A derivative of rapamycin or a pharmaceutically acceptable salt thereof, pharmaceutical composition and combination, and its uses.

Description

1 / 105 A derivative of rapamycin or a pharmaceutically acceptable salt thereof, pharmaceutical composition and combination, and its uses. Divided from BR112020005898-0, filed on 25.9.2018 PRIORITY CLAIM

[0001] This application claims priority over U.S. 62 / 563,312, filed September 26, 2017, which is incorporated herein by reference in its entirety. FIELD

[0002] The invention provides derivatives of 32-desoxorrapamycin and relates to their methods of use. BACKGROUND

[0003] In mammalian cells, the target kinase of rapamycin (mTOR) exists in two distinct multiprotein complexes, described as the mTORC1 complex and the mTORC2 complex, both of which sense the availability of nutrients and energy and integrate information from growth factor stimulation and stress signaling. mTORC1 integrates signals from growth factors and nutrients and controls cell growth and metabolism. Laplante M. et al. Cell. (2012) 149(2):274-93. mTORC1 is a key regulator of protein translation and autophagy. The mTORC1 complex is sensitive to allosteric mTOR inhibitors, such as rapamycin and rapamycin analogs (so-called rapalogs).The mode of action of rapamycin and previously produced rapalogs involves the formation of an intracellular complex with FK506-binding proteins, FKBP12, FKBP51, or FKBP52 (these three FKBPs will be referred to herein as FKBP or FKBPs), followed by the binding of the FKBP-rapalog complex to the FRB (FK506-rapamycin binding) domain of mTOR. This interaction of the FKBP-rapalog complex with mTORC1 results in allosteric inhibition of the complex. Rapamycin and rapalogs, such as RAD001 (everolimus; Afinitor®), have gained clinical relevance by inhibiting mTORC1 activity, which is associated with both benign and malignant proliferation disorders. Royce ME et al. Breast Cancer (Auckl). (2015) 9:73-79; Pleniceanu O. et al. Kidney Int Rep. (2018) 3(1):155-159. Petition 870260074748, dated 07 / 27 / 2026, p. 11 / 295 2 / 105

[0004] Rapamycin is a known macrolide antibiotic produced by Streptomyces hygoscopius, see, for example, McAlpine, JB, et al., J. Antibiotics (1991) 44:688; Schreiber, SL; et al., J. Am. Chem. Soc. (1991) 113:7433; U.S. Pat. No. 3,929,992. The following numbering convention for rapamycin and its derivatives used in this document is shown below:

[0005] Rapamycin is a potent immunosuppressant and has also demonstrated antitumor and antifungal activity. It has been shown to be useful in the prevention or treatment of systemic lupus erythematosus, pulmonary inflammation, insulin-dependent diabetes mellitus, skin disorders such as psoriasis, smooth muscle cell proliferation and intimal thickening after vascular injury, adult T-cell leukemia / lymphoma, malignant carcinomas, inflammatory heart disease, anemia, and increased neurite growth. Its usefulness as a pharmaceutical product, however, is limited by its very low and variable bioavailability. In addition, rapamycin is challenging to formulate, making it difficult to obtain stable galenic compositions.

[0006] To overcome these problems, numerous rapalogs have been (semi)synthesized. Water-soluble prodrugs have been prepared by derivatizing rapamycin at C28 and 40 to form glycinate, propionate, and pyrrolidine butyrate prodrugs (USPat. No. 4,650,803). Other rapamycin analogs include monoacyl and diacyl analogs (US 4,316,885), acetal analogs (US Pat. No. 5,151,413), silyl ethers (US Pat. No. 5,120,842), hydroxy esters (US Pat. No. 5,362,718), as well as aryl, alkyl, alkenyl, and alkynyl analogs (US Pat. Nos. 5,665,772; 5,258,389; 6,384,046; WO97 / 35575). Modifications to Petition 870260074748, dated 07 / 27 / 2026, p. 12 / 295 3 / 105 rapamycin include demethylation, elimination, or substitution of one or more of the methoxy groups; elimination, derivatization, or substitution of one or more of the hydroxyl chemical moieties; reduction, elimination, or derivatization of one or more of the ketone chemical moieties; substitution of the 6-membered pipecolate ring with a 5-membered prolyl ring; alternative substitution in the cyclohexyl ring with a substituted cyclopentyl ring. Illustrative examples from the patent literature in this field are US 5,527,907, WO96 / 41865, and WO99 / 36553, which describe a wide variety of rapalogs aimed at avoiding the immunosuppressive side effects of rapamycin. US 5,985,890 discloses examples of 32-deoxorrapamycin analogs, including 32-deoxorrapamycin itself. These compounds are described as having an improved pharmacological profile compared to rapamycin and greater stability.

