The cloned vector was transformed with E. coli DH5a, and the transformed E. coli was seeded on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the plasmid in LB medium were selected, and the plasmid was obtained using a plasmid extraction method (US5981235 A). Finally, the recombinant pDCM2-AmetY vector cloned with the metY gene deletion cassette was prepared.

[00162] The pDCM2-AmetY vector thus prepared was transformed with ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB using an electric pulse method and subjected to a secondary crossover process to obtain ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY, in which the metY gene was additionally inactivated on the chromosome.

[00163] The inactivation of the metY gene was finally confirmed by comparison with ATCC13032, in which the metY gene was not inactivated after performing PCR using primers with SEQ IDs NOS: 20 and 23. Example 1-3. Introduction of lysC(L377K)

[00164] In order to introduce a mutation (L377K) (US 10662450 B2) to increase the expression of the lysC gene and alleviate Petition 870250091575, dated 07 / 10 / 2025, pages 86 / 104 69 / 81 retroactive inhibition by L-lysine and L-threonine (US 10662450 B2) in the Corynebacterium glutamicum ATCC13032-derived lysC gene (SEQ ID NO: 24) encoding aspartokinase, and to prepare a vector including the variant lysC gene, a pair of primers (SEQ ID NOS: 25 and 26) were designed to amplify a 5' upstream region and a pair of primers (SEQ ID NOS: 27 and 28) to amplify a 3' downstream region relative to the mutation position. The primer sequences are shown in Table 3 below. [Table 3] SEQ ID NO: Sequence Name Sequences 25 lysC L377K 5 F CAGAAGCTGGAAAAGCTCA 26 lysC L377K 5 R ATCTCAGAGGTGGAAATCttTTCGATGTTCACGTTGACAT 27 lysC L377K 3 F TGTCAACGTGAACATCGAAaaGATTTCCACTCCTGAGATT 28 lysC L377K 3 R TCCTTGTCGGAAGGGTTCA

[00165] PCR was performed using the Corynebacterium glutamicum ATCC13032 chromosome as a template, using primers SEQ ID NOS: 25 and 26 and SEQ ID NOS: 27 and 28. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds were repeated, and then polymerization was performed at 72 °C for 7 minutes. As a result, a 512 bp DNA fragment from a 5' upstream region and a 522 bp DNA fragment from a 3' downstream region relative to the lysC gene mutation were obtained. Petition 870250091575, dated 07 / 10 / 2025, pp. 87 / 104 70 / 81 Next, PCR was performed using the two amplified DNA fragments as templates, using primers with SEQ IDs 25 and 28. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds were repeated, and then polymerization was performed at 72 °C for 7 minutes. As a result, a 1011 bp DNA fragment, including the lysC variant (L377K), which encodes an aspartokinase variant in which leucine at position 377 has been replaced by lysine, was amplified.

[00166] The pDCM2 vector was treated with the restriction enzyme Smal, and the resulting PCR product (1011 bp) was cloned by fusion with the Smal-treated pDCM2 vector using an HD In-Fusion® cloning kit (Clontech). The cloned vector was transformed with E. coli DH5a, and the transformed E. coli was seeded on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the plasmid on LB medium were selected, and the plasmid was obtained using a plasmid extraction method (US5981235 A). Finally, the recombinant pDCM2-lysC(L377K) vector cloned with the cassette including the lysC(L377K) gene substitution was prepared.

[00167] The pDCM2-lysC(L377K) vector thus prepared was transformed with ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) Petition 870250091575, dated 07 / 10 / 2025, pages 88 / 104 71 / 81 AmetB AmetY was obtained using an electric pulse method and subjected to a secondary crossing process to obtain Corynebacterium glutamicum ATCC13032 ANCgl2335::PCJ7yjeH(eco,F351L) AmetB AmetY lysC(L377K), in which a nucleotide mutation was introduced into the lysC gene on the chromosome. The introduction of the nucleotide mutation was finally identified by PCR performed using primers with SEQ IDs NOS: 25 and 28, and then comparing the sequence with that of the wild-type lysC gene by sequencing. Example 1-4. Deletion of NCgl0616

[00168] A vector was prepared to delete the endogenous gene NCgl0616 (SEQ ID NO: 29) in Corynebacterium glutamicum ATCC13032.

