RESTAURAÇÃO DA FERTILIDADE EM PLANTAS

Description

1 / 64 RESTORING PLANT FERTILITY Divided from BR 11 2021 004851 0, deposited on September 13, 2019. CROSS-REFERENCE TO RELATED REQUESTS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 832716, filed April 11, 2019; U.S. Provisional Patent Application No. 62 / 815261, filed March 7, 2019; and U.S. Provisional Patent Application No. 62 / 731252, filed September 14, 2018; the entire contents of each are incorporated herein by reference. FIELD

[0002] The present invention relates to the field of plant molecular biology, more particularly to an impact on male fertility. REFERENCE TO THE LIST OF SEQUENCES SUBMITTED ELECTRONICALLY

[0003] The official copy of the sequence listing is submitted electronically via EFS-Web as a sequence listing in ASCII format with a file named 7795WOPCT_seqlisting_ST25.txt, created on September 8, 2019, and which has a size of 97 kilobytes and is deposited simultaneously with the descriptive report. The sequence listing contained in this document is in ASCII format. ASCII is part of the descriptive report and is incorporated herein in its entirety by reference. Petition 870260056100, dated 10 / 06 / 2026, p. 14 / 125 2 / 64 BACKGROUND

[0004] The development of hybrid plant breeding has enabled considerable advances in the quality and quantity of crops produced. Increased yield and the combination of desirable traits, such as resistance to diseases and insects, tolerance to heat and drought, along with variations in plant composition, are all possible due to hybridization procedures. These procedures often depend heavily on the supply of a male parent that contributes pollen to a female parent to produce the resulting hybrid.

[0005] Field crops are produced using techniques that take advantage of the plant's pollination method. A plant is self-pollinating if the pollen from a flower is transferred to the same flower, or to another flower of the same plant, or to a genetically identical plant. A plant undergoes cross-pollination if the pollen comes from a flower of a different plant.

[0006] In certain species, such as Brassica campestris, the plant is normally self-sterile and can only be pollinated by cross-pollination. In self-pollinating species, such as soybeans, cotton, and wheat, the male and female plants are anatomically juxtaposed. During natural pollination, the male reproductive organs of a given flower pollinate the female reproductive organs of the same flower. Corn has male flowers, located in the tassel, and female flowers, located in the ear, on the same plant and can Petition 870260056100, dated 10 / 06 / 2026, page 15 / 125 3 / 64 can be produced by self-pollination and cross-pollination techniques.

[0007] During hybrid seed production, it is desirable to avoid self-pollination of inbred female plants to prevent the production and harvesting of inbred female seeds, as they exhibit less vigor than hybrid seeds. To increase the commercial quantities of the resulting hybrid seed, hybrid seed is often obtained using male-sterile female parents and male parents. SUMMARY

[0008] Compositions and methods for restoring male fertility in a male-sterile plant are provided in this document. Male fertility can be restored to the male-sterile plant by providing a plant restoration donor chromosome component from a species or plant different from the male-sterile plant. The plant restoration donor chromosome component contains a male fertility restoration locus that functionally complements the male sterility phenotype of a plant rendered male-sterile due to one or more homozygous recessive mutations in a male fertility polynucleotide. The male fertility restoration locus is linked to a plant-derived polynucleotide that confers a plant phenotypic marker. Also provided in this document are plants, plant cells, and seeds that have one or more homozygous mutations in a male fertility polynucleotide and contain the Petition 870260056100, dated 10 / 06 / 2026, page 16 / 125 4 / 64 plant restoration donor chromosome component. In some examples, the plant restoration donor chromosome component replaces a native male-sterile plant chromosome so that the plant produces euploid seed.

[0009] In some embodiments disclosed herein, plant restoration donor chromosomal components are modified with respect to one or more plant-derived polynucleotides that confer a plant phenotypic marker and / or one or more male fertility restoration loci. For example, a modified plant-derived polynucleotide and / or a male fertility restoration locus may be modified in terms of its polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosomal component compared to an unmodified native plant-derived polynucleotide that confers a plant phenotypic marker or a male fertility restoration locus. Plants, plant cells, and seeds with such plant restoration donor chromosomal components are also disclosed herein.

[0010] Therefore, methods for the production and use of such plants are described in this document. Maintainer plants having any of the plant restoration donor chromosome components described in this document can be used for seed production, allowing them to self-fertilize. Seeds, plants or parts thereof containing the component Petition 870260056100, dated 10 / 06 / 2026, page 17 / 125 5 / 64 plant restoration chromosomal donor components can be identified using the plant phenotypic marker, for example, in seed selection. The absence of the plant phenotypic marker expression in seeds indicates that the seeds do not contain the plant restoration donor chromosomal component and, when planted, will give rise to male-sterile female plants. On the other hand, the presence of the plant phenotypic marker in seeds indicates that the seeds contain the plant restoration donor chromosomal component and, when planted, will give rise to male-fertile plants. Such seeds and plants can be used in maintaining male sterility, inbreeding male-sterile female plants for hybrids, and increasing seed production. BRIEF DESCRIPTION OF THE FIGURES

[0011] FIG. 1 shows examples of phenotypes in the F3 generation in wheat. Part A) shows the blue wheat seed that will give rise to male-fertile wheat plants and part B) shows the white (not blue) seed that will give rise to male-sterile female wheat plants.

[0012] FIG. 2. shows an example of a seed from an F3 wheat plant segregating by seed color with a portion of white wheat seeds that will give rise to male-sterile female wheat plants, a portion of light blue wheat seeds (heterozygous for blue aleurone) that will give rise to male-fertile wheat plants; and a portion of dark blue wheat seeds (homozygous for blue aleurone) that will give rise to male-fertile wheat plants. Petition 870260056100, dated 10 / 06 / 2026, p. 18 / 125 6 / 64

[0013] FIG. 3 illustrates an embodiment of a pericentric inversion of Ms1 to increase binding to BA (from the English “blue aleurone”) on a chromosome.

[0014] FIG. 4 shows an embodiment of a translocation and replacement of a wheat chromosome arm by a 4E-Ms45 plant restoration donor chromosome component. Part A shows a plant restoration chromosome component of a 4EL telosomal addition chromosome that provides Ms45 and BA. Part B shows a 4EL plant restoration donor chromosome component that provides Ms45 and BA and translocates and replaces a 5AL wheat chromosome. DETAILED DESCRIPTION

[0015] All publications and patent applications mentioned in the descriptive report are indicative of the level of skill of those skilled in the subject matter to which the present invention pertains. All publications and patent applications are incorporated herein by reference in the same manner as if each individual publication or patent application were specifically and individually indicated for incorporation by reference.

[0016] Plants, plant parts, plant cells, or seeds containing a plant restoration donor chromosome component that can be used to restore male fertility in male-sterile plants and to facilitate the identification of plant parts, plant cells, or seeds containing the plant restoration donor chromosome component are provided herein. As used herein, a “plant restoration donor chromosome component” Petition 870260056100, dated 10 / 06 / 2026, page 19 / 125 7 / 64 plant restoration” is a chromosome or fragment thereof that includes a plant-derived polynucleotide that confers a plant phenotypic marker linked to a male fertility restoration locus. As used herein, the term “plant-derived” indicates that the polynucleotide conferring the plant phenotypic marker is from a plant. In some examples, the plant-derived polynucleotide conferring the plant phenotypic marker is endogenous with respect to the plant restoration donor chromosome component and the male fertility restoration locus. As used herein, the term “endogenous” or “native” or “natively” means normally present in the specified plant, present in its normal state or in its normal location on the chromosome (unmodified), plant cell or plant.

[0017] In some examples, the plant-derived polynucleotide is exogenous with respect to the plant restoration donor chromosomal component, plant, or plant cell into which it is being introduced. The term “exogenous” means not normally present in the chromosomal component, plant, or plant cell; not present in its normal state or location in the chromosomal component, plant, or plant cell; is introduced into the chromosomal component, plant, or plant cell; or originates from a different chromosome, plant type, or plant species; or, if from the same chromosome, plant type, or plant species, is in a different location, modified from its native form in genomic composition and / or locus by deliberate human intervention. In some examples, the Petition 870260056100, dated 10 / 06 / 2026, page 20 / 125 8 / 64 Plant restoration donor chromosome component includes one or more plant-derived polynucleotides that confer the plant phenotypic marker, including, but not limited to, one or more native, edited, repositioned, substituted, or inserted plant-derived polynucleotides that confer the plant phenotypic marker, or combinations thereof. In embodiments where there are two or more plant-derived polynucleotides, the polynucleotides may be the same or different from each other, for example, with respect to their sequences, such as their origin, e.g., plant type or species, polynucleotide or amino acid sequence, or location in the plant restoration donor chromosome component.In some examples, one or more plant-derived polynucleotides that confer the plant phenotypic marker are exogenous with respect to the plant, plant cell, or plant restoration donor chromosomal component into which they are being introduced, or combinations thereof.

[0018] The expression of the plant phenotypic marker in seeds allows the seed to be identified, selected and / or separated from seeds that do not contain the plant restoration donor chromosomal component, that is, that do not have the plant-derived polynucleotide that confers the plant phenotypic marker. In some respects, the plant phenotypic marker is a non-destructive marker.

[0019] The phenotypic marker of a plant may be related to the color, physiology, or morphology of the plant or seed. Examples of seed phenotypes that are suitable markers include, but are not limited to, seed color, Petition 870260056100, dated 10 / 06 / 2026, p. 21 / 1259 / 64 Seed color intensity or pattern, seed shape, seed surface texture, seed size including seed width and / or length, seed density, or other seed characteristics. Examples of phenotypic seed color markers include, but are not limited to, blue aleurone, the P gene which regulates flavonoid synthesis in maize, anthocyanin, Kala 4, and other endosperm coloration characteristics. In some examples, the plant-derived polynucleotide is ThMYC4E and confers a blue aleurone phenotype. See Li, Na et al. ThMYC4E, Candidate Blue Aleurone 1 Gene Controlling the Associated Tract in Triticum Aestivum. Ed. Harsh Raman. PLoS ONE 12.7 (2017): e0181116. PMC. Web. September 13, 2018, incorporated herein in its entirety by reference. Please refer to the published PCT patent application, WC2019090496, incorporated herein by reference in its entirety and in the immediate sequence listing.In some embodiments where there are two or more plant-derived polynucleotides, the two plant-derived polynucleotides are polynucleotides encoding blue aleurone color markers that confer a blue aleurone phenotype to the seed and can be used for seed identification, selection, and separation. The color markers may be the same or different from each other, for example, with respect to their sequences, such as their origin, e.g., plant type or species, polynucleotide or amino acid sequence, or location on the plant restoration donor chromosome component. Petition 870260056100, dated 10 / 06 / 2026, p. 22 / 125 10 / 64

[0020] As desired, plant-derived polynucleotides that confer the plant phenotypic marker can be modified to increase their expression in the plant, for example, to increase the expression of the plant phenotypic marker in a plant, part of the same plant, or seed. In some respects, the regulatory region of the plant-derived polynucleotide can be modified to increase the expression of the plant phenotypic marker, for example, by editing the existing regulatory region for nucleotide substitution, deletion, and / or insertion for enhanced expression. See, for example, PCT Patent Publication WO2018183878, published on 10-4-2018, incorporated herein by reference in its entirety. Alternatively, or additionally, nucleotides in the plant phenotypic marker in the plant restoration donor chromosomal component can be modified to alter the polynucleotide so that it uses codons preferred by the host plant.