[0007] The rapalogs described in the literature above have been shown to be useful for treating the same disorders as rapamycin. U.S. Patent No. 8,906,374 and U.S. Patent No. 9,669,032 disclose their use in cancer. U.S. Patent No. 9,358,236 discloses their use in neurodegenerative disorders.

[0008] In animal models, rapalogs prolong lifespan and delay the onset of age-related diseases. Aging, like other biological processes, is regulated by signaling pathways, such as the TOR pathway (referred to as TOR in this case to include yeast and C. elegans systems, where the mammalian equivalent [mTOR] is simply called TOR) and, in mammals, the mTORCl pathway. Modulation of TOR and mTORCl signaling prolongs lifespan and delays the onset of age-related diseases in a wide variety of organisms, from flies to mammals. For example, inhibition of the TOR pathway by genetic mutation prolonged lifespan in yeast, C. elegans, and Drosophila, and inhibition of the mTORC1 pathway increased lifespan in mice (Kaeberlein et al., Science (2005) 310:1193-1196; Kapahi et al., Curr Biol (2004) 14:885-890; Selman et al., Science (2009) 326:140-144; Vellai et al., Nature (2003) 426:620).Furthermore, the mTORC1 inhibitor, rapamycin, prolonged the lifespan of mice even when administered late in life (Harrison et al., Nature (2009) 460 (7253): 392-395). These data raise the possibility that drugs targeting the mammalian TOR (mTOR) pathway may have therapeutic effects on aging and age-related diseases in humans. For example, WO2008 / 022256 describes methods and formulations. Petition 870260074748, dated 07 / 27 / 2026, page 13 / 295 4 / 105 topical drugs comprising an mTOR inhibitor for the treatment or prevention of an age-related disease. A report of a clinical trial using rapamycin in elderly men was described by M. Leslie in Science, 2013, 342. J. Mannick et al. describe in Sci Transl Med. (2014) 6(268): 268ra179 that mTOR inhibition improves immune function in the elderly. However, researchers are wary of using currently available mTOR inhibitors in human aging trials due to their side effects (including immunosuppression, cytopenias, stomatitis, gastrointestinal problems, and interstitial pneumonitis).

[0009] In animal and human studies of Focal Cortical Dysplasia (FCD) and Tuberous Sclerosis Complex (TSC), the mTOR pathway is implicated in mediating the cellular and molecular changes that lead to the formation of cortical malformations and the expression of epilepsy (Wong et al., Experimental Neurology (2013) 244: 22-26). Focal Cortical Dysplasia (FCD) is a developmental cortical malformation that is the most common cause of refractory epilepsy in the pediatric population and the second / third most common etiology of clinically intractable seizures in adults (Kabat J, et al., Pol J Radiology (2012) 77(2) 3543). Mutations in the tuberous sclerosis complex (TSC), including tuberous sclerosis complex 1 (TSC1) and tuberous sclerosis complex-2 (TSC2), act upstream of the mTOR pathway, leading to widespread development of benign tumors, mental retardation, and a high incidence of epilepsy (Manning et al.)., Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase / akt pathway, Mol. Cell, (2002) 10: 151-162; Inoki et al., Dysregulation of the TSC-mTOR pathway in human Disease, Nat. Genet, (2005), 37:19-24; e Holmes e Stafstrom, Tuberous sclerosis complex and epilepsy: recent developments and future Challenges, Epilepsia, (2007) 48:617-630).