[00169] Specifically, a pair of primers (SEQ ID NOS: 30 and 31) were designed to amplify a 5' upstream region and a pair of primers (SEQ ID NOS: 32 and 33) to amplify a 3' downstream region relative to the position of the NCgl0616 gene at SEQ ID NO: 29. The primer sequences are shown in Table 4 below. [Table 4] SEQ ID NO: Sequence Name Sequences 30 0616 del up F TCGAGCTCGGTACCCAGCATAATTCCATACTCCCAC 31 0616 del up R GGTAGCGCTTGGGCTGCAGTACTCTCGACGGCGTGCTCAATT 32 0616 del down F AATTGAGCACGCCGTCGAGAGTACTGCAGCCCAAGCGCTACC 33 0616 del down R CTCTAGAGGATCCCCCTACGACGCTACTGCGCAG

[00170] PCR was performed based on the chromosome of Petition 870250091575, dated 07 / 10 / 2025, pp. 89 / 104 72 / 81 Wild-type ATCC13032 was used as a template, with primers SEQ ID NOS: 30 and 31 and SEQ ID NOS: 32 and 33. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 30 seconds were repeated, followed by polymerization at 72 °C for 7 minutes. As a result, a 701 bp DNA fragment from a 5' upstream region and a 699 bp DNA fragment from a 3' downstream region were obtained relative to the deletion position of the NCgl0616 gene.

[00171] Next, PCR was performed based on the two amplified DNA fragments as templates, using primers with SEQ IDs NOS: 30 and 33. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 90 seconds were repeated, followed by polymerization at 72 °C for 7 minutes. As a result, a 1410 bp DNA fragment, including the region from which the NCgl0616 gene could be deleted, was amplified.

[00172] The pDCM2 vector was treated with the restriction enzyme Smal, and the resulting PCR product (2912 bp DNA fragment) was cloned by fusion with the Smal-treated pDCM2 vector using an In-Fusion® HD cloning kit (Clontech). The cloned vector was transformed Petition 870250091575, dated 07 / 10 / 2025, pages 90 / 104 73 / 81 with E. coli DH5a, and the transformed E. coli was seeded on LB solid medium containing kanamycin (25 mg / L). Colonies transformed with the plasmid in LB medium were selected, and the plasmid was obtained using a plasmid extraction method (US5981235 A). Finally, the recombinant vector pDCM2ANCgl0616 cloned with the NCgl0616 deletion cassette was prepared. [Table 5] SEQ ID NO: Sequence Name Sequences 34 0616 del F GGCTTCCAACTGTAATGG 35 0616 del R TAGAACACCCAGCTAACA

[00173] The pDCM2-ANCgl0616 vector thus prepared was transformed using an electric pulse method and subjected to a secondary crossover process to obtain ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K) ANCgl0616 in which the NCgl0616 gene was deleted on the chromosome. The inactivation of the NCgl0616 gene was finally confirmed by comparison with ATCC13032, in which the NCgl0616 gene was not inactivated after performing PCR using primers with SEQ IDs NOS: 34 and 35. Example 2. Plasmid Preparation to Increase the Activity of the E1 Subunit of the Pyruvate Dehydrogenase Complex