[0021] In some embodiments, the blue aleurone gene in the plant restoration chromosomal component has a nucleic acid sequence encoding an amino acid sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity with the amino acid sequence of SEQ ID NO: 41 or 42, variants, or fragments thereof. The nucleic acid sequence encoding the polypeptide that confers the blue aleurone phenotype may be synthesized, isolated, or obtained from any number of sources, including but not limited to Petition 870260056100, dated 10 / 06 / 2026, p. 23 / 125 11 / 64 a, Agropyron, Thinopyrum, or Triticum, such as Agropyron elongation, Agropyron trlchophorum, Triticum thaoudar, Triticum aestivum, Triticum monococcum, and Thinopyrum ponticum. The source of blue aleurone and the plant restoration donor chromosome component may be from Sebesta Blue, Blue Sando, Blue Baart, Blue Onas, Blue 1, PBB, or Blue Norco, or another addition strain comprising a polynucleotide encoding blue aleurone. The presence of blue aleurone in the seed may be indicated by the appearance of a blue color in the aleurone layer of the seed, confirmed using PCR or any other suitable assays. The examples of plant phenotypic markers included in this document are not intended to be limiting. Any desired plant phenotypic marker may be used in the methods and compositions described herein.

[0022] Seeds can be separated into various populations using any suitable seed phenotypic marker. For example, the absence of the plant phenotypic marker in the seed, for example, seed without the plant restoration donor chromosome component, indicates that the seed, when planted, will give rise to a male-sterile female plant. Plants from this seed can be used as male-sterile female inbred plants for hybrids and increased seed production. The presence of the plant phenotypic marker in the seed, for example, seed with the plant restoration donor chromosome component, indicates that the seed will give rise to a male-fertile plant that can be used as a maintainer of the male-sterile female plant. As discussed elsewhere in Petition 870260056100, dated 10 / 06 / 2026, p. 24 / 125 12 / 64 of this document, the seeds can be separated using any suitable approach or instrument, provided it has sufficient sensitivity to detect the difference between seeds that express and do not express the phenotypic marker.

[0023] In addition to the plant-derived polynucleotide that confers the plant phenotypic marker, the plant restoration donor chromosomal component includes a male fertility restoration locus that is capable of functionally complementing the male-sterility phenotype of a plant. As used in this document, a “male fertility restoration locus” refers to one or more male fertility polynucleotides that, when expressed in a male-sterile female plant, restore the plant’s male fertility by complementing the female plant’s male-sterility condition caused by one or more homozygous mutations in a male fertility polynucleotide. Such mutations may be a substitution, a deletion, and / or an insertion of one or more nucleotides that result in the attribution of male sterility to a plant.As used in this document, the term “male fertility polynucleotide” means one of the polynucleotides critical to a specific step in microsporogenesis, the term applying to the entire pollen formation process. In some examples, one or more male fertility polynucleotides include, but are not limited to, Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45. In some embodiments, the male fertility restoration locus utilizes, without limitation, two or more male fertility polynucleotides of Ms1, Ms5, Ms9, or Ms45. Petition 870260056100, dated 10 / 06 / 2026, page 25 / 125 13 / 64 Ms22, Ms26, or Ms45 to complement the male sterility condition of a female plant caused by one or more homozygous mutations in the male fertility polynucleotide of Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45, respectively.

[0024] As desired, the male fertility restoration locus can be modified to increase the expression of the male fertility polynucleotide in the plant, for example, to supplement male sterility or restore male fertility in a male-sterile plant. In some respects, the regulatory region can be modified to increase the expression of the male fertility restoration locus or male fertility polynucleotide, for example, by editing the existing regulatory region for nucleotide substitution, deletion and / or insertion for enhanced expression. See, for example, patent publication PCT WO2018183878, published on 10-4-2018, incorporated herein by reference in its entirety.Alternatively, or additionally, nucleotides in the male fertility restoration locus or male fertility polynucleotide in the plant restoration donor chromosome component can be modified to alter the polynucleotide so that it uses codons preferred by the host plant.

[0025] In some examples, the male fertility restoration locus is associated with an increased male fertility phenotype in a plant. The plant's male fertility status can be assessed by Petition 870260056100, dated 10 / 06 / 2026, page 26 / 125 14 / 64 any suitable technique, for example, by observing the development of male plant tissue, such as by phenotyping anthers and seed clusters in individual plants. See, for example, Example 1 in this document.

[0026] In some examples, the male fertility restoration locus includes, but is not limited to, one or more native, edited, substituted, repositioned, or inserted male fertility polynucleotides, or combinations thereof. In embodiments where there are two or more male fertility polynucleotides in the male fertility restoration loci, the male fertility restoration loci may be the same or different from each other, for example, with respect to their sequences, such as their origin, for example, plant type or species, polynucleotide or amino acid sequence, or location in the plant restoration donor chromosomal component. In some respects, one or more male fertility restoration loci are endogenous to the plant, plant cell, or plant restoration donor chromosomal component into which they are being introduced, or combinations thereof.In some respects, one or more male fertility restoration loci are exogenous with respect to the plant, plant cell, or plant restoration donor chromosomal component into which they are being introduced, or combinations thereof. Male fertility restoration may include one or more male fertility polynucleotides known to a person skilled in the art, described herein. Petition 870260056100, dated 10 / 06 / 2026, page 27 / 125 15 / 64 document, including counterparts and orthologs of any of the above.

[0027] In one example, the male fertility restoration locus functionally complements the male-sterility phenotype of one or more homozygous mutations in an endogenous male fertility polynucleotide that confers male sterility to the plant. This includes, but is not limited to, one or more homozygous recessive alleles for Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45. Since Ms1 in wheat behaves as a single recessive gene, in some embodiments, it may be that only the male fertility polynucleotide or ms1 allele located on chromosome 4BS needs to be mutated to confer male sterility to a wheat plant.

[0028] There are several known male fertility polynucleotides and male fertility mutants from wheat and other species, including, but not limited to, Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45.

[0029] Patent publication PCT WO2016048891, published on 31-3-2016, describes a male fertility gene called “MS1” that is located on the wheat chromosome 4BS and encodes a glycosylphosphatidylinositol (GPI)-anchored nsLTP polypeptide (LTPG) (also called TaLTPGI) important for male fertility. Examples of DNA and polypeptide sequences of wheat Ms1 sequences are disclosed in WO2016048891, published on 31-3-2016, and WO2019118342, published on 20-6-2019, each of which is incorporated herein in its entirety and in the immediate sequence listing. Petition 870260056100, dated 10 / 06 / 2026, page 28 / 125 16 / 64

[0030] Wheat Ms5 is a glycosylphosphatidylinositol-anchored lipid transfer protein required for normal pollen exine development, and the gene is located on wheat chromosome 3A. Examples of wheat Ms5 DNA and polypeptide sequences are disclosed in WO2019118342, published on 20-6-2019, incorporated in its entirety herein and in the current sequence listing.

[0031] US patent publication US20150191743 Al, published on 09-07-2015, describes a male fertility gene called MS9 that is located on chromosome 1 of maize and encodes a transcription factor myb critical for male fertility. The Ms9 phenotype was first identified in maize in 1932. Beadle, (1932) Genetics 17:413-431. It was found to be linked to the PI gene on chromosome 1. The breakdown of male reproductive tissue development occurs very early in pre-meiosis; tapetal cells may also be affected. Greyson, et al., (1980) Can. J. Genet. Cytol. 22:153-166. Examples of genomic DNA and polypeptide sequences of maize Ms9 are disclosed in U.S. Patent Publication 20150191743, published July 9, 2015, which is incorporated herein in its entirety. Wheat Ms9 is located on the long arm of wheat chromosome 4.Examples of genomic and polypeptide DNA sequences of wheat Ms9 are disclosed in U.S. patent publication US20190177722A1, published on 13-6-2019, incorporated herein in its entirety and in the immediate sequence listing. Petition 870260056100, dated 10 / 06 / 2026, p. 29 / 125 17 / 64

[0032] US patent publication US20090038026A1, published on 05-02-2009, describes a male fertility gene called Mscal or MS22 that is located on chromosome 7 of maize and encodes a protein critical for male fertility. Mutations called ms22 or mscal were first noted as phenotypically male-sterile with anthers that did not project from the tassel and lacked sporogenous tissue. West and Albertsen (1985) Maize Newsletter 59:87; Neuffer et al. (1977) Maize mutants. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. The mutant locus was originally named ms22, but was later changed to mscal or male sterile converted anther. See Chaubal et al. Anther transformation in the maize mutant mscal. Planta (2003)216:778-788. Wheat Ms22 is located on the long arm of wheat chromosome 2. Examples of genomic and polypeptide DNA sequences of wheat Ms22 are disclosed in US patent publication US20190177722A1, published on 13-6-2019, incorporated herein in its entirety and in the immediate sequence listing.

[0033] U.S. Patent No. 7,517,975, issued April 14, 2009, describes a male fertility gene called MS26 (also known as SB200 or SBMu200) that is located on chromosome 1 of maize. Sequences of Ms26 in maize or rice, for example, as disclosed in U.S. Patent 7,919,676 or 8,293,970. In wheat, the Ms26 gene is located on chromosome 4AS of Petition 870260056100, dated 10 / 06 / 2026, p. 30 / 125 18 / 64 Wheat. Examples of genomic and polypeptide DNA sequences of Ms26 from wheat are disclosed in U.S. patent publication US20190177722A1, published on 13-6-2019, incorporated herein in its entirety and in the immediate sequence listing.

[0034] U.S. Patent No. 5,478,369, issued December 26, 1995, describes a male fertility gene called “MS45” cloned on chromosome 9 of maize. In wheat, the Ms45 gene is located on the long arm of wheat chromosome 4. Examples of genomic and polypeptide DNA sequences of wheat Ms45 are disclosed in U.S. Patent Publication US20190177722A1, published June 13, 2019, incorporated herein in its entirety and in the immediate sequence listing.

[0035] Male-sterile female plants for use in the methods and compositions described herein may be generated using any number of methods recognized in the art, including, but not limited to, mutagenesis, suppression, and genome editing. Mutations that cause male sterility in cultivated plants, such as maize, wheat, and rice, have been produced by a variety of methods, such as X-ray or UV irradiation, chemical treatments, or insertions of transposable elements (Chaubal et al. 2000) Am J Bot 87:1193-1201). Suppression technology, such as antisense, cosuppression, RNAi, hairpin formations, may be used to inactivate or prevent the expression of fertility gene alleles to create a male-sterile female plant, for example, to create homozygous recessive alleles that confer maleness. Petition 870260056100, dated 10 / 06 / 2026, page 31 / 125 19 / 64 Plant sterility. In some cases, male sterility results from the use of genome editing technology to introduce a genetic modification (mutation) near or within an endogenous male fertility gene, for example, a male fertility polynucleotide, to cause sterility. See WO2015026883, published February 26, 2015, and Singh, M., Kumar, M., Albertsen, MC et al. Plant Mol Biol (2018) 97: 371-383. Therefore, methods may employ CRISPR technology using a guide RNA / Cas endonuclease system, where the Cas endonuclease is guided by the guide RNA to recognize and optionally introduce a double-strand break at a specific target site in the plant genome of a cell.In some examples, wheat genomes (A, B, and D) contain homologous genes that have similar gene structure and function, requiring triple mutants to result in a male-sterility phenotype, for example, one, two, or three homozygous mutations in a male fertility polynucleotide. In some embodiments, the male-sterility phenotype is caused by the introduction of genetic modification (mutation) of a target site located at or near one or more endogenous male fertility gene loci of Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45 in the genome of a plant cell. See, for example, US20190177722A1, published 2019-6-13, and WO2019118342, published 2019-6-20, each of which is incorporated herein in its entirety.