[0010] Aberrant mTOR activation interferes with normal brain development and leads to epilepsy. Treatment with rapamycin, which inhibits the mTORC1 pathway, has been shown to attenuate structural abnormalities and reduce seizures in mouse models of tuberous sclerosis (Ehninger et al., Reversal of learning deficits in a Tsc2+ / - mouse model of tuberous sclerosis; Nat. Med., (2008), 843-848; Meikle et al., Response of a neuronal model of tuberous sclerosis to mammalian target of rapamine, mTOR inhibitors: effects on mTORC1 and Akt signaling leading to improved survival and function; Ann. Neurol., Petition 870260074748, dated 07 / 27 / 2026, p. 14 / 295 5 / 105 (2008) 63:444-453; Ljungberg et al., Rapamycin suppresses seizures and neuronal hypertrophy in a mouse model of cortical dysplasia; (2009) pages 389-398; and Zhou et al., Pharmacological inhibition of mTORCl suppresses anatomical, cellular, and behavioral abnormalities in mice with specific neural knockout (Pten, J. Neurosci., (2009), 29: 1773-1783). Furthermore, pharmacological inhibition of the mTOR pathway, before or immediately after neurological insults, can prevent pathological changes in the brain of animals and the development of recurrent spontaneous seizures in a model of acquired epilepsy (Zeng et al., The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy; J. Neurosci., (2009) pages 6964-6972). Rapamycin and rapalogs are therefore also considered to have potential value in such indications.

[0011] Mitochondrial myopathy (MM) is the most common manifestation of adult-onset mitochondrial disease and shows a multifaceted tissue-specific response to stress: (1) transcriptional response, including the metabolic cytokines FGF21 and GDF15; (2) one-carbon metabolism remodeling; and (3) mitochondrial unfolded protein response. In Cell Metabolism 26, 419-428, August 1, 2017, Khan et al. describe that these processes are part of an integrated mitochondrial stress response (ISRmt), which is controlled by mTORC1 in skeletal muscle. A defect in mtDNA replication activates mTORC1, which generates an integrated mitochondrial stress response through ATF4 activation, inducing de novo nucleotide and serine synthesis, cycle 1C, and the production of FGF21 and GDF15.Inhibition of mTORC1 by rapamycin suppressed all components of the mTORC1 integrated response (mitochondrial stress response), improved all features of MM, and reversed progression even in late-stage MM, without inducing mitochondrial biogenesis. Rapamycin and rapalogs are therefore also considered to have potential value in such indications.

[0012] There continues to be a need for the supply of novel mTOR inhibitors that are good drug candidates. In particular, preferred compounds should have at least mTORC1 inhibitory capacity and be well absorbed from the gastrointestinal tract, be sufficiently metabolically stable, and possess favorable pharmacokinetic properties. In addition, the ideal drug candidate will be able to exist in a physical form that is stable, non-hygroscopic, and appropriate for formulation. Petition 870260074748, dated 07 / 27 / 2026, page 15 / 295 6 / 105 SUMMARY

[0013] The compounds of structural formula (I) are mTORCl inhibitors and are therefore potentially useful in the treatment of a wide range of disorders, particularly age-related disorders, or diseases and disorders currently approved for treatment using rapalogs. The complete reduction of the ketone at C32 and the replacement of the C16 methoxy group by an aliphatic ring system containing N-cyclic, such as a cyclic amine, amide or sultama, provides compounds with the desired advantages mentioned above, exhibiting a good balance of potency, stability and bioavailability.