[00174] A vector was prepared to increase the activity of the E1 subunit of the pyruvate complex. Petition 870250091575, dated 07 / 10 / 2025, pp. 91 / 104 74 / 81 dehydrogenase (NCgl2167, hereinafter referred to as aceE). Specifically, to prepare a vector to enhance the E1 subunit of the pyruvate dehydrogenase complex (NCgl2167, SEQ ID NO: 1), the wild-type promoter of the aceE gene (SEQ ID NO: 2) was replaced with Pcj7 using a strong promoter known as the Pcj7 promoter (US 7662943 B2) (SEQ ID NO: 3), thus preparing a plasmid to enhance aceE activity. The upstream and downstream regions of the aceE gene were obtained. Specifically, to prepare a strain in which aceE with the Pcj7 promoter was introduced, PCR was performed based on chromosomal DNA from Corynebacterium glutamicum ATCC13032 as a template to amplify the upstream region of the aceE gene using primers with SEQ ID NO: 12 and SEQ ID NO: 13, and the downstream region of the aceE gene using primers with SEQ ID NO: 14 and SEQ ID NO: 15, respectively.Furthermore, fragments of the Pcj7 promoter were obtained using SEQ ID NO: 10 and SEQ ID NO: 11 based on pDCM2-Pcj7 as a template. The primer sequences used to perform each of the PCRs are shown in Table 6 below. [Table 6] SEQ ID NO: Sequence name Sequences 10 Pcj7-F AGAAACATCCCAGCGCTACTAATAGGGAGCGTTG 11 Pcj7-R ATGGGATACGTACCCAACGAAAGGAAACACTC 12 aceE -5'-F GTGAATTCGAGCTCGGTACCCCACTGGCCAGCGATTAACTTT 13 aceE -5'-R TAGTAGCGCTGGGATGTTTCTTTCCACACCTCCTGTTGGAAT 14 aceE -3'-F CCAACGAAAGGAAACACTCATGGCCGATCAAGCAAAACTT 15 aceE -3'-R GGTCGACTCTAGAGGATCCCCCCTGGAAGAAGATCTGGTCGC Petition 870250091575, dated 07 / 10 / 2025, pp. 92-104 75 / 81

[00175] The highly reliable DNA polymerase PfuUltraTM (Stratagene) was used as the polymerase for the PCR reaction, and the PCR was performed by repeating 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 1 minute.

[00176] As a result, a 318 bp DNA fragment from the Pcj7 promoter region, a 526 bp DNA fragment upstream of Corynebacterium glutamicum ATCC13032 aceE, and a 527 bp DNA fragment downstream were obtained, respectively. PCR was performed based on the amplified promoter and DNA fragments as templates using primers with SEQ ID NO: 12 and SEQ ID NO: 15. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 28 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 2 minutes were repeated, and then polymerization was performed at 72 °C for 5 minutes. The two fragments obtained above were subjected to DNA purification and then fusion cloning was performed using an In-Fusion® HD cloning kit (Clontech) based on the pDCM2 vector (Korean Patent No. WO2021-187781 A1) treated with Smal restriction enzyme to obtain a plasmid according to the provided manual.The resulting vector was named pDCM2-Pcj7_aceE. Petition 870250091575, dated 07 / 10 / 2025, pp. 93 / 104 76 / 81 Example 3. Preparation of the O-Acetyl-Homoserine Strain with Enhanced Pyruvate Dehydrogenase Complex E1 Subunit Activity

[00177] To determine whether the activity-enhancing strain has the effect of increasing production capacity in the Corynebacterium glutamicum strain capable of producing O-acetyl-homoserine and homoserine, the pDCM2-Pcj7_aceE vector prepared in Example 2 was transformed with ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K)ANCgl0616, which is the Corynebacterium glutamicum strain for the production of O-acetylhomoserine and homoserine prepared in Example 1, by homologous recombination on the chromosome (van der Rest et al., Appl Microbiol Biotechnol 52:541-545, 1999).

[00178] The resulting recombinant strain was named CM04-8001 (ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K)ANCgl0616-Pcj7_aceE). Example 4. Evaluation of the Production Capacity of O-Acetyl-Homoserine and Homoserine Strains with Enhanced Activity of the E1 Subunit of the Pyruvate Dehydrogenase Complex

[00179] A flask evaluation was performed to compare the production capacity of Corynebacterium glutamicum ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K)ANCgl0616 and CM04-8001, which are the strains Petition 870250091575, dated 07 / 10 / 2025, pages 94 / 104 77 / 81 producers of O-acetyl-homoserine and homoserine.