[0036] Thus, male-sterile edited or mutant plants ms1 / ms1 / ; ms5 / ms5; ms9 / ms9 / ; ms22 / ms22 / ; ms26 / ms26 / Petition 870260056100, dated 10 / 06 / 2026, p. 32 / 125 Known or created 20 / 64 or ms45 / ms45 strains can be used in the methods and compositions described in this document, for example, for use as male-sterile female plants in the production of hybrids and hybrid seeds. Since Ms1 in wheat behaves as a single recessive gene, in some embodiments, it may be that only the male fertility polynucleotide or ms1 allele located on chromosome 4BS needs to be mutated to confer male sterility to a wheat plant.

[0037] In some embodiments, compositions and methods are provided in this document for supplementing and restoring male fertility in male-sterile female wheat plants containing one or more homozygous mutations in a male fertility polynucleotide of Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45 that confers male sterility to the wheat plant. In some examples, the male-sterile plant contains one or more homozygous mutations in a recessive sporophytic male fertility polynucleotide. In some examples, these male-sterile wheat plants can have male fertility restored when a plant restoration donor chromosome component from a non-wheat species is used to functionally supplement one or more homozygous mutations of Ms1, Ms5, Ms9, Ms22, Ms26, or Ms45 that confer male sterility to the wheat plant.

[0038] In some embodiments, the wheat Ms1 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence presented in SEQ ID NO: 1, 3 or 5; (b) a polynucleotide Petition 870260056100, dated 10 / 06 / 2026, page 33 / 125 21 / 64 that has at least 85%, 90%, or 95% sequence identity with SEQ ID NO: 1, 3, or 5; (c) a polynucleotide encoding a polypeptide that has at least 85%, 90%, or 95% sequence identity with SEQ ID NO: 2, 4, or 6; and (d) a polynucleotide encoding a polypeptide with SEQ ID NO: 2, 4, or 6.

[0039] In some embodiments, the wheat Ms5 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence presented in SEQ ID NO: 7, 9, 12 or 14; (b) a polynucleotide having at least 85%, 90% or 95% sequence identity with SEQ ID NO: 7, 9, 12 or 14; (c) a polynucleotide encoding a polypeptide having at least 85%, 90% or 95% sequence identity with SEQ ID (d) a polynucleotide encoding a polypeptide with SEQ ID NO: 8, 10, 11, 13 or 15.

[0040] In some embodiments, the wheat Ms9 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence presented in SEQ ID NO: 16, 18, or 20; (b) a polynucleotide having at least 85%, 90%, or 95% sequence identity with SEQ ID NO: 16, 18, or 20; (c) a polynucleotide encoding a polypeptide having at least 85%, 90%, or 95% sequence identity with SEQ ID NO: 17, 19 or 21; and (d) a polynucleotide encoding a polypeptide with SEQ ID NO: 17, 19 or 21.

[0041] In some embodiments, the wheat Ms22 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence Petition 870260056100, dated 10 / 06 / 2026, page 34 / 125 22 / 64 presented in SEQ ID NO: 22, 24 or 26; (b) a polynucleotide that has at least 85%, 90% or 95% sequence identity with SEQ ID NO: 22, 24 or 26; (c) a polynucleotide that encodes a polypeptide that has at least 85%, 90% or 95% sequence identity with SEQ ID NO: 23, 25 or 27; and (d) a polynucleotide that encodes a polypeptide of SEQ ID NO: 23, 25 or 27.

[0042] In some embodiments, the wheat Ms26 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence presented in SEQ ID NO: 28, 30 or 32; (b) a polynucleotide having at least 85%, 90% or 95% sequence identity with SEQ ID NO: 28, 30 or 32; (c) a polynucleotide encoding a polypeptide having at least 85%, 90% or 95% sequence identity with SEQ ID NO: 29, 31 or 33; and (d) a polynucleotide encoding a polypeptide from SEQ ID NO: 29, 31 or 33.

[0043] In some embodiments, the wheat Ms45 male fertility polynucleotide sequences include (a) a polynucleotide comprising the sequence shown in SEQ ID NO: 34, 36 or 38; (b) a polynucleotide having at least 85%, 90% or 95% sequence identity with SEQ ID NO: 34, 36 or 38; (c) a polynucleotide encoding a polypeptide having at least 85%, 90% or 95% sequence identity with SEQ ID NO: 35, 37 or 39; and (d) a polynucleotide encoding a polypeptide of SEQ ID NO: 35, 37 or 39. Table 1: Summary of SEQ ID NOs: Petition 870260056100, dated 10 / 06 / 2026, p. 35 / 125 23 / 64 SEQ ID NO: Description 1 Genomic (exon-intron) of Ms1 of A of wheat 2 Amino acids of Ms1 of A of wheat 3 Genomic (exon-intron) of Ms1 of B of wheat 4 Amino acids of Ms1 of B of wheat 5 Genomic (exon-intron) of Ms1 of D of wheat 6 Amino acids of Ms1 of D of wheat 7 Genomic (exon-intron) of Ms5 of 3A of wheat 8 Amino acids of Ms5 of 3A of wheat 9 Genomic (exon-intron) of Ms5 of 3B of wheat 10 Amino acids of Ms5 of 3B of wheat 11 Amino acids of Ms5 of 3B of wheat 12 Genomic (exon-intron) of Ms5 of 3D of wheat 13 Amino acids of Ms5 of 3D of wheat 14 Genomic (exon-intron) of Ms5 of 3D of wheat Petition 870260056100, dated 10 / 06 / 2026, page 36 / 125 24 / 64 SEQ ID NO: Description 15 Ms5 3D wheat amino acid genomics (exon / intron) 16 Ms9 4AS wheat amino acid genomics (exon / intron) 17 Ms9 4AS wheat amino acid genomics (exon / intron) 18 Ms9 4BL wheat amino acid genomics (exon / intron) 19 Ms9 4BL wheat amino acid genomics (exon / intron) 20 Ms9 4DL wheat amino acid genomics (exon / intron) 21 Ms9 4DL wheat amino acid genomics (exon / intron) 22 Ms22 AL wheat amino acid genomics (exon / intron) 23 Ms22 AL wheat amino acid genomics (exon / intron) 24 Ms22 BL wheat amino acid genomics (exon / intron) 25 Ms22 BL wheat amino acid genomics (exon / intron) 26 Ms22 DL wheat amino acid genomics (exon / intron) 27 Ms22 DL wheat amino acid genomics 28 (exon / intron) of Ms26 of wheat 4AS Petition 870260056100, dated 10 / 06 / 2026, page 37 / 125 25 / 64 SEQ ID NO: Description 29 Amino acids of Ms26 from 4AS wheat 30 Genomics (exon / intron) of Ms26 from 4BL wheat 31 Amino acids of Ms26 from 4BL wheat 32 Genomics (exon / intron) of Ms26 from 4DL wheat 33 Amino acids of Ms26 from 4DL wheat 34 Genomics (exon / intron) of Ms45 from 4AS wheat 35 Amino acids of Ms45 from 4AS wheat 36 Genomics (exon / intron) of Ms45 from 4BL wheat 37 Amino acids of Ms45 from 4BL wheat 38 Genomics (exon / intron) of Ms45 from 4DL wheat 39 Amino acids of Ms45 from 4DL wheat 40 Guide to gene editing 41 Amino acids of Thinopyrum ponticum blue aleurone Petition 870260056100, dated 10 / 06 / 2026, page 38 / 125 26 / 64 SEQ ID NO: Description 42 amino acids of blue aleurone from Thinopyrum ponticum

[0044] In some respects, the plant-derived polynucleotide that confers the plant phenotypic marker and the male fertility restoration locus are natively linked to each other in the plant restoration donor chromosomal component. In some respects, the plant-derived polynucleotide that confers the plant phenotypic marker and the male fertility restoration locus are natively linked to each other and are both located on the same side of the centromere in the plant restoration donor chromosomal component, i.e., on the same chromosome arm. In some embodiments, they are both linked to each other and located on the long arm of the plant restoration donor chromosomal component or both located on the short arm of the plant restoration donor chromosomal component and not separated by a centromere.The present disclosure described in this document is based, in part, on the discovery that the Blue Norco chromosome 4EL is capable of complementing Tams45-abd mutations, see, for example, Example 1 in this document. In one embodiment, the plant phenotypic marker is blue aleurone and is on the same side of the centromere as a male fertility restoration locus that functionally complements the male-sterility phenotype in a. Petition 870260056100, dated 10 / 06 / 2026, p. 39 / 125 27 / 64 female male-sterile wheat plant that has homozygous Ms45 mutations.

[0045] The plant restoration donor chromosome component can be from any plant, provided it is capable of restoring the fertility of a male-sterile plant so that the plant produces viable pollen capable of fertilizing a plant, for example, itself. In some respects, the plant restoration donor chromosome component is from maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, grass, triticale, switchgrass, wheatgrass, fonio, soybean, canola, alfalfa, sunflower, cotton, tobacco, peanut, potato, tobacco, Arabidopsis, safflower, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, Hordeum, or a species related thereto. In some respects, the plant restoration donor chromosome component comprises chromosome 4 of a plant.In some embodiments, the plant restoration donor chromosome component is a 4E, 4EL, or 4H chromosome from a species of Triticum, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, or Hordeum, or a species related to them. The orthologous counterpart of the plant restoration donor chromosome component in other species may be on the same chromosome, for example, 4, or located on a different chromosome. In some respects, the plant phenotypic marker and the male fertility restoration locus are linked on chromosome 4, which can be used as a plant restoration donor chromosome component. Petition 870260056100, dated 10 / 06 / 2026, page 40 / 125 28 / 64

[0046] In some cases, the male fertility restoration locus and the plant-derived polynucleotide that confers the plant phenotypic marker are not closely linked or natively linked. Molecular and biological techniques, including genome editing technology such as CRISPR, Talons, meganucleases, and the like, can be used to increase their genetic linkage and / or decrease their physical distance in the plant restoration donor chromosomal component.

[0047] In some examples, one or more plant-derived polynucleotides that confer the plant phenotypic marker are inserted, repositioned, or rearranged in the plant restoration donor chromosomal component to increase genetic linkage, decrease recombination frequency, decrease crossing-over frequency, and / or decrease the physical distance or combinations thereof relative to one or more male fertility restoration loci in the plant restoration donor chromosomal component. One or more of the plant-derived polynucleotides that confer the plant phenotypic marker may be endogenous or exogenous relative to the plant restoration donor chromosomal component and / or one or more male fertility restoration loci. One or more of the male fertility restoration loci may be endogenous or exogenous relative to the plant restoration donor chromosomal component.

[0048] In some examples, one or more male fertility restoration loci are inserted, repositioned, or rearranged in the chromosomal component. Petition 870260056100, dated 10 / 06 / 2026, page 41 / 125 29 / 64 plant restoration donor to increase genetic linkage, decrease recombination frequency, decrease crossing-over frequency, and / or decrease physical distance or combinations thereof in relation to one or more plant-derived polynucleotides that confer the plant phenotypic marker on the plant restoration donor chromosomal component. One or more of the male fertility restoration loci may be endogenous or exogenous in relation to the plant restoration donor chromosomal component or one or more plant-derived polynucleotides that confer the plant phenotypic marker. One or more of the plant-derived polynucleotides that confer the plant phenotypic marker may be endogenous or exogenous in relation to the plant restoration donor chromosomal component.

