Nucleic acid vector, its use, transgenic plant, methods for producing a transgenic plant cell and for expressing a polynucleotide sequence of interest in a plant cell.

Description

1 / 128 Nucleic acid vector, its use, transgenic plant, methods for producing a plant cell. TRANSGENIC AND TO EXPRESS A POLYNUCLEOTIDE SEQUENCE OF INTEREST IN A PLANT CELL. Divided from patent application BR 11 2020 008731 9, filed on October 31, 2018. Incorporation by Reference

[001] This application claims the benefit of the Patent Application. U.S. Provisional Serial No. 62 / 587024, filed November 16, 2017, which is expressly incorporated by reference in its entirety hereof.

[002] Incorporated by way of reference, in its entirety, is a computer-readable nucleotide / amino acid sequence listing submitted concurrently with this document and identified as follows: a 28.3 KB ASCII file (Text) named 79350-US-PSP2_20170815_Sequence_ST25 created on November 16, 2017. BACKGROUND

[003] Many plant species have the capacity to be transformed with transgenes to introduce agronomically desirable traits or characteristics. The resulting plant species are developed and / or modified to have particular desirable traits. In general, desirable traits include, for example, improving nutritional value, increasing yield, conferring resistance to pests or disease, increasing drought and stress tolerance, improving horticultural qualities (e.g., pigmentation and growth), conferring herbicide tolerance, enabling the production of industrially useful compounds and / or plant materials, and / or enabling the production of pharmaceuticals.

[004] Transgenic plant species comprising Petition 870260049160, dated 05 / 22 / 2026, page 13 / 151 2 / 128 Multiple transgenes stacked at a single genomic locus are produced through plant transformation technologies. Plant transformation technologies result in the introduction of a transgene into a plant cell, recovery of a fertile transgenic plant containing the stably integrated copy of the transgene in the plant genome, and subsequent transgene expression through transcription and translation results in transgenic plants possessing desirable traits and phenotypes. However, innovative gene regulatory elements that allow the production of transgenic plant species to highly express multiple manipulated transgenes as a set of traits are desirable.

[005] Similarly, innovative gene regulatory elements that allow the expression of a transgene in particular plant tissues or organs are desirable. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots. Alternatively, it may be desirable to express a transgene in plant tissues that are at a particular stage of development or growth, such as cell division or elongation. Additionally, it may be desirable to express a transgene in leaf and stem tissues of a plant to provide herbicide tolerance, or resistance to aboveground insects and pests.

[006] Therefore, there is a need for innovative gene regulatory elements that can lead to desirable levels of transgene expression in specific plant tissues. BRIEF SUMMARY

[007] In forms of the present revelation, the revelation is Petition 870260049160, dated 05 / 22 / 2026, p. 14 / 151 3 / 128 refers to a nucleic acid vector comprising a promoter functionally linked to: a polylinking sequence; a non-GmPSID2 heterologous coding sequence wherein said promoter comprises a polynucleotide sequence having at least 95% sequence identity with SEQ ID No. 2. In further embodiments, said promoter is 821 base pairs in length. In other embodiments, said promoter consists of a polynucleotide sequence having at least 95% sequence identity with SEQ ID No. 2. In further embodiments, said promoter is functionally linked to a heterologous coding sequence.Accordingly, the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein, or a DNA-binding protein. In other embodiments, the nucleic acid vector comprises a termination polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 3' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises a 5' untranslated polynucleotide sequence. In further embodiments, the nucleic acid vector comprises an intron sequence. In further embodiments, said promoter has tissue-preferential expression.In further embodiments, the nucleic acid vector comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID No. 2 functionally linked to a heterologous coding sequence. In further embodiments, said plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, Glycine max, cotton, Arabidopsis, tobacco, sunflower, and... Petition 870260049160, dated 05 / 22 / 2026, p. 15 / 151 4 / 128 canola. In yet another embodiment, said plant is Glycine max. In some embodiments, the heterologous coding sequence is inserted into the genome of said plant. In other embodiments, the promoter comprises a polynucleotide sequence that has at least 95% sequence identity with SEQ ID No. 2 and said promoter is functionally linked to a heterologous coding sequence. In further embodiments, the transgenic plant comprises an untranslated 3' sequence. In further embodiments, said heterologous coding sequence has preferential tissue expression. In further embodiments, the transgenic plant comprises said promoter of 821 base pairs in length.

[008] In embodiments of the present disclosure, the disclosure relates to a method for producing a transgenic plant cell, wherein the method comprises the steps of: transforming a plant cell with a gene expression cassette comprising a GmPSID2 promoter of claim 1 functionally linked to at least one polynucleotide sequence of interest; isolating the transformed plant cell comprising the gene expression cassette; and producing a transgenic plant cell comprising the GmPSID2 promoter of claim 1 functionally linked to at least one polynucleotide sequence of interest. In other embodiments, the transformation of a plant cell is performed using a plant transformation method.In some aspects, the plant transformation method that is selected is from a group consisting of an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. In further embodiments, the polynucleotide sequence of interest is expressed in a plant cell. In other embodiments, the polynucleotide sequence of... Petition 870260049160, dated 05 / 22 / 2026, page 16 / 151 5 / 128 of interest is stably integrated into the genome of the transgenic plant cell. In further embodiments, the method comprises regenerating the transgenic plant cell into a transgenic plant; and obtaining the transgenic plant, wherein the transgenic plant comprises the gene expression cassette comprising the GmPSID2 promoter of claim 1 functionally linked to at least one polynucleotide sequence of interest. In other embodiments, the transgenic plant cell is either a monocotyledonous transgenic plant cell or a dicotyledonous transgenic plant cell. Examples of a dicotyledonous transgenic plant cell include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell. Examples of a monocotyledonous transgenic plant cell include a Zea mays plant cell, a rice plant cell, and a wheat plant cell.In some embodiments, the GmPSID2 promoter comprises the polynucleotide of SEQ ID No. 2. In other embodiments, the GmPSID2 promoter comprises a first polynucleotide sequence of interest functionally linked to the 3' end of SEQ ID No. 2. In further embodiments, the method comprises introducing into the plant cell a polynucleotide sequence of interest functionally linked to a GmPSID2 promoter. In further embodiments, the polynucleotide sequence of interest functionally linked to the GmPSID2 promoter is introduced into the plant cell by a plant transformation method. Examples of plant transformation methods include an Agrobacterium-mediated transformation method, a biolistic transformation method, a silicon carbide transformation method, a protoplast transformation method, and a liposome transformation method. In further embodiments, the polynucleotide sequence... Petition 870260049160, dated 05 / 22 / 2026, page 17 / 151 6 / 128 of interest is expressed in embryonic cell tissue. In further embodiments, the polynucleotide sequence of interest is stably integrated into the plant cell genome. In some embodiments, the transgenic plant cell is either a monocotyledonous plant cell or a dicotyledonous plant cell. Examples of dicotyledonous plant cells include an Arabidopsis plant cell, a tobacco plant cell, a Glycine max plant cell, a canola plant cell, and a cotton plant cell. Examples of exemplary monocotyledonous plant cells include a Zea mays plant cell, a rice plant cell, and a wheat plant cell.

[009] In embodiments of the present disclosure, the disclosure relates to a transgenic plant cell comprising a GmPSID2 promoter. In other embodiments, the transgenic plant cell comprises a transgenic event. In further embodiments, the transgenic event comprises an agronomic trait. Examples of agronomic traits include an insecticide resistance trait, herbicide tolerance trait, nitrogen use efficiency trait, water use efficiency trait, nutritional quality trait, DNA linkage trait, selectable marker trait, small RNA trait, or any combination thereof. In further embodiments, the agronomic trait comprises a herbicide-tolerant trait. In one aspect of this embodiment, the herbicide-tolerant trait comprises an aad-1 coding sequence. In yet another embodiment, the transgenic plant cell produces a commodity product.Examples of a commodity product include protein concentrate, protein isolate, grains, bran, flour, oil, or fiber. In further embodiments, the transgenic plant cell is selected from the group consisting of a dicotyledonous plant cell or a monocotyledonous plant cell. For example, a. Petition 870260049160, dated 05 / 22 / 2026, page 18 / 151 7 / 128 A dicotyledonous plant cell is a Glycine max plant cell. In further embodiments, the GmPSID2 promoter comprises a polynucleotide with at least 95% sequence identity to the polynucleotide of SEQ ID No. 2. In other embodiments, the GmPSID2 promoter is 821 base pairs long. In some embodiments, the GmPSID2 promoter consists of SEQ ID No. 2. In subsequent embodiments, the GmPSID2 promoter comprises a first polynucleotide sequence of interest functionally linked to the 3' end of SEQ ID No. 2. In other embodiments, the agronomic trait is expressed in plant tissues. In further embodiments, the isolated polynucleotide comprises a nucleic acid sequence with at least 95% sequence identity to the polynucleotide of SEQ ID No. 2. In further embodiments, the isolated polynucleotide triggers preferential tissue expression.In other embodiments, the isolated polynucleotide comprises expression activity within a plant cell. In some embodiments, the isolated polynucleotide comprises an open reading frame polynucleotide encoding a polypeptide; and a termination sequence. In subsequent embodiments, the polynucleotide of SEQ ID No. 2 is 821 base pairs in length.

[0010] In embodiments of the present disclosure, the disclosure refers to a gene expression cassette comprising a promoter functionally linked to a heterologous coding sequence, wherein the promoter comprises a polynucleotide comprising at least 95% sequence identity with SEQ ID No. 2. In some embodiments, the polynucleotide has at least 95% sequence identity with SEQ ID No. 2. In further embodiments, the gene expression cassette comprises an intron. In further embodiments, the gene expression cassette comprises a 5' UTR. In subsequent embodiments, the promoter Petition 870260049160, dated 05 / 22 / 2026, p. 19 / 151 8 / 128 has preferential tissue expression. In other embodiments, the promoter is functionally linked to a heterologous coding sequence encoding a polypeptide or a small RNA gene. Examples of the encoded polypeptide or small RNA gene include a heterologous coding sequence conferring insecticide resistance, herbicide tolerance, a nucleic acid conferring nitrogen use efficiency, a nucleic acid conferring water use efficiency, a nucleic acid conferring nutritional quality, a nucleic acid conferring DNA-binding protein, and a nucleic acid encoding a selectable marker. In further embodiments, the gene expression cassette comprises a 3' untranslated region. For example, the 3' untranslated region has at least 95% sequence identity with SEQ ID No. 4. In further embodiments, the gene expression cassette comprises a 5' untranslated region.For example, the 5' untranslated region has at least 95% sequence identity with SEQ ID No. 3. In further embodiments, the gene expression cassette comprises a termination region. For example, the termination region has at least 95% sequence identity with SEQ ID No. 5. In other embodiments, the present disclosure relates to a recombinant vector comprising the gene expression cassette, wherein the vector is selected from the group consisting of a plasmid, a cosmid, a bacterial artificial chromosome, a virus, and a bacteriophage. In other embodiments, the present disclosure relates to a transgenic cell comprising the gene expression cassette. In one aspect of this embodiment, the transgenic cell is a transgenic plant cell. In other aspects of this embodiment, the transgenic plant comprises the transgenic plant cell. In further aspects, the transgenic plant is a monocotyledonous plant or a dicotyledonous plant.Examples of a plant. Petition 870260049160, dated 05 / 22 / 2026, page 20 / 151 9 / 128 monocotyledonous plants include a maize plant, a rice plant, and a wheat plant. In additional aspects of the embodiment, the transgenic plant produces a seed comprising the gene expression cassette. In other embodiments, the promoter is a tissue-preferred promoter. In some embodiments, the tissue-preferred promoter is a tissue-preferred promoter.

[0011] The aforementioned and other resources will become more evident from the following detailed description of various modalities that proceed with reference to the accompanying figures. BRIEF DESCRIPTION OF THE FIGURES

[0012] Figure 1 provides a picture of a linear synthetic DNA fragment containing the GmPSID2 promoter, 5' UTR and terminator linked by the multiple cloning site. DETAILED DESCRIPTION I. Overview of various modalities

[0013] The development of transgenic plant products is becoming increasingly complex. Commercially viable transgenic plants now require the stacking of multiple transgenes at a single locus. Plant promoters and 3' UTRs / terminators used for basic research or biotechnological applications are generally unidirectional, directing only one gene that has been fused at its 3' end (downstream) to the promoter, or at its 5' end (upstream) to the 3' UTR / terminator. Consequently, each heterologous transgene / coding sequence typically requires a promoter and 3' UTR / terminator for expression, where multiple regulatory elements are needed to express multiple transgenes in a gene stack. With an increasing number of transgenes in gene stacks, the same promoter and / or 3' UTR / terminator is routinely used to achieve optimized levels of expression patterns for different transgenes. Obtain Petition 870260049160, dated 05 / 22 / 2026, p. 21 / 151 Optimized levels of heterologous transgene / coding sequence expression (10 / 128) are required for the production of a unique polygenic trait. Unfortunately, multiple gene constructs driven by the same promoter and / or 3' UTR / terminator are known to cause gene silencing, resulting in less effective transgenic products in the field. Repeated promoter and / or 3' UTR / terminator elements can lead to homology-based gene silencing. Furthermore, repetitive sequences in a heterologous transgene / coding sequence can lead to intragene homologous locus recombination, resulting in polynucleotide reassignments. Transgene silencing and reassignment will likely have an undesirable effect on the performance of a transgenic plant produced to express transgenes.Additionally, an excess of transcription factor (TF) binding sites due to promoter repetition can cause depletion of endogenous TFs, leading to transcriptional deactivation. Given the need to introduce multiple genes into plants for metabolic manipulation and trait stacking, a variety of promoters and / or 3' UTRs / terminators is required to develop transgenic crops that trigger the expression of multiple genes.

[0014] A particular problem in identifying the promoter and / or UTR 3' / terminator refers to the need to identify tissue-specific / preferred promoters, related to specific cell types, developmental stages, and / or functions in the plant that are not expressed in other plant tissues. Tissue-specific (i.e., tissue-preferred) or organ-specific promoters drive gene expression in a certain tissue, such as the grain, root, leaf, or tapetum of the plant. Tissue- and developmental stage-specific promoters and / or UTR 3' / terminators can initially be identified from observing the expression of Petition 870260049160, dated 05 / 22 / 2026, page 22 / 151 11 / 128 genes, which are expressed in particular tissues or at particular time periods during plant development. These tissue-specific / preferred promoters and / or 3' UTRs / terminators are necessary for certain applications in the transgenic plant industry and are needed because they allow specific expression of heterologous genes in a tissue- and / or developmental stage-selective manner, indicating differential expression of the heterologous gene in various organs, tissues, and / or times, but not in other undesirable tissues. For example, increased plant resistance to infection by soil-borne pathogens can be achieved by transforming the plant genome with a pathogen resistance gene, so that the pathogen resistance protein is robustly expressed in the plant roots.Alternatively, it may be desirable to express a heterologous transgene / coding sequence in plant tissues that are in a particular developmental or growth phase, such as cell division or elongation. Another application is the convenience of using tissue-specific / preferred promoters and / or 3' UTRs / terminators to restrict the expression of transgenes encoding an agronomic trait to specific tissue types, such as developing parenchyma cells. As such, a particular problem in identifying promoters and / or 3' UTRs / terminators is how to identify the promoters and relate the identified promoter to cell developmental properties for tissue-specific / preferred expression.

[0015] Another problem related to promoter identification is the need to clone all relevant cis-acting and trans-activating control elements so that the cloned DNA fragment drives transcription in the desired specific expression pattern. Since such control elements are located in Petition 870260049160, dated 05 / 22 / 2026, page 23 / 151 12 / 128 distal mode of translation initiation or start site, the size of the polynucleotide that is selected to comprise the promoter is important for providing the expression level and expression patterns of the promoter polynucleotide sequence. Promoter lengths are known to contain functional information, and different genes have been shown to have longer or shorter promoters than promoters of other genes in the genome. Elucidating the transcription start site of a promoter and predicting the functional gene elements in the promoter region is challenging. In addition to the challenge there is the complexity, diversity and inherent degenerate nature of regulatory motifs and cis and trans regulatory elements (Blanchette, Mathieu, et al. Genome-wide computational prediction of transcriptional regulatory modules reveals new insights into human gene expression. Genome research 16,5 (2006): 656 to 668).Cis and trans regulatory elements are located in the distal parts of the promoter that regulate the spatial and temporal expression of a gene to occur only at necessary sites and at specific times (Porto, Milena Silva, et al. Plant promoters: a structure and function approach. Molecular Biotechnology 56.1 (2014): 38-49). Consequently, the identification of promoter regulatory elements requires that an appropriate sequence of a specific size containing the necessary cis and trans regulatory elements be obtained so that it will result in driving the expression of a functionally linked transgene / a heterologous coding sequence in a desirable manner.

[0016] Methods and compositions are provided to overcome such problems through the use of GmPSID2 gene regulatory elements to express transgenes in planta. II. Terms and Abbreviations

[0017] Throughout the descriptive report, several terms are used. In order to provide a clear and consistent understanding of the report Petition 870260049160, dated 05 / 22 / 2026, p. 24 / 151 13 / 128 descriptive and claims, including the scope to be given to these terms, the following definitions are provided.

[0018] As used in this document, the articles, a, an and the include plural references unless the context clearly and unambiguously states otherwise.

[0019] The term isolate, as used in this document, means having been removed from its natural environment, or removed from other compounds present when the compound is first formed. The term isolate encompasses materials isolated from natural sources, as well as materials (e.g., nucleic acids and proteins) recovered after preparation by recombinant expression in a host cell, or chemically synthesized compounds such as nucleic acid molecules, proteins, and peptides.

[0020] The term purified, as used in this document, refers to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment, or substantially enriched in concentration relative to other compounds present when the compound is first formed, and means that have increased in purity as a result of being separated from other components of the original composition.The term purified nucleic acid is used in this document to describe a nucleic acid sequence that has been separated, produced separately from, or purified away from other biological compounds including, but not limited to, polypeptides, lipids, and carbohydrates, while effecting a chemical or functional change in the component (for example, a nucleic acid may be purified from a chromosome by removing protein contaminants and breaking chemical bonds that connect the nucleic acid to the remaining DNA in the chromosome).

[0021] The synthetic term, as used in this document, Petition 870260049160, dated 05 / 22 / 2026, page 25 / 151 14 / 128 refers to a polynucleotide molecule (i.e., DNA or RNA) that has been created through chemical synthesis as an in vitro process. For example, synthetic DNA can be created during a reaction in an Eppendorf™ tube, such that the synthetic DNA is enzymatically produced from a native strand of DNA or RNA. Other laboratory methods can be used to synthesize a polynucleotide sequence. Oligonucleotides can be chemically synthesized in an oligo synthesizer via solid-phase synthesis using phosphoramidites. The synthesized oligonucleotides can be annealed together as a complex, thus producing a synthetic polynucleotide. Other methods for chemically synthesizing a polynucleotide are known in the art and can be readily implemented for use in the present disclosure.

[0022] The term approximately, as used in this document, means greater than or less than the stated value or range of values ​​by 10 percent, but is not intended to designate any value or range of values ​​except that broader definition. Each value or range of values ​​preceded by the term approximately is also intended to encompass the modality of the stated absolute value or range of values.

[0023] For the purposes of this disclosure, a gene includes a region of DNA that encodes a gene product (see below), as well as all regions of DNA that regulate the production of the gene product, whether or not such regulatory sequences are adjacent to the coding sequences and / or transcribed. Consequently, a gene includes, but is not necessarily limited to, promoter / terminator sequences, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, threshold elements, origins of replication, binding sites Petition 870260049160, dated 05 / 22 / 2026, p. 26 / 151 15 / 128 matrix, introns, and locus control regions.

[0024] As used in this document, the terms native or natural define a condition found in nature. A native DNA sequence is a DNA sequence found in nature that was produced by natural means or traditional reproductive techniques, but not generated by genetic manipulation (e.g., using molecular biology / transformation techniques).

[0025] As used in this document, a transgene is defined to be a nucleic acid sequence that encodes a gene product, including, for example, but not limited to, an mRNA. In one embodiment, the transgene / heterologous coding sequence is an exogenous nucleic acid, wherein the transgene / heterologous coding sequence has been introduced into a host cell by genetic manipulation (or the progeny thereof) in which the transgene / heterologous coding sequence is not normally found. In one example, a transgene / heterologous coding sequence encodes an industrially or pharmaceutically useful compound, or a gene encoding a desirable agricultural trait (e.g., a herbicide resistance gene). In yet another example, a transgene / heterologous coding sequence is an antisense nucleic acid sequence, wherein the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence.In one embodiment, the transgene / heterologous coding sequence is either an endogenous nucleic acid, where additional genomic copies of the endogenous nucleic acid are desirable, or a nucleic acid that is in the antisense orientation with respect to the sequence of a target nucleic acid in a host organism.

[0026] As used in this document, the term non-GmPSID2 transgene or non-GmPSID2 gene is any heterologous transgene / coding sequence that has less than 80% Petition 870260049160, dated 05 / 22 / 2026, p. 27 / 151 16 / 128 sequence identity with the coding sequence of the GmPSID2 gene.

[0027] As used in this document, heterologous DNA coding sequence means any coding sequence other than that which naturally codes for the GmPSID2 gene, or any homolog of the expressed GmPSID2 protein. The term heterologous is used in the context of this invention for any combination of nucleic acid sequences that are not normally found to be closely associated in nature.

[0028] A gene product, as defined herein, is any product produced by a gene. For example, a gene product may be the direct transcription product of a gene (e.g., mRNA, tRNA, rRNA, antisense RNA, interfering RNA, ribozyme, structural RNA, or any other type of RNA) or a protein produced by translation of an mRNA. Gene products also include RNA that is modified by processes such as capping, polyadenylation, methylation, and editing, and proteins modified by, for example, methylation, acetylation, phosphorylation, ubiquitination, ADP-ribosylation, myristylation, and glycosylation. Gene expression may be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression may also be regulated anywhere along the DNA-to-RNA-to-protein pathway.The regulation of gene expression occurs, for example, through controls that act on transcription, translation, RNA transport and processing, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof. Gene expression can be measured at the RNA level or the protein level by any method. Petition 870260049160, dated 05 / 22 / 2026, page 28 / 151 17 / 128 known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay (or in vitro, in situ, or in vivo protein activity assays).