[00180] An inoculation loop of each strain was inoculated into a 250 mL flask with a corner baffle containing 25 mL of the following medium and then cultured under agitation at 33 °C for 20 hours at 200 rpm. O-acetyl-homoserine concentrations were analyzed by HPLC, and the analyzed concentrations are presented in Table 7. Production medium for O-acetyl-homoserine (pH 7.2)

[00181] 30 g of glucose, 2 g of KH2PO4, 3 g of urea, 40 g of (NH4)2SO4, 2.5 g of peptone, 5 g (10 mL) of corn steep liquor (CSL, Sigma), 0.5 g of MgSO4^7H2O and 20 g of CaCO3 (based on 1 L of distilled water) [Table 7] Strains O-AH (g / L) ATCC13032 0.27 ATCC13032ANCg12335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY 1ysC(L377K) ANCg10616 1.73 CM04-8001 (ATCC13032 ΔNCg12335::PCJ7-yjeH(echo,F351L) AmeEB AmeEY 1ysC(L377K)ANCg10616 -Pcj7 aceE) 2.00

[00182] As demonstrated in Table 7 above, it was confirmed that the concentration of O-acetyl-homoserine increased in the O-acetyl-homoserine-producing strain with increased activity of the E1 subunit of the pyruvate dehydrogenase complex, compared to ATCC13032 and ATCC13032ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K)ANCgl0616. Petition 870250091575, dated 07 / 10 / 2025, pages 95 / 104 78 / 81 Example 5. Preparation of a Plasmid Introduced with Acetyl-Homoserine Transferase (MetX)

[00183] To amplify a gene encoding OAcetyl-Homoserine Transferase (MetX), nucleotide sequence information from the metX gene (NCBI number NCgl0624, SEQ ID NO: 16) was obtained from GenBank of the National Institutes of Health (USA). A BamHI restriction enzyme site was inserted at both ends of each primer (SEQ ID NO: 17 and 18) to amplify a promoter region (located approximately 300 bp upstream of a start codon) to a terminator region (located approximately 100 bp downstream of a stop codon) based on it. PCR was performed under the following conditions: after denaturation at 95 °C for 5 minutes, 30 cycles of denaturation at 95 °C for 30 seconds, annealing at 55 °C for 30 seconds, and polymerization at 72 °C for 90 seconds were repeated, and then polymerization was performed at 72 °C for 7 minutes. As a result, a 1546 bp DNA fragment from a coding region of the metX gene was obtained.A pECCG117 vector (KR 10-0057684 B1) and the metX DNA fragment were treated with the restriction enzyme BamHI, ligated using a DNA ligase, and cloned to obtain a plasmid, which was named pECCG117-metX WT. The primer sequences are shown in Table 8 below. [Table 8] Petition 870250091575, dated 07 / 10 / 2025, pp. 96 / 104 79 / 81 SEQ ID NO: Sequence Name SEQ ID NO: 17 metX F GGATCCCCTCGTTGTTCACCCAGCAACC SEQ ID NO: 18 metX R GGATCCCAAAGTCACAACTACTTATGTTAG

[00184] After introducing the previously prepared pECCG117-metX WT vector into ATCC13032 ANCgl2335::PCJ7yjeH(eco,F351L) AmetB AmetY lysC(L377K)ANCgl0616 and CM04-8001 using an electric pulse method, the strains were seeded in a selective medium containing kanamycin (25 mg / L) and cultured to obtain the respective transformants.

[00185] To compare the O-acetyl-homoserine production capacity of the previously prepared strains, the strains were cultured using the following method, and the O-acetyl-homoserine contained in the culture solutions was analyzed.

[00186] An inoculation loop of each strain was inoculated into a 250 mL flask with a corner baffle containing 25 mL of the following medium and then cultured under agitation at 33 °C for 20 hours at 200 rpm. O-acetyl-homoserine concentrations were analyzed by HPLC, and the analyzed concentrations are presented in Table 9. Production medium for O-acetyl-homoserine (pH 7.2)

[00187] 30 g of glucose, 2 g of KH2PO4, 3 g of urea, 40 g of (NH4)2SO4, 2.5 g of peptone, 5 g (10 mL) of liquor Petition 870250091575, dated 07 / 10 / 2025, pages 97 / 104 80 / 81 corn steep liquor (CSL, Sigma), 0.5 g MgSCh ·7H2θ, 400 mg methionine and 20 g CaCCs (based on 1 L distilled water) [Table 9] Strains O-AH (g / L) ATCC13032ANCg12335::PCJ7-yjeH(eco,F351L) ΔmetB ΔmetY 1ysC(L377K)ΔNCg10616 1.73 CM04-8001 (ATCC13032 ΔNCg12335::PCJ7-yjeH(echo,F351L) AmetB AmetY 1ysC(L377K)ANCg10616 -Pcj7 aceE) 2.00 ATCC13032 ANCg12335::PCJ7-yjeH(echo,F351L) ΔmetB ΔmetY 1ysC(L377K)ANCg10616) / pECCG117-metX WT 2.83 CM04-8001 (ATCC13032 ΔNCg12335::PCJ7-yjeH(echo,F351L) AmetB AmetY 1ysC(L377K) ANCg10616 -Pcj7 aceE) / pECCG117-metX WT 3.51