[0049] In other embodiments, the male fertility restoration locus and the plant-derived polynucleotide conferring the plant phenotypic marker have been edited, inserted, repositioned, or rearranged, or combinations thereof, such that both are in different locations on the plant restoration donor chromosome component than their native locations on the plant restoration donor chromosome component. In some examples, the plant phenotypic marker and the male fertility restoration locus are located on the same side of the centromere of the plant restoration donor chromosome component. In some embodiments where there is more than one male fertility restoration locus and / or plant-derived polynucleotide conferring the Petition 870260056100, dated 10 / 06 / 2026, page 42 / 125 30 / 64 plant phenotypic marker, at least one male fertility restoration locus, and at least one plant-derived polynucleotide are located in different locations on the plant restoration donor chromosomal component than their native locations. In some embodiments, the plant-derived polynucleotide conferring the plant phenotypic marker and one or more male fertility restoration loci are less physically distant from each other compared to the physical distance between the original plant-derived polynucleotide and the original male fertility restoration locus when located in their native locations.In some embodiments, the plant-derived polynucleotide conferring the plant phenotypic marker and one or more male fertility restoration loci have higher genetic linkage to each other compared to the genetic linkage between the original plant-derived polynucleotide and the original male fertility restoration locus when located in their native locations. In some respects, the plant-derived polynucleotide conferring the plant phenotypic marker and one or more male fertility restoration loci have lower recombination frequencies compared to the recombination frequency between the original plant-derived polynucleotide and the original male fertility restoration locus when located in their native locations. In some respects, the plant-derived polynucleotide conferring the plant phenotypic marker and one or more male fertility restoration loci have lower recombination frequencies. Petition 870260056100, dated 10 / 06 / 2026, page 43 / 125 31 / 64 comparison with the recombination frequency between the original plant-derived polynucleotide and the original male fertility restoration locus when located in their native locations.

[0050] In some embodiments, where one or more male fertility restoration loci have been inserted into the plant restoration donor chromosomal component, the native or original male fertility restoration locus may be inactivated so that it no longer expresses and cannot restore male fertility in a male-sterile plant. In some respects, the method may include inactivating the native or original male fertility restoration locus if it is not located on the same side of the centromere of the plant restoration donor chromosomal component as the plant-derived polynucleotide that confers the plant phenotypic marker or is not closely linked to the plant-derived polynucleotide from a genetic perspective.

[0051] In some embodiments, where one or more plant-derived polynucleotides conferring the plant phenotypic marker have been inserted into the plant restoration donor chromosome component, the native or original plant-derived polynucleotide conferring the plant phenotypic marker may be inactivated so that it no longer expresses and cannot confer a marker phenotype to a plant or parts thereof. In some respects, the method may include the inactivation of the native or original plant-derived polynucleotide that Petition 870260056100, dated 10 / 06 / 2026, p. 44 / 125 32 / 64 confers the plant phenotypic marker if it is not located on the same side of the centromere of the plant restoration donor chromosome component as the male fertility restoration locus or is not closely linked to the male fertility restoration locus from a genetic perspective.

[0052] In some embodiments, the plant restoration donor chromosomal component has one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more male fertility restoration loci. For example, the modified plant-derived polynucleotides that confer a plant phenotypic marker may be modified in terms of their polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosomal component compared to the polynucleotide sequence, copy number, expression level, or location of an unmodified native plant-derived polynucleotide that confers a plant phenotypic marker.

[0053] In some embodiments, the plant restoration donor chromosome component has one or more plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more modified male fertility restoration loci. For example, the modified male fertility restoration loci may be modified in terms of their polynucleotide sequence, copy number, expression level, or location within the donor chromosome component. Petition 870260056100, dated 10 / 06 / 2026, page 45 / 125 33 / 64 plant restoration compared to the polynucleotide sequence, copy number, expression level, or location of an unmodified native male fertility restoration locus.

[0054] In some embodiments, the plant restoration donor chromosome component has one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more modified male fertility restoration loci. For example, the modified male fertility restoration loci may be modified in terms of their polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosome component compared to the polynucleotide sequence, copy number, expression level, or location of an unmodified native male fertility restoration locus.For example, modified plant-derived polynucleotides that confer a plant phenotypic marker may be modified in terms of their polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosomal component compared to the polynucleotide sequence, copy number, expression level, or location of an unmodified native plant-derived polynucleotide that confers a plant phenotypic marker.

[0055] In some respects, the plant-derived polynucleotide that confers the plant phenotypic marker and the male fertility restoration locus Petition 870260056100, dated 10 / 06 / 2026, page 46 / 125 34 / 64 are located on opposite arms of the chromosome. Any suitable technology and technique can be used to bring the plant-derived polynucleotide that confers the plant phenotypic marker and the male fertility restoration locus to the same arm of the chromosome, for example, translocation, genome editing, pericentric inversions, or combinations thereof.

[0056] In one embodiment, the Ms1 male fertility restoration locus and the plant-derived polynucleotide encoding the plant phenotypic marker of the blue aleurone gene (Ba1) are initially located on different chromosome arms. In some respects, the Ms1 male fertility restoration locus is located on chromosome 4ES of Agropyron elongatum or 4HS of barley (Hordeum vulgare) and the blue aleurone gene (Ba1) on 4EL of Blue Norco. In one embodiment, double-strand breaks are induced in a hybrid (chimeric) plant restoration donor chromosome component of 4HS-4EL, for example, a double-strand break between the barley Ms1-H gene and the 4HS telomere, and a double-strand break between the Ba1 gene and the 4HS-4EL centromere.The chromosome fragment containing the centromere and Ms1-H will be reattached to the telomeric ends in the opposite orientation, resulting in a pericentric inversion, with Ms1-H and Ba1 now located on the same arm of the new chromosome. See, for example, FIG. 3.

[0057] The plant restoration donor chromosome component can be introduced into a plant cell, plant part or plant, for example, a plant Petition 870260056100, dated 10 / 06 / 2026, page 47 / 125 35 / 64 male-sterile, using any suitable technique known to those skilled in the art. In some approaches, the plant restoration donor chromosome component is introduced into the plant cell, part of the plant, or plant using genome editing, transformation, embryo culture, or chromosome translocation techniques. In some embodiments, the plant cell is a wheat plant cell that has one or more homozygous mutations in a male fertility polynucleotide, for example, Ms45, and a plant restoration donor chromosome component that functionally complements the homozygous male-sterility mutations that confer male-sterility to a wheat plant.

[0058] The plant restoration donor chromosome component can be translocated into the genome of a plant using any suitable methods. The translocation can be a Robertsonian or non-Robertsonian translocation. In some embodiments, the plant restoration donor chromosome component is translocated and replaces an existing plant chromosome arm, for example, from a wheat, barley, or rye plant. In some embodiments, the plant restoration donor chromosome component can be used to replace the short or long arm of the plant chromosome, for example, wheat, barley, or rye.

[0059] In some embodiments, the plant restoration donor chromosome component is introduced using a targeted approach so that the plant restoration donor chromosome component is Petition 870260056100, dated 10 / 06 / 2026, page 48 / 125 36 / 64 introduced into a location in the recipient plant genome so that any potential undesirable effects on the recipient plant are minimized, avoided, or the target location offers potential beneficial advantages. For example, the plant restoration donor chromosome component can be introduced into or can replace a chromosome arm in a wheat plant, where the wheat plant without that chromosome arm or pair of chromosome arms (monosomic or ditellosomic) has a normal phenotype. In another example, the plant restoration donor chromosome component can be introduced into or can replace a chromosome arm in a wheat plant where the lack of the chromosome arm would have the effect of reducing the transmission rates of the plant restoration donor chromosome component, for example, reducing male or female transmission rates.In one embodiment, the plant restoration donor chromosome component replaces the long arm of chromosome 5A (5AL) in a wheat plant, so that the result is the plant restoration donor chromosome component-5AS.

[0060] In some instances, having a translocated and / or substitute plant restoration donor chromosome component may confer advantages over an independent (additional) plant restoration donor chromosome component. One advantage is the reduced gametic transmission of the independent (additional) plant restoration donor chromosome component, which allows for a higher percentage of seeds containing one or more homozygous mutations in the fertility polynucleotide. Petition 870260056100, dated 10 / 06 / 2026, page 49 / 125 37 / 64 male and do not contain the plant restoration donor chromosome component to be produced during the increase of female seeds.

[0061] In some embodiments, a translocated and substitutable plant restoration donor chromosome component can be created via a Robertsonian translocation. See, for example, FIG. 4. Aneuploid stocks can be used to create Robertsonian translocations of wheat chromosome donors in a targeted manner by producing the appropriate wheat and donor chromosomes in monosomic condition. The translocated and substitutable plant restoration donor chromosome component can be introgressed along with one or more homozygous mutations in the male fertility polynucleotide or a single recessive fertility gene into several elite female lines to facilitate hybrid seed production.Since Ms1 behaves as a single recessive gene, in some embodiments, only one mutation in the Ms1 polynucleotide or allele located on chromosome 4BS may need to be introgressed into female wheat lines to produce male sterility.

[0062] In one example, the plant restoration donor chromosome component is introduced into the male-sterile plant using breeding techniques. In some examples, the male-sterile plant is crossed with a plant comprising the plant restoration donor chromosome component. The plant restoration donor chromosome component can be introduced into a plant, for example, a male-sterile plant, using a plant that Petition 870260056100, dated 10 / 06 / 2026, p. 50 / 125 38 / 64 has the same base number of chromosomes as the recipient plant (e.g., male-sterile). In some examples, the male-sterile plant is a wheat plant, for example, diploid, tetraploid, or hexaploid. In some examples, the plant restoration donor chromosome component may be from or introduced from a wheat plant, for example, diploid, tetraploid, or hexaploid wheat, an Aegilops, Secale, Agropirina, Haynaldia, Hordeum, or Elyymus plant, or any other plant with which the male-sterile plant is compatible for crossing and by which it can be fertilized.

[0063] In some respects, the plant restoration donor chromosome component may be exogenous with respect to the recipient plant, for example, a male-sterile plant, or its host plant, for example, a male-fertile plant. For example, the plant restoration donor chromosome component may be from a plant that is of a different species or plant than the male-sterile plant, for example, which has a plant restoration donor chromosome component from wheatgrass or barley in a wheat plant. Consequently, in some examples, the plant restoration donor chromosome component is from a plant or species that is not wheat. In some embodiments, the plant restoration donor chromosome component does not pair or recombine with any of the chromosomes of the female male-sterile plant, for example, wheat chromosomes.

[0064] The plant restoration donor chromosome component can be from any wild plant. Petition 870260056100, dated 10 / 06 / 2026, p. 51 / 125 39 / 64 or cultivated, including, but not limited to, maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, grass, triticale, switchgrass, wheatgrass, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, Hordeum, soybean, canola, alfalfa, sunflower, cotton, corn, or a species related thereto. The plant restoration donor chromosome component may be from any number of plant species, including, but not limited to, species of Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, or Hordeum. In some embodiments, the plant restoration donor chromosome component may be from a wheat line with one or more chromosomes from maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, grass, triticale, switchgrass, wheatgrass, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus or Hordeum, soybean, canola, alfalfa, sunflower, cotton, corn, or a related species. The plant restoration donor chromosome component may be introduced into and / or from a telosomic addition line, such as a monotelosomic or ditelosomic addition line or a disomic addition line. In some examples, the plant with the plant restoration donor chromosome component is a wheat line, including, but not limited to, a Blue Sando, Blue Baart, Blue Onas, Blue 1, PBB, or Blue Norco wheat line.Non-limiting examples include, but are not limited to, the Blue Baart wheat variety, which has a disomic addition of chromosome 4E from Thinopyron ponticum, Blue Norco, which has a ditelosomal addition of chromosome 4E from Thinopyron ponticum, or a wheat line that has one. Petition 870260056100, dated 10 / 06 / 2026, p. 52 / 125 40 / 64 disomic addition of chromosome 4H of Hordeum vulgare (barley). Blue Norco, aneuploid, monosomic and disomic, and other wheat lines are publicly available and can be obtained from a number of centers, such as the National Small Grains Collection (United States Department of Agriculture - Agricultural Research Service, National Small Grains Collection, Aberdeen, ID 83210 USA), or Wheat Genetics Resource Center (Kansas). State University, Kansas, USA).