[0029] As used in this document, the term gene expression refers to the process by which the encoded information of a nucleic acid transcription unit (including, for example, genomic DNA) is converted into an operational, non-operational, or structural part of a cell, often including the synthesis of a protein. Gene expression can be influenced by external signals, for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Gene expression can also be regulated anywhere along the DNA-to-RNA-to-protein pathway. Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediate molecules such as mRNA, or through the activation, deactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof.Gene expression can be measured at the RNA level or the protein level by any method known in the art, including, without limitation, Northern blot, RT-PCR, Western blot, or in vitro, in situ, or in vivo protein activity assay (or in vitro, in situ, or in vivo protein activity assays).

[0030] As used in this document, homology-based gene silencing (HBGS) is a generic term that includes both transcriptional gene silencing and post-transcriptional gene silencing. Silencing of a target locus by an unbound silencing locus can result from inhibition of transcription (transcriptional gene silencing; TGS) or degradation of mRNA (post-transcriptional gene silencing; PTGS), due to the production of Petition 870260049160, dated 05 / 22 / 2026, page 29 / 151 18 / 128 Double-stranded RNA (dsRNA) corresponding to promoter or transcript sequences, respectively. The involvement of distinct cellular components in each process suggests that dsRNA-induced TGS and PTGS likely result from the diversification of a common ancient mechanism. Meanwhile, a strict comparison of TGS and PTGS has been difficult to achieve due to the fact that it generally depends on the analysis of distinct silencing loci. In some cases, a single transgene locus can trigger both TGS and PTGS, due to the production of dsRNA corresponding to the promoter and transcript sequences of different target genes. Mourrain et al. (2007) Plant 225:365 to 379. It is likely that siRNAs are the actual molecules that trigger TGS and PTGS in homologous sequences: in this model, siRNAs would trigger the silencing and methylation of homologous sequences in cis and trans through the spreading of transgene sequence methylation in the endogenous promoter.

[0031] As used herein, the term nucleic acid molecule (or nucleic acid or polynucleotide) may refer to a polymeric form of nucleotides, which may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic and mixed polymer forms thereof. A nucleotide may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of any type of nucleotide. A nucleic acid molecule, as used herein, is synonymous with nucleic acid and polynucleotide. The nucleic acid molecule is normally at least 10 bases long, unless otherwise specified. The term may refer to a molecule of RNA or DNA of indeterminate length. The term includes single-stranded and double-stranded forms of DNA. A nucleic acid molecule may include any or both naturally occurring and modified nucleotides linked together. Petition 870260049160, dated 05 / 22 / 2026, page 30 / 151 19 / 128 joined together by naturally occurring and / or unnaturally occurring nucleotide bonds.

[0032] Nucleic acid molecules can be chemically or biochemically modified, or can contain unnatural or derived nucleotide bases, as will be readily observed by those skilled in the art. Such modifications include, for example, identifications, methylation, substitution of one or more of the naturally occurring nucleotides with an analogue, internucleotide modifications (e.g., uncharged linkages: e.g., methyl phosphonates, phosphotriesters, phosphoramidites, carbamates, etc.; charged linkages: e.g., phosphorothioates, phosphorodithioates, etc.; pendant chemical moieties: e.g., peptides; intercalators: e.g., acridine, psoralen, etc.; chelating agents; alkylating agents; and modified linkages: e.g., alpha anomeric nucleic acids, etc.).The term nucleic acid molecule also includes any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpin, circular, and locked conformations.

[0033] Transcription proceeds in a 5' to 3' direction along a DNA strand. This means that RNA is made by the sequential addition of ribonucleotide-5'-triphosphates to the 3' end of the growing chain (with a necessary elimination of the pyrophosphate). In a linear or circular nucleic acid molecule, distinct elements (e.g., particular nucleotide sequences) may be termed upstream or 5' relative to an additional element if they are or would be linked to the same nucleic acid in the 5' direction of that element. Similarly, distinct elements may be downstream or 3' relative to an additional element if they are or would be linked to the same nucleic acid in the 3' direction of that element.

[0034] A base position, as used herein Petition 870260049160, dated 05 / 22 / 2026, page 31 / 151 20 / 128 document, refers to the location of a given nucleotide or base residue in a designated nucleic acid. The designated nucleic acid can be defined by alignment (see below) with a reference nucleic acid.

[0035] Hybridization refers to the linking of two polynucleotide strands through hydrogen bonds. Oligonucleotides and their analogues hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding, between complementary bases. In general, nucleic acid molecules consist of nitrogenous bases that are pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the linking of pyrimidine to purine is called base pairing. More specifically, A will hydrogen bond with T or U, and G will bond with C. Complementary refers to base pairing that occurs between two distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.

[0036] Specifically hybridizable and specifically complementary are terms that indicate a sufficient degree of complementarity so that stable and specific binding occurs between the oligonucleotide and the target DNA or RNA. The oligonucleotide does not need to be 100% complementary to its target sequence to be specifically hybridizable. An oligonucleotide is specifically hybridizable when the binding of the oligonucleotide to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to prevent non-specific binding of the oligonucleotide to non-target sequences under conditions where specific binding is desirable, for example, under physiological conditions in the case of in vivo assays or systems. Such binding is Petition 870260049160, dated 05 / 22 / 2026, p. 32 / 151 21 / 128 referred to as a specific hybridization.

[0037] The hybridization conditions that result in particular degrees of stringency will vary depending on the nature of the hybridization method chosen and the composition and length of the hybridization nucleic acid sequences. In general, the hybridization temperature and the ionic strength (especially the concentration of Na+ and / or Mg2+) of the hybridization buffer will contribute to the hybridization stringency, although washing times also influence the stringency. Calculations regarding the hybridization conditions necessary to achieve particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd edition, volumes 1 to 3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chapters 9 and 11.

[0038] As used in this document, stringent conditions encompass conditions under which hybridization will occur only if there is less than 50% divergence between the hybridization molecule and the target DNA. Stringent conditions additionally include particular levels of stringency. Thus, as used in this document, moderate stringency conditions are those under which molecules with more than 50% sequence divergence will not hybridize; high stringency conditions are those under which sequences with more than 20% divergence will not hybridize; and very high stringency conditions are those under which sequences with more than 10% divergence will not hybridize.

[0039] In particular embodiments, the stringent conditions may include hybridisation at 65°C, followed by washes at 65°C with 0.1x SSC / 0.1% SDS for 40 minutes.

[0040] The following are representative non-limiting hybridization conditions: Petition 870260049160, dated 05 / 22 / 2026, p. 33 / 151 22 / 128

[0041] Very High Stringency: Hybridization in SSC buffer 5x a 65°C for 16 hours; washing twice in SSC buffer 2x at room temperature for 15 minutes each time; and washing twice in SSC buffer 0.5x at 65°C for 20 minutes each time.

[0042] High Stringency: Hybridization in SSC buffer 5x to 6x at 70°C for 16 to 20 hours; washing twice in SSC buffer 2x at room temperature for 5 to 20 minutes each; and washing twice in SSC buffer 1x at 55 to 70°C for 30 minutes each.

[0043] Moderate Stringency: Hybridization in SSC buffer 6x at room temperature at 55°C for 16 to 20 hours; washing at least twice in SSC buffer 2x to 3x at room temperature at 55°C for 20 to 30 minutes each.

[0044] In particular embodiments, specifically hybridizable nucleic acid molecules can remain linked under very high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain linked under high stringency hybridization conditions. In these and additional embodiments, specifically hybridizable nucleic acid molecules can remain linked under moderate stringency hybridization conditions.

[0045] As used in this document, the term oligonucleotide refers to a short nucleic acid polymer. Oligonucleotides can be formed by cleaving longer nucleic acid segments, or by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred base pairs in length. Because oligonucleotides can bind to a complementary nucleotide sequence, they can be used as probes to detect DNA or RNA. DNA-based oligonucleotides (oligodeoxyribonucleotides) Petition 870260049160, dated 05 / 22 / 2026, page 34 / 151 23 / 128 can be used in PCR, a technique for amplifying small DNA sequences. In PCR, the oligonucleotide is typically referred to as a primer, which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.

[0046] The terms percentage of sequence identity or percentage of identity or identity are used interchangeably to refer to a sequence comparison based on identical matches between consequently identical positions in the compared sequences between two or more amino acid or nucleotide sequences. The percentage of identity refers to the extent to which two optimally aligned polynucleotide or peptide sequences are invariant over a component alignment window, for example, nucleotides or amino acids. Hybridization experiments and mathematical algorithms known in the art can be used to determine the percentage of identity.Many mathematical algorithms exist as sequence alignment computer programs known in the art that calculate the percentage of identity. These programs can be categorized as global sequence alignment programs or local sequence alignment programs.

[0047] Global sequence alignment programs calculate the percentage of identity of two sequences by comparing end-to-end alignments in order to find exact matches, dividing the number of exact matches by the length of the shorter sequences, and then multiplying by 100. Basically, the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) polynucleotide molecule compared to a test (subject) polynucleotide molecule when the two Petition 870260049160, dated 05 / 22 / 2026, page 35 / 151 24 / 128 sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps).

[0048] Local sequence alignment programs are similar in their calculation, but they only compare aligned fragments of sequences instead of using end-to-end analysis. Local sequence alignment programs, such as BLAST, can be used to compare specific regions of two sequences. A BLAST comparison of two sequences results in an E-value, or expectation value, which represents the number of different alignments with scores equal to or better than the raw alignment score, S, that are expected to occur in a random database search. The lower the E-value, the more significant the match. Because database size is an element in E-value calculations, E-values ​​obtained by BLASTing against public databases, such as GENBANK, generally increased over time for any given input query / match.In defining criteria for polypeptide function prediction security, a high BLAST match is considered in this document to have an E-value for superior BLAST accuracy of less than 1E-30; a medium BLAST E-value is 1E-30 to 1E-8; and a low BLAST E-value is greater than 1E-8. Protein function assignment in the present invention is determined using combinations of E-values, identity percentage, query coverage, and accuracy coverage. Query coverage refers to the percentage of the query sequence that is represented in the BLAST alignment. Accuracy coverage refers to the percentage of the database entry that is represented in the BLAST alignment. In one embodiment of the invention, the function of a query polypeptide is inferred from the function of a protein homolog. Petition 870260049160, dated 05 / 22 / 2026, p. 36 / 151 25 / 128 where either (1) hit_p<1e-30 or % identity >35% AND query_coverage >50% AND hit_coverage >50%, or (2) hit_p<1e-8 AND query_coverage >70% AND hit_coverage >70%. The following abbreviations are produced during a BLAST analysis of a sequence.

[0049] Methods for aligning sequences for comparison are well known in the art. Several alignment programs and algorithms are described. In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the AlignX alignment program from the Vector NTI package (Invitrogen, Carlsbad, CA). The AlignX alignment program is a global sequence alignment program for polynucleotides or proteins. In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the MegAlign program from the LASERGENE bioinformatics computing package (MegAlign™ (©1993-2016). DNASTAR. Madison, WI). The MegAlign program is a global sequence alignment program for polynucleotides or proteins.In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Clustal package of alignment programs, including, but not limited to, ClustalW and ClustalV (Higgins and Sharp (1988) Gene. Dec. 15;73(1):237-44; Higgins and Sharp (1989) CABIOS 5:151-3; Higgins et al. (1992) Comput. Appl. Biosci. 8:189-91). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the GCG package of programs (Wisconsin Package Version 9.0, Genetics Computer Group (GCG), Madison, WI). In another embodiment, the present disclosure relates to calculating the percentage of identity between two sequences. Petition 870260049160, dated 05 / 22 / 2026, page 37 / 151 26 / 128 of polynucleotide or amino acid sequences using the BLAST alignment program package, for example, but not limited to, BLASTP, BLASTN, BLASTX, etc. (Altschul et al. (1990) J. Mol. Biol. 215:403-10). In one embodiment, the present disclosure relates to calculating the percentage identity between two polynucleotide or amino acid sequences using the FASTA alignment program package, including, but not limited to, FASTA, TFASTX, TFASTY, SSEARCH, LALIGN, etc. (Pearson (1994) Comput. Methods Genome Res. [Proc. Int. Symp.], Meeting Date, 1992 (Suhai and Sandor, Eds.), Plenum: New York, NY, pp. 111-20). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the T-Coffee alignment program (Notredame, et al. (2000) J. Mol. Biol. 302, 205-17).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the DIALIGN package of alignment programs, including, but not limited to, DIALIGN, CHAOS, DIALIGN-TX, DIALIGN-T, etc. (Al Ait, et al. (2013) DIALIGN in GOBICS Nuc. Acids Research 41, W3-W7). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MUSCLE package of alignment programs (Edgar (2004) Nucleic Acids Res. 32(5): 1792-1797). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MAFFT alignment program (Katoh, et al. (2002) Nucleic Acids Research 30(14): 3059-3066).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Genoogle program (Albrecht, Felipe. arXiv150702987v1 [cs.DC] July 10, 2017). Petition 870260049160, dated 05 / 22 / 2026, p. 38 / 151 27 / 128 (2015). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the HMMER package of programs (Eddy. (1998) Bioinformatics, 14:755-63). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the PLAST package of alignment programs, including, but not limited to, TPLASTN, PLASTP, KLAST and PLASTX (Nguyen & Lavenier. (2009) BMC Bioinformatics, 10:329). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the USEARCH alignment program (Edgar (2010) Bioinformatics 26(19), 2460-61).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the SAM alignment program package (Hughey & Krogh (January 1995) Technical Report UCSC0CRL-95-7, University of California, Santa Cruz). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the IDF Finder (O'Kane, KC, The Effect of Inverse Document Frequency Weights on Indexed Sequence Retrieval, Online Journal of Bioinformatics, Volume 6 (2) 162-173, 2005). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Parasail alignment program. (Daily, Jeff. Parasail: SIMD C library for alignments of global, semi-global, and local pairwise sequences. BMC Bioinformatics. 17:18. February 10, 2016).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the ScalaBLAST alignment program. Petition 870260049160, dated 05 / 22 / 2026, p. 39 / 151 28 / 128 (Oehmen C, Nieplocha J. ScalaBLAST: A scalable implementation of BLAST for high-performance data-intensive bioinformatics analysis. IEEE Transactions on Parallel & Distributed Systems 17 (8): 740-749 August 2006). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the SWIPE alignment program (Rognes, T. Faster Smilth-Waterman database searches with inter-sequence SIMD parallelization. BMC Bioinformatics. 12, 221 (2011)). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the ACANA alignment program (Weichun Huang, David M. Umbach, and Leping Li, Accurate anchoring alignment of divergent sequences. Bioinformatics 22:29-34, January 1, 2006).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the DOTLET alignment program (Junier, T. & Pagni, M. DOTLET: diagonal plots in a web browser. Bioinformatics 16(2): 178-9 February 2000). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the G-PAS alignment program (Frohmberg, W., et al. G-PAS 2.0 - an enhanced version of a protein alignment tool with an effective backtracking routine on multiple GPUs. Bulletin of the Polish Academy of Sciences Technical Sciences, Vol. 60, 491, November 2012). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the GapMis alignment program (Flouri, T. et al.Gap Mis: A tool for single-gap paired sequence alignment. Recent Pat DNA Gene Seq. 7(2): 84-95, August 2013). In one embodiment, the present disclosure is. Petition 870260049160, dated 05 / 22 / 2026, p. 40 / 151 29 / 128 refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the EMBOSS package of alignment programs, including, but not limited to: Matcher, Needle, Stretcher, Water, Wordmatch, etc. (Rice, P., Longden, I. & Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16(6) 276-77 (2000)). In one embodiment, the present disclosure refers to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Ngila alignment program (Cartwright, R. Ngila: global pairwise alignments with logarithmic and affine gap costs. Bioinformatics. 23(11): 1427-28. June 1, 2007). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the probA, also known as propA, alignment program (Mückstein, U., Hofacker, IL, & Stadler, PF.Stochastic Paired Alignments. Bioinformatics 18 Suppl. 2:S153-60. 2002). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the SEQALN package of alignment programs (Hardy, P. & Waterman, M. The Sequence Alignment Software Library at USC. 1997). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the SIM package of alignment programs, including, but not limited to, GAP, NAP, LAP, etc. (Huang, X & Miller, W. A Time-Efficient, LinearSpace Local Similarity Algorithm. Advances in Applied Mathematics, vol. 12 (1991) 337-57). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the UGENE alignment program (Okonechnikov, K., Golosova, O. & Fursov, M. Unipro UGENE:. Petition 870260049160, dated 05 / 22 / 2026, p. 41 / 151 30 / 128 a unified bioinformatics toolkit. Bioinformatics. 2012 28:1166-67). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the BAli-Phy alignment program (Suchard, MA & Redelings, BD. BAli-Phy: simultaneous Bayesian inference of alignment and phylogeny. Bioinformatics. 22:2047-48. 2006). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Base-By-Base alignment program (Brodie, R., et al. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments, BMC Bioinformatics, 5, 96, 2004). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the DECIPHER alignment program (ES Wright (2015) DECIPHER: harnessing local sequence context to improve protein multiple sequence alignment. BMC Bioinformatics, doi:10.1186 / s12859-015-0749-z). In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the FSA alignment program (Bradley, RK, et al. (2009) Fast Statistical Alignment. PLoS Computational Biology. 5:e1000392).In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Geneious alignment program (Kearse, M., et al. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28(12), 1647-49). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Kalig alignment program (Lassmann, T. & Sonnhammer, E. Kalig - an. Petition 870260049160, dated 05 / 22 / 2026, p. 42 / 151 31 / 128 accurate and fast multiple sequence alignment algorithm. BMC Bioinformatics 2005 6:298). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MAVID alignment program (Bray, N. & Pachter, L. MAVID: Constrained Ancestral Alignment of Multiple Sequences. Genome Res. April 2004; 14(4): 693-99). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MSA alignment program (Lipman, DJ, et al. A tool for multiple sequence alignment. Proc. Nat' Acad. Sci. USA. 1989; 86:4412-15). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the MultAlin alignment program (Corpet, F., Multiple sequence alignment with hierarchical clustering. Nuc'. Acids Res., 1988, 16(22), 10881-90). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the LAGAN or MLAGAN alignment programs (Brudno, et al. LAGAN and MultiLAGAN: efficient tools for large-scale multiple alignment of genomic DNA. Genome Research April 2003; 13(4): 721-31). In another embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the Opal alignment program (Wheeler, TJ, & Kececiouglu, JD Multiple alignment by link alignments. Proceedings of the 15th ISCB Conference on Intelligent Systems for Molecular Biology. Bioinformatics. 23, i559-68, 2007). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the PicXAA package of programs, including, but not including, the PicXAA package of programs. Petition 870260049160, dated 05 / 22 / 2026, p. 43 / 151 32 / 128 limitation, PicXAA, PicXAA-R, PicXAA-Web, etc. (Mohammad, S., Sahraeian, E. & Yoon, B. PicXAA: graceful probabilistic construction of maximum expected precision alignment of multiple sequences. Nucleic Acids Research. 38(15):4917-28. 2010). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the PSAlign alignment program (SZE, S.-H., Lu, Y., & Yang, Q. (2006) A polynomial time solvable formulation of multiple sequence alignment Journal of Computational Biology, 13, 309-19). In one embodiment, the present disclosure relates to the calculation of the percentage of identity between two polynucleotide or amino acid sequences using the StatAlign alignment program (Novák, Á., et al. (2008) StatAlign: an extendable software package for joint Bayesian estimation of alignments and evolutionary trees. Bioinformatics, 24(20):2403-04).In one embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the Gap alignment program of Needleman and Wunsch (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970). In another embodiment, the present disclosure relates to calculating the percentage of identity between two polynucleotide or amino acid sequences using the BestFit alignment program of Smith and Waterman (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981; Smith et al., Nucleic Acids Research 11:2205-2220, 1983). These programs produce biologically significant multiple sequence alignments of divergent sequences. The best-match alignments calculated for the selected sequences are aligned so that identities, similarities, and differences can be observed.

[0050] The term similarity refers to a comparison between amino acid sequences, and takes into account not only Petition 870260049160, dated 05 / 22 / 2026, p. 44 / 151 33 / 128 identical amino acids in corresponding positions, but also amino acids with similar functionality in corresponding positions. Thus, similarity between polypeptide sequences indicates functional similarity, in addition to sequence similarity.

[0051] The term homology is sometimes used to refer to the level of similarity between two or more amino acid or nucleic acid sequences in terms of percentage of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of evolutionary relationship, generally evidenced by similar functional properties among different nucleic acids or proteins that share similar sequences.

[0052] As used in this document, the term variants means substantially similar sequences. For nucleotide sequences, naturally occurring variants can be identified using well-known molecular biology techniques, such as, for example, polymerase chain reaction (PCR) and hybridization techniques as outlined in this document.

[0053] For nucleotide sequences, a variant comprises a deletion and / or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and / or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a native nucleotide sequence comprises a naturally occurring nucleotide sequence. For nucleotide sequences, naturally occurring variants can be identified using well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques, as highlighted below. Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, using site mutagenesis. Petition 870260049160, dated 05 / 22 / 2026, page 45 / 151 34 / 128 targeted. Generally, variants of a particular nucleotide sequence of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity with that particular nucleotide sequence as determined by sequence alignment programs and parameters described elsewhere in this document. A biologically active variant of a nucleotide sequence of the invention may differ from that sequence by 1 to 15 nucleic acid residues, by 1 to 10, by 6 to 10, by 5, by 4, 3, 2, or even 1 nucleic acid residue.

[0054] As used in this document, the term functionally linked refers to a first nucleic acid sequence being functionally linked to a second nucleic acid sequence when the first nucleic acid sequence is in a functional relationship with the second nucleic acid sequence. For example, a promoter is functionally linked to a coding sequence when the promoter affects the transcription or expression of the coding sequence. When recombinantly produced, functionally linked nucleic acid sequences are usually contiguous and, when necessary, to join two protein coding regions in the same reading frame. However, the elements do not need to be contiguous to be functionally linked.

[0055] As used in this document, the term promoter refers to a region of DNA that is generally located upstream (toward the 5' end of a gene) of a gene and is required to initiate and trigger transcription of the gene. A promoter may allow appropriate activation or repression of a gene that it controls. A promoter may contain specific sequences that Petition 870260049160, dated 05 / 22 / 2026, page 46 / 151 35 / 128 are recognized by transcription factors. These factors can bind to a promoter DNA sequence, resulting in the recruitment of RNA polymerase, an enzyme that synthesizes RNA from the gene's coding region. The promoter generally refers to all gene regulatory elements located upstream of the gene, including upstream promoters, 5' UTRs, introns, and leader sequences.