[0014] In one aspect, the disclosure provides compounds of the structural formula

[0015] or a pharmaceutically acceptable salt thereof, wherein

[0016] RI is selected from the group consisting of hydroxy,

[0017] R2 is selected from the group consisting of Petition 870260074748, dated 07 / 27 / 2026, page 16 / 295 7 / 105

[0018] in which

[0019] m is 0, 1, 2 or 3;

[0020] n is 1, 2 or 3;

[0021] o is 1, 2, 3, 4, 5 or 6;

[0022] p is 1, 2, 3, 4 or 5

[0023] q is 1, 2, 3, 4 or 5, where the sum of peq is 2, 3, 4, 5 or 6;

[0024] r is 2, 3 or 4;

[0025] s is 2, 3 or 4, where the sum of res is 4, 5 or 6; X is O, S, NR6 or SO2;

[0026] R3 is hydrogen, Ci-6 alkyl, Ci-6 hydroxyalkyl, cycloalkyl(C3-8)alkyl(Co6) or phenylalkyl(Co-6);

[0027] R4 is hydrogen;

[0028] R5 is hydrogen, hydroxyl or cyano; or R4 and R5 together form =O; and

[0029] R6 is hydrogen, C1-6 alkyl, cycloalkyl(C3-8)alkyl(Co-6), phenylalkyl(C06), alkyl(C16)-CO-, cycloalkyl(C38)alkyl(Co-6)-CO-, alkyl(C16)-SO2- or cycloalkyl(C3.8)alkyl(Co.6)-S02-.

[0030] In one embodiment, the disclosure provides a pharmaceutical composition comprising a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable carriers.

[0031] In one embodiment, the disclosure provides a pharmaceutical combination comprising a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof and one or more therapeutically active agents.

[0032] In another aspect, the disclosure provides a method of treating a disorder or disease mediated by the mTOR pathway in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Structural Formula (I), or a pharmaceutical composition or pharmaceutical combination thereof. In another aspect, the Petition 870260074748, dated 07 / 27 / 2026, page 17 / 295 Disclosure 8 / 105 provides a method of treating a disease or disorder in an individual, wherein the target tissue or organ associated with the pathology of the disease or disorder has sufficient levels of FKBP12 to inhibit mTORC1, wherein the method comprises administering to the individual in need thereof a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition or a pharmaceutical combination thereof.

[0033] In one embodiment, the target tissue or organ associated with the pathology of the disease or disorder to be treated with a compound of Structural Formula (I) has FKBP12 levels sufficient to inhibit mTORC1, which are determined empirically, for example, using a specific FKBP12 inhibitor compared to rapamycin or RAD001.

[0034] In another aspect, the disclosure provides a method of treating a disease or disorder in an individual with, or previously determined to have, levels of FKBP12 sufficient to inhibit mTORC1, wherein the method comprises administering to the individual in need thereof a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition thereof, or a pharmaceutical combination thereof.

[0035] In one embodiment, the individual has, or is previously determined to have, sufficient levels of FKBP12 in the target tissue, organ, or cells to inhibit mTORC1.

[0036] In another aspect, the disclosure provides a method of treating an age-related disease or disorder in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof or a pharmaceutical composition or a combination thereof,

[0037] In one modality, the disease or disorder is selected from sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy - also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, Petition 870260074748, dated 07 / 27 / 2026, page 18 / 295 9 / 105 liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility (e.g., frailty), cognitive decline, tendon stiffness, cardiac dysfunction such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0038] In another aspect, the disclosure provides a method of treating a disease or disorder in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition or a pharmaceutical combination thereof, wherein the disorder or disease is selected from:

[0039] - Acute or chronic rejection of organ or tissue transplantation;

[0040] - Transplant vasculopathies;

[0041] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0042] - Autoimmune diseases and inflammatory conditions;

[0043] - Treatment and prevention of asthma;

[0044] - Multidrug resistance (MDR);

[0045] - Fungal infections;

[0046] - Inflammation;

[0047] - Infection;

[0048] - Age-related diseases;

[0049] - Neurodegenerative diseases;

[0050] - Proliferative disorders, in particular cancer;

[0051] - Seizures and seizure-related disorders; and

[0052] - Mitochondrial myopathy and mitochondrial stress.