[0065] In some embodiments, the plant restoration donor chromosome component is from two, three, or more of the same species or from different species to produce a hybrid (chimeric) plant restoration donor chromosome component. In some embodiments, the hybrid (chimeric) plant restoration donor chromosome component has the plant-derived polynucleotide that confers the plant phenotypic marker from one plant or species and the male fertility restoration locus from a different plant or species.The plant-derived polynucleotide that confers the plant phenotypic marker on the hybrid (chimeric) plant restoration donor chromosome component may have one or more chromosomes or chromosome fragments from maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, grass, triticale, switchgrass, wheatgrass, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, Hordeum, soybean, canola, alfalfa, sunflower, cotton, corn, or a related species. The male fertility restoration locus on the plant restoration donor chromosome component. Petition 870260056100, dated 10 / 06 / 2026, page 53 / 125 A 41 / 64 hybrid (chimeric) may have one or more chromosomes or chromosome fragments from maize, rice, sorghum, rye, barley, wheat, millet, oats, sugarcane, grass, triticale, switchgrass, wheatgrass, Thinopyrum, Aegilops, Secale, Haynaldia, Elyymus, Hordeum, soybean, canola, alfalfa, sunflower, cotton, or a species related to them. In one example, the plant phenotypic marker is from Thinopyrum ponticum, for example, chromosome 4E, and the fertility restoration locus from Hordeum vulgare (barley), for example, chromosome 4H, to produce a 4H-4E hybrid (chimeric) plant restoration donor chromosome component.In some embodiments, the hybrid (chimeric) plant restoration donor chromosome component includes the short arm of chromosome 4 from Hordeum vulgare (barley) and the long arm of chromosome 4E from Thinopyron ponticum, for example, from Blue Norco, to produce a hybrid (chimeric) plant restoration donor chromosome component of 4HS-4EL. The plant phenotypic marker and fertility restoration locus may be from any suitable lineages, including, but not limited to, disomic additions such as 4H from barley, chromosome 4E from Thinopyrum ponticum, 4E from Agropyron, or combinations thereof.

[0066] Confirmation can be made as to whether the plant, part of the plant, plant cell or seed contains the plant restoration donor chromosomal component, including the phenotypic marker or male fertility restoration locus or both, using routine and well-known methods. The donor chromosomal components of Petition 870260056100, dated 10 / 06 / 2026, page 54 / 125 42 / 64 Plant restoration must retain the activity of restoring male fertility in plants, particularly the ability to promote the development of male tissue. The male fertility status of the plant can be assessed by any suitable technique, for example, by observing the development of male plant tissue, such as by phenotyping anthers and seed clusters in individual plants. See, for example, Example 1 in this document.

[0067] The absence of the plant restoration donor chromosome component, for example, lost through crossing or mutation, may be evidenced by plants lacking the male fertility phenotype or by plants, plant parts, plant cells, or seeds lacking the phenotype conferred by the plant-derived phenotypic marker compared to a control. Alternatively, or additionally, confirmation of the presence or absence of the plant restoration donor chromosome component may occur later, for example, after multiple plant crossings or from subsequent generations.

[0068] Seeds produced from plants or crosses can be harvested together and separated into distinct populations if desired. For example, seeds comprising the plant-derived phenotypic marker for seeds linked to the fertility restoration locus are seeds that can be separated and selected for use as a maintainer, and seeds without the plant-derived phenotypic marker linked to the fertility restoration locus (chromosomal component) can be separated and selected for use as a maintainer. Petition 870260056100, dated 10 / 06 / 2026, p. 55 / 125 43 / 64 plant restoration donor) can be cultivated and used as female-sterile male parents in hybrid crosses. Seeds can be separated manually, mechanically, or optically in these populations. To facilitate high productivity and analysis, separation can employ a semi-automatic or automatic approach. Seed populations can be separated using optical sensing technology, including multi- or hyperspectral imaging, UV, visible, or NIR spectroscopy systems, and / or optical scanning. For example, when the plant phenotypic marker of the plant restoration donor chromosomal component is a color marker, such as aleurone, homozygous blue seed will be more intensely colored than heterozygous blue seed and can be separated on that basis, e.g., seeds with different concentrations or expression levels of blue aleurone. See, for example, FIG. 2.Additionally or alternatively, the seeds can be evaluated for the presence of the plant restoration donor chromosomal component, for example, the plant phenotypic marker, using any other suitable technique, including but not limited to flow cytometry or qPCR.

[0069] Alternatively, the seeds may be mixed (not separated) so that a first portion of the seeds contains one or more homozygous mutations of the male fertility polynucleotide (seeds that will give rise to male-sterile female plants) and a second portion of seeds contains one or more homozygous mutations of the fertility polynucleotide. Petition 870260056100, dated 10 / 06 / 2026, p. 56 / 125 44 / 64 male and the plant restoration donor chromosomal component comprising a plant-derived polynucleotide that confers the plant phenotypic marker linked to the male fertility restoration locus (seeds that will give rise to male-fertile plants). A plant phenotypic marker that is a seed color marker can be used to separate and select hybrid wheat or inbred wheat seeds from wheat maintainer seeds. In some examples, seed mixtures are planted together to increase the number of male-sterile female seeds produced. The seed mixture can be placed in a bag or other suitable container. The method may include planting the seed mixture of male and female parent plants in the same row in a field, rather than in separate rows.Male and female parent plants are cultivated, and the male parent plants fertilize the female parent plants to produce seeds. The resulting seeds will be a mixture of seeds that, when planted, will give rise to either male-sterile or male-fertile plants. In some examples, the percentage of seeds produced that will give rise to male-fertile plants may be at least about 20%, 25%, 30%, 35%, 40%, or 45% of the seeds produced. In some examples, the percentage of seeds produced that will give rise to male-sterile female plants is at least about 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90% of the seeds produced. In some respects, this method increases the number of seeds produced that will give rise to male-sterile female plants compared to the number of seeds. Petition 870260056100, dated 10 / 06 / 2026, page 57 / 125 45 / 64 female male-sterile seeds produced in a field where female-sterile seeds and male-sterile seeds are not planted together in the same row, but are each planted in separate rows from male and female rows.

[0070] Also provided in this document is a plant cell, plant, or seed obtained or produced from the methods described in this document. In some methods, a male-sterile female plant is fertilized with pollen from a plant comprising the plant-restoring donor chromosome component that complements the male-sterility condition of the female plant. This method produces seeds that may be a seed mixture which, when planted, give rise to male-sterile or male-fertile plants. The absence of the plant phenotypic marker in the seeds indicates that the seed lacks the plant-restoring donor chromosome component and, when planted, will give rise to male-sterile female plants. Plants from these seeds can be used as male-sterile female inbred plants for the production of hybrid seeds.The presence of the plant phenotypic marker in the seed indicates that the seed contains the plant restoration donor chromosome component and will give rise to male-fertile plants. Plants grown from this seed can be used as maintainers, if desired. The seed can be left unseparated, mixed with other seeds, or separated and selected into populations using routine techniques and instruments, as described elsewhere in this document and known to a person skilled in the art. Petition 870260056100, dated 10 / 06 / 2026, page 58 / 125 46 / 64

[0071] Since a male-sterile plant, for example, a male-sterile wheat plant, cannot be maintained on its own, compositions and methods for maintaining the homozygous recessive male sterility condition of the wheat plant are provided in this document, which include the use of a plant restoration donor chromosomal component for restoring the male fertility of the wheat plant. For example, a mutation in a gene critical for male fertility can confer a male-sterility phenotype to wheat plants when this mutant allele is in the homozygous state, for example, in endogenous wheat polynucleotides Ms1, Ms5, Ms9, Ms22, Ms26 and Ms45 which encode the wheat polypeptides Ms1, Ms5, Ms9, Ms22, Ms26 and Ms45, respectively.Since Ms1 in wheat behaves as a single recessive gene, in some embodiments, it may be that only the male fertility polynucleotide or ms1 allele located on chromosome 4BS needs to be mutated to confer male sterility to a wheat plant.

[0072] When a male fertility restoration locus that is able to functionally complement homozygous recessive alleles that confer male sterility is introduced and expressed in the male-sterile plant, male fertility is restored in the plant so that it can produce viable pollen and be able to fertilize a compatible female plant for crossing.

[0073] Maintaining the homozygous recessive condition or male-sterility condition may involve introducing a chromosomal component into the wheat plant. Petition 870260056100, dated 10 / 06 / 2026, p. 59 / 125 47 / 64 plant restoration donor to create a maintainer plant. The plant restoration donor chromosome component, after introduction into a plant that has one or more homozygous mutations of a male fertility polynucleotide, restores the plant's male fertility so that the plant produces viable pollen capable of fertilizing itself or fertilizing a compatible plant for crossing. In some embodiments, the plant restoration donor chromosome component may be present in the maintainer wheat plant as an additional chromosome in the wheat genome, as a chromosome translocated in the wheat genome, or as a chromosome that replaces a wheat chromosome in the wheat genome. Therefore, a wheat plant or cell is provided herein that has one or more of its wheat chromosomes replaced by a plant restoration donor chromosome component from a non-wheat plant or species.For example, in some embodiments, the wheat plant or cell has a pair of homologous chromosomes of two chromosomes. The first chromosome is native to the wheat plant, and the second chromosome comprises a plant restoration donor chromosome component. The plant restoration donor chromosome component may be translocated with, or may replace, any wheat chromosomes, provided it does not have a deleterious effect on the wheat plant. In some embodiments, the addition, translocation, or replacement must not interfere with one or more homozygous mutations in the wheat plant that confer the male-sterility phenotype. In some embodiments, the donor chromosome component... Petition 870260056100, dated 10 / 06 / 2026, p. 60 / 125 48 / 64 plant restoration can replace or be translocated on a wheat chromosome 5AL.

[0074] Wheat seeds from these plants with chromosomal substitutions are euploid, but have one or more chromosomes replaced by or containing the plant restoration donor chromosome component. Confirmation of the number of chromosomes in the wheat plant or cell or the translocation or substitution of the plant restoration donor chromosome component can be detected using any appropriate technique, such as genomic in situ hybridization (GISH) or fluorescent in situ hybridization (FISH).

[0075] The male-sterility condition of the wheat plant can be maintained by self-fertilization of the maintainer plant comprising the plant restoration donor chromosome component, which will result in the creation of a mixed seed population. A portion of the seeds will contain one or more homozygous male-sterility mutations and a portion of the seeds will contain one or more homozygous male-sterility mutations and the plant restoration donor chromosome component. The seeds resulting from the self-fertilization of the maintainer can be planted and the seeds from these plants separated and selected for use in maintaining male-sterility or producing hybrid seeds. In some examples, the selection process uses any suitable seed marker as a plant phenotypic marker to identify such seeds. Therefore, they are provided in the present Petition 870260056100, dated 10 / 06 / 2026, p. 61 / 125 49 / 64 document methods for producing seeds of a wheat plant by self-fertilization of the maintainer plant. In other embodiments, a male-sterile wheat plant homozygous for one or more mutations of a male fertility polynucleotide can be fertilized by pollen from a male-fertile plant with which it is compatible for crossing. In some respects, the male-fertile plant contains a plant restoration donor chromosome component.