[0056] As used in this document, the term upstream promoter refers to a contiguous polynucleotide sequence that is sufficient to direct transcription initiation. As used in this document, an upstream promoter encompasses the transcription initiation site with various sequence motifs, which include the TATA Box, primer sequence, TFIIB recognition elements, and other promoter motifs (Jennifer, EF et al., (2002) Genes & Dev., 16: 2583-2592). The upstream promoter provides the site of action for RNA polymerase II, which is a multi-subunit enzyme with basal or general transcription factors such as TFIIB, B, D, E, F, and H. These factors combine into a transcription pre-initiation complex that catalyzes RNA synthesis from the DNA template.

[0057] Upstream promoter activation is achieved by the additional sequence of DNA sequence regulatory elements to which various proteins bind and subsequently interact with the transcription initiation complex to activate gene expression. These gene sequence regulatory elements interact with specific DNA binding factors. These sequence motifs can sometimes be referred to as cis elements. Such cis elements, to which developmentally specific or tissue-specific transcription factors bind, individually or in combination, can determine the spatiotemporal expression pattern of a promoter at the transcriptional level. Petition 870260049160, dated 05 / 22 / 2026, page 47 / 151 36 / 128 These cis-elements vary widely in the type of control they exert on functionally linked genes. Some elements act to increase the transcription of functionally linked genes in response to environmental responses (e.g., temperature, humidity, and injury). Other cis-elements may respond to developmental cues (e.g., germination, seed maturation, and flowering) or spatial information (e.g., tissue specificity). See, for example, Langridge et al., (1989) Proc. Natl. Acad. Sci. USA 86:3219-23. These cis-elements are located at varying distances from the transcription starting point; some cis-elements (called proximal elements) are adjacent to a minimal core promoter region, while other elements may be positioned several kilobases upstream or downstream of the promoter (enhancers).

[0058] As used in this document, the term 5' untranslated region or 5' UTR is defined as the untranslated segment at the 5' end of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, a 5' UTR typically harbors a 7-methylguanosine cap at its 5' end and is involved in many processes such as splicing, polyadenylation, mRNA export towards the cytoplasm, identification of the 5' end of the mRNA by the translation machinery, and protection of mRNAs against degradation.

[0059] As used in this document, the term intron refers to any nucleic acid sequence contained within a gene (or expressed polynucleotide sequence of interest) that is transcribed but not translated. Introns include untranslated nucleic acid sequences within an expressed DNA sequence, as well as the corresponding sequence in RNA molecules transcribed from it. A construct described in this document may also contain sequences that enhance translation. Petition 870260049160, dated 05 / 22 / 2026, p. 48 / 151 37 / 128 and / or mRNA stability, such as introns. An example of such an intron is the first intron of gene II of the Arabidopsis thaliana histone H3 variant or any other commonly known intron sequence. Introns can be used in combination with a promoter sequence to enhance translation and / or mRNA stability.

[0060] As used in this document, the terms transcription terminator or terminator are defined as the segment transcribed at the 3' end of pre-mRNAs or mature mRNAs. For example, longer stretches of DNA beyond the polyadenylation signal site are transcribed as a pre-mRNA. This DNA sequence typically contains a transcription termination signal for the appropriate processing of the pre-mRNA into mature mRNA.

[0061] As used in this document, the term 3' untranslated region or 3' UTR is defined as the untranslated segment at the 3' terminus of pre-mRNAs or mature mRNAs. For example, in mature mRNAs, this region harbors the poly-(A) tail and is known to have many roles in mRNA stability, translation initiation, and mRNA export. In addition, the 3' UTR is considered to include the polyadenylation signal and transcription terminator.

[0062] As used in this document, the term polyadenylation signal designates a nucleic acid sequence present in mRNA transcripts that allows transcripts, when in the presence of a poly-(A) polymerase, to be polyadenylated at the polyadenylation site, for example, located 10 to 30 bases downstream of the poly(A) signal. Many polyadenylation signals are known in the art and are useful for the present invention. An exemplary sequence includes AAUAAA and variants thereof, as described in Loke J., et al., (2005) Plant Physiology 138(3); 1457-1468.

[0063] A DNA linker transgene is a sequence Petition 870260049160, dated 05 / 22 / 2026, p. 49 / 151 38 / 128 is a polynucleotide coding molecule that encodes a DNA-binding protein. A DNA-binding protein has the ability to subsequently bind to another molecule. A binding protein can bind to, for example, a DNA molecule (a DNA-binding protein), an RNA molecule (an RNA-binding protein), and / or a protein molecule (a protein-binding protein). In the case of a protein-binding protein, it can bind to itself (to form homodimers, homotrimers, etc.) and / or it can bind to one or more molecules of a different protein or different proteins. A binding protein can have more than one type of binding activity. For example, zinc finger proteins have DNA-binding, RNA-binding, and protein-binding activity.

[0064] Examples of DNA-binding proteins include; Meganucleases, zinc fingers, CRISPRs, and TALEN binding domains can be genetically modified to bind to a predetermined nucleotide sequence. Typically, genetically modified DNA-binding proteins (e.g., zinc fingers, CRISPRs, or TALEN) are proteins that are non-naturally occurring. Non-limiting examples of methods for genetically modified DNA-binding proteins are design and selection. A designed DNA-binding protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria. Rational criteria for design include applying substitution rules and computerized algorithms to process information in a database that stores information on existing ZFP, CRISPR, and / or TALEN designs and binding data. See, for example, U.S. Patents 6,140,081; 6,453,242; and 6,534.261; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496 and U.S. Publication Nos. 20110301073, 20110239315 and 20119145940. Petition 870260049160, dated 05 / 22 / 2026, page 50 / 151 39 / 128

[0065] A zinc finger DNA-binding protein (or binding domain) is a protein, or a domain within a larger protein, that binds DNA in a sequence-specific manner through one or more zinc fingers, which are amino acid sequence regions within the binding domain whose structure is stabilized through coordination with a zinc ion. The term zinc finger DNA-binding protein is generally abbreviated as zinc finger protein or ZFP. Zinc finger binding domains can be genetically modified to bind to a predetermined nucleotide sequence. Non-limiting examples of methods for genetically modifying zinc finger proteins are design and selection. An engineered zinc finger protein is a non-naturally occurring protein whose design / composition results primarily from rational criteria.Rational design criteria include applying substitution rules and computerized algorithms to process information in a database that stores existing ZFP design information and linkage data. See, for example, U.S. Patents Nos. 6,140,081; 6,453,242; 6,534,261 and 6,794,136; see also WO 98 / 53058; WO 98 / 53059; WO 98 / 53060; WO 02 / 016536 and WO 03 / 016496.

[0066] In other examples, the DNA-binding domain of one or more of the nucleases comprises a naturally occurring or genetically modified (non-naturally occurring) TAL effector DNA-binding domain. See, for example, U.S. Patent Publication No. 20110301073, incorporated by reference in its entirety herein. Plant pathogenic bacteria of the genus Xanthomonas are known to cause many diseases in important crop plants. The pathogenicity of Xanthomonas depends on a conserved type III (T3S) secretion system that Petition 870260049160, dated 05 / 22 / 2026, page 51 / 151 40 / 128 injects more than one different actuator protein into the plant cell. Among these injected proteins are transcription activator-like actuators (TALENs) that mimic plant transcriptional activators and manipulate the plant transcriptome (see Kay et al., (2007) Science 318:648-651). These proteins contain a DNA-binding domain and a transcriptional activation domain. One of the best-characterized TALEN actuators is AvrBs3 from Xanthomonas campestgris pv. vesicatoria (see Bonas et al., (1989) Mol Gen Genet 218: 127136 and WO2010079430). TALEN actuators contain a centralized domain of parallel repeats, where each repeat contains approximately 34 amino acids, which are key to the DNA-binding specificity of these proteins. In addition, they contain a nuclear localization sequence and a transcriptional activation acid domain (for an evaluation, see Schornack S, et al., (2006) J Plant Physiol 163(3): 256-272).Furthermore, in the pathogenic bacteria Ralstonia solanacearum, two genes, designated brg11 and hpx17, were found to be homologous to the AvrBs3 family of Xanthomonas in the biovar strain R. solanacearum GMI1000 and the biovar strain 4 RS1000 (See Heuer et al., (2007) Appl and Enviro Micro 73(13): 43794384). These genes are 98.9% identical in nucleotide sequence to each other, but differ by a 1,575 bp deletion in the repeat domain of hpx17. However, both gene products have less than 40% sequence identity with Xanthomonas AvrBs3 family proteins. See, for example, U.S. Patent Publication No. 20110301073, incorporated by reference in its entirety.

[0067] The specificity of these TAL actuators depends on the sequences observed in the parallel repetitions. The repeated sequence comprises approximately 102 bp and the repetitions are typically 91 to 100% homologous to each other (Bonas et al., ibid). The Petition 870260049160, dated 05 / 22 / 2026, p. 52 / 151 41 / 128 polymorphism of the repeats is normally located at positions 12 and 13 and appears to be a one-to-one correspondence between the identity of the hypervariable diresidues at positions 12 and 13 with the identity of the contiguous nucleotides in the target sequence of the TAL actuator (see Moscow and Bogdanove, (2009) Science 326:1501 and Boch et al., (2009) Science 326:1509-1512). Experimentally, the natural code for DNA recognition of these TAL actuators was determined such that an HD sequence at positions 12 and 13 leads to cytosine (C) binding, NG binds to T, NI to A, C, G or T, NN binds to A or G, and ING binds to T. These DNA-binding repeats were grouped into proteins with new combinations and repeat numbers to produce artificial transcription factors capable of interacting with new sequences and activating the expression of a non-endogenous reporter gene in plant cells (Boch et al., ibid).Genetically modified TAL proteins were ligated to a Fok I cleavage domain to produce a TAL actuator domain nuclease fusion (TALEN) that exhibits activity in a yeast reporter assay (plasmid-based target).

[0068] The CRISPR nuclease system (Repeat repeats CRISPR-associated short interspaced regular palindromic RNAs (CRISPR) are a recently genetically modified nuclease system based on a bacterial system that can be used for genome genetic modification. It is based, in part, on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades a bacterium, segments of the invader's DNA are converted into CRISPR RNAs (crRNAs) by the immune response. This crRNA then associates, through a region of partial complementarity, with another type of RNA called tracrRNA to guide the Cas9 nuclease to a region homologous to the crRNA in the target DNA called a protospacer. Petition 870260049160, dated 05 / 22 / 2026, page 53 / 151 42 / 128 performs DNA cleavage to generate blunt ends at double-strand breaks (DSBs) at sites specified by a 20-nucleotide guide sequence contained within the crRNA transcript. Cas9 requires both crRNA and tracrRNA for site-specific DNA recognition and cleavage. This system has now been genetically modified so that crRNA and tracrRNA can be combined into one molecule (the single guide RNA), and the crRNA equivalent of the single guide RNA can be genetically modified to guide the Cas9 nuclease to target any desired sequence (see Jinek et al., (2012) Science 337, pp. 816-821, Jinek et al., (2013), eLife 2:e00471, and David Segal, (2013) eLife 2:e00563). In other examples, crRNA associates with tracrRNA to guide Cpf1 nuclease to a region homologous to crRNA to cleave DNA with staggered ends (see Zetsche, Bernd, et al. Cell 163,3 (2015): 759-771). Thus, the system of CRISPR / Cas can be genetically modified to create a DSB at a desired target in a genome, and DSB repair can be influenced by the use of repair inhibitors to cause an increase in error-prone repair.

[0069] In other examples, the linkage transgene of A heterologous DNA / coding sequence is a site-specific nuclease comprising a genetically modified (unnaturally occurring) meganuclease (also described as a migrating endonuclease). Recognition sequences of migrating endonucleases or meganucleases such as I-Sce I, I-Ceu I, PI-Psp I, PI-Sce, ISce IV, I-Csm I, I-Pan I, I-Sce II, I-Ppo I, I-Sce III, I-Cre I, I-Tev I, I-Tev II, and ITevIII are known. See also U.S. Patent No. 5,420,032; U.S. Patent No. 6,833,252; Belfort et al., (1997) Nucleic Acids Res. 25:3379-30 3388; Dujon et al., (1989) Gene 82:115-118; Perler et al., (1994) Nucleic Acids Res. 22, 11127; Jasin (1996) Trends Petition 870260049160, dated 05 / 22 / 2026, p. 54 / 151 43 / 128 Genet. 12:224-228; Gimble et al., (1996) J. Mol. Biol. 263:163-180; Argast et al., (1998) J. Mol. Biol. 280:345-353 and the New England Biolabs catalog. Furthermore, the DNA binding specificity of migrating endonucleases and meganucleases can be genetically modified to bind to unnatural target sites. See, for example, Chevalier et al., (2002) Molec. Cell 10:895-905; Epinat et al., (2003) Nucleic Acids Res. 5 31:2952-2962; Ashworth et al., (2006) Nature 441:656-659; Paques et al., (2007) Current Gene Therapy 7:4966; U.S. Patent Publication No. 20070117128. The DNA-binding domains of migrating endonucleases and meganucleases can be altered within the context of the nuclease as a whole (i.e., so that the nuclease includes the cognate cleavage domain) or can be fused to a heterologous cleavage domain.

[0070] As used in this document, the term transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation; lipofection; microinjection (Mueller et al., (1978) Cell 15:579-85); Agrobacterium-mediated transfer; direct DNA uptake; WHISKERS™-mediated transformation; and microprojectile bombardment. These techniques can be used for both stable and transient transformation of a plant cell. Stable transformation refers to the introduction of a nucleic acid fragment into the genome of a host organism resulting in genetically stable inheritance. After stable transformation, the nucleic acid fragment is stably integrated into the genome of the host organism and any subsequent generation.Host organisms containing the transformed nucleic acid fragments are called transgenic organisms. Transient transformation refers to the introduction of a... Petition 870260049160, dated 05 / 22 / 2026, page 55 / 151 44 / 128 fragment of nucleic acid in the nucleus, or organelle containing DNA, of a host organism, resulting in gene expression without genetically stable inheritance.

[0071] An exogenous nucleic acid sequence. In one example, a heterologous transgene / coding sequence is a sequence of genes (e.g., a herbicide-resistant gene), a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desired agricultural trait. In yet another example, the heterologous transgene / coding sequence is an antisense nucleic acid sequence, in which the expression of the antisense nucleic acid sequence inhibits the expression of a target nucleic acid sequence. A heterologous transgene / coding sequence may contain regulatory sequences functionally linked to the heterologous transgene / coding sequence (e.g., a promoter). In some embodiments, a polynucleotide sequence of interest is a transgene.However, in other embodiments, a polynucleotide sequence of interest is either an endogenous nucleic acid sequence, where additional genomic copies of the endogenous nucleic acid sequence are desired, or a nucleic acid sequence that is in the antisense orientation relative to the sequence of a target nucleic acid molecule in the host organism.

[0072] As used in this document, the term a transgenic event is produced by transformation of plant cells with heterologous DNA, that is, a nucleic acid construct that includes a heterologous transgene / coding sequence of interest, regeneration of a plant population resulting from the insertion of the heterologous transgene / coding sequence into the plant genome, and selection of a particular plant characterized by insertion at a particular genomic location. The term event refers to Petition 870260049160, dated 05 / 22 / 2026, page 56 / 151 45 / 128 original transformer and progeny of the transformation that include heterologous DNA. The term event also refers to progeny produced by a sexual cross between the transformation and another variety that includes genomic / transgene DNA. Even after repeated backcrossing to a recurrent parent, the inserted heterologous transgene / coding sequence DNA and flanking genomic DNA (genomic / transgene DNA) of the transformed parent are present in the progeny of the cross at the same chromosomal location.The term event also refers to DNA from the original transformer and its progeny comprising the inserted DNA and flanking genomic sequence immediately adjacent to the inserted DNA that was expected to be transferred to progeny receiving inserted DNA, including the heterologous transgene / coding sequence of interest, as a result of a sexual cross between a parental lineage that includes the inserted DNA (e.g., the original transformer and progeny resulting from self-pollination) and a parental lineage that does not contain the inserted DNA.

[0073] As used in this document, the terms Polymerase Chain Reaction or PCR defines a procedure or technique in which minute quantities of nucleic acid, RNA and / or DNA, are amplified, as described in U.S. Patent No. 4,683,195 issued July 28, 1987. In general, sequence information from the ends of the region of interest or beyond needs to be available so that oligonucleotide primers can be designed; these primers will be identical or similar in sequence to the opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers may coincide with the ends of the amplified material. PCR can be used to amplify specific RNA sequences, specific DNA sequences from total genomic DNA, and cDNA transcribed from total cellular RNA sequences. Petition 870260049160, dated 05 / 22 / 2026, page 57 / 151 46 / 128 bacteriophage or plasmid, etc. See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51:263 (1987); Erlich, ed., PCR Technology, (Stockton Press, NY, 1989).

[0074] As used in this document, the term primer refers to an oligonucleotide capable of acting as a synthesis initiation point along a complementary strand when conditions are suitable for the synthesis of a primer extension product. Synthesis conditions include the presence of four different deoxyribonucleotide triphosphates and at least one polymerization-inducing agent such as reverse transcriptase or DNA polymerase. These are present in a suitable buffer, which may include constituents that are cofactors or that affect conditions such as pH and the like at various suitable temperatures. A primer is preferably a single-stranded sequence so that amplification efficiency is optimized, but double-stranded sequences may be used.

[0075] As used in this document, the term probe refers to an oligonucleotide that hybridizes to a target sequence. In the TaqMan® or TaqMan®-style assay procedure, the probe hybridizes to a portion of the target located between the annealing sites of the two primers. A probe includes about eight nucleotides, about ten nucleotides, about fifteen nucleotides, about twenty nucleotides, about thirty nucleotides, about forty nucleotides, or about fifty nucleotides. In some embodiments, a probe includes from about eight nucleotides to about fifteen nucleotides. A probe may also include a detectable identifier, for example, a fluorophore (Texas-Red®, fluorescein isothiocyanate, etc.). The detectable identifier can be covalently attached directly to the probe oligonucleotide, for example, located at the 5' end of the probe or at the 3' end of the probe. Petition 870260049160, dated 05 / 22 / 2026, p. 58 / 151 47 / 128 A probe that includes a fluorophore may also include a burst cooler, for example, Black Hole Quencher™, Iowa Black™, etc.

[0076] As used in this document, the terms restriction endonucleases and restriction enzymes refer to bacterial enzymes, each of which cuts double-stranded DNA at or near a specific nucleotide sequence. Type 2 restriction enzymes recognize and cleave DNA at the same site, and include, but are not limited to, XbaI, BamHI, HindIII, EcoRI, XhoI, SalI, KpnI, AvaI, PstI, and SmaI.

[0077] As used in this document, the term vector is used interchangeably with the terms construct, cloning vector, and expression vector and means the vehicle by which a DNA or RNA sequence (e.g., an exogenous gene) can be introduced into a host cell so as to transform the host and promote expression (e.g., transcription and translation) of the introduced sequence. A nonviral vector is intended to mean any vector that does not comprise a virus or retrovirus. In some embodiments, a vector is a DNA sequence comprising at least one origin of DNA replication and at least one selectable marker gene. Examples include, but are not limited to, a plasmid, cosmid, bacteriophage, bacterial artificial chromosome (BAC), or virus carrying exogenous DNA into a cell. A vector may also include one or more genes, antisense molecules, and / or selectable marker genes and other genetic elements known in the art.A vector can transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid and / or protein molecules encoded by the vector.

[0078] The term plasmid defines a circular strand of nucleic acid with the capacity for autosomal replication or replication within a cell. Petition 870260049160, dated 05 / 22 / 2026, page 59 / 151 48 / 128 prokaryotic host or in a eukaryotic host cell. The term includes nucleic acid which can be either DNA or RNA and can be single-stranded or double-stranded. The plasmid of the definition may also include sequences that correspond to a bacterial origin of replication.

[0079] As used herein, the term selectable marker gene as used herein defines a gene or other expression cassette that encodes a protein that facilitates identification of cells into which the selectable marker gene is inserted. For example, a selectable marker gene encompasses reporter genes, as well as genes used in plant transformation to, for example, protect plant cells from a selective agent or provide resistance / tolerance to a selective agent. In one embodiment, only those cells or plants that receive a functional selectable marker have the ability to divide or grow under conditions that have a selective agent.The term "positive marker" refers to plants that have been transformed to include a selectable marker gene.

[0080] As used in this document, the term detectable marker refers to a detectable identifier, such as, for example, a radioisotope, fluorescent compound, bioluminescent compound, chemiluminescent compound, metal chelator, or enzyme. Examples of detectable markers include, however, without limitation, the following: fluorescent identifiers (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic identifiers (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescence, biotinyl groups, predetermined polypeptide epitopes recognized by a secondary reporter (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal-binding domains, epitope labels). In one embodiment, a detectable marker may be fixed. Petition 870260049160, dated 05 / 22 / 2026, p. 60 / 151 49 / 128 by spacer arms of varying lengths to reduce potential steric hindrance.

[0081] As used in this document, the terms cassette, expression cassette, and gene expression cassette refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide at specific restriction sites or by homologous recombination. As used in this document, the DNA segment comprises a polynucleotide encoding a polypeptide of interest, and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation. In one embodiment, an expression cassette may include a polynucleotide encoding a polypeptide of interest and that has elements beyond the polynucleotide that facilitate transformation in a specific host cell. In one embodiment, a gene expression cassette may also include elements that allow enhanced expression of a polynucleotide encoding a polypeptide of interest in a host cell.These elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, a terminator sequence, a polyadenylation sequence, and the like.

[0082] As used in this document, a linker or spacer is a link, molecule, or group of molecules that links two separate entities together. Linkers and spacers may provide ideal spacing between the two entities or may provide a labile link that allows the two entities to be separated from each other. Labile linkages include photocleavable groups, acid-labile chemical portions, base-labile chemical portions, and enzyme-cleavable groups. The terms polylinker or multiple cloning sites, as used in this document, Petition 870260049160, dated 05 / 22 / 2026, page 61 / 151 50 / 128 defines a cluster of three or more Type 2 restriction enzyme sites located within 10 nucleotides of each other in a nucleic acid sequence. In other examples, the term polylinker, as used herein, refers to a stretch of nucleotides that are targeted to join two sequences by means of any known continuous cloning method (i.e., Gibson Assembly®, NEBuilder HiFiDNA Assembly®, Golden Gate Assembly, BioBrick® Assembly, etc.). Constructs comprising a polylinker are used for insertion and / or excision of nucleic acid sequences as the coding region of a gene.

[0083] As used in this document, the term control refers to a sample used in an analytical procedure for comparison purposes. A control can be positive or negative. For example, when the purpose of an analytical procedure is to detect a differently expressed transcript or polypeptide in cells or tissue, it is generally preferable to include a positive control, such as a sample from a known plant that exhibits the desired expression, and a negative control, such as a sample from a known plant that does not have the desired expression.