[0053] In another aspect, the disclosure provides a method of cancer treatment for an individual in need thereof, wherein the method comprises Petition 870260074748, dated 07 / 27 / 2026, page 19 / 295 10 / 105 administer to the individual a therapeutically effective amount of a compound of Structural Formula (I) or a pharmaceutically acceptable salt thereof or a pharmaceutical composition or a pharmaceutical combination thereof.

[0054] In one embodiment, the method additionally comprises a PD-1 / PDL-1 inhibitor.

[0055] In one embodiment, the cancer is selected from renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, uterine endometrial cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and neck cancer.

[0056] In one embodiment, the disorder is a liver disorder that includes the process of fibrosis and / or inflammation, for example, hepatic fibrosis that occurs in end-stage liver disease; hepatic cirrhosis; liver failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease.

[0057] In one embodiment, the disorder is a renal disorder that includes the process of fibrosis or inflammation in the kidney, for example, renal fibrosis, which occurs as a result of acute kidney injury, leading to chronic kidney disease and diabetic nephropathy.

[0058] In one embodiment, the disorder is a cardiac dysfunction, for example, myocardial infarction or cardiac hypertrophy. In one embodiment, the cardiac dysfunction is systolic and / or diastolic dysfunction. In one embodiment, the cardiac dysfunction is hypertension. In one embodiment, the cardiac dysfunction results in a decline in ejection fraction.

[0059] In one form, the disorder is an immunosenescence that leads to cancer due to a decrease in immune surveillance.

[0060] In one embodiment, the disorder is cancer, including tumors that are treated by immunotherapy and those that have been previously treated with rapamycin or everolimus or another rapalog. In one embodiment, cancer includes tumors in which the mTOR pathway is shown to be activated, including settings in which there is a mutation in the Tsc1 gene or where the tumor microenvironment is adequately treated with a rapalog.

[0061] Details of one or more disclosure methods are presented in this document. Other resources, objectives, and advantages of disclosure will be... Petition 870260074748, dated 07 / 27 / 2026, p. 20 / 295 11 / 105 apparent from the Figures, Detailed Description, Examples and Claims. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1A is a cocrystal structure image of Example 1 with FKBP12. The absolute configuration at C16 is (S).

[0063] Figure 1B shows the structure of Example 1 with the FKBP12 protein removed.

[0064] Figure 2A is an image of a co-crystal structure from Example 2 with FKBP12. The absolute configuration at C16 is (R).

[0065] Figure 2B shows the structure of Example 2 with the FKBP12 protein removed.

[0066] Figure 3 is a line graph showing the pharmacokinetic profile of Example 2 in rats after a single postoperative dose of 3 mg / kg. Y-axis - blood concentrations of Example 2 (nM). X-axis - time (hours) to blood collection after administration of Example 2. Data are mean ± standard deviation of 3 rats.

[0067] Figure 4A is a bar graph showing comparative blood concentrations of RAD001 (open bars) and Example 2 (solid bars) in rats administered a single oral dose of either compound at 3, 10, and 30 mg / kg. Compound concentrations were measured 3 and 24 hours (h) after dose administration. Data are the mean ± standard deviation of 5 to 6 rats in each group. Rats in which a compound was below the limit of quantification were excluded from the data analysis: this applies to the RAD001-treated groups. The asterisk (*) indicates a significant difference between the respective RAD001-treated groups and Example 2. ** P<0.01, *** P<0.001, **** P<0.0001, t-tests. ALQ - below the limit of quantification. Y-axis - blood concentrations of the compounds (nM). X-axis - time (3 and 24 hours) after oral administration and the doses administered orally (3, 10 and 30 mg / kg).