[0076] Also included in this document are methods and compositions for restoring male fertility in a plant with one or more homozygous recessive mutations in a male fertility polynucleotide that confer male sterility to the plant. In some respects, the method includes the introduction of the plant restoration donor chromosomal component that functionally complements the male sterility phenotype of one or more homozygous mutations in the male-sterile wheat plant so that the wheat plant becomes male-fertile. The plant restoration donor chromosomal component may be introduced using any number of approaches as described in this document and known to a person skilled in the art.

[0077] The plants or plant restoration chromosome component for use in the methods and compositions described herein may be a monocotyledonous plant or a dicotyledonous plant. Monocotyledonous plants include, but are not limited to, maize, rice, sorghum, rye, barley, wheat, millet, oats, triticale, fonio, sugarcane, grass, switchgrass, Thinopyrum, Petition 870260056100, dated 10 / 06 / 2026, p. 62 / 125 50 / 64 Dicotyledonous plants include, but are not limited to, soybeans, canola, alfalfa, sunflower, cotton, tobacco, peanuts, potatoes, Arabidopsis, or safflower, or a species related to them. Additional definitions:

[0078] As used in this document and the accompanying claims, the singular forms a, an, or include plural references unless the context clearly states otherwise. Therefore, for example, reference to a plant includes a plurality of such plants, reference to a cell includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

[0079] The term crossbreeding or crossbreeding, in the context of this disclosure, means the fusion of gametes through pollination to produce offspring (i.e., cells, seeds, or plants). The term encompasses both sexual crossbreeding (the pollination of one plant by another) and self-fertilization (self-pollination, i.e., when the pollen and ovule (or microspores and megaspores) are from the same plant or genetically identical plants).

[0080] Expression generally refers to the production of a functional product. For example, the expression of a nucleic acid fragment may refer to the transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and / or translation of mRNA into a precursor or mature protein. Petition 870260056100, dated 10 / 06 / 2026, page 63 / 125 51 / 64

[0081] Gamete refers to a reproductive cell with the 1n (haploid number) set of chromosomes that can fuse with another gamete of the opposite sex during fertilization in sexually reproducing organisms. As used in this document, a gamete in asexually reproducing organisms refers to a cell with a 2n (non-reduced number) set of chromosomes.

[0082] The term genome refers to the entire complement of genetic material (genes and non-coding sequences) that is present in each cell of an organism, or virus or organelle; and / or a complete set of chromosomes inherited as a single (haploid) unit from a parent.

[0083] As used in this document, a male-sterile plant is a plant that does not produce viable male gametes or otherwise have the capacity for fertilization and is female-fertile.

[0084] The term plant refers to whole plants, plant organs, plant tissues, seeds, plant cells, seeds and their progeny. Plant cells include, but are not limited to, seed cells, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, buds, gametophytes, sporophytes, pollen and microspores. Plant parts include differentiated and undifferentiated tissues which include, but are not limited to, roots, stems, buds, leaves, pollen, seeds, tumor tissue and various cell and culture forms (e.g., individual cells, protoplasts, embryos and callus tissue). Plant tissue may be Petition 870260056100, dated 10 / 06 / 2026, page 64 / 125 52 / 64 in a plant or in a plant cell, tissue, or organ culture. The term "plant organ" refers to plant tissue or a group of tissues that constitute a morphologically and functionally distinct part of a plant.

[0085] “Polynucleotide”, “nucleic acid sequence”, “nucleotide sequence” or nucleic acid fragment are used interchangeably and are a single- or double-stranded polymer of RNA or DNA, optionally containing synthetic, non-natural or altered nucleotide bases.

[0086] As used in this document, “polynucleotide” includes reference to a deoxyribopolynucleotide, ribopolynucleotide, or analogues thereof that have the essential nature of a natural ribonucleotide in that they hybridize, under stringent hybridization conditions, with substantially the same nucleotide sequence as naturally occurring nucleotides and / or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide may be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as to the sequence complementary to it. Thus, DNAs or RNAs with backbones modified for stability or other reasons are “polynucleotides” as that term is intended in this document.Furthermore, DNAs or RNAs that comprise unusual bases, such as inosine, or modified bases, such as trityped bases, to name just a few. Petition 870260056100, dated 10 / 06 / 2026, page 65 / 125 53 / 64 two examples, are polynucleotides, as the term is used in this document.

[0087] Polypeptide, peptide, “amino acid sequence” and protein are used interchangeably in this document to refer to a polymer of amino acid residues.

[0088] Progeny includes any subsequent generation of a plant.

[0089] A functional promoter in a plant is a promoter capable of controlling transcription in plant cells, whether its origin is from a plant cell or not.

[0090] As used in this document, promoter includes reference to a region of DNA upstream of the transcription start site and involved in the recognition and binding of RNA polymerase and other proteins to initiate transcription.

[0091] A plant promoter is a promoter capable of initiating transcription in plant cells.

[0092] The terms suppress, suppressed, suppression, suppressing and silencing are used interchangeably in this document and include lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing. Gene silencing or silencing does not specify the mechanism and is inclusive of, but not limited to, antisense, cosuppression, viral suppression, hairpin-shaped suppression, stem-loop suppression, RNAi-based approaches and small RNA-based approaches and the like.

[0093] As used in this document, the term wheat refers to any species of the genus Triticum, including its parents as well as its offspring. Petition 870260056100, dated 10 / 06 / 2026, page 66 / 125 54 / 64 through crosses with other species. Wheat includes "hexaploid wheat," which has a genomic organization of AABBDD, composed of 42 chromosomes, and "tetraploid wheat," which has a genomic organization of AABB, composed of 28 chromosomes. Hexaploid wheat includes *T. aestivum*, *T. spelta*, *T. mocha*, *T. compactum*, *T. sphaerococcum*, *T. vavilovii*, and interspecies crosses of these. Tetraploid wheat includes *T. durum* (also called durum wheat or *Triticum turgidum* ssp. *durum*), *T. dicoccoides*, *T. dicoccum*, *T. polonicum*, and interspecies crosses of these. Furthermore, the term "wheat" includes possible progenitors of *Triticum* sp. Hexaploid or tetraploid, such as T. uartu, T. monococcum or T. boeoticum for genome A, Aegilops speltoides for genome B and T. tauschii (also known as Aegilops squarrosa or Aegilops tauschii) for genome D. A wheat cultivar for use in this disclosure may belong to, but is not limited to, any of the species mentioned above.Also included are plants produced by conventional techniques using Triticum sp. as a parent in a sexual cross with a non-Triticum species, such as rye (Secale cereale), including, but not limited to, Triticale. In some respects, the wheat plant is suitable for commercial grain production, such as commercial varieties of hexaploid wheat or durum wheat, with suitable agronomic characteristics that are known to those skilled in the art. EXAMPLES

[0094] In the following examples, unless otherwise specified, parts and percentages are in Petition 870260056100, dated 10 / 06 / 2026, page 67 / 125 55 / 64 weight, and the degrees are Celsius. It should be understood that these Examples, while indicating concretizations of the disclosure, are given for illustrative purposes only. Based on the above discussion and these examples, a person skilled in the art may make various alterations and modifications to the disclosure to adapt it to various uses and conditions. Such modifications are also intended to be covered by the scope of the appended claims. EXAMPLE 1: A monotelosomal chromosome from Thinopyrum ponticum can complement triple mutations of Ms45 and restore fertility.

[0095] As demonstrated in this document, the 4EL chromosome of Blue Norco is capable of complementing the Tams45-abd mutations. Blue Norco, a blue aleurone wheat, is a ditellosomic addition line that possesses an extra set of 4EL (2n = 42” + 2t) that is available from USDA-ARS (PI 542465). Tams45-abd plants were crossed with Blue Norco as the male parent. The crossed seeds (blue in color) were planted and the F1 progeny screened to confirm the presence of the TaMS45-A, -B, and -D mutations and allowed to self-pollinate.

[0096] Light blue F2 seeds (monosomic for 4EL (i.e., one copy of 4EL) plants were planted, and the progeny were genotyped for mutant alleles of TaMs45 and allowed to self-pollinate and establish seeds. From the seeds harvested from these plants, 64 light blue seeds (with 4EL) and 64 white seeds (without 4EL) were each planted to obtain F3 plants that were genotyped for mutant alleles of TaMs45. Triple homozygous mutant (Tams45-abd) grain plants Petition 870260056100, dated 10 / 06 / 2026, page 68 / 125 56 / 64 white and blue seeds were identified and analyzed for male fertility through anther phenotyping and seed set analysis in individual plants. In total, 12 triple homozygous Tams45-abd plants were analyzed, six with white seeds and six with blue seeds (Table 2). The anthers of the white-seeded Tams45-abd plants were wrinkled in shape and smaller in size, while the anthers of the blue-seeded Tams45-abd plants were similar to wild-type plants (FIG. 1). All six Tams45-abd plants carrying the 4EL chromosome were male-fertile with seed sets comparable to wild-type plants, while the six plants without the 4EL chromosome showed insignificant seed sets (Table 2; Note: the seeds observed in these plants were probably due to open fertilization, since these heads were not bagged and these plants were very close to plants with fertile flowers).

[0097] To test an operational male-sterile maintenance system based on blue and white selection, seeds from fertile F3 plants were harvested, and 12 visually separated white and light blue seeds from three F3 plants (total = 36 white and blue seeds each) were planted to obtain the F4 generation. All 36 plants from the white seeds were male-sterile, while all 36 plants from the blue seeds were male-fertile (Table 2). These data demonstrate that a monosomic 4EL chromosome can complement and restore male fertility and maintain triple homozygous Tams45 mutants. Furthermore, it is possible to identify from the seeds of a plant Petition 870260056100, dated 10 / 06 / 2026, page 69 / 125 57 / 64 maintainer, based on color, the seed that will produce a male-sterile or male-fertile plant. Table 2. Complementation of homozygous triple mutants of TaMs45 with chromosome 4EL. Genotype of TaMs451 homologs Seed set Fertility Male-fertile plants Male-sterile plants Plants Total seeds Seeds per plant F3 generation Tams45-abd + 4EL 6 1635 272 6 0 Tams45-abd 6 68* 11 0 6 F4 generation Tams45-abd + 4EL 36 4858 135 36 0 Tams45-abd 36 0 0 0 36 TaMs45-ABD 5 855 171 5 0 *Note: the heads were not bagged and grew near fertile plants at the same stage. EXAMPLE 2: The production of a 4HS-4EL hybrid chromosome

[0098] In this example, a 4HS-4EL hybrid chromosome is created using a Robertsonian translocation. For example, aneuploid stocks can be used to create Robertsonian translocations in a targeted manner by producing the appropriate plant restoration donor chromosome component in monosomic condition. A Chinese Spring wheat line that has a disomic addition (2n=44) of the Betzes barley 4H chromosome was used in this example. (O Petition 870260056100, dated 10 / 06 / 2026, page 70 / 125 58 / 64 stock wheat TA#3700, which has a disomic addition (2n=44) of chromosome 4H from Hordeum vulgare (barley), was obtained from the Kansas State Wheat Genetics Resource Center. (University, USA) The Blue Baart wheat variety, which has a disomic addition (2n=44) of chromosome 4E from Thinopyrum ponticum and possesses a blue aleurone, was used in this example. (Buresová V, Kopecky D, Bartos J, Martinek P, Watanabe N, Vyhnánek T, and Dolezal J. 2015. “Variation in genome composition of blue-aleurone wheat”. Theor. Appl. Genet. 128: 273-282) A cross was performed between these two lines, and the resulting F1 seeds were cultivated and the plants allowed to self-pollinate. The presence of a new 4HS-4EL chromosome in the F2 or F3 generations can be tracked using any suitable method, for example, regarding the presence of blue color, indicative of the presence of 4EL, the absence of markers for 4ES, the presence of a 4HS marker, such as Mmag 053, and the absence of a 4HL marker, such as HVM40 (Molnár I, Linc G, Dulai S, Nagy ED and Molnár-Láng MM. 2007. Ability of the 4H chromosome to compensate for 4D in response to drought stress in a newly developed and identified 4H (4D) disomic replacement line of wheat and barley.Candidate lineages can be further screened, for example, using standard cytogenetic techniques such as GISH (genomic in situ hybridization) to confirm the presence of a hybrid 4HS-4EL chromosome. EXAMPLE 3: The use of a CRISPR-Cas9-induced pericentric inversion to place Ms1 and Ba1 on the same chromosome arm. Petition 870260056100, dated 10 / 06 / 2026, page 71 / 125 59 / 64

[0099] In this example, pericentric inversions are used in wheat to place the Ms1 and Ba1 genes on the same chromosome arm in cases where the complement (homolog) of Ms1 and the Ba1 gene are on different chromosome arms, for example, located on 4ES or 4HS and 4EL, respectively. An advantage of this approach is that it would place the Ms1 and Ba1 trait genes on the same chromosome arm and avoid their separation due to a chromosome break at the centromere and possible misclassification of seeds as male-sterile when they are actually male-fertile.