[0084] As used in this document, the term plant includes a complete plant and any offspring, cell, tissue, or part of a plant. A class of plant that may be used in the present invention is generally as broad as the class of mutagenic lower and higher plants, including angiosperms (monocotyledonous and dicotyledonous plants), gymnosperms, ferns, and multicellular algae. Thus, plant includes monocotyledonous and dicotyledonous plants. The term plant parts includes any part (or parts) of a plant, including, for example and without limitation: seed (including seed Petition 870260049160, dated 05 / 22 / 2026, page 62 / 151 51 / 128 mature and immature seed); a plant cutting; a plant cell; a plant cell culture; a plant organ (e.g., pollen, embryos, flowers, fruits, buds, leaves, roots, stems, and explants). A plant tissue or plant organ can be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may have the capacity to regenerate a plant that has the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and to regenerate a plant that has substantially the same genotype as the plant. Conversely, some plant cells do not have the capacity to be regenerated to produce plants.Regenerable cells in a plant cell or tissue culture can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silk, flowers, grains, ears, cobs, husks, or stems.

[0085] Plant parts include harvestable parts and parts useful for propagating progeny plants. Plant parts useful for propagation include, for example, and without limitation: seed; fruit; a cutting; a seedling; a tuber; and a rootstock. A harvestable part of a plant may be any useful part of a plant, including, for example, and without limitation: flower; pollen; seedling; tuber; leaf; stem; fruit; seed; and root.

[0086] A plant cell is the structural and physiological unit of a plant, comprising a protoplast and a cell wall. A plant cell may be in the form of a single isolated cell, or an aggregate of cells (e.g., a friable callus and a cultured cell), and may be part of a higher organized unit (e.g., a plant tissue, plant organ, and plant). Thus, a plant cell may be a protoplast, a cell-producing gamete, or a cell or collection of cells that can regenerate into Petition 870260049160, dated 05 / 22 / 2026, page 63 / 151 52 / 128 a complete plant. In this way, a seed, which comprises multiple plant cells and has the capacity to regenerate into a complete plant, is considered a plant cell in the modalities of this document.

[0087] As used in this document, the term small RNA refers to several classes of non-coding ribonucleic acid (ncRNA). The term small RNA describes the short chains of ncRNA produced in bacterial, animal, plant, and fungal cells. These short chains of ncRNA can be produced naturally within the cell or can be produced by the introduction of an exogenous sequence that expresses the short chain or ncRNA. Small RNA sequences do not directly code for a protein, and differ in function from other RNA since small RNA sequences are only transcribed and not translated. Small RNA sequences are involved in other cellular functions, including gene expression and modification. Small RNA molecules are typically produced from about 20 to 30 nucleotides. Small RNA sequences can be derived from longer precursors.The precursors form structures that fold back into each other in self-complementary regions; these are then processed by the nuclease Dicer in animals or DCL1 in plants.

[0088] Many types of small RNA exist either naturally or are artificially produced, including microRNAs (miRNAs), short interfering RNAs (siRNAs), antisense RNAs, short hairpin RNAs (shRNAs), and small nucleolar RNAs (snoRNAs). Certain types of small RNA, such as microRNAs and siRNAs, are important in gene silencing and RNA interference (RNAi). Gene silencing is a gene regulation process in which a gene that would normally be expressed is switched off by a Petition 870260049160, dated 05 / 22 / 2026, page 64 / 151 53 / 128 intracellular element, in this case, the small RNA. The protein that would normally be formed from this genetic information is not formed due to interference, and the information encoded in the gene is blocked from expression.

[0089] As used in this document, the term small RNA encompasses RNA molecules described in the literature as tiny RNA (Storz, (2002) Science 296:1260-3; Illangasekare et al., (1999) RNA 5:1482-1489); prokaryotic small RNA (sRNA) (Wassarman et al., (1999) Trends Microbiol. 7:37-45); eukaryotic non-coding RNA (ncRNA); micro-RNA (miRNA); non-small mRNA (snmRNA); functional RNA (fRNA); transfer RNA (tRNA); catalytic RNA [e.g., ribozymes, including self-acylated ribozymes (Illangasekare et al., (1999) RNA 5:1482-1489); small nucleolar RNAs (snoRNAs), tmRNA (also known as 10S RNA, Muto et al., (1998) Trends Biochem Sci. 23:25-29; and Gillet et al., (2001) Mol Microbiol.42:879-885); RNAi molecules, including without limitation small interfering RNA (siRNA), endoribonuclease-prepared siRNA (e-siRNA), hairpin-shaped short RNA (shRNA), and temporally small regulated RNA (stRNA), spliced ​​siRNA (d-siRNA), and aptamers, oligonucleotides and other synthetic nucleic acids comprising at least one uracil base.

[0090] Unless specifically explained otherwise, all technical and scientific terms used in this document have the same meaning as that commonly understood by those of ordinary skill in the art to which this disclosure pertains. Definitions of terms common in molecular biology may be seen in, for example: Lewin, Genes V, Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); Petition 870260049160, dated 05 / 22 / 2026, p. 65 / 151 54 / 128 and Meyers (ed.), Molecular Biology and Biotechnology: A Comprehensive Table Reference, VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). III. GmPSID2 Gene Regulatory Elements and Acids Nucleicos that comprise the same

[0091] Methods and compositions are provided for using a promoter of a Glycine max Glyma 10g39460 gene (PsaD subunit of photosystem I) to express non-GmPSID2 transgenes in plants. In one embodiment, a promoter can be the promoter of the GmPSID2 gene of SEQ ID No:2.

[0092] In one embodiment, a polynucleotide comprising a promoter is provided, wherein the promoter is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID No. 2. In one embodiment, a promoter is a GmPSID2 gene promoter comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to the polynucleotide of SEQ ID No. 2. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID No. 2. In one embodiment, a nucleic acid vector is provided that comprises a GmPSID2 promoter of SEQ ID No. 2. In one embodiment, a polynucleotide is provided that comprises a GmPSID2 promoter that is functionally linked to a polylinker.In one embodiment, a gene expression cassette is provided comprising a GmPSID2 promoter that is functionally linked to a non-GmPSID2 transgene. In another embodiment, a nucleic acid vector is provided comprising a GmPSID2 promoter that is functionally linked to a non-GmPSID2 transgene. In one embodiment, the promoter consists of SEQ ID No. 2. In an illustrative embodiment, an acid vector. Petition 870260049160, dated 05 / 22 / 2026, p. 66 / 151 55 / 128 nucleic acid comprises a GmPSID2 promoter that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[0093] In one embodiment, a nucleic acid vector comprises a gene expression cassette, as disclosed herein. In one embodiment, a vector may be a plasmid, a cosmid, a bacterial artificial chromosome (BAC), a bacteriophage, a virus, or a polynucleotide fragment excised for use in direct transformation or gene targeting as a donor DNA.

[0094] Transgene expression can also be regulated by a 5' UTR region located downstream of the promoter sequence. Both a promoter and a 5' UTR can regulate heterologous transgene / coding sequence expression. Although a promoter is required to trigger transcription, the presence of a 5' UTR can increase expression levels that result in mRNA transcript for translation and protein synthesis. A 5' UTR gene region assists in stable transgene expression. In an additional embodiment, a 5' UTR is functionally linked to a GmPSID2 promoter. In one embodiment, a 5' UTR can be the GmPSID2 5' UTR of SEQ ID No: 3.

[0095] In one embodiment, a polynucleotide comprising a 5' UTR is provided, wherein the 5' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID No. 3. In one embodiment, a 5' UTR is Petition 870260049160, dated 05 / 22 / 2026, page 67 / 15156 / 128 a 5' UTR of GmPSID2 comprising a polynucleotide of at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID No. 3. In one embodiment, an isolated polynucleotide is provided comprising at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity to the polynucleotide of SEQ ID No. 3. In one embodiment, a nucleic acid vector comprising a 5' UTR of GmPSID2 from SEQ ID No. 3 is provided. In another embodiment, a polynucleotide comprising a 5' UTR of GmPSID2 that is functionally linked to a polylinker is provided. In another embodiment, a gene expression cassette comprising a 5' UTR of GmPSID2 that is functionally linked to a non-GmPSID2 transgene is provided. In another embodiment, a nucleic acid vector comprising a 5' UTR of GmPSID2 that is functionally linked to a non-GmPSID2 transgene is provided.In one embodiment, the 5' UTR consists of SEQ ID No. 3. In an illustrative embodiment, a nucleic acid vector comprises a 5' UTR of GmPSID2 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[0096] Transgene expression can also be regulated by an intron region located downstream of the promoter sequence. Both a promoter and an intron can regulate the expression of a heterologous transgene / coding sequence. Although a promoter is required to trigger transcription, the presence of an intron can Petition 870260049160, dated 05 / 22 / 2026, page 68 / 151 57 / 128 increase expression levels that result in mRNA transcript for translation and protein synthesis. An intron gene region assists in stable expression of a transgene. In an additional embodiment, an intron is functionally linked to a GmPSID2 promoter.

[0097] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmPSID2 promoter functionally linked to a polylinker sequence, a non-GmPSID2 gene or non-GmPSID2 transgene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a GmPSID2 promoter functionally linked to a transgene or non-GmPSID2 gene. In one embodiment, the recombinant gene cassette comprises a GmPSID2 promoter, as disclosed herein, that is functionally linked to a polylinker sequence.The polyligand is functionally linked to the GmPSID2 promoter in such a way that insertion of a coding sequence into one of the polyligand's restriction sites will functionally bind to the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell.

[0098] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmPSID2 promoter and a non-GmPSID2 gene. In one embodiment, the GmPSID2 promoter of SEQ ID No: 2 is functionally ligated to the 5' end of the transgene or non-GmPSID2 gene. In a further embodiment, the GmPSID2 promoter sequence comprises SEQ ID No: 2 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No: 2. According to one embodiment, a nucleic acid vector is provided Petition 870260049160, dated 05 / 22 / 2026, p. 69 / 151 58 / 128 comprising a gene cassette consisting of a GmPSID2 promoter, a non-GmPSID2 gene, wherein the GmPSID2 promoter is functionally linked to the 5' end of the non-GmPSID2 gene, and the GmPSID2 promoter sequence comprises SEQ ID No:2 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No:2. In a further embodiment, the GmPSID2 promoter sequence consists of SEQ ID No:2, or an 821 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:2.

[0099] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 5' GmPSID2 UTR functionally linked to a polylinker sequence, a transgene or non-GmPSID2 gene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a 5' GmPSID2 UTR functionally linked to a transgene or non-GmPSID2 gene. In one embodiment, the recombinant gene cassette comprises a 5' GmPSID2 UTR, as disclosed herein, which is functionally linked to a polylinker sequence.The polyligand is functionally linked to the 5' UTR of GmPSID2 in such a way that insertion of a coding sequence into one of the polyligand's restriction sites will functionally link to the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell.

[00100] According to one embodiment, a nucleic acid vector comprising a gene cassette consisting of a 5' UTR of GmPSID2 and a non-GmPSID2 gene is provided. In one embodiment, the 5' UTR of GmPSID2 from SEQ ID No. 3 is functionally ligated to the 5' end of the transgene or non-GmPSID2 gene. In Petition 870260049160, dated 05 / 22 / 2026, p. 70 / 151 59 / 128 In an additional embodiment, the 5' UTR sequence of GmPSID2 comprises SEQ ID No: 3 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with a SEQ ID No: 3. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 5' UTR of GmPSID2, a non-GmPSID2 gene, wherein the 5' UTR of GmPSID2 is functionally linked to the 5' end of the non-GmPSID2 gene, and the 5' UTR sequence of the GmPSID2 gene comprises SEQ ID No: 3 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No: 3. In an additional embodiment, the 5' UTR sequence of the GmPSID2 gene consists of SEQ ID No:3 or a 248 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:3.

[00101] A GmPSID2 promoter may also comprise one or more additional sequence elements. In some embodiments, a GmPSID2 promoter may comprise an exon (e.g., a leader or signal peptide such as a chloroplast transit peptide or ER retention signal). For example, and without limitation, a GmPSID2 promoter may encode an exon incorporated into the GmPSID2 promoter as an additional embodiment.

[00102] Methods and compositions are further provided for using a 3' UTR of a Glycine max gene Glyma10g39460 (Photosystem I PsaD subunit) to terminate the expression of non-GmPSID2 transgenes in a plant. In one embodiment, a 3' UTR terminator can be the 3' UTR of GmPSID2 of SEQ ID No:4.

[00103] In one embodiment, a polynucleotide comprising a 3' UTR is provided, wherein the 3' UTR is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID No. 4. In one embodiment, a 3' UTR is a GmPSID2 3' UTR comprising a polynucleotide of at least Petition 870260049160, dated 05 / 22 / 2026, p. 71 / 151 60 / 128 less 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID No.:4. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID No.:4. In one embodiment, a nucleic acid vector comprising a 3' UTR of GmPSID2 from SEQ ID No. 4 is provided. In another embodiment, a polynucleotide comprising a 3' UTR of GmPSID2 that is functionally linked to a polylinker is provided. In another embodiment, a gene expression cassette comprising a 3' UTR of GmPSID2 that is functionally linked to a non-GmPSID2 transgene is provided. In another embodiment, a nucleic acid vector comprising a 3' UTR of GmPSID2 that is functionally linked to a non-GmPSID2 transgene is provided. In one embodiment, the 3' UTR consists of SEQ ID No. 4.In an illustrative embodiment, a nucleic acid vector comprises a 3' UTR of the GmPSID2 gene that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linker transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00104] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a 3' UTR of GmPSID2 functionally linked to a polylinker sequence, a heterologous transgene / coding sequence, or a non-GmPSID2 gene, or a combination thereof. In Petition 870260049160, dated 05 / 22 / 2026, p. 72 / 151 61 / 128 In one embodiment, the recombinant gene cassette comprises a GmPSID2 3' UTR functionally linked to a transgene or non-GmPSID2 gene. In one embodiment, the recombinant gene cassette comprises a GmPSID2 3' UTR, as disclosed herein, that is functionally linked to a polylinker sequence. The polylinker is functionally linked to the GmPSID2 3' UTR in such a way that insertion of a coding sequence into one of the polylinker restriction sites will functionally bind to the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell.

[00105] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmPSID2 and a non-GmPSID2 gene. In one embodiment, the 3' UTR of GmPSID2 of SEQ ID No:4 is functionally ligated to the 3' end of the transgene or non-GmPSID2 gene. In a further embodiment, the 3' UTR sequence of GmPSID2 comprises SEQ ID No:4 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No:4. According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a 3' UTR of GmPSID2, a non-GmPSID2 gene, wherein the 3' UTR of GmPSID2 is functionally ligated to the 3' end of the non-GmPSID2 gene, and the 3' UTR sequence of GmPSID2 comprises SEQ ID No:4 or a sequence that has 80, 85, 90, 95, 99 or 100% sequence identity with SEQ ID No:4.In an additional embodiment, the UTR 3' sequence of GmPSID2 consists of SEQ ID No:4 or a 739 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:4.

[00106] Methods and compositions for use are still provided. Petition 870260049160, dated 05 / 22 / 2026, p. 73 / 151 62 / 128 a terminator of a Glycine max gene Glyma10g39460 (Photosystem I PsaD subunit) to terminate the expression of non-GmPSID2 transgenes in a plant. In one embodiment, a terminator may be the GmPSID2 terminator of SEQ ID No: 5.

[00107] In one embodiment, a polynucleotide comprising a terminator is provided, wherein the terminator is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to SEQ ID No. 5. In one embodiment, a terminator is a GmPSID2 terminator comprising a polynucleotide that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identical to the polynucleotide of SEQ ID No. 5. In one embodiment, an isolated polynucleotide is provided that comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.8%, or 100% identity with the polynucleotide of SEQ ID No. 5. In one embodiment, a nucleic acid vector is provided that comprises a GmPSID2 terminator of SEQ ID No. 5. In one embodiment, a polynucleotide is provided that comprises a GmPSID2 terminator that is functionally linked to a polylinker.In one embodiment, a gene expression cassette is provided comprising a GmPSID2 terminator that is functionally linked to a non-GmPSID2 transgene. In another embodiment, a nucleic acid vector is provided comprising a GmPSID2 terminator that is functionally linked to a non-GmPSID2 transgene. In one embodiment, the terminator consists of SEQ ID No. 5. In an illustrative embodiment, a nucleic acid vector comprises a GmPSID2 terminator that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, or a use efficiency transgene. Petition 870260049160, dated 05 / 22 / 2026, p. 74 / 151 63 / 128 nitrogen, a water use efficiency transgene, a nutritional quality transgene, a DNA linking transgene, a small RNA transgene, a selectable marker transgene, or combinations thereof.

[00108] According to one embodiment, a nucleic acid vector is provided comprising a recombinant gene expression cassette, wherein the recombinant gene expression cassette comprises a GmPSID2 terminator functionally linked to a polylinking sequence, a transgene or non-GmPSID2 gene, or a combination thereof. In one embodiment, the recombinant gene cassette comprises a GmPSID2 terminator functionally linked to a transgene or non-GmPSID2 gene. In one embodiment, the recombinant gene cassette comprises a GmPSID2 terminator, as disclosed herein, that is functionally linked to a polylinking sequence.The polyligand is functionally linked to the GmPSID2 terminator in such a way that insertion of a coding sequence into one of the polyligand's restriction sites will functionally link to the coding sequence, allowing expression of the coding sequence when the vector is transformed or transfected into a host cell.

[00109] According to one embodiment, a nucleic acid vector is provided comprising a gene cassette consisting of a GmPSID2 terminator and a non-GmPSID2 gene. In one embodiment, the GmPSID2 terminator of SEQ ID No. 5 is functionally linked to the 3' end of the transgene or non-GmPSID2 gene. In a further embodiment, the GmPSID2 terminator sequence comprises SEQ ID No. 5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No. 5. According to one embodiment, a nucleic acid vector comprising a gene cassette consisting of a terminator Petition 870260049160, dated 05 / 22 / 2026, p. 75 / 151 64 / 128 of GmPSID2, a non-GmPSID2 gene, wherein the GmPSID2 terminator is functionally linked to the 3' end of the non-GmPSID2 gene, and the GmPSID2 terminator sequence comprises SEQ ID No:5 or a sequence that has 80, 85, 90, 95, 99, or 100% sequence identity with SEQ ID No:5. In a further embodiment, the GmPSID2 terminator sequence consists of SEQ ID No:5 or an 897 bp sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:5.

[00110] In one embodiment, a nucleic acid construct is provided comprising a GmPSID2 promoter and a non-GmPSID2 gene and, optionally, one or more of the following elements: a) an untranslated region 5'; b) an intron; and c) an untranslated 3' region, wherein the GmPSID2 promoter consists of SEQ ID No:2 or a sequence that has 95% sequence identity with SEQ ID No:2; The 5' UTR of GmPSID2 consists of a known 5' UTR, SEQ ID No. 3, or a sequence that has 95% sequence identity with SEQ ID No. 3; and the 3' UTR consists of a known 3' UTR, SEQ ID No. 4, or a sequence that has 95% sequence identity with SEQ ID No. 4; furthermore, said GmPSID2 promoter is functionally linked to said heterologous transgene / coding sequence, and each optional element, when present, is also functionally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the nucleic acid construct disclosed immediately above is provided. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a Petition 870260049160, dated 05 / 22 / 2026, page 76 / 151 65 / 128 of the plant is provided, wherein the plant comprises said transgenic cells.

[00111] In one embodiment, a nucleic acid construct is provided comprising a GmPSID2 promoter and a non-GmPSID2 gene and, optionally, one or more of the following elements: a) an untranslated region 5'; b) an intron; and c) a 3' terminator region, wherein the GmPSID2 promoter consists of SEQ ID No:2 or a sequence that has 95% sequence identity with SEQ ID No:2; The 5' UTR of GmPSID2 consists of a known 5' UTR, SEQ ID No. 3, or a sequence that has 95% sequence identity with SEQ ID No. 3; and the 3' terminator consists of a known 3' terminator, SEQ ID No. 5, or a sequence that has 95% sequence identity with SEQ ID No. 5; furthermore, said GmPSID2 promoter is functionally linked to said heterologous transgene / coding sequence, and each optional element, when present, is also functionally linked to both the promoter and the transgene. In a further embodiment, a transgenic cell comprising the nucleic acid construct disclosed immediately above is provided. In one embodiment, the transgenic cell is a plant cell, and in a further embodiment, a plant is provided, wherein the plant comprises said transgenic cells.

[00112] Another aspect of the present disclosure comprises a functional variant that differs in one or more nucleotides from the nucleotide sequences comprising the regulatory element, provided herein. Such a variant is produced as a result of one or more modifications (e.g., deletion, Petition 870260049160, dated 05 / 22 / 2026, page 77 / 151 66 / 128 rearrangement or insertion) of nucleotide sequences comprising the sequence described herein. For example, fragments and variants of the GmPSID2 promoter sequence of SEQ ID No. 2 may be used in a DNA construct or in a gene expression cassette to trigger the expression of a heterologous coding sequence. As used herein, the term fragment refers to a portion of the nucleic acid sequence. Fragments of the GmPSID2 promoter sequence of SEQ ID No. 2 may retain the biological activity of initiating transcription, more particularly triggering transcription in a tissue-preferential manner. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes may not necessarily retain biological activity.Fragments of a nucleotide sequence for the promoter region of the GmPSID2 promoter sequence of SEQ ID No. 2 can vary from at least about 20 nucleotides, about 50 nucleotides, about 100 nucleotides, up to the full-length nucleotide sequence of the invention for the gene promoter region.

[00113] A biologically active portion of a GmPSID2 promoter sequence from SEQ ID No:2 can be prepared by isolating a portion of the GmPSID2 promoter sequence from SEQ ID No:2, and evaluating the promoter activity of the portion. Nucleic acid molecules that are fragments of a GmPSID2 promoter nucleotide sequence comprise at least about 16, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1550, 1600, 1650, or 1700 nucleotides, or up to the number of nucleotides present in a full-length GmPSID2 promoter sequence disclosed herein.