[0068] Figure 4B is a bar graph showing comparative brain concentrations of RAD001 (open bars) and Example 2 (solid bars) in rats administered a single oral dose of either compound at 3, 10, and 30 mg / kg. Compound concentrations were measured 3 and 24 hours (h) after dose administration. Data are mean ± standard deviation. Five to six rats were used in each group. Rats in which a compound was below the limit of quantification were excluded from data analysis: this applies to Petition 870260074748, dated 07 / 27 / 2026, p. 21 / 295 12 / 105 groups treated with RAD001. The asterisk (*) indicates a significant difference between the respective groups treated with RAD001 and Example 2. ** P<0.01, *** P<0.001, **** p <o,oooi, testes t. ALQ - abaixo do limite de quantificação. Eixo Y concentrações dos compostos no cérebro (nM). Eixo X - tempo (3 e 24 horas) após administração e as doses administradas por via oral (3, 10 e 30 mg / kg).

[0069] Figure 4C shows the blood concentration of Example 2 in rats after intravenous (iv) and oral (po) administration. Y-axis - blood concentrations of Example 2 (nM). X-axis - time (hours) to blood collection after administration of Example 2. Data are mean ± standard deviation of 3 rats.

[0070] Figure 4D shows the blood concentration of RAD001 in rats after intravenous (iv) and oral (po) administration. Y-axis - blood concentrations of RAD001 (nM). X-axis - time (hours) to blood collection after RAD001 administration. Data are mean ± standard deviation of 3 rats.

[0071] Figures 5A to 5D show that Example 2 inhibits the mTORC1 pathway in rat liver. Rats were given a single oral dose of Example 2 at 3, 10, or 30 mg / kg, and liver samples were collected 3 hours (h) and 24 h after administration. Rats treated with a vehicle (Veh) were used as controls. (5A) and (5C) show immunoblot images of phosphorylated (p-) and total (t-) S6 proteins in livers of rats treated with a vehicle or 3, 10, or 30 mg / kg of Example 2 and analyzed 3 h (5A) and 24 h (5C) after treatment. The histograms in (5B) and (5D) show the densitometric quantification of p-S6 to t-S6 3 h (5B) and 24 h (5D) after treatment. In the histograms (5B and 5D), arbitrary mean values ​​indicating p-S6 / t-S6 ratios are shown above each bar. The X-axes represent the orally administered doses (3, 10, 30 mg / kg). The Y-axes represent arbitrary units. Six rats were used in each experimental group. Data are mean ± standard deviation.The data were analyzed by one-way ANOVA, followed by Dunnett's multiple comparison tests, where the means of all groups were compared to the group treated with the vehicle. ** P < 0.01, **** P < 0.001, ns - not significant.

[0072] Figures 6A to 6C show the inhibition of S6K1(Thr389) in wild-type 293T cells (6A), knockout for FKBP12 (6B), and knockout for FKBP12 (6C) after treatment with RAD001 (dashed line) and Example 2 (solid line). Cells were treated in triplicate. The Y-axis represents the percentage of inhibition relative to the S6K1(Thr389) level in cells treated with medium plus DMSO. The X-axis represents the concentrations of RAD001 and Example 2. Petition 870260074748, dated 07 / 27 / 2026, p. 22 / 295 13 / 105 DETAILED DESCRIPTION

[0073] In a first aspect, the disclosure provides a compound of the Formula

[0074] or a pharmaceutically acceptable salt thereof, wherein

[0075] RI is selected from the group consisting of hydroxy,

[0076] R2 is selected from the group consisting of

[0077] in which

[0078] m is 0, 1, 2 or 3;

[0079] n is 1, 2 or 3;

[0080] o is 1, 2, 3, 4, 5 or 6;

[0081] p is 1, 2, 3, 4 or 5

[0082] q is 1, 2, 3, 4 or 5, where the sum of peq is 2, 3, 4, 5 or 6;

[0083] r is 2, 3 or 4;

[0084] s is 2, 3 or 4, where the sum of res is 4, 5 or 6;

[0085] X is O, S, NR6 or SO2; Petition 870260074748, dated 07 / 27 / 2026, page 23 / 295 14 / 105