[0100] In this example, the starting material can use the 4HS-4EL chromosome described in Example 2 in this document. Two QFDs will be induced: one between the Ms1-H gene and the 4HS telomere, and one between the Ba1 gene and the 4HS-4EL centromere. The barley Ms1-H gene is oriented with the 5' end closer to the telomere and the 3' end closer to the centromere. The 5' DNA sequence of the Ms1-H gene (http: / / plants.ensembl.org / Hordeum_vulgare / Tools / Blast) will be analyzed for the NGG sequence of the protospacer adjacent motif (PAM) for cas9. For each site found, the upstream 17 bp sequence will be evaluated to find a unique cleavage site that is not present in the wheat genome.

[0101] Marker fragments located on the long arm of chromosome 4J (4Eb) and situated between the centromere and the BaThb gene will be cloned and sequenced; the resulting sequences will be analyzed for the NGG motif sequence. Petition 870260056100, dated 10 / 06 / 2026, page 72 / 125 60 / 64 adjacent to the protospacer (PAM) for Cas9. For each site, the upstream 17 bp sequence will be evaluated to find a unique cleavage site that is not present in the wheat genome.

[0102] Once suitable site(s) and guide RNAs for the two locations have been identified, the two QFDs will be induced by CRISPR-Cas9 using standard methods. At a given frequency, the chromosomal fragment containing the centromere and Ms1-H will be reattached to the telomeric ends in the opposite orientation, resulting in a pericentric inversion, with Ms1-H and Ba1 now located on the same arm of the new chromosome. PCR primers will be designed that produce a PCR product only when the pericentric inversion has occurred. EXAMPLE 4: An alternative construction for a 4E-ms45 system

[0103] This example describes an embodiment of constructing a hybridization system using 4E-ms45. Instead of the seed color marker (blue aleurone=BA) and the functional dominant Ms45 allele being provided by an additional telocentric chromosome, such as 4EL, the 4EL chromosome arm will be translocated to the wheat genome, replacing an existing wheat chromosome arm.

[0104] The appropriate choice of the targeted wheat chromosome arm for 4EL replacement may confer some advantages over an independent (additional) 4EL. One possible advantage is the reduced gametic transmission of the additional telosomal chromosome, for example, a reduced male and / or female transmission rate. This will allow Petition 870260056100, dated 10 / 06 / 2026, page 73 / 125 61 / 64 that a higher percentage of non-blue seeds will be produced during female seed increase (self-pollination). In this example, 4EL will replace the wheat chromosome arm 5AL. Gametes containing a 5AS-4EL chromosome will not have a copy of 5AL. See, for example, FIG. 4.

[0105] Even in the case of reduced male and / or female transmission rates, some homozygous 4EL (blue) seeds may be produced. The presence of these homozygous blue seeds can be identified and detected by seed separation. For example, homozygous blue seeds will be more intensely colored than heterozygous blue seeds and can be separated on this basis. A homozygous 5AS-4EL plant is believed to likely be male-sterile, so little or no seed separation would be necessary to remove such seeds from the blue seed population.

[0106] A 5AS-4EL chromosome can be created using a Robertsonian translocation. In this example, aneuploid stocks can be used to create Robertsonian translocations of the wheat plant restoration donor chromosome component in a manner directed by producing the appropriate wheat plant restoration donor chromosome components in monosomic condition. An aneuploid wheat line, Chinese Spring, which segregated to wheat chromosome 5A monosomy was used in this example. (Stock TA#3045, which segregates to wheat chromosome 5A monosomy, was obtained from Wheat) Petition 870260056100, dated 10 / 06 / 2026, page 74 / 125 62 / 64 (Genetics Resource Center, Kansas State University, USA) The Blue Baart wheat variety, which has a disomic addition (2n=44) of chromosome 4E from Thinopyron ponticum and possesses a blue aleurone, was used in this example (Buresová V, Kopecky D, Bartos J, Martinek P, Watanabe N, Vyhnánek T, and Dolezal J. 2015. “Variation in genome composition of blue-aleurone wheat”. Theor. Appl. Genet. 128:273-282). Ten seeds of the aneuploid wheat line from Chinese Spring that segregates for monosomy of wheat chromosome 5A were cultivated, root tips were sampled, and chromosome counts were performed using standard methods to identify monosomic plants (2n-1=41). Monosomic plants produce ~75% nullisomic female gametes (n-1=20). The identified monosomic plants were crossed as females with Blue Baart. The F1 seeds produced from nullisomic gametes will have a composition of 42 chromosomes, including 1 5A + 1 4E, both derived from the male parent. Blue Baart and have a blue aleurone color. The F1 seeds were grown and the plants allowed to self-pollinate.

[0107] The presence of a new 5AS-4EL chromosome can be tracked by any suitable method, for example, by the presence of blue aleurone seed color, indicative of the presence of 4EL, and the absence of markers for 4ES. This would indicate a break in chromosome 4E. Candidate lines can be further tracked, for example, using standard cytogenetic techniques such as FISH (fluorescence in situ hybridization) to confirm the presence of a hybrid 5AS / 4EL chromosome. Petition 870260056100, dated 10 / 06 / 2026, page 75 / 125 63 / 64

[0108] Once established, such lines will be self-pollinated to confirm the male sterility of 5AS / 4EL homozygotes, as well as reciprocally crossed as male and female to determine pollen and egg transmission frequencies. The 5AS / 4E chromosome can be introgressed along with recessive ms45 alleles in 4A, 4B, and 4D into several elite female lines to facilitate hybrid seed production. EXAMPLE 5: The use of 4E or 4H addition chromosomes to complement triple mutations of wheat Ms9 and restore fertility.

[0109] In this example, a wheat CAS9-CRISPR construct was produced targeting the TA-Ms9 gene using a guide, TA-Ms9-CR2 ggaggtacaccaactacctg (SEQ ID NO:40).

[0110] Wheat plants will be transformed with this construct and the endogenous wheat Ms9 genes will be evaluated for mutations in all three wheat genomes. Subsequent crosses and self-pollinations will be performed to combine Ms9 mutations as homozygous in a single plant. Wheat plants homozygous for Ms9 mutations in all three genomes will be evaluated for male sterility by examining anthers and seed sets in individual plants.

[0111] If male sterility is achieved, these wheat plants can be maintained by crossing them with a wheat maintenance line containing an additional 4EL chromosome, such as Blue Norco, described in Example 1. The TA-Ms9 gene is mapped to the long arm of chromosome 4 in wheat, which has synteny with the long arm of chromosome 4. Petition 870260056100, dated 10 / 06 / 2026, page 76 / 125 64 / 64 addition of 4EL, which should provide a complementary function to the TA-ms9 mutation, restoring male fertility. A wheat line containing barley chromosome 4 as an addition chromosome (4H from Hordeum vulgare) can also be evaluated for possible Ta-ms9 restoration. The restoration of male fertility in these male-sterile wheat plants by the 4E, 4EL, or 4H addition chromosomes in the wheat maintainer line will be evaluated by the ability to complement ms9 mutations in these plants, as determined by examination of anthers and seed set in individual plants.

[0112] As described in Example 1, the 4EL addition chromosome also contains the blue aleurone (BA) gene on the long arm, which provides a dominant blue seed phenotype. Therefore, seeds from the self-pollinated homozygous TA-ms9 mutant restored with the presence of the 4EL addition chromosome will segregate into blue and non-blue seeds. These resulting seeds can be grown and evaluated for male fertility and male sterility. As demonstrated in Example 1, it is expected that plants derived from non-blue seeds will be male-sterile and plants derived from blue seeds will be male-fertile, and the latter can act as a maintainer line for the TA-ms9 mutation in a hybrid system. Petition 870260056100, dated 10 / 06 / 2026, page 77 / 125

Claims

1 / 14 CLAIMS 1. A method for restoring male fertility in a male-sterile plant, characterized in that it comprises: (a) introducing into a male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26, wherein the plant exhibits male sterility due to the presence of one or more mutations in an endogenous male fertility polynucleotide, a plant restoration donor chromosomal component comprising one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more modified Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci;and (b) the restoration of male fertility in the male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by complementing the male-sterility phenotype of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by the plant restoration donor chromosomal component, wherein the expression of the plant restoration donor chromosomal component functionally complements the male-sterility phenotype caused by one or more mutations of Ms1, Ms5, Ms9, Ms22, and / or Ms26 in the endogenous male fertility polynucleotide in the male-sterile plant such that the male-sterile plant becomes male-fertile.

2. Method for restoring male fertility in a male-sterile plant characterized in that it comprises: Petition 870260056100, dated 10 / 06 / 2026, page 78 / 125 2 / 14 (a) the introduction into a male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26, wherein the plant exhibits male sterility due to the presence of one or more mutations in an endogenous male fertility polynucleotide of a plant restoration donor chromosomal component comprising one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci;and (b) the restoration of male fertility in the male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by complementing the male-sterility phenotype of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by the plant restoration donor chromosomal component, wherein the expression of the plant restoration donor chromosomal component functionally complements the male-sterility phenotype caused by one or more mutations of Ms1, Ms5, Ms9, Ms22, and / or Ms26 in the endogenous male fertility polynucleotide in the male-sterile plant such that the male-sterile plant becomes male-fertile.

3. Method for restoring male fertility in a male-sterile plant characterized in that it comprises: (a) the introduction into a male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26, in which the plant exhibits male sterility due to the presence of one or more mutations in an endogenous male fertility polynucleotide, of a plant restoration donor chromosomal component comprising one or more polynucleotides derived from Petition 870260056100, dated 10 / 06 / 2026, p.79 / 125 3 / 14 plant that confer a plant phenotypic marker linked to one or more modified Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci; and (b) the restoration of male fertility in the male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by complementing the male-sterility phenotype of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by the plant restoration donor chromosomal component, wherein the expression of the plant restoration donor chromosomal component functionally complements the male-sterility phenotype caused by one or more mutations of Ms1, Ms5, Ms9, Ms22, and / or Ms26 in the endogenous male fertility polynucleotide in the male-sterile plant such that the male-sterile plant becomes male-fertile.