[00114] Variant nucleotide sequences also encompass Petition 870260049160, dated 05 / 22 / 2026, p. 78 / 151 67 / 128 sequences derived from a mutagenic or recombinogenic procedure, such as DNA rearrangement. With such a procedure, GmPSID2 promoter nucleotide sequences of SEQ ID No. 2 can be manipulated to create a novel GmPSID2 promoter. In this way, recombinant polynucleotide libraries are generated from a population of polynucleotide sequences comprising sequence regions that have substantial sequence identity and can be recombined homologously in vitro or in vivo. Strategies for such DNA rearrangement are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA i: 10747-10751; Stemmer (1994) Nature 570:389-391; Crameri et al. (1997) Nature Biotech. 75:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. EUA £4:4504-4509; Crameri et al. (1998) Nature 527:288-291; and U.S. Patents Nos. 5,605,793 and 5,837,458.

[00115] The nucleotide sequences of the present disclosure can be used to isolate corresponding sequences from other organisms, particularly other plants, more specifically other monocotyledons. In this way, methods such as PCR, hybridization and the like can be used to identify such sequences based on their sequence homology with the sequences presented in the present document. The sequences isolated based on their sequence identity with the entire GmPSID2 promoter sequence presented in the present document or fragments thereof are covered by the present invention.

[00116] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from genomic DNA extracted from any plant of interest. Primer design methods Petition 870260049160, dated 05 / 22 / 2026, p. 79 / 151 68 / 128 PCR and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, New York), hereinafter Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known PCR methods include, but are not limited to, methods using paired primers, nested primers, individual specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially non-matching primers, and the like.

[00117] In hybridization techniques, all or part of a known nucleotide sequence is used as a probe that selectively hybridizes with other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a selected organism. Hybridization probes can be labeled with a detectable group, such as P32 or any other detectable marker. Thus, for example, hybridization probes can be prepared by labeling synthetic oligonucleotides based on the GmPSID2 promoter sequence of the invention. Methods for preparing hybridization probes and for constructing genomic libraries are generally known in the art and are disclosed in Sambrook.For example, the entire GmPSID2 promoter sequence disclosed in this document, or one or more portions thereof, can be used as a probe capable of specifically hybridizing with corresponding GmPSID2 promoter sequences and messenger RNAs. To achieve specific hybridization under a variety of... Petition 870260049160, dated 05 / 22 / 2026, p. 80 / 151 Under conditions 69 / 128, such probes include sequences that are unique among GmPSID2 promoter sequences and are at least 10 nucleotides long or at least about 20 nucleotides long. Such probes can be used to amplify a matching GmPSID2 promoter sequence from a plant selected by PCR. This technique can be used to isolate additional coding sequences from a desired organism, or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include screening by hybridization of plated DNA libraries (or plates or colonies; see, for example, Sambrook).

[00118] According to one embodiment, the nucleic acid vector further comprises a sequence encoding a selectable marker. According to one embodiment, the recombinant gene cassette is functionally linked to an Agrobacterium T-DNA edge. According to one embodiment, the recombinant gene cassette further comprises a first and a second T-DNA edge, wherein the first T-DNA edge is functionally linked to one end of a gene construct, and the second T-DNA edge is functionally linked to the other end of a gene construct.The first and second Agrobacterium T-DNA borders can be independently selected from T-DNA border sequences originating from bacterial strains selected from the group consisting of an Agrobacterium nopalin-synthesizing T-DNA border, an Agrobacterium ocotopin-synthesizing T-DNA border, an Agrobacterium mannopin-synthesizing T-DNA border, an Agrobacterium succinamopine-synthesizing T-DNA border, or any combination thereof. In one embodiment, a strain of... Agrobacterium selected from the group consisting of a strain Petition 870260049160, dated 05 / 22 / 2026, p. 81 / 151 70 / 128 of nopaline synthesis, a mannopine synthesis strain, a succinamopine synthesis strain, or an octopine synthesis strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID No:2 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:2. In another embodiment, the first and second Agrobacterium T-DNA borders can be independently selected from T-DNA border sequences originating from bacterial strains selected from the group consisting of an Agrobacterium nopalin-synthesizing T-DNA border, an Agrobacterium ocotopin-synthesizing T-DNA border, an Agrobacterium mannopin-synthesizing T-DNA border, an Agrobacterium succinamopine-synthesizing T-DNA border, or any combination thereof.In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID No:3 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with a SEQ ID No:3. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinate-mopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a functionally linked heterologous transgene / coding sequence. Petition 870260049160, dated 05 / 22 / 2026, p. 82 / 151 71 / 128 to a sequence selected from SEQ ID No:4 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:4. In one embodiment, an Agrobacterium strain selected from the group consisting of a nopalin-synthesizing strain, a mannopin-synthesizing strain, a succinamopin-synthesizing strain, or an octopin-synthesizing strain is provided, wherein said strain comprises a plasmid, wherein the plasmid comprises a heterologous transgene / coding sequence functionally linked to a sequence selected from SEQ ID No:5 or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:5.

[00119] Transgenes of interest that are suitable for use in the constructs presently disclosed include, but are not limited to, coding sequences that confer (1) pest or disease resistance, (2) herbicide tolerance, (3) added agronomic traits of value, such as; yield enhancement, nitrogen use efficiency, water use efficiency, and nutritional quality, (4) site-specific binding of a protein to DNA, (5) small RNA expression, and (6) selectable markers. According to one embodiment, the heterologous transgene / coding sequence encodes a selectable marker or gene product that confers insecticide resistance, herbicide tolerance, small RNA expression, nitrogen use efficiency, water use efficiency, or nutritional quality. 1. Insect Resistance

[00120] Several insect resistance genes can be functionally linked to the GmPSID2 promoter comprising SEQ ID No. 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No. 2. Furthermore, insect resistance genes can be functionally linked to the 5' UTR of GmPSID2. Petition 870260049160, dated 05 / 22 / 2026, page 83 / 151 72 / 128 comprising SEQ ID No: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 3. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No: 4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No: 5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 5. The functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary insect resistance coding sequences are known in the art.As examples of insect resistance coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following traits are provided. Exemplary Lepidoptera insect resistance coding sequences include: crylA; cry1A.105; crylAb; crylAb (truncated); cry1Ab-Ac (fusion protein); crylAc (marketed as Widestrike®); crylC; crylF (marketed as Widestrike®); cry1Fa2; cry2Ab2; cry2Ae; cry9C; mocry1F; pinlI (protease inhibitor protein); vip3A(a); and vip3Aa20. Exemplary Coleoptera insect resistance coding sequences include: cry34Ab1 (marketed as Herculex®); cry35Ab1 (marketed as Herculex®); cry3A; cry3Bb1; dvsnf7 and mcry3A. Exemplary coding sequences that provide resistance in multiple insects include ecry31.Ab. The above list of insect resistance genes is not intended to be exhaustive.Any insect resistance genes are covered by this disclosure. 2. Herbicide Tolerance Petition 870260049160, dated 05 / 22 / 2026, page 84 / 151 73 / 128

[00121] Several herbicide tolerance genes can be functionally linked to the GmPSID2 promoter comprising SEQ ID No: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 2. In addition, insect resistance genes can be functionally linked to the 5' UTR of GmPSID2 comprising SEQ ID No: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 3. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No.:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No.:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:5.Functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary herbicide tolerance coding sequences are known in the art. As examples of herbicide tolerance coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following traits are provided. The herbicide glyphosate has a mode of action by inhibiting the EPSPS enzyme (5-enolpyruvylshikimate-3-phosphate synthase). This enzyme is involved in the biosynthesis of aromatic amino acids that are essential for plant growth and development. Several enzymatic mechanisms are known in the art that can be used to inhibit this enzyme. Genes encoding such enzymes can be functionally linked to the gene regulatory elements of the present disclosure.In one embodiment, selectable marker genes include, but are not limited to, genes that encode genes. Petition 870260049160, dated 05 / 22 / 2026, page 85 / 151 74 / 128 glyphosate resistance genes include: mutant EPSPS genes, such as 2mEPSPS genes, cp4 EPSPS genes, mEPSPS genes, dgt-28 genes; aroA genes; and glyphosate degradation genes, such as glyphosate acetyltransferase (gat) genes and glyphosate oxidase (gox) genes. These traits are currently marketed as Gly-Tol™, Optimum® GAT®, Agrisure® GT, and Roundup Ready®. Resistance genes to glufosinate and / or bialaphos compounds include dsm-2, bar, and pat genes. The bar and pat traits are currently marketed as LibertyLink®. Also included are tolerance genes that provide resistance to 2,4-D genes, such as aad-1 genes (it should be noted that aad-1 genes also have activity against arloxyphenoxypropionate herbicides) and aad-12 genes (it should be noted that aad-12 genes also have activity against pyidyloxyacetate synthetic auxins). These traits are marketed as Enlist® crop protection technology.Resistance genes for ALS inhibitors (sulfonylureas, imidazolinones, triazolopyrimidines, pyrimidinylthiobenzoates, and sulfonylaminocarbonyltriazolinones) are known in the art. These resistance genes most commonly result from point mutations to the ALS-encoding gene sequence. Other ALS inhibitor resistance genes include hra genes, csr1-2 genes, Sr-HrA genes, and surB genes. Some of the traits are marketed under the trade name Clearfield®. Herbicides that inhibit HPPD include pyrazolones such as pyrazoxifene, benzophenone, and topramezone; triketones such as mesotrione, sulcotrione, tembotrione, benzobicyclone; and diketonitriles such as isoxaflutol. These example HPPD herbicides may be tolerated by known traits. Examples of HPPD inhibitors include the hppdPF_W336 gene (for isoxaflutol resistance) and the avhppd-03 gene (for meostrione resistance).An example of traits tolerant to the herbicide oxinil includes the bxn gene, which has been shown to express resistance to the herbicide / antibiotic. Petition 870260049160, dated 05 / 22 / 2026, page 86 / 151 75 / 128 bromoxynil. Resistance genes for dicamba include the dicamba monooxygenase (dmo) gene, as disclosed in International PCT Application No. WO 2008 / 105890. Resistance genes for PPO- or PROTOX-type herbicides (e.g., acifluorfen, butafenacil, flupropazil, pentoxazone, carfentrazone, fluazolate, piraflufen, aclonifen, azafenidine, flumioxazin, flumiclorac, bifenox, oxyfluorfen, lactofen, fomesafen, fluoroglycofen, and sulfentrazone) are known in the art. Exemplary genes that confer PPO resistance include overexpression of a wild-type Arabidopsis thaliana PPO enzyme (Lermontova I and Grimm B, (2000) Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance to the diphenyl-ether herbicide acifluorfen. Plant Physiol 122:75-83.), the B. subtilis PPO gene (Li, X. and Nicholl D. 2005. Development of PPO inhibitor-resistant cultures and crops. Pest Manag. Sci.61: 277-285 and Choi KW, Han O, Lee HJ, Yun YC, Moon YH, Kim MK, Kuk YI, Han SU and Guh JO, (1998) Generation of resistance to diphenyl ether, oxyfluorfen weed via Bacillus subtilis protoporphyrinogen oxidase gene expression in transgenic tobacco plants. Biosci Biotechnol Biochem 62: 558-560.) Resistance genes for pyridinoxy or phenoxy propionic acids and cyclohexones include ACCase inhibitor-coding genes (e.g., Acc1-S1, Acc1-S2, and Acc1-S3). Exemplary genes conferring resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid include haloxifop, diclofop, fenoxyprop, fluazifop, and quizalofop. Finally, herbicides that inhibit photosynthesis, including triazine or benzonitrile, are conferred with tolerance by psbA genes (triazine tolerance), 1s+ genes (triazine tolerance), and nitrilase genes (benzonitrile tolerance). The above list of herbicide tolerance genes is not intended to be exhaustive.Any herbicide tolerance genes are covered by this disclosure. Petition 870260049160, dated 05 / 22 / 2026, page 87 / 151 76 / 128 3. Agronomic Traits

[00122] Several agronomic trait genes can be functionally linked to the GmPSID2 promoter comprising SEQ ID No: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 2. In addition, insect resistance genes can be functionally linked to the 5' UTR of GmPSID2 comprising SEQ ID No: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 3. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No.:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No.:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:5.Functionally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary agronomic trait coding sequences are known in the art. As examples of agronomic trait coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following traits are provided. Delayed fruit softening, as provided by the pg genes, inhibits the production of the polygalacturonase enzyme responsible for breaking down pectin molecules in the cell wall and thus causes delayed fruit softening. Furthermore, delayed fruit ripening / senescence, as provided by the acc gene, acts to suppress the normal expression of the native acc synthase gene, resulting in reduced ethylene production and delayed fruit ripening.While the accd genes metabolize the ethylene precursor of the ripening hormone. Petition 870260049160, dated 05 / 22 / 2026, page 88 / 151 77 / 128 fruit, resulting in delayed fruit ripening. Alternatively, sam-k genes cause delayed ripening by reducing S-adenosylmethionine (SAM), a substrate for ethylene production. Water stress tolerance phenotypes, as provided by cspB genes, maintain normal cellular functions under water stress conditions, preserving RNA stability and translation. Another example includes EcBetA genes that catalyze the production of the osmoprotective compound glycine betaine, conferring water stress tolerance. Additionally, RmBetA genes catalyze the production of the osmoprotective compound glycine betaine, conferring water stress tolerance. Photosynthesis and yield enhancement are provided by the bbx32 gene, which expresses a protein that interacts with one or more endogenous transcription factors to regulate the plant's diurnal / nocturnal physiological processes.Ethanol production can be increased by expression of the amy797E genes, which encode a thermostable alpha-amylase enzyme that enhances bioethanol production by increasing the thermostability of amylase used in starch degradation. Finally, modified amino acid compositions can result from the expression of the cordapA genes, which encode a dihydrodipicolinate synthase enzyme that increases the production of the amino acid lysine. The above list of agronomic trait coding sequences is not intended to be exhaustive. Any agronomic trait coding sequence is covered by this disclosure. 4. DNA-Binding Proteins

[00123] Several heterologous coding sequences / genes of heterologous coding sequences / transgenes of DNA linkage can be functionally linked to the GmPSID2 promoter comprising SEQ ID No: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 2. Furthermore, the Petition 870260049160, dated 05 / 22 / 2026, p. 89 / 151 78 / 128 insect resistance genes can be functionally linked to the 5' UTR of GmPSID2 comprising SEQ ID No:3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No:3. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No. 4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No. 4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No. 5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No. 5. The functionally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Exemplary DNA-binding protein coding sequences are known in the art.As examples of DNA-binding protein coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following types of DNA-binding proteins may include: Zinc Fingers, TALENS, CRISPRs, and meganucleases. The above list of DNA-binding protein coding sequences is not intended to be exhaustive. Any DNA-binding protein coding sequences are covered by the present disclosure. 5. Small RNA

[00124] Several small RNA sequences can be functionally linked to the GmPSID2 promoter comprising SEQ ID No. 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No. 2. Furthermore, insect resistance genes can be functionally linked to the 5' UTR of GmPSID2 comprising SEQ ID No. 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No. 3. Petition 870260049160, dated 05 / 22 / 2026, p. 90 / 151 79 / 128 Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No.:4, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No.:5, or a sequence having 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:5. The functionally linked sequences can then be incorporated into a chosen vector to enable identification and selection of transformed plants (transformants). Exemplary small RNA traces are known in the art. As embodiments of small RNA coding sequences that can be functionally linked to the regulatory elements of the present disclosure, the following traces are provided.For example, delayed fruit ripening / senescence of the small RNA antiefe delays ripening by suppressing ethylene production through silencing the ACO gene that encodes an ethylene-forming enzyme. Altered lignin production of the small RNA ccomt reduces guanacyl (G) lignin content by inhibiting endogenous S-adenosyl-L-methionine: trans-caffeoyl CoA 3-O-methyltransferase (CCOMT gene). Furthermore, Black Spot Wound Tolerance in Solanum verrucosum can be reduced by the small RNA Ppo5 which triggers the degradation of Ppo5 transcripts to block black spot wound development. Also included is the small RNA dvsnf7 which inhibits Western Maize Root System Chrysomelid with dsRNA containing a 240 bp fragment of the Western Maize Root System Chrysomelid gene Snf7.Modified starch / carbohydrates can result from small RNA, such as pPhL small RNA (degrades PhL transcripts to limit the formation of reducing sugars through starch degradation). Petition 870260049160, dated 05 / 22 / 2026, p. 91 / 151 80 / 128 Small RNA pR1 (degrades R1 transcripts to limit the formation of reducing sugars through starch degradation). Additionally, benefits such as reduced acrylamide resulting from small RNA asn1 triggering Asn1 degradation to impair asparagine formation and reduce polyacrylamide. Finally, the non-browning phenotype of small RNA pgas suppressing ppo results in PPO suppression to produce apples with a non-browning phenotype. The above list of small RNAs is not intended to be exhaustive. Any small RNA coding sequences are covered by this disclosure. 6. Selectable Markers

[00125] Several selectable markers also described as reporter genes can be functionally linked to the GmPSID2 promoter comprising SEQ ID No: 2, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 2. In addition, insect resistance genes can be functionally linked to the 5' UTR of GmPSID2 comprising SEQ ID No: 3, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No: 3. Similarly, insect resistance genes can be functionally linked to the 3' UTR of GmPSID2 comprising SEQ ID No.:4, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:4. Furthermore, insect resistance genes can be functionally linked to the GmPSID2 terminator comprising SEQ ID No.:5, or a sequence that has 80, 85, 90, 95, or 99% sequence identity with SEQ ID No.:5.Functionally linked sequences can then be incorporated into a chosen vector to allow identification and selection of transformed plants (transformants). Many methods are available to confirm the expression of selectable markers in transformed plants. Petition 870260049160, dated 05 / 22 / 2026, page 92 / 151 81 / 128 including, for example, DNA sequencing and PCR (polymerase chain reaction), Southern blotting, RNA blotting, immunological methods for detecting an expressed vector protein. But, normally reporter genes are observed through visual observation of proteins that, when expressed, produce a colored product. Exemplary reporter genes are known in the art and encode β-glucuronidase (GUS), luciferase, green fluorescent protein (GFP), yellow fluorescent protein (YFP, Phi-YFP), red fluorescent protein (DsRFP, RFP, etc.), β-galactosidase, and the like (See Sambrook, et al., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Press, NY, 2001, the content of which is incorporated into this document by reference in its entirety).

[00126] Selectable marker genes are used for the selection of transformed cells or tissues. Selectable marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO), spectinomycin / streptionomycin (AAD) resistance, and hygromycin phosphotransferase (HPT or HGR), as well as genes conferring resistance to herbicide compounds. Herbicide resistance genes generally encode for a modified target protein insensitive to the herbicide or for an enzyme that degrades or detoxifies the herbicide in the plant before it can act. For example, glyphosate resistance has been obtained using genes encoding mutant target enzymes, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Genes and mutants for EPSPS are well known, and further described below.Resistance to glufosinate ammonium, bromoxynil, and 2,4-dichlorophenoxyacetate (2,4-D) has been achieved using bacterial genes encoding PAT or DSM-2, a nitrilase, an AAD-1, or an AAD-12, each of which are examples of... Petition 870260049160, dated 05 / 22 / 2026, page 93 / 151 82 / 128 proteins that detoxify their respective herbicides.

[00127] In one embodiment, herbicides can inhibit the growth point or meristem, including imidazolinone or sulfonylurea, and genes for acetohydroxyacid synthase (AHAS) and acetolactate synthase (ALS) resistance / tolerance to these herbicides are well known. Glyphosate resistance genes include mutant 5-enolpyruvylshikimate-3-phosphate synthase (EPSP) and dgt-28 genes (through the introduction of recombinant nucleic acids and / or various forms of in vivo mutagenesis of native EPSP genes), aroA genes, and glyphosate acetyltransferase (GAT) genes, respectively. Resistance genes for other phosphono compounds include bar and pat genes from Streptomyces species, including Streptomyces hygroscopicus and Streptomyces viridichromogenes, and pyridinoxy or phenoxypropionic acids and cyclohexones (ACCase inhibitor encoding genes).Exemplary genes conferring resistance to cyclohexanediones and / or aryloxyphenoxypropanoic acid (including haloxyfop, diclofop, phenoxyprop, fluazifop, quizalofop) include acetyl coenzyme A carboxylase (ACCase) genes; Acc1-S1, Acc1-S2, and Acc1-S3. In one embodiment, herbicides can inhibit photosynthesis, including triazine (psbA and 1s+ genes) or benzonitrile (nitrilase gene). Furthermore, such selectable markers may include positively selected markers such as phosphomannose isomerase (PMI) enzyme.

[00128] In one embodiment, selectable marker genes include, but are not limited to, genes encoding: 2,4-D; neomycin phosphotransferase II; cyanamide hydratase; aspartate kinase; dihydrodipicolinate synthase; tryptophan decarboxylase; desensitized dihydrodipicolinate synthase and aspartate kinase; bar gene; tryptophan decarboxylase; neomycin phosphotransferase (NEO); hygromycin phosphotransferase (HPT or HYG); dihydrofolate reductase (DHFR); phosphinothricin acetyltransferase; 2,2-dichloropropionic acid of Petition 870260049160, dated 05 / 22 / 2026, page 94 / 151 83 / 128 halogenase; acetohydroxyacid synthase; 5-enolpyruvylshikimate-phosphate synthase (aroA); haloarylnitrilase; acetylcoenzyme A carboxylase; dihydropteroate synthase (sul I); and photosystem II 32 kD polypeptide (psbA). One embodiment also includes selectable marker genes encoding resistance to: chloramphenicol; methotrexate; hygromycin; spectinomycin; bromoxynil; glyphosate; and phosphinothricin. The above list of selectable marker genes is not intended to be limiting. Any selectable marker or reporter gene is covered by this disclosure.

[00129] In some embodiments, coding sequences are synthesized for optimal expression in a plant. For example, in one embodiment, a gene's coding sequence has been modified by codon optimization to enhance expression in plants. An insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, or a selectable marker heterologous coding sequence transgene can be optimized for expression in a particular plant species or, alternatively, can be modified for optimal expression in dicotyledonous or monocotyledonous plants. Plant-preferred codons can be determined from the highest frequency codons in the proteins expressed in the greatest quantity in the particular plant species of interest.In one embodiment, a coding sequence, gene, heterologous coding sequence, or transgene / heterologous coding sequence is designed to be expressed in plants at a higher level, resulting in greater transformation efficiency. Methods for plant gene optimization are well known. Guidance related to the optimization and production of synthetic DNA sequences can be found, for example. Petition 870260049160, dated 05 / 22 / 2026, page 95 / 151 84 / 128 example, in documents WO2013016546, WO2011146524, WO1997013402, U.S. Patent No. 6166302, and U.S. Patent No. 5380831, are incorporated herein by reference. Transformation

[00130] Suitable methods for plant transformation include any method by which DNA can be introduced into a cell, for example and without limitation: electroporation (see, for example, U.S. Patent 5,384,253); microprojectile bombardment (see, for example, U.S. Patents 5,015,580, 5,550,318, 5,538,880, 6,160,208, 6,399,861 and 6,403,865); transformation mediated by Agrobacterium (see, for example, U.S. Patents 5,635,055, 5,824,877, 5,591,616; 5,981,840, and 6,384,301); and protoplast transformation (see, for example, U.S. Patent 5,508,184).