[0086] R3 is hydrogen, Cl-6 alkyl, Cl-6 hydroxyalkyl, cycloalkyl(C3 8) alkyl(CO-6) or phenylalkyl(CO-6);

[0087] R4 is hydrogen;

[0088] R5 is hydrogen, hydroxyl, or cyano; or R4 and R5 together form =O; and

[0089] R6 is hydrogen, Cl-6 alkyl, cycloalkyl(C3-8)alkyl(C0-6), phenylalkyl(C0-6), alkyl(Cl-6)-CO-, cycloalkyl(C3-8)alkyl(CO-6)-CO-, alkyl(Cl-6)SO2- or cycloalkyl(C3-8)alkyl(C0-6)-SO2-.

[0090] In one embodiment, the disclosure provides a compound of Formula (I)

[0091] or a pharmaceutically acceptable salt thereof, wherein

[0092] RI is selected from the group that

[0093] R2 is selected from the group consisting of Petition 870260074748, dated 07 / 27 / 2026, p. 24 / 295 15 / 105

[0094] in which

[0095] m is 0, 1, 2 or 3;

[0096] n is 1, 2 or 3;

[0097] o is 1, 2, 3, 4, 5 or 6;

[0098] p is 1, 2, 3, 4 or 5

[0099] q is 1, 2, 3, 4 or 5, where the sum of peq is 2, 3, 4, 5 or 6;

[0100] r is 2, 3 or 4;

[0101] s is 2, 3 or 4, where the sum of res is 4, 5 or 6;

[0102] X is O, S, NR6 or SO2;

[0103] R3 is hydrogen, Cl-6 alkyl, cycloalkyl(C3-8)alkyl(C0-6) or phenylalkyl(C0-6);

[0104] R4 is hydrogen;

[0105] R5 is hydrogen, hydroxyl or cyano; or R4 and R5 together form =O; and

[0106] R6 is hydrogen, C1-6 alkyl, cycloalkyl(C3.8)alkyl(Co-6), phenylalkyl(C06). alkyl(C16)-CO-, cycloalkyl(C3.8)alkyl(Co-6)-CO-, alkyl(C16)-SO2- or cycloalkyl(C3.8)alkyl(Co-6)-SO2-. Definitions

[0107] Unless otherwise specified, the term disclosure compounds or disclosure compound refers to compounds of Formula (I) and to compounds exemplified and salts thereof, as well as all stereoisomers (including diastereomers and enantiomers), rotamers, tautomers and isotopically labeled compounds (including deuterium substitutions), as well as inherently formed chemical moieties.

[0108] As used in this document, represents a portion of a variable linked to the base molecule and includes both (R) and (S) stereochemistry. R3I For example, when R2 is , it represents the portion of R2 bound to C16 and includes both (R) and (S) stereochemistry.

[0109] As used in this document, the term C1-6 alkyl refers to a linear or branched hydrocarbon chain radical consisting only of Petition 870260074748, dated 07 / 27 / 2026, p. 25 / 295 16 / 105 carbon and hydrogen atoms, containing no unsaturation, having one to six carbon atoms, and linked to the rest of the molecule by a single bond. The term C1-4 alkyl should be interpreted accordingly. Examples of C1-6 alkyl include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, and 1,1-dimethylethyl (t-butyl).

[0110] As used in this document, the term Cx-e hydroxyalkyl refers to an alkyl group substituted with one or more -OH groups. Examples of C1-6 hydroxyalkyl groups include HO-CH2-, HO-CH2CH2-, and CH2-CH(OH)-.

[0111] As used in this document, the term cycloalkyl (C3-8)alkyl(C0-6) refers to a stable monocyclic saturated hydrocarbon radical consisting only of carbon and hydrogen atoms, with three to eight carbon atoms, and which is linked to the rest of the molecule by a single bond or by an alkyl radical. C1-6 as defined above. Examples of cycloalkyl(C3-8)alkyl(C0-6) include, but are not limited to, cyclopropyl, cyclopropylmethyl, cyclobutyl, cyclobutylethyl