4. Seed production method characterized in that it comprises: crossing a male-sterile plant, wherein the male-sterile plant exhibits male sterility due to the presence of one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations in an endogenous male fertility polynucleotide, with a seed-producing plant, wherein the plant comprises: - a plant restoration donor chromosomal component, wherein the plant restoration donor chromosomal component comprises one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci, wherein the expression of the plant restoration donor chromosomal component functionally complements a phenotype. Petition 870260056100, dated 10 / 06 / 2026, p. 80 / 125 4 / 14 of male sterility caused by one or more mutations of Ms1, Ms5, Ms9, Ms22,and / or Ms26 of a male fertility polynucleotide so that a male-sterile plant with one or more mutations of Ms1, Ms5, Ms9, Ms22, and / or Ms26 becomes male-fertile; or - a plant restoration donor chromosomal component, wherein the plant restoration donor chromosomal component comprises one or more modified plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci, wherein the expression of the plant restoration donor chromosomal component functionally complements a male-sterility phenotype caused by one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations of a male fertility polynucleotide such that a male-sterile plant with one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations becomes male-fertile; or - a plant restoration donor chromosomal component,wherein the plant restoration donor chromosomal component comprises one or more plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more modified Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci, wherein the expression of the plant restoration donor chromosomal component functionally complements a male-sterility phenotype caused by one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations of a male fertility polynucleotide such that a male-sterile plant with one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations becomes male-fertile; or - a plant restoration donor chromosome component,wherein the plant restoration donor chromosomal component comprises one or more plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 male fertility restoration loci, wherein one or more functionally complement a male-sterility phenotype caused by one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations of a male fertility polynucleotide such that a male-sterile plant with one or more Ms1, Ms5, Ms9, Ms22, and / or Ms26 mutations becomes male-fertile, and wherein the plant-derived polynucleotide and the male fertility restoration loci are at different locations in the plant restoration donor chromosomal component than their native locations in the plant restoration donor chromosomal component.

5. Method for restoring male fertility in a male-sterile plant characterized in that it comprises: (a) the introduction into a male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26, in which the plant exhibits male sterility due to the presence of one or more mutations in an endogenous male fertility polynucleotide, of a plant restoration donor chromosomal component comprising one or more plant-derived polynucleotides that confer a plant phenotypic marker linked to one or more male fertility restoration loci. Petition 870260056100, dated 10 / 06 / 2026, p.82 / 125 6 / 14 of Ms1, Ms5, Ms9, Ms22, and / or Ms26, wherein the plant-derived polynucleotide and a male fertility restoration locus are in different locations on the plant-restoration donor chromosome component than their native locations on the plant-restoration donor chromosome component; and (b) the restoration of male fertility in the male-sterile plant of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by complementing the male-sterility phenotype of Ms1, Ms5, Ms9, Ms22, and / or Ms26 by the plant restoration donor chromosomal component, wherein the expression of the plant restoration donor chromosomal component functionally complements the male-sterility phenotype caused by one or more mutations of Ms1, Ms5, Ms9, Ms22, and / or Ms26 in the endogenous male fertility polynucleotide in the male-sterile plant such that the male-sterile plant becomes male-fertile.

6. Method according to claim 5, characterized in that one or more plant-derived polynucleotides conferring a plant phenotypic marker and one or more male fertility restoration loci: - are located on the same side of the centromere of the plant restoration donor chromosomal component; or - have less physical distance between them compared to the physical distance between the plant-derived polynucleotide and the male fertility restoration locus when located in their native locations; or Petition 870260056100, dated 10 / 06 / 2026, p. 83 / 125 7 / 14 - have a lower recombination frequency compared to the recombination frequency when located in their native locations; or - have a lower recombination frequency compared to the recombination frequency when the plant-derived polynucleotide and the male fertility restoration locus are located in their native locations.

7. A method according to claim 5, characterized in that one or more plant-derived polynucleotides and one or more male fertility restoration loci are inserted into locations other than their native locations in the plant-restoration donor chromosome component using gene editing technology, chromosome rearrangement, or combinations thereof.

8. Method according to claim 5, characterized in that plant-derived polynucleotides are phenotypic seed markers.

9. A method according to claim 5, characterized in that the plant restoration donor chromosomal component comprises two or more plant-derived polynucleotides that confer a plant phenotypic marker, wherein the two or more plant-derived polynucleotides that confer a plant phenotypic marker are preferably different or the same from each other.

10. Method according to claim 5, characterized in that the male-sterile plants comprise one or more homozygous mutations in the endogenous male fertility polynucleotide. Petition 870260056100, dated 10 / 06 / 2026, p. 84 / 125 8 / 14 11. Method according to claim 5, characterized in that the plant restoration donor chromosome component comprises two or more male fertility restoration loci.

12. Method, according to claim 5, characterized in that the two or more loci of male fertility restoration are different or the same from each other.

13. Method for restoring male fertility in a male-sterile plant characterized in that it comprises: (a) the introduction into a male-sterile plant of a plant-restoration donor chromosomal component comprising a plant-derived polynucleotide that confers a plant phenotypic marker linked to a male fertility restoration locus of Ms1, Ms5, Ms9, Ms22, or Ms26, wherein the male-sterile plant comprises one or more homozygous mutations of a male fertility polynucleotide of Ms1, Ms5, Ms9, Ms22, or Ms26 that causes male sterility;and (b) the restoration of male fertility in the male-sterile plant by complementing the male-sterility phenotype with the plant-restoration donor chromosomal component, wherein the expression of the plant-restoration donor chromosomal component functionally complements the male-sterility phenotype caused by one or more Ms1, Ms5, Ms9, Ms22, or Ms26 mutations in the endogenous male fertility polynucleotide in the male-sterile plant, so that the male-sterile plant becomes male-fertile.

14. A method according to any one of claims 1, 2, 3, 5, or 13, characterized in that the male fertility polynucleotide is a male fertility polynucleotide of Ms1, Ms5, Ms9, Ms22, or Ms26; or - the plant is a monocotyledon or dicotyledon; or - the plant is a wheat plant; or - the plant restoration donor chromosome component is derived from a plant species other than wheat; or - the plant restoration donor chromosome component is from a species of Thinopyrum, Aegilops, Secale, Haynaldia, Elymus, or Hordeum; or - the plant restoration donor chromosome component comprises chromosome 4E, 4EL, or 4H of Thinopyrum, Aegilops, Secale, Haynaldia, Elymus, or Hordeum; or - the plant phenotypic marker is a seed color, physiology, or morphology marker; or - the plant phenotypic marker is a blue aleurone color marker, P gene, anthocyanin, or Kala 4;or - one or more modified male fertility restoration loci have been inserted, edited, replaced, or repositioned within the plant restoration donor chromosome component; or - one or more modified plant-derived polynucleotides that confer a plant phenotypic marker have been inserted, edited, replaced, or repositioned within the plant restoration donor chromosome component; or - one or more modified male fertility restoration loci have been modified in their polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosome component compared to an unmodified male fertility restoration locus;or - one or more modified plant-derived polynucleotides that confer a plant phenotypic marker have been modified in their polynucleotide sequence, copy number, expression level, or location within the plant restoration donor chromosomal component compared to an unmodified plant-derived polynucleotide that confers a plant phenotypic marker; or - one or more modified male fertility restoration loci and one or more modified plant-derived polynucleotides that confer a plant phenotypic marker are located on the same side of the centromere of the plant restoration donor chromosomal component;or - one or more modified male fertility restoration loci and one or more modified plant-derived polynucleotides that confer a plant phenotypic marker have a smaller physical distance between them compared to the physical distance between an unmodified male fertility restoration locus and an unmodified plant-derived polynucleotide that confers a plant phenotypic marker on the plant restoration donor chromosome component;or - one or more modified male fertility restoration loci and one or more modified plant-derived polynucleotides that confer a plant phenotypic marker have a decreased recombination frequency compared to the recombination frequency between an unmodified male fertility restoration locus and an unmodified plant-derived polynucleotide that confers a plant phenotypic marker on the plant restoration donor chromosomal component; or - one or more modified male fertility restoration loci and one or more modified plant-derived polynucleotides that confer a plant phenotypic marker have a lower crossover frequency compared to the crossover frequency for an unmodified male fertility restoration locus and an unmodified plant-derived polynucleotide that confers a plant restoration donor phenotypic marker chromosomal component;or - one or more modified plant-derived polynucleotides and one or more modified male fertility restoration loci are inserted at locations other than their native locations in the plant-restoration donor chromosome component using gene editing technology, chromosome rearrangement, or combinations thereof; or - one or more modified plant-derived polynucleotides are phenotypic seed markers; or Petition 870260056100, dated 10 / 06 / 2026, page 88 / 125 12 / 14 - the plant-restoration donor chromosome component comprises two or more modified plant-derived polynucleotides that confer a plant phenotypic marker; or - the two or more modified plant-derived polynucleotides that confer a plant phenotypic marker are different or the same with respect to each other;or - the plant comprises one or more homozygous mutations in an endogenous male fertility polynucleotide that confers male sterility; preferably wherein the plant restoration donor chromosomal component comprises two or more modified male fertility restoration loci; more preferably wherein the two or more modified male fertility restoration loci are different or identical with respect to each other.

15. Method, according to any one of claims 1, 2, 3 or 5, characterized in that the sterile male plant comprises homozygous triple mutations in the endogenous male fertility polynucleotide of Ms1, Ms5, Ms9, Ms22 or Ms26.

16. Method, according to any one of claims 1, 2, 3 or 5, characterized in that the plant restoration donor chromosomal component comprises a 4E chromosomal component from Thinopyrum, Agropyron or Elymus, or a 4H chromosomal component from Hordeum, wherein the plant restoration donor chromosomal component comprises a plant-derived polynucleotide that confers a plant phenotypic marker linked to the male fertility restoration locus. Petition 870260056100, dated 10 / 06 / 2026, p. 89 / 125 13 / 14 17. A method according to any one of claims 1, 2, 3 or 5, characterized in that the donor chromosome component for plant restoration restores plant fertility without recombining with wheat chromosomes.

18. A method according to any one of claims 1, 2, 3 or 5, characterized in that the method comprises introducing the donor chromosomal component for plant restoration by means of crossing with a selected fertile male plant of wheat, barley, oats, prairie wheat, rye or a related species thereof.

19. Method, according to any one of claims 1, 2, 3 or 5, characterized in that the phenotypic marker of the plant is a color marker selected from blue aleurone, gene P, anthocyanin or Kala 4.

20. A method according to any one of claims 1, 2, 3 or 5, characterized in that the donor chromosome component for plant restoration is a monosomic replacement for a wheat chromosome.

21. Method according to claim 20, characterized in that the donor chromosome component for plant restoration is part of a pair of homeologous chromosomes, wherein a first chromosome is native to the plant and a second chromosome comprises the donor chromosome component for plant restoration.

22. Method, according to any one of claims 1, 2, 3 or 5, characterized in that the donor chromosome component for plant restoration comprises a 4EL chromosome from Thinopyrum ponticum. Petition 870260056100, dated 10 / 06 / 2026, pp. 90 / 125 14 / 14 23. Method, according to any one of claims 1, 2, 3 or 5, characterized in that the plant restoration donor chromosome component is present as a chromosome replaced by a 5AL wheat chromosome via a Robertsonian translocation. Petition 870260056100, dated 10 / 06 / 2026, pp. 91 / 125

Images