[00131] A DNA construct can be introduced directly into the genomic DNA of the plant cell using techniques such as agitation with silicon carbide fibers (see, for example, U.S. Patents 5,302,523 and 5,464,765), or DNA constructs can be introduced directly into plant tissue using biolistic methods such as DNA particle bombardment (see, for example, Klein et al. (1987) Nature 327:70-73). Alternatively, the DNA construct can be introduced into the plant cell by means of nanoparticle transformation (see, for example, U.S. Patent Application No. 20090104700, which is incorporated herein by reference in its entirety).

[00132] Furthermore, gene transfer can be achieved using non-Agrobacterium bacteria or viruses, such as Rhizobium sp. NGR234, Sinorhizobium meliloti, Mesorhizobium loti, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus and / or tobacco mosaic virus. See, for example, Chung et al. (2006) Trends Petition 870260049160, dated 05 / 22 / 2026, page 96 / 151 85 / 128 Plant Sci. 11(1):1-4.

[00133] Through the application of transformation techniques, cells of virtually any plant species can be stably transformed, and these cells can be developed into transgenic plants by well-known techniques. For example, techniques that may be particularly useful in the context of cotton transformation are described in U.S. Patent Nos. 5,846,797, 5,159,135, 5,004,863 and 6,624,344; techniques for transforming Brassica plants, in particular, are described, for example, in U.S. Patent 5,750,871; techniques for transforming soybean grains are described, for example, in U.S. Patent 6,384,301; and techniques for transforming Zea mays are described, for example, in U.S. Patents 7,060,876 and 5,591,616, and International Application PCT WO 95 / 06722.

[00134] After effective delivery of an exogenous nucleic acid to a recipient cell, a transformed cell is usually identified for further culture and plant regeneration. In order to enhance the ability to identify transformants, it may be desirable to employ a selectable marker gene with the transformation vector used to generate the transformation. In an illustrative embodiment, a population of transformed cells can be examined by exposing the cells to a selective agent or agents, or the cells can be analyzed for the desired marker gene trait.

[00135] Cells that survive exposure to a selective agent, or cells that have been classified as positive in an assay, can be grown in media that support plant regeneration. In one embodiment, any suitable plant tissue culture medium can be modified by including additional substances, such as growth regulators. The tissue can be maintained in a basic medium with growth regulators until sufficient tissue is available to initiate regeneration efforts. Petition 870260049160, dated 05 / 22 / 2026, page 97 / 151 86 / 128 plants, or after repeated cycles of manual selection, until the tissue morphology is suitable for regeneration (e.g., at least two weeks), are then transferred to conducting media for shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots have formed, they are transferred to conducting media for root formation. Once sufficient roots have formed, plants can be transferred to soil for further growth and maturation. Molecular Confirmation

[00136] A transformed plant cell, callus, tissue, or plant can be identified and isolated by selecting or analyzing the genetically modified plant material for traits encoded by the marker genes present in the DNA transformation. For example, selection can be performed by growing the genetically modified plant material in media containing an inhibitory amount of the antibiotic or herbicide to which the transformation gene construct confers resistance. Furthermore, transformed plants and plant cells can also be identified by analyzing the activities of any visible marker genes (e.g., β-glucuronidase, luciferase, or green fluorescent protein genes) that may be present in the recombinant nucleic acid constructs. Such selection and analysis methodologies are well known to those skilled in the art.The molecular confirmation methods that can be used to identify transgenic plants are known to those skilled in the art. Several illustrative methods are further described below.

[00137] Molecular beacons have been described for use in sequence detection. Briefly, a FRET oligonucleotide probe is designed, which overlaps the insertion DNA and flanking genomics junction. The unique structure of the FRET probe Petition 870260049160, dated 05 / 22 / 2026, page 98 / 151 The 87 / 128 design results in the probe containing a secondary structure that keeps the chemically cooled and fluorescent portions in close proximity. The FRET probe and PCR primers (one primer on the insert DNA sequence and one on the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. After successful PCR amplification, hybridization of the FRET probe(s) to the target sequence results in the removal of the probe's secondary structure and spatial separation of the chemically cooled and fluorescent portions. A fluorescent signal indicates the presence of the flanking genomic / transgene insert sequence due to successful amplification and hybridization. Such a molecular signaling assay for detecting an amplification reaction is an embodiment of the present disclosure.

[00138] The hydrolysis probe assay, otherwise known as TAQMAN® (Life Technologies, Foster City, Calif.), is a method for detecting and quantifying the presence of a DNA sequence. Briefly, a FRET oligonucleotide probe is designed with one oligo within the transgene / heterologous coding sequence and one in the flanking genomic sequence for event-specific detection. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of the fluorescent chemical portion in the opposite direction of the cold chemical portion in the FRET probe. A fluorescent signal indicates the presence of the transgene / flanking insert sequence due to successful amplification and hybridization.Such a hydrolysis probe assay for detecting how an amplification reaction occurs is one embodiment of the present disclosure. Petition 870260049160, dated 05 / 22 / 2026, p. 99 / 151 88 / 128

[00139] KASPar® assays are a method of detecting and quantifying the presence of a DNA sequence. Briefly, the genomic DNA sample comprising the integrated gene expression cassette polynucleotide is analyzed using a polymerase chain reaction (PCR)-based assay known as a KASPar® assay system. The KASPar® assay used in the practice of the present disclosure may utilize a KASPar® PCR assay mixture containing multiple primers. The primers used in the PCR assay mixture may comprise at least one forward primer and at least one reverse primer. The forward primer contains a sequence that corresponds to a specific region of the DNA polynucleotide, and the reverse primer contains a sequence that corresponds to a specific region of the genomic sequence. Furthermore, the primers used in the PCR assay mixture may comprise at least one forward primer and at least one reverse primer.For example, the KASPar® PCR assay mixture can use two advanced primers that correspond to two different alleles and a reverse primer. One of the advanced primers contains a sequence that corresponds to a specific region of the endogenous genomic sequence. The second advanced primer contains a sequence that corresponds to a specific region of the DNA polynucleotide. The reverse primer contains a sequence that corresponds to a specific region of the genomic sequence. Such a KASPar® assay for detecting an amplification reaction is an embodiment of the present disclosure.

[00140] In some embodiments, the fluorescent signal or fluorescent dye is selected from the group consisting of a dye. fluorescent HEX, a fluorescent dye FAM, a fluorescent dye JOE, a fluorescent dye TET, a fluorescent dye Cy 3, a fluorescent dye Cy 3.5, a dye Petition 870260049160, dated 05 / 22 / 2026, pp. 100 / 151 89 / 128 fluorescent Cy 5, a fluorescent dye Cy 5.5, a fluorescent dye Cy 7 and a fluorescent dye ROX.

[00141] In other embodiments, the amplification reaction is performed using suitable secondary fluorescent DNA dyes that have the ability to stain cellular DNA in a concentration range detectable by flow cytometry, and have a fluorescent emission spectrum that is detectable by real-time thermal cycling. It should be noted by those of common skill in the art that other nucleic acid dyes are known and are continually being identified. Any suitable nucleic acid dye with appropriate excitation and emission spectra may be employed, such as YO-PRO-1®, SYTOX Green®, SYBR Green I®, SYTO11®, SYTO12®, SYTO13®, BOBO®, YOYO®, and TOTO®. In one embodiment, a second fluorescent DNA dye is used in SYTO13® at less than 10 μM, less than 4 μM, or less than 2.7 μM.

[00142] In additional modalities, Next-Generation Sequencing (NGS) can be used for detection. As described by Brautigma et al., 2010, DNA sequence analysis can be used to determine the nucleotide sequence of the isolated and amplified fragment. The amplified fragments can be isolated and subcloned into a vector and sequenced using a chain terminator method (also called Sanger sequencing) or dye terminator sequencing. Furthermore, the amplicon can be sequenced with Next-Generation Sequencing. NGS technologies do not require the subcloning step, and multiple sequencing reads can be completed in a single reaction. Three NGS platforms are commercially available: the Genome Sequencer FLX™ available from 454 Life Sciences Roche, the Illumina Genome Analyser™ available from Solexa, and SOLiD™ from Applied Biosystems (acronym for: Petition 870260049160, dated 05 / 22 / 2026, pp. 101 / 151 90 / 128 Oligo-Linkage Sequencing and Detection). In addition, there are two single-molecule sequencing methods currently under development. These include true Single Molecule Sequencing (tSMS) available from Helicos Bioscience™ and Single Molecule Real-Time Sequencing™ (SMRT) available from Pacific Biosciences.

[00143] The FLX™ Genome Sequencer, marketed by 454 Life Sciences / Roche, is a long-read NGS that uses emulsion PCR and pyrosequencing to generate sequencing reads. DNA fragments of 300 to 800 bp or libraries containing fragments of 3 to 20 kb can be used. The reactions can produce over one million reads of approximately 250 to 400 bases per run for a total throughput of 250 to 400 megabases. This technology produces the longest reads, but the total sequence output per run is low compared to other NGS technologies.

[00144] The Illumina Genome Analyzer™, marketed by Solexa™, is a short-read NGS that uses a synthesis-based sequencing approach with reversibly terminating nucleotides identified by fluorescent dye and is based on solid-phase bridge PCR. Paired-end sequencing libraries containing DNA fragments up to 10 kb can be constructed. The reactions produce over 100 million short reads that are 35 to 76 bases in length. This data can yield 3 to 6 gigabases per run.

[00145] The Oligo-Linked Sequencing and Detection (SOLiD) system marketed by Applied Biosystems™ is a short-read technology. This NGS technology uses fragmented double-stranded DNA that is up to 10 kb in length. The system uses oligonucleotide primer ligation sequencing. Petition 870260049160, dated 05 / 22 / 2026, pp. 102 / 151 91 / 128 identified by dye and emulsion PCR to generate one billion short reads that can result in a total sequence output of up to 30 gigabases per run.

[00146] Helicos Bioscience™ tSMS and Pacific Biosciences™ SMRT employ a different approach that uses single DNA molecules for sequencing reactions. The Helicos™ tSMS system produces up to 800 million short reads that can result in 21 gigabases per run. These reactions are completed using virtual terminator nucleotides identified with fluorescent dye, which is described as a sequencing-by-synthesis approach.

[00147] The SMRT Next Generation Sequencing system marketed by Pacific Biosciences™ uses real-time synthesis sequencing. This technology can produce reads up to 1,000 base pairs in length as a result of not being limited by reversible terminators. The gross read throughput equivalent to covering one fold of a diploid human genome can be produced per day using this technology.

[00148] In another embodiment, detection can be completed using blotting assays, including Western blots, Northern blots, and Southern blots. Such blotting assays are techniques commonly used in biological research for the identification and quantification of biological samples. These assays involve, first, separating the sample components in gels by electrophoresis, followed by electrophoretic transfer of the separated components from the gels to transfer membranes that are produced from materials such as nitrocellulose, polyvinylidene fluoride (PVDF), or nylon. Analytes can also be directly stained onto these supports or targeted to specific regions on the supports by applying vacuum, capillary action, or pressure, without separation. Petition 870260049160, dated 05 / 22 / 2026, pp. 103 / 151 92 / 128 previous. Transfer membranes are then commonly subjected to post-transfer treatment to improve the ability of analytes to be distinguished from one another and detected, either visually or by automated readers.

[00149] In an additional embodiment, detection can be completed using an ELISA assay, which uses a solid-phase enzyme immunoassay to detect the presence of a substance, usually an antigen, in a liquid or wet sample. The sample antigens are fixed to a plate surface. Then, an additional specific antibody is applied to the surface so that it can bind to the antigen. This antibody is linked to an enzyme, and in the final step, a substance containing the enzyme substrate is added. The subsequent reaction produces a detectable signal, most commonly a color change in the substrate. Transgenic Plants

[00150] In one embodiment, a plant, plant tissue, or plant cell comprises a GmPSID2 promoter. In one embodiment, a plant, plant tissue, or plant cell comprises the GmPSID2 promoter of a sequence selected from SEQ ID No:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:2. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID No:2, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:2 that is functionally linked to a non-GmPSID2 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmPSID2 promoter that is functionally linked to a transgene or Petition 870260049160, dated 05 / 22 / 2026, pp. 104 / 151 93 / 128 heterologous coding sequence, wherein the transgene or heterologous coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00151] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a GmPSID2-derived promoter sequence functionally linked to a transgene, wherein the GmPSID2-derived promoter sequence comprises a SEQ ID No: 2 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No: 2. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID No: 2, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No: 2 functionally linked to a non-GmPSID2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID No. 2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No. 2 functionally linked to a non-GmPSID2 gene. In one embodiment, a. Petition 870260049160, dated 05 / 22 / 2026, pp. 105 / 151 94 / 128 plant, plant tissue, or plant cell comprises a promoter functionally linked to a heterologous transgene / coding sequence, wherein the promoter consists of SEQ ID No: 2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No: 2. According to one embodiment, the gene construct comprising a GmPSID2 promoter sequence functionally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell.

[00152] In one embodiment, a plant, plant tissue, or plant cell comprises a 5' UTR of GmPSID2. In one embodiment, a plant, plant tissue, or plant cell comprises the 5' UTR of GmPSID2 of a sequence selected from SEQ ID No:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:3. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID No:3, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:3 that is functionally linked to a non-GmPSID2 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 5' UTR of GmPSID2 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof. Petition 870260049160, dated 05 / 22 / 2026, pp. 106 / 151 95 / 128

[00153] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a 5' UTR-derived sequence of GmPSID2 functionally linked to a transgene, wherein the 5' UTR-derived sequence of GmPSID2 comprises a SEQ ID No:3 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:3. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID No:3, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:3 functionally linked to a non-GmPSID2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybeans, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybeans (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID No. 3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No. 3 functionally linked to a non-GmPSID2 gene. In one embodiment, the plant, plant tissue, or plant cell comprises a 5' UTR functionally linked to a heterologous transgene / coding sequence, wherein the 5' UTR consists of SEQ ID No:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:3.According to one embodiment, the gene construct comprising a 5' UTR sequence of GmPSID2 functionally linked to a heterologous transgene / coding sequence is... Petition 870260049160, dated 05 / 22 / 2026, pp. 107 / 151 96 / 128 incorporated into the genome of the plant, plant tissue, or plant cell.

[00154] In one embodiment, a plant, plant tissue, or plant cell comprises a 3' UTR of GmPSID2. In one embodiment, a plant, plant tissue, or plant cell comprises the 3' UTR of GmPSID2 of a sequence selected from SEQ ID No:4, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:4. In one embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID No. 4, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No. 4 that is functionally linked to a non-GmPSID2 gene.In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a 3' UTR of GmPSID2 that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00155] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a 3' UTR-derived sequence of GmPSID2 functionally linked to a transgene, wherein the 3' UTR-derived sequence of GmPSID2 comprises a SEQ ID No:4 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:4. In one embodiment, a plant, plant tissue, or plant cell is provided, Petition 870260049160, dated 05 / 22 / 2026, pp. 108 / 151 97 / 128 wherein the plant, plant tissue, or plant cell comprises SEQ ID No:4, or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:4 functionally linked to a non-GmPSID2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant. In one embodiment, the plant is selected from the group consisting of Zea mays, wheat, rice, sorghum, oats, rye, bananas, sugarcane, soybean, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybean (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID No:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:4 functionally linked to a non-GmPSID2 gene.In one embodiment, the plant, plant tissue, or plant cell comprises a 3' UTR functionally linked to a heterologous transgene / coding sequence, wherein the 3' UTR consists of SEQ ID No:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:4. According to one embodiment, the gene construct comprising the 3' UTR sequence of the GmPSID2 gene functionally linked to a heterologous transgene / coding sequence is incorporated into the genome of the plant, plant tissue, or plant cell.

[00156] In one embodiment, a plant, plant tissue, or plant cell comprises a GmPSID2 terminator. In one embodiment, a plant, plant tissue, or plant cell comprises the GmPSID2 terminator of a sequence selected from SEQ ID No:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:5.In one form, a plant, plant tissue, or... Petition 870260049160, dated 05 / 22 / 2026, pp. 109 / 151 98 / 128 plant cell comprises a gene expression cassette comprising a sequence selected from SEQ ID No:5, or a sequence that has 80%, 85%, 90%, 95% or 99.5% sequence identity with a sequence selected from SEQ ID No:5 that is functionally linked to a non-GmPSID2 gene. In an illustrative embodiment, a plant, plant tissue, or plant cell comprises a gene expression cassette comprising a GmPSID2 terminator that is functionally linked to a transgene, wherein the heterologous transgene / coding sequence may be an insecticide resistance transgene, a herbicide tolerance transgene, a nitrogen use efficiency transgene, a water use efficiency transgene, a nutritional quality transgene, a DNA linkage transgene, a selectable marker transgene, or combinations thereof.

[00157] According to one embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises a GmPSID2 terminator-derived sequence functionally linked to a transgene, wherein the GmPSID2 terminator-derived sequence comprises a SEQ ID No:5 sequence or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:5. In another embodiment, a plant, plant tissue, or plant cell is provided, wherein the plant, plant tissue, or plant cell comprises SEQ ID No:5, or the sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No:5 functionally linked to a non-GmPSID2 gene. In one embodiment, the plant, plant tissue, or plant cell is a dicotyledonous or monocotyledonous plant or a cell or tissue derived from a dicotyledonous or monocotyledonous plant.In one variant, the plant is selected from the group consisting of Zea mays, wheat, rice, etc. Petition 870260049160, dated 05 / 22 / 2026, pp. 110 / 151 99 / 128 sorghum, oats, rye, banana, sugarcane, soybean, cotton, sunflower, and canola. In one embodiment, the plant is Zea mays. In another embodiment, the plant is soybean (e.g., Glycine max). According to one embodiment, the plant, plant tissue, or plant cell comprises SEQ ID No. 5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No. 5 functionally linked to a non-GmPSID2 gene. In another embodiment, the plant, plant tissue, or plant cell comprises a terminator functionally linked to a heterologous transgene / coding sequence, wherein the terminator consists of SEQ ID No. 5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with SEQ ID No. 5. According to one embodiment, the gene construct comprising a GmPSID2 gene terminator sequence functionally linked to a heterologous transgene / coding sequence is incorporated into the plant genome, plant tissue, or plant cell.

[00158] In one embodiment, a plant, plant tissue, or plant cell according to the methods disclosed herein may be a dicotyledonous plant. The dicotyledonous plant, plant tissue, or plant cell may, however, without limitation, be alfalfa, rapeseed, canola, Indian mustard, Ethiopian mustard, soybean, sunflower, cotton, beans, broccoli, cabbage, cauliflower, celery, cucumber, eggplant, lettuce; melon, pea, pepper, peanut, potato, pumpkin, radish, spinach, sugar beet, sunflower, tobacco, tomato, and watermelon.

[00159] An individual skilled in the art will recognize that, after the exogenous sequence has been stably incorporated into transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any one of a number of standard breeding techniques can be used, depending on the species to be crossed. Petition 870260049160, dated 05 / 22 / 2026, pp. 111 / 151 100 / 128

[00160] This disclosure also covers seeds of the transgenic plants described above, wherein the seed has the heterologous transgene / coding sequence or gene construct containing the gene regulatory elements of this disclosure. This disclosure further covers the progeny, clones, cell lines or cells of the transgenic plants described above, wherein said progeny, clone, cell line or cell has the heterologous transgene / coding sequence or gene construct containing the gene regulatory elements of this disclosure.

[00161] The present disclosure also covers the cultivation of transgenic plants described above, wherein the transgenic plant has the heterologous transgene / coding sequence or gene construct containing the gene regulatory elements of the present disclosure. Consequently, such transgenic plants can be genetically modified to, inter alia, have one or more desired transgenic traits or events containing the gene regulatory elements of the present disclosure, by being transformed with nucleic acid molecules according to the invention, and can be harvested or cultivated by any method known to those skilled in the art. Method of Expressing a Transgene

[00162] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmPSID2 promoter functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmPSID2 promoter consists of a sequence selected from SEQ ID No:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:2. In a Petition 870260049160, dated 05 / 22 / 2026, pp. 112 / 151 101 / 128 embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprising cultivating a plant comprising a GmPSID2 promoter functionally linked to at least one transgene. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprising culturing a plant tissue or plant cell comprising a GmPSID2 promoter functionally linked to at least one transgene.

[00163] In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmPSID2 promoter functionally linked to at least one transgene. In one embodiment, the GmPSID2 promoter consists of a sequence selected from SEQ ID No:2 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:2. In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmPSID2 promoter functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmPSID2 promoter functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette. Petition 870260049160, dated 05 / 22 / 2026, pp. 113 / 151 102 / 128 gene containing a GmPSID2 promoter functionally linked to at least one transgene. In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette, a GmPSID2 promoter functionally linked to at least one transgene.

[00164] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmPSID2 functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the 5' UTR of GmPSID2 consists of a sequence selected from SEQ ID No:3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:3. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 5' UTR of GmPSID2 functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprising culturing a plant tissue or plant cell comprising a 5' UTR of GmPSID2 functionally linked to at least one transgene.

[00165] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmPSID2 functionally linked to at least one transgene. In one embodiment, Petition 870260049160, dated 05 / 22 / 2026, pp. 114 / 151 103 / 128 a 5' UTR of GmPSID2 consists of a sequence selected from SEQ ID No: 3 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No: 3. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmPSID2 functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 5' UTR of GmPSID2 functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette containing a 5' UTR of GmPSID2 functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette, a 5' UTR of GmPSID2 functionally linked to at least one transgene.

[00166] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a 3' UTR of GmPSID2 functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the 3' UTR of GmPSID2 consists of a sequence selected from SEQ ID No:4 or a sequence Petition 870260049160, dated 05 / 22 / 2026, pp. 115 / 151 104 / 128 that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a selected sequence of SEQ ID No. 4. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprising cultivating a plant comprising a 3' UTR of GmPSID2 functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprising culturing a plant tissue or plant cell comprising a 3' UTR of GmPSID2 functionally linked to at least one transgene.