[00188] As a result, it was confirmed that C-acetyl-L-homoserine was accumulated at a concentration of 2.83 g / L when ATCC13032 ANCgl2335::PCJ7-yjeH(eco,F351L) AmetB AmetY lysC(L377K) ANCgl0616 / pECCG117-metX WT was cultured, and when CM04-8002 was cultured, it was confirmed that the production of C-acetyl-L-homoserine increased by 130% at a concentration of 3.68 g / L.

[00189] Therefore, an increase in C-acetylL-homoserine production was confirmed when the activity of the E1 subunit of the pyruvate dehydrogenase complex was increased in the strain with the greater capacity to produce C-acetylL-homoserine.

[00190] Through this, it was confirmed that the production of C-acetyl-homoserine increased when the activity of the E1 subunit of the pyruvate dehydrogenase complex was Petition 870250091575, dated 07 / 10 / 2025, pages 98 / 104 81 / 81 increased in the strain with higher production of O-acetylmoserine.

[00191] Previous results demonstrate that increasing the activity of the E1 subunit of the pyruvate dehydrogenase complex in O-acetyl-L-homoserine and homoserine-producing strains of the genus Corynebacterium is effective in the production of O-acetyl-L-homoserine and its derivatives.

[00192] Based on the preceding description, it will be understood by those skilled in the art that the present description can be implemented in a different specific form without altering the technical spirit or its essential characteristics. In this sense, it should be understood that the previous embodiment is not limiting but illustrative in all respects. The scope of the present description is defined by the appended claims and not by the description preceding them, and therefore all alterations and modifications that fall within the limits of the claims, or equivalents of such limits, should be included by the claims. Petition 870250091575, dated 07 / 10 / 2025, pages 99 / 104

Claims

1 / 3 CLAIMS 1. Method for producing O-acetyl-homoserine or a derivative thereof, characterized in that it comprises: culturing a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity thereof, in a medium.

2. Method according to claim 1, characterized in that the microorganism is a microorganism of the genus Corynebacterium.

3. Method according to claim 2, characterized in that the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

4. Method according to claim 1, characterized in that the E1 subunit of the pyruvate dehydrogenase complex is derived from Corynebacterium glutamicum.

5. Method according to claim 1, characterized in that the E1 subunit of the pyruvate dehydrogenase complex comprises an amino acid sequence of SEQ ID NO:

1.

6. Method according to claim 5, characterized in that the E1 subunit of the pyruvate dehydrogenase complex is encoded by a polynucleotide with SEQ ID NO: 2 or SEQ ID NO:

3. Petition 870250091575, dated 10 / 07 / 2025, pp. 100 / 104 2 / 3 7. Method according to claim 1, characterized in that O-acetyl-homoserine or a derivative thereof is any one or more selected from O-acetyl-homoserine, L-methionine, and L-homoserine.

8. Method according to claim 1, characterized in that it further comprises a step of recovering O-acetyl-homoserine or a derivative thereof from the microorganism being cultured, from a culture of the microorganism, from a fermented product of the microorganism or from the culture medium.

9. Microorganism to produce O-acetyl-homoserine or a derivative thereof, characterized in that the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to its endogenous activity.

10. Composition for producing O-acetyl-homoserine or a derivative thereof, characterized in that it comprises: a microorganism in which the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity thereof; a culture of the microorganism; a fermented product of the microorganism; or a combination of two or more thereof.

11. Use of a microorganism, characterized in that the activity of the E1 subunit of the pyruvate dehydrogenase complex is increased compared to the endogenous activity thereof, for the production of O-acetyl-homoserine or a derivative thereof.