[00167] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmPSID2 functionally linked to at least one transgene. In one embodiment, the 3' UTR of GmPSID2 consists of a sequence selected from SEQ ID No:4 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:4. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmPSID2 functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a 3' UTR of GmPSID2 functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue. Petition 870260049160, dated 05 / 22 / 2026, pp. 116 / 151 105 / 128 or plant cell comprises performing the culture of a plant tissue or plant cell comprising a gene expression cassette containing a 3' UTR of GmPSID2 functionally linked to at least one transgene. In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant tissue or plant cell comprises performing the culture of a plant tissue or plant cell comprising a gene expression cassette, a 3' UTR of GmPSID2 functionally linked to at least one transgene.

[00168] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmPSID2 terminator functionally linked to at least one heterologous transgene / coding sequence or a polylinking sequence. In one embodiment, the GmPSID2 terminator consists of a sequence selected from SEQ ID No:5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No:5. In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a GmPSID2 terminator functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprising culturing a plant tissue or plant cell comprising a GmPSID2 terminator functionally linked to at least one transgene.

[00169] In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant comprises cultivating a plant comprising a cassette of Petition 870260049160, dated 05 / 22 / 2026, pp. 117 / 151 106 / 128 gene expression comprising a GmPSID2 terminator functionally linked to at least one transgene. In one embodiment, the GmPSID2 terminator consists of a sequence selected from SEQ ID No. 5 or a sequence that has 80%, 85%, 90%, 95%, or 99.5% sequence identity with a sequence selected from SEQ ID No. 5. In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmPSID2 terminator functionally linked to at least one transgene. In one embodiment, a method of expressing at least one transgene / heterologous coding sequence in a plant comprises cultivating a plant comprising a gene expression cassette comprising a GmPSID2 terminator functionally linked to at least one transgene.In one embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette containing a GmPSID2 terminator functionally linked to at least one transgene. In another embodiment, a method of expressing at least one heterologous transgene / coding sequence in a plant tissue or plant cell comprises culturing a plant tissue or plant cell comprising a gene expression cassette, a GmPSID2 terminator functionally linked to at least one transgene.

[00170] The following examples are provided to illustrate specific features and / or modalities. The examples should not be interpreted as limiting the disclosure to the specific features or modalities exemplified. EXAMPLES Petition 870260049160, dated 05 / 22 / 2026, pp. 118 / 151 107 / 128 Example 1: Identification of Regulatory Elements in Soybean Genomic Sequences

[00171] Total mRNA expression profiles for 25 soybean tissues (Var. Williams82) were obtained through next-generation sequencing (NGS) and used to identify candidate soybean genes as sources of regulatory elements. The included tissues were collected from young seedlings (expanded cotyledons, roots, and hypocotyls), V5 (leaves and stems), and R5 soybean plants (leaves, flowers, different stages of seed development, and pods). Endogenous soybean genes exhibiting the desired expression profile were identified as potential candidates for obtaining regulatory elements.

[00172] One of the genes with the desired expression profile was Glyma10g39460, which was preferentially expressed in green aboveground tissues. This gene was identified as the PsaD subunit of photosystem I (Apweiler, Rolf, et al. UniProt: the universal protein knowledgebase. Nucleic acids research 32.suppl_1 (2004): D115D119; available at http: / / www.uniprot.org / ), therefore, this gene was described as GmPSID2. Regulatory sequences of the GmPSID2 gene were isolated and characterized for their ability to trigger heterologous transgene / coding sequence expression. The GmPSID2 promoter is provided in this document as SEQ ID No: 1.

[00173] The regulatory sequences of the Glyma10g39460 gene (GmPSID2) were defined as a ~2 kb sequence upstream of the ATG of the Glyma10g39460 gene for the promoter and 5' untranslated leader (UTR), and ~1 kb downstream of the termination codon of the Glyma10g39460 gene for the 3' UTR and terminator. To further refine the regulatory sequences, additional analyses of the regulatory elements were completed. Regulatory sequences Petition 870260049160, dated 05 / 22 / 2026, pp. 119 / 151 Putative upstream and downstream 108 / 128 sequences were evaluated for the presence of transposable sequence marks, repressor DNA (methylation), and chromatin marks (lysine 4 dimethylation of histone 3, commonly abbreviated as H3K4me2) using methods as previously disclosed in U.S. Patent Publication No. 20150128309A1, incorporated by reference in its entirety herein. Glyma10g39460 gene DNA sequences containing repressor DNA and chromatin marks were excluded from the upstream and downstream regulatory sequences. Long stretches (100 bp or more) of AT-rich sequences (AT-rich >75%) within 5' and 3' sequences were also avoided as a means of reducing difficulties with de novo synthesis of the DNA fragments.

[00174] The resulting upstream regulatory sequence of GmPSID2 contained both a promoter (SEQ ID No.:2) and a 5' UTR (SEQ ID No.:3). Downstream sequences included a 3' UTR (SEQ ID No.:4) and a terminator (SEQ ID No.:4) of the GmPSID2 gene. The terminator sequences extended ~100-200 bp beyond the last known polyadenylation site. A single base pair change was performed on the candidate GmpSID2 promoter (SEQ ID No.:1) to reduce sequence complexity. The adenine nucleotide residue of the base pair was removed from a nine-A stretch, resulting in an eight-A stretch; located between positions 524 and 531 in the SEQ ID No.:1 promoter sequence.

[00175] The promoter / UTR 5' and terminator sequences of the GmPSID2 gene (Glyma10g39460) obtained from the soybean genome are provided in this document. Example 2: Cloning of soybean regulatory sequences

[00176] The promoter, 5' UTR, and 3' UTR / terminator sequences of the GmPSID2 gene were synthesized by DNA2.0. A diagram of the synthetic fragment is shown in Figure 1. A linker containing a Petition 870260049160, dated 05 / 22 / 2026, pp. 120 / 151 The 109 / 128 multiple cloning site was included between the promoter / UTR 5' and the UTR 3' / terminator sequence.

[00177] The synthetic GmPSID2 fragment (promoter / 5' UTR and terminator) was cloned into a Gateway entry vector, and the heterologous reporter gene / coding sequence RFP / AAD12 (SEQ ID No.: 10) was inserted between the 5' UTR and the terminator. The heterologous reporter gene / coding sequence was the double reporter encoding a translational fusion protein containing the RFP and AAD12 polypeptides linked by the rigid helical peptide linker, LAE(EAAAK)5AAA, described by Arai et al. (2001), Protein Eng, 14, 529-532 and Marqusee et al. (1987), Proc Natl Acad Sci USA, 84, 8898-8902. The resulting expression cassette (SEQ ID No.: 11) was transferred to a binary vector and named pDAB122135. This binary vector also contained the heterologous coding sequence of the green fluorescent protein (GFP) driven by the Arabidopsis Ubiquitin 3 promoter and UTR 5' (AtUbi3) and terminated by the Arabidopsis Ubiquitin 3 terminator (AtUbi3).Similarly, the binary vector containing the synthetic heterologous gene / coding sequence of Streptomyces viridochromogenes phosphinothricin N-acetyltransferase (PAT) was triggered by the promoter of cassava vein mosaic virus (CsVMV) and terminated by the Orf1 terminator of Agrobacterium tumefaciens (AtuOrf1). The gene expression / heterologous coding sequence cassettes of GFP and PAT are provided as SEQ ID No: 12.

[00178] The cloning steps for the regulatory sequences of GmAct7-2 and GmGAPC1 were similar to those described above for GmPSID2. GmAct7-2 was tested on the pDAB122133 construct and GmGAPC1 was tested on the pDAB122134 construct. Example 3: Infiltration in N. benthamiana Leaves and Tests Petition 870260049160, dated 05 / 22 / 2026, pp. 121 / 151 110 / 128 Transient Expression Triggered by GmPSID2, GmAct7-2 and GmGAPCI from Reporter RFP / AAD12

[00179] Next, L / . benthamiana plants were grown in the greenhouse under a 16-hour photoperiod, 27°C / 24°C. Plants aged 20 to 24 days were used for transient expression assays. For these, the top 3 to 4 leaves were infiltrated using a mixture of two modified strains of Agrobacterium tumefaciens. The first strain was used in all infiltrations and carried the pDAB112236 construct containing the heterologous transgene / coding sequence that expresses the P19 silencing suppressor (Voinnet et al, (1999), Proc Natl Acad Sci USA, 96, 14147-14152). The second Agrobacterium strain was either the experimental strain carrying a test construct (with the regulatory elements GmPSID2, GmAct7-2, or GmGAPCI), or reference control constructs (Table 1).Two reference constructs were used containing the heterologous reporter gene / coding sequence RFP / AAD12 under the control of the Arabidopsis thaliana Ubiquitin 14 promoter: Arabidopsis thaliana Ubiquitin 14 terminator (AtUbi14 / AtUbi14) and the Arabidopsis thaliana Ubiquitin 10 promoter: Agrobacterium tumefaciens Ubiquitin 10 Orf23 (AtUbi10 / AtuOrf23). Mixing ratios were based on Optical Density (OD) readings. The density of all Agrobacterium cultures was set to OD 2.0. After infiltration, plants were grown in a Conviron™ until infiltrated leaves were collected on the fifth day after infiltration. Fluorescence data for heterologous reporter genes / coding sequences were collected using a Typhoon™ scanner from 25 to 30 individual 1.5 cm leaf discs for each construct.

[00180] All N. benthamiana samples were scanned in three channels; chlorophyll (488 nm blue laser, 670 nm BP30, splitting at 580 nm), GFP (488 nm blue laser, 520 nm BP40, splitting at Petition 870260049160, dated 05 / 22 / 2026, pages 122 / 151 111 / 128 580 nm) and RFP (532 nm green laser, 580 nm BP30). The photomultiplier voltage (PMT) setting used for N. benthamiana was 340 for chlorophyll, 340 for GFP, and 360 for RFP.

[00181] The results of the N. benthamiana transient assay tests are shown in Table 1. Analysis of the fluorescence produced by the RFP / AAD12 reporter heterologous transgene / coding sequence revealed that the GmPSID2 regulatory sequences resulted in mean RFP fluorescence (794.1 pixels / area) that was significantly higher (p<0.0001) than the mean background fluorescence (26.1 pixels / area). It was observed that the RFP / AAD12 fluorescence of the GmPSID2 regulatory sequences was lower (p<0.0001) than the average RFP / AAD12 fluorescence of the constructs triggered by the AtUbi14 / AtUbi14 and AtUbi10 / AtuOrf23 reference regulatory elements; 7567.4 and 3084.5 pixels / area, respectively.The significantly higher-than-background expression of RFP / AAD12 fluorescence sustained by GmPSID2 regulatory elements indicated that the GmPSID2 regulatory sequences were functional and could be used to trigger the expression of a heterologous transgene / coding sequence in transient assays on N. benthamiana leaves.

[00182] In contrast to the GmPSID2 regulatory sequences that triggered significantly higher mean RFP / AAD12 fluorescence expression than the background, the GmAct2-2 and GmGAPC1 regulatory sequences contained in the pDAB122333 and pDAB122134 constructs, respectively, produced only low levels of expression that were similar to the background (Table 1). These results demonstrate that the newly isolated GmAct2-2 and GmGAPC1 candidate soybean regulatory sequences were unable to trigger the expression of the heterologous transgene / coding sequence RFP / AAD12. The absence of RFP / AAD12 expression in the constructs Petition 870260049160, dated 05 / 22 / 2026, pp. 123 / 151 112 / 128 pDAB122333 and pDAB122134 was not due to low infiltration because the second heterologous transgene / coding sequence within these constructs, GFP, exhibited strong fluorescence that was significantly higher than the background (p<0.0001). Therefore, these results show that the de novo candidate regulatory sequences of Glyma06g15520 and Glyma06g01850 were not able to trigger heterologous expression of the reporter heterologous transgene / coding sequence.

[00183] Based on these results, the pDAB122333 and pDAB122134 constructs carrying candidate regulatory sequences of GmAct7-2 and GmGAPC1, respectively, were not pursued further. In contrast, the pDAB122135 construct containing the regulatory sequences of GmPSID2 and exhibiting high levels of RFP / AAD12 fluorescence, compared to the background in N. benthamiana leaves, was pursued for further testing in stably transformed Arabidopsis transgenic plants. TABLE 1. Results of RFP / AAD12 fluorescence evaluation in transiently transformed N. benthamiana leaves. Construct Regulator Element Name Number of Samples Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error P19 only None (Background) 216.0 26.1 24.0 14.4 1.0 34.6 33.5 14.0 1.0 pDAB 117559 AtUbi14 / AtUbi14 261.0 7567.4*** 6698.4 5191.7 321.4 9770.9*** 9230.0 4609.7 285.3 pDAB 117560 AtUbi10 / AtuOrf2 3 260.0 3084.5*** 2760.0 1984.2 123.1 8915.9*** 8737.2 5404.7 335.2 pDAB 122133 GmAct7- 2 / GmAct7-2 60.0 25.3 26.4 7.0 0.9 14206.1*** 12874.3 6178.5 797.6 pDAB 122134 GmGAPC1 / GmG APC1 30.0 25.3 24.6 5.1 0.9 5295.7*** 5184.5 2085.8 380.8 pDAB 122135 GmPSID2 / GmP SID2 90.0 794.1*** 763.6 371.0 39.1 5938.5*** 5577.7 3287.4 346.5 Petition 870260049160, dated 05 / 22 / 2026, pp. 124 / 151 113 / 128

[00184] Note: ***indicates means that are significantly higher (p<0.0001) than the mean background fluorescence. Statistical analyses were conducted using non-parametric comparisons with control using Dunn's method for joint classification in the JMP® statistical package. Example 4: Agrobacterium-Mediated Transformation of Arabidopsis and Molecular Analyses of Transgenic Events

[00185] The Arabidopsis thaliana Columbia-0 (Col-0) ecotype was used to test the relative expression of the RFP / AAD12 reporter under the control of GmPSID2 regulatory elements. A standard Arabidopsis transformation procedure was used to produce transgenic seeds by the inflorescence immersion method (Clough and Bent, 1998). Ti seeds were sown in sorting trays (10.5x21x1, TO Plastics Inc., Clearwater, MN). For this, 200 mg of cold stratified seeds (0.1% agar + 385 mg / L Liberty for 48 hours before sowing) were distributed into sorting trays using a modified air-powered sprayer to distribute 10 ml of seed suspension per sorting tray. The trays were covered with moisture domes, marked with seed identifiers, and placed in a Conviron™ with an individual watering tray under each block. The humidification dome was removed approximately five days after sowing.The first watering of the selection trays was carried out using subirrigation with Hoagland fertilizer approximately 10 to 14 days after sowing. In addition to herbicide stratification, the plants were sprayed with a 0.2% solution (20 pl / 10 mL distilled H2O) of Liberty™ herbicide seven and nine days after sowing. Liberty™-resistant T1 plants were transplanted from selection trays into two-inch pots and allowed to grow for seven to ten days before collecting samples for molecular analysis. Petition 870260049160, dated 05 / 22 / 2026, pp. 125 / 151 114 / 128

[00186] Next, DNA was extracted from leaves using approximately 0.5 square centimeters of Arabidopsis leaf that was broken off from each plant. Samples were collected in a 96-well DNA extraction plate. Then 200 µl of extraction buffer were added to each well and the tissue was broken up with three mm stainless steel beads using a Kleko™ tissue sprayer (three minutes at the maximum setting). After tissue maceration, DNA was isolated using the BioSprint 96 DNA Plant Kit™.

[00187] For qPCR, the transgene copy number was assessed using a hydrolysis probe designed to detect the heterologous coding genes / sequences pat and aad12 (Table 2). The endogenous Arabidopsis gene, AtTafII15 (Arabidopsis locus: AT4G31720), was used for normalization of the DNA template concentration (Table 2). qPCR was performed as follows: 10 μl of Probes Master Mix™ with a final concentration of 0.4 μM of each primer and 0.2 μM of each probe. PCR cycles were performed using 95°C for 10 min, followed by 40 amplification cycles (95°C for 1 min, 60°C for 40 sec, and 72°C for 1 sec) and 40°C for 1 sec. All qPCR assays were performed in biplex format, with the pat or aad12 assays paired with an assay for the endogenous gene AtTafII15.The cp scores, the point at which the fluorescence signal crosses the background threshold, using the advanced relative quantification algorithm based on the AACt method (LightCycler® version 1.5 program), were used to analyze the real-time PCR data. All samples were then calibrated to a known homozygous plant to obtain the number of heterologous transgene / coding sequence copies. Up to 100 T1 events identified as Liberty™ resistant were screened to identify single- and double-copy transgene events, which were used for further analyses of heterologous transgene / coding sequence expression in T1 transgenic plants. Petition 870260049160, dated 05 / 22 / 2026, pp. 126 / 151 115 / 128 TABLE 2. Primers and probes used for genotyping and zygosity analysis of transgenic Arabidopsis plants. Nome do oligo Sequência do oligo Marcador de fluoróforo Gene alvo AtTafII15 F SEQ ID N°:13 GAGGATTAGGGTTTCAACGGAG — AtTafII15 AtTafII15 R SEQ ID N°:14 GAGAATTGAGCTGAGACGAGG — AtTafII15 Sonda de AtTafII15 SEQ ID N°:15 AGAGAAGTTTCGACGGATTTCGGGC HEX AtTafII15 Iniciador de PAT A SEQ ID N°:16 ACAAGAGTGGATTGATGATCTAGAGAGGT — PAT Iniciador de PAT S SEQ ID N°:17 CTTTGATGCCTATGTGACACGTAAACAGT — PAT Sonda de PAT_AS SEQ ID N°:18 AGGGTGTTGTGGCTGGTATTGCTTACGCT Cy5 PAT AAD12 F SEQ ID N°:19 CAGAGTCCATGCTCACCAAT — AAD12 AAD12 R SEQ ID N°:20 ACGTGGCAACTTGAAATCC — AAD12 Sonda de AAD12 SEQ ID N°:21 TGGAGATGTGGTTGTGTGGGACAA Cy5 (T1) ou FAM (T2) AAD12 Example 5: Availability of Genes Ligados of Maneira Funcional a Sequências Reguladoras de GmPSID2 em Plantas de Arabidopsis Ti

[00188] To evaluate the expression of the heterologous reporter gene / coding sequence RFP / AAD12 driven by the regulatory elements of the GmPSID2 promoter, GmPSID2 UTR 5', and GmPSID2 terminator, single-copy transgenic events were identified and evaluated for RFP / AAD12 fluorescence using the Typhoon instrument. All samples were scanned in three channels: chlorophyll (488 nm blue laser, 670 nm BP30, split at 580 nm), GFP (488 nm blue laser, 520 nm BP80, split at 580 nm), and RFP (532 nm green laser, 580 nm BP30). The PMT configuration for leaf tissue was for chlorophyll 400, GFP 400, and RFP 420. For fluorescence analyses in leaves, fully expanded rosette leaves from low-copy transgenic events (1 to 2 copies) were harvested from each plant and scanned from the adaxial (top) side.The Draw Outline function was used to define the shapes of the leaves, and normalized fluorescence was determined by signal volume division. Petition 870260049160, dated 05 / 22 / 2026, pp. 127 / 151 116 / 128 across the leaf surface. The results are shown in Table 3.

[00189] Analysis of the Ti events of RFP / AAD12 fluorescence revealed that the GmPSID2 regulatory elements sustained high mean RFP / AAD12 fluorescence (2418.8 pixels / area) that was statistically higher (p<0.0001) than the mean background fluorescence (350.5 pixels / area) detected in the non-transgenic wild-type control (Wt) (Table 3). These results show that the GmPSID2 regulatory sequences triggered high expression of the RFP / AAD12 reporter in transgenic Arabidopsis thaliana plants. The average RFP / AAD12 fluorescence produced by the GmPSID2 regulatory elements was similar to the RFP / AAD12 fluorescence levels of the reference constructs pDAB117559 (1492.3 pixels / area) and pDAB117560 (1547.6 pixels / area) (p=1.0000, not shown).In the pDAB117559 and pDAB117560 constructs, the RFP / AAD12 reporter was under the control of the following regulatory elements: Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator, and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator, respectively. Based on these results, the pDAB122135 transgenic events containing the GmPSID2 regulatory sequences were further characterized in Arabidopsis T2. TABLE 3. Results of gene expression tests of the heterologous reporter coding sequence RFP / AAD12 in leaves of transgenic Arabidopsis T1 plants. Construct Regulatory Element Number of Events Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Wt None (Fund) 57 350.5 269.3 231.4 30.7 665.2 614.1 218.0 28.9 pDAB117559 AtUbi14 / AtUbi14 60 1492.3*** 1537.3 495.2 63.9 5164.1*** 5164.7 1605.8 207.3 Petition 870260049160, dated 05 / 22 / 2026, pp. 128 / 151 117 / 128 Construct Regulatory Element Number of Events Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error pDAB1 17560 AtUbi10 / AtuOrf23 63 1547.6*** 1556.1 504.5 63.6 5521.2*** 5515.4 1434.3 180.7 pDAB122135 GmPSID2 / GmPSID2 20 2418.8*** 2008.8 918.0 205.3 8448.1*** 7215.5 3414.7 763.6

[00190] Note: ***indicates means that are significantly higher (p<0.0001) than the mean background fluorescence. Statistical analyses were conducted using non-parametric comparisons with control using Dunn's method for joint classification in the JMP® statistical package. Example 6: Expression of Genes Functionally Linked to GmPSID2 Regulatory Sequences in Arabidopsis T2 Plant Leaves

[00191] The GmPSID2 regulatory sequences exhibited similar expression levels compared to the expression levels of the reference Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator, and the Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator in Arabidopsis Ti (EXAMPLE 5). Selected events containing the GmPSID2 regulatory sequences triggering the RFP / AAD12 heterologous gene / coding sequence reporter were carried forward for further characterization in Arabidopsis T2 plants. Thus, five T1 plants expressing medium to high expression transgenic events of RFP / AAD12 and pDAB12235 GFP were selected for testing in T2 plants. Of these five events, 56 plants were grown for each event. The T2 plants were molecularly genotyped as described in EXAMPLE 4.Based on molecular analyses, all homozygous plants and a comparable number of hemizygous plants were retained for fluorescence analysis. Petition 870260049160, dated 05 / 22 / 2026, pp. 129 / 151 118 / 128 In order to simplify the interpretation of data for two-copy transgenic events, only hemizygous plants were retained for expression analyses.

[00192] Results of analyses in T2 transgenic plants are provided in Table 4. Results for homozygous (1 copy) and hemizygous (one and two copies) events containing the heterologous transgene / coding sequence RFP / AAD12 under the control of GmPSID2 regulatory elements exhibited RFP / AAD12 fluorescence that was significantly higher than the background fluorescence of non-transgenic control plants. While the average RFP / AAD12 fluorescence produced by the GmPSID2 regulatory elements was significantly higher than the background fluorescence, this fluorescence was lower than the reference pDAB117559 and pDAB117560 constructs (p<0.001, not shown).In the pDAB117559 and pDAB117560 constructs, the RFP / AAD12 reporter was under the control of the following regulatory elements: Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator, and Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator, respectively. These results demonstrate that GmPSID2 regulatory sequences support the robust expression of heterologous transgenes / coding sequences across two generations of transgenic events, and that GmPSID2 regulatory sequences support the expression of heritable transgenes. TABLE 4. Results of expression tests of the heterologous reporter gene / coding sequence RFP / AAD12 in leaves of transgenic Arabidopsis T2 plants. Construct Regulatory Elements Zygosity Number of Plants Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error Col-0 (Wt) None (background) None 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 Petition 870260049160, dated 05 / 22 / 2026, pp. 130 / 151 119 / 128 Construct Regulatory Elements Zygosity Number of Plants Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard Deviation Standard Error Mean Median Standard Deviation Standard Error hemi 26 10943.2*** 10394.5 2862.0 561.3 3352.3*** 3355.0 380.2 74.6 pDAB117559 AtUbi14 / AtUbi14 homo 40 17194.3*** 16208.0 6090.0 962.9 5649.3*** 6144.2 1509.4 238.7 hemi 25 8239.2*** 8031.3 1928.4 385.7 3436.3*** 3312.6 674.3 134.9 pDAB117560 AtUbilO / AtuOrf23 homo 50 15334.3*** 15077.5 4080.2 577.0 6308.3*** 6152.4 1385.5 195.9 GmPSID2 / GmPSID hemi 25 7748.5*** 7484.5 3517.5 703.5 3152.3*** 2817.1 706.8 141.4 pDAB122135 2 homo 19 8208.4** 7355.4 3412.6 782.9 4386.9** 4190.5 1593.9 365.7

[00193] Note: the stars indicate fluorescence averages that are significantly higher than the average background fluorescence (** p<0.01, *** p<0.0001). Statistical analyses were conducted using non-parametric comparisons with control using Dunn's method for joint classification in the JMP® statistical package.

[00194] Interrogation of individual transgenic events (Table 5) revealed that RFP / AAD12 fluorescence was detected in all single- and double-copy pDAB122135 transgenic events, indicating that GmPSID2 was consistently expressed regardless of the genomic integration site or copy number of the transgene integration. In general, homozygous GmPSID2 transgenic plants from single-copy transgenic events exhibited increased RFP / AAD12 fluorescence, indicating that heterologous transgene / coding sequence expression was copy number dependent. Hemizygous transgenic events containing double-copy transgenic events exhibited variable RFP / AAD12 fluorescence.This variation may reflect possible DNA rearrangements of the heterologous transgene / coding sequence that could affect the expression of the heterologous transgene / coding sequence in some of the copies of the heterologous transgene / coding sequence, resulting in greater variation between individual events with different potential rearrangements.

[00195] In summary, tests of Arabidopsis transgenic events Petition 870260049160, dated 05 / 22 / 2026, pp. 131 / 151 120 / 128 T2 showed that GmPSID2 regulatory elements trigger heritable expression of the RFP / AAD12 heterologous reporter gene / coding sequence in all transgenic events tested. These results reaffirm that GmPSID2 regulatory elements are highly effective in triggering heritable heterologous transgene / coding sequence expression in stably transformed Arabidopsis plants. TABLE 5. Results of expression tests of the heterologous reporter gene / coding sequence RFP / AAD12 in leaves of homozygous and hemizozygous plants of individual Arabidopsis T2 events. Construct; Regulatory elements Event Zygosity Number of plants Fluorescence RFP Fluorescence GFP Mean Median Standard deviation Standard error Mean Median Standard deviation Standard error Col-0 None (background) None 15 1137.5 1062.9 384.0 99.2 337.0 322.8 60.3 15.6 pDAB117559; AtUbi14 / AtUbi14 117559-057 hemi 5 10415.0 10400.7 9302 416.0 3529.5 3519.1 159.8 71.5 homo 8 17840.7 19158.8 3743.1 1323.4 6196.5 6607.7 1257.6 444.6 117559-062 hemi 6 9320.9 9586.9 808.9 3302 3486.9 3472.2 161.6 66.0 homo 9 14534.0 16156.6 3679.1 1226.4 5455.1 6345.2 1482.7 494.2 117559-246 hemi 5 14037.8 13650.2 11122 497.4 3351.0 3316.9 488.5 2184 homo 9 23442.5 25126.5 5547.1 1849.0 5724.0 5870.9 1573.9 524.6 11755-9314 hemi 5 13987.2 13806.8 1671.9 747.7 3411.0 3489.6 465.9 208.3 homo 4 21176.8 20884.0 7321.8 3660.9 5296.8 5217.0 2391.4 1195.7 11755-9391 hemi 5 7279.7 7364.9 922.8 412.7 29562 3020.1 350.4 156.7 homo 10 11855.0 12938.5 2711.7 857.5 5459.9 5750.6 1475.0 466.4 pDAB117560;AtUbi10 / AtuOrf23 11756-0191 hemi 5 88892 9549.1 2092.5 935.8 3831.1 4015.2 859.5 384.4 homo 10 15330.1 148640.439.496 6352.1 60302 1756.8 555.6 11756-0254 hemi 5 9158.7 8167.0 2264.3 1012.6 3611.3 3358.9 664.3 297.1 homo 101.4 149.1495 4009.6 1267.9 6283.7 6343.9 1273.8 402.8 11756-0288 hemi 5 6506.8 6287.3 948.7 424.3 3066.4 3136.1 256.9 ho 14.9 18550.4 18921.9 3158.6 998.8 7007.3 6673.1 1175.3 371.7 11756-0325 hemi 5 7716.5 6838.0 1951.7 872.8 372.36936 299.1 homo 10 14238.9 13152.0 4636.8 1466.3 6230.7 5924.0 1444.7 456.9 11756-0353 hemi 5 8924.7 8444.1 1354.20 3650 3459.6 733.6 328.1 homo 10 13848.3 13274.9 2821.9 892.4 5667.9 5782.0 1125.1 355.8 pDAB122135; GmPSID2 / GmPSI 12213-5006 (2 copy event) Hemi 5 10706.3 10578.1 771.3 344.9 2495.6 2487.4 227.5 101.7; Petition 870260049160, of 22 / 05 / 2026, p. 132 / 151 121 / 128 Construct; Regulatory elements D2 Event Zygosity Number of plants Fluorescence RFP Fluorescence GFP Mean Median Standard deviation Standard error Mean Median Standard deviation Standard error 12213-5090 (2 copy event) Hemi 5 4401.6 4216.3 586.3 262.2 2944.4 2763.3 5620 251.4 12213-5091 hemi 5 3990.3 4123.6 606.2 311.4 2636.9 2527.2 577.3 258.2 homo 9 6675.1 6904.5 1588.5 529.5 3877.4 3925.7 997.3 332.4 12213-5128 (2 copy event) hemi 5 12413.5 12724.4 1525.4 682.2 3807.8 3817.5 319.1 1427 12213-5192 hemi 5 7231.0 7484.5 596.6 266.8 3876.9 3785.7 275.9 123.4 homo 10 9588.4 8006.5 4072.1 1287.7 4845.5 4615.3 1924.5 608.6 Example 7: Production of Transgenic Soybean Plants and Estimation of the Transgene Copy Number Using TaqMan® Real-Time PCR

[00196] The regulatory elements of GmPSID2 (pDAB122135) were further tested in transgenic soybean plants. Transgenic soybean plants were produced using the split seed method described by Pareddy et al., US 2014 / 0173774 A1, incorporated by reference in its entirety herein. Transgenic seedlings were molecularly analyzed to determine the number of copies of the heterologous transgene / coding sequence. For this, leaf tissue samples from transgenic soybean plants and non-transgenic controls were collected in 96-well collection tubes. Tissue disruption was performed using 2 mm tungsten beads. After tissue maceration, genomic DNA was isolated in high-throughput format using the MagAttract Plant kit™ (Qiagen, Hilden, Germany) on the Agilent BioCel™.The number of transgenic copies of PAT was determined using a hydrolysis probe assay, analogous to the TaqMan® assay, in biplex with an internal soybean reference gene, GMS116 (GMFL01-25-J19, GenBank accession number: AK286292.1). The assays were designed using LightCycler® Probe Design Software 2.0. The presence / absence of the transgenic PAT resistance gene was determined. Petition 870260049160, dated 05 / 22 / 2026, pp. 133 / 151 Spectinomycin (SpecR) 122 / 128 was determined using a hydrolysis probe assay, analogous to the TaqMan® assay, in biplex with an internal soybean reference gene, GMS116. This assay was designed to detect the heterologous SpecR gene / coding sequence located in the main strand of the binary constructs used for transformation. Only events in which there was no amplification with the SpecR probe were regenerated, as this indicated that main strand fragments were unlikely to be present in the transgenic soybean genome. For the amplification of all genes of interest (PAT, SpecR, GMS116), LightCycler®480 Probes Master mix™ (Roche Applied Science) was prepared at a final concentration of 1x in a 10 pL multiplex reaction containing 0.4 μM of each primer and 0.2 μM of each probe (primer and probe composition shown in Table 6).A two-step amplification reaction was performed using the LIGHTCYCLER 480™ system (Roche Applied Science), with an extension at 60°C for 60 seconds with fluorescence acquisition.

[00197] Real-time PCR data analysis was performed using LightCycler® version 1.5 software using the advanced relative quantification module and was based on the / VACt method. For PAT, a known single-copy gDNA sample was included in each run and used as a single-copy calibrator. In addition, each run, for all genes of interest, included a wild-type (Maverick) sample as a negative control. TABLE 6. Primer and probe information for the hydrolysis probe assay of the PAT and SpecR genes located on the main chain and internal reference (GMS116). All sequences are indicated 5'-3'. OLIGO SEQUENCE TYPE PAT F ACAAGAGTGGATTGATGATCTAGAGA (SEQ ID N°:22) Initiator PAT R CTTTGATGCCTATGTGACAGGTAAAC (SEQ ID N°:23) Initiator Petition 870260049160, dated 05 / 22 / 2026, pp. 134 / 151 123 / 128 OLIGO SEQUENCE TYPE PAT PR 6FAM-CCAGCGTAAGCAATACCAGCCACAACACC-3BHQ_1 (SEQ ID N°:24) Hydrolysis probe SpecR F CGCCGAAGTATCGACTCAACT (SEQ ID N°:25) Initiator SpecR R GCAACGTCGGTTCGAGATG (SEQ ID N°:26) Initiator SpecR PR 6FAM-TCAGAGGTAGTTGGCGTCATCGAG-3BHQ_1 (SEQ ID N°:27) Hydrolysis probe Example 8: Evaluation of the Expression of Regulatory Sequences of GmPSID2 in Soybean Plants

[00198] The expression of genes by GmPSID2 regulatory elements was tested in transgenic soybean plants. For this analysis, stable transformations of soybean plants were generated as described in EXAMPLE 7. Transgenic seedlings carrying low transgene copy numbers (1 to 2 copies) from transformations with the GmPSID2 regulatory element construct (pDAB122135) and the reference control constructs (pDAB117559 and pDAB117560) were regenerated and transplanted into soil. After acclimation, samples were harvested from the seedlings to evaluate transgene expression in fully expanded upper leaves.To evaluate the expression of the RFP / AAD12 reporter gene triggered by the GmPSID2 5' promoter / UTR regulatory elements and the GmPSID2 terminator, transgenic leaves were screened using a Typhoon instrument in three channels: chlorophyll (488 nm blue laser, 670 nm BP30, split at 580 nm), GFP (488 nm blue laser, 520 nm BP40, split at 580 nm), and RFP (532 nm green laser, 580 nm BP30). The PMT configuration for leaf tissue was chlorophyll 400, GFP 400, and RFP 420. The fluorescence results of the RFP / AAD12 and GFP reporter genes are shown in Table 7. The expression of the heterologous reporter gene / coding sequence triggered by the GmPSID2 regulatory sequences was robust. The average RFP fluorescence specified by the GmPSID2 regulatory sequences was... Petition 870260049160, dated 05 / 22 / 2026, pp. 135 / 151 124 / 128 significantly higher (p<0.01) than the average RFP fluorescence of the regulatory control elements; the Arabidopsis thaliana Ubiquitin 14 promoter::Arabidopsis thaliana Ubiquitin 14 terminator, and the Arabidopsis thaliana Ubiquitin 10 promoter::Agrobacterium tumefaciens Orf23 terminator. These results show that GmPSID2 regulatory sequences are highly effective in triggering reporter transgene expression in transgenic soybean plants. TABLE 7. Results of gene expression tests / heterologous reporter coding sequence RFP / AAD12 in low-copy (one to two copies) T0 soybean plant leaves Construct Regulatory elements Number of events T0 Fluorescence RFP (pixels / area) Fluorescence GFP (pixels / area) Mean Median Standard deviation Standard error Mean Median Standard deviation Standard error None Maverick 7 1786.7 827.3 1869.8 706.7 950.4 961.7 287.9 ​​108.8 pDAB117559 AtUbi14 / AtUbi14 16 1862.2 1692.7 1217.7 304.4 15472.1** 13107.7 9510.4 2377.6 pDAB117560 AtUbi10 / AtuOrf23 11 2773.7 2564.2 1526.8 460.3 25416.3*** 28041.9 12475.1 3761.4 pDAB122135 GmPSID2 / GmPSID2 9 5629.6** 5539.9 2712.6 904.2 8639.1 8560.3 4973.0 1657.7

[00199] Note: the stars indicate fluorescence averages that are significantly higher than the average background fluorescence (** p<0.01, *** p<0.0001). Statistical analyses were conducted using non-parametric comparisons with control using Dunn's method for joint classification in the JMP® statistical package.

[00200] Example 9: Agrobacterium-mediated transformation of genes functionally linked to the GmPSID2 promoter, the 5' UTR of GmPSID2, the 3' UTR of GmPSID2, and / or the GmPSID2 terminator.

[00201] Soybeans can be transformed with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR, and / or the GmPSID2 terminator using the same Petition 870260049160, dated 05 / 22 / 2026, pp. 136 / 151 125 / 128 techniques described previously in Example No. 11 or Example No. 13 of patent application WO 2007 / 053482.

[00202] Cotton can be transformed with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR, and / or the GmPSID2 terminator using the same techniques previously described in Example No. 14 of U.S. Patent No. 7,838,733 or in Example No. 12 of patent application WO 2007 / 053482 (Wright et al.).

[00203] Canola can be transformed with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR, and / or the GmPSID2 terminator using the same techniques previously described in Example No. 26 of U.S. Patent No. 7,838,733 or in Example No. 22 of patent application WO 2007 / 053482 (Wright et al.).

[00204] Wheat can be transformed with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR and / or the GmPSID2 terminator using the same techniques previously described in Example No. 23 of patent application WO 2013 / 116700A1 (Lira et al.).

[00205] Rice can be transformed with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR and / or the GmPSID2 terminator using the same techniques previously described in Example No. 19 of patent application WO 2013 / 116700A1 (Lira et al.). Example 10: Agrobacterium-mediated transformation of genes functionally linked to GmPSID2 regulatory elements.

[00206] In light of the present revelation, additional crops can be transformed according to the modalities of the present revelation by using techniques that are known in the art. For Petition 870260049160, dated 05 / 22 / 2026, pp. 137 / 151 126 / 128 Agrobacterium-mediated transformation of rye, see, for example, Popelka JC, Xu J, Altpeter F., Generation of transgenic low copy number rye after biolytic gene transfer and production of instantly transgenic marker-free plants (Secale cereale L.), Transgenic Res. October 2003;12(5):587-596.). For Agrobacterium-mediated transformation of sorghum, see, for example, Zhao et al., Agrobacterium-mediated transformation of sorghum, Plant Mol Biol. December 2000;44(6):789 to 798. For Agrobacterium-mediated transformation of barley, see, for example, Tingay et al., Agrobacterium tumefaciens-mediated barley transformation, The Plant Journal, (1997) 11: 1,369 to 1,376. For Agrobacterium-mediated transformation of wheat, see, for example, Cheng et al., Genetic Transformation of Wheat Mediated by Agrobacterium tumefaciens, Plant Physiol. November 1997;115(3):971 to 980.For Agrobacterium-mediated transformation of rice, see, for example, Hiei et al., Agrobacterium tumefaciens-mediated transformation of rice, Plant Mol. Biol. September 1997;35(1-2):205-218.

[00207] The Latin names for these and other plants are given below. It should be clear that other transformation techniques (not Agrobacterium) can be used to transform genes functionally linked to the GmPSID2 promoter or to the GmPSID2 5' UTR, the GmPSID2 3' UTR and / or the GmPSID2 terminator, for example, in these and other plants. Examples include, but are not limited to; Corn (Zea mays), Wheat (Triticum spp.), Rice (Oryza spp. and Zizania spp.), Barley (Hordeum spp.), Cotton (Abroma augusta and Gossypium spp.), Soybean (Glycine max), Sugar beet and table beet (Beta spp.), Sugarcane (Arenga pinnata), Tomato (Lycopersicon esculentum and other spp., Physalis ixocarpa, Solanum incanum and other spp., and Cyphomandra betacea), Potato Petition 870260049160, dated 05 / 22 / 2026, pp. 138 / 151 127 / 128 (Solanum tuberosum), Sweet potato (Ipomoea batatas), Rye (Secale spp.), Peppers (Capsicum annuum, chinense and frutescens), Lettuce (Lactuca sativa, perennis and pulchella), Cabbage (Brassica spp.), Celery (Apium graveolens), Eggplant (Solanum melongena), Peanut (Arachis hypogea), Sorghum (Sorghum spp.), Alfalfa (Medicago sativa), Carrot (Daucus carota), Beans (Phaseolus spp. and other genera), Oats (Avena sativa and strigosa), Peas (Pisum, Vigna and Tetragonolobus spp.), Sunflower (Helianthus annuus), Pumpkin (Cucurbita spp.), Cucumber (Cucumis sativa), Tobacco (Nicotiana spp.), Arabidopsis (Arabidopsis thaliana), Grass (Lolium, Agrostis, Poa, Cynodon, and other genera), Clover (Trifolium), Vetch (Vicia). The transformation of such plants with genes functionally linked to the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR, and / or the GmPSID2 terminator, for example, is contemplated in the embodiments of the present disclosure.

[00208] The use of the GmPSID2 promoter, the GmPSID2 5' UTR, the GmPSID2 3' UTR, and / or the GmPSID2 terminator to functionally trigger linked genes can be implemented in many deciduous and evergreen wood species. Such applications are also within the scope of the modalities of this disclosure. These species include, but are not limited to, alder (Alnus spp.), ash (Fraxinus spp.), aspen and poplar species (Populus spp.), beech (Fagus spp.), birch (Betula spp.), cherry (Prunus spp.), eucalyptus (Eucalyptus spp.), walnut (Carya spp.), maple (Acer spp.), oak (Quercus spp.), and pine (Pinus spp.).

[00209] The use of GmPSID2 promoter, GmPSID2 5' UTR, GmPSID2 3' UTR and / or GmPSID2 terminator to functionally trigger linked genes can be implemented in ornamental and fruit species. Such applications are also within the scope of the modalities of this disclosure. Examples include, however Petition 870260049160, dated 05 / 22 / 2026, pp. 139 / 151 128 / 128 without limitation; rose (Rosa spp.), burning bush (Euonymus spp.), petunia (Petunia spp.), begonia (Begonia spp.), rhododendron (Rhododendron spp.), wild apple or apple (Malus spp.), pear (Pyrus spp.), peach (Prunus spp.) and marigolds (Tagetes spp.).

[00210] Although various exemplary aspects and embodiments have been discussed above, those skilled in the art will recognize certain modifications, permutations, additions, and subcombinations thereof. It is intended, therefore, that the appended claims and claims introduced hereafter be interpreted as including all such modifications, permutations, additions, and subcombinations as are within their true spirit and scope. Petition 870260049160, dated 05 / 22 / 2026, pp. 140 / 151

Claims

1 / 3 CLAIMS 1. Nucleic acid vector characterized in that it comprises a terminator operatively linked to a heterologous polynucleotide sequence, wherein said terminator comprises a polynucleotide sequence as set forth by SEQ ID NO:

5.

2. Nucleic acid vector, according to claim 1, characterized in that said terminator has a length of 897 base pairs.

3. Nucleic acid vector, according to claim 1, characterized in that said terminator is operatively linked to a heterologous coding sequence.

4. Nucleic acid vector, according to claim 3, characterized in that the heterologous coding sequence encodes a selectable marker protein, an insecticide resistance protein, a herbicide tolerance protein, a nitrogen use efficiency protein, a water use efficiency protein, a small RNA molecule, a nutritional quality protein, or a DNA-binding protein.

5. Nucleic acid vector, according to claim 1, characterized in that it further comprises a polynucleotide promoter sequence.

6. Nucleic acid vector, according to claim 1, characterized in that it further comprises an untranslated polynucleotide sequence at the 3' end.

7. Nucleic acid vector, according to Petition 870260049160, dated 05 / 22 / 2026, pp. 141 / 151 2 / 3 claim 1, characterized in that it further comprises an untranslated polynucleotide sequence at the 5' end.

8. Nucleic acid vector, according to claim 1, characterized in that it further comprises an intron sequence.

9. Nucleic acid vector, according to claim 1, characterized in that the GmPSID2 terminator acts to terminate the transcription of the heterologous polynucleotide sequence.

10. Method for producing a transgenic plant cell characterized in that the method comprises the steps of: a) transforming a plant cell with a gene expression cassette comprising a GmPSID2 terminator, wherein the polynucleotide sequence is as set out in SEQ ID NO: 5, operatively linked to at least one polynucleotide sequence of interest; b) isolating the transformed plant cell comprising the gene expression cassette; and c) producing a transgenic plant cell comprising the GmPSID2 terminator operatively linked to at least one polynucleotide sequence of interest, wherein the GmPSID2 terminator acts to terminate the transcription of the polynucleotide sequence of interest.

11. Method for expressing a polynucleotide sequence of interest in a plant cell, characterized in that it comprises introducing into the plant cell a polynucleotide sequence of interest operatively linked as set out in SEQ ID GmPSID2 to terminate the polynucleotide sequence of interest. to a GmPSID2 terminator, NO: 5, wherein the terminator transcription of the sequence Petition 870260049160, dated 22 / 05 / 2026, pages 142 / 151 3 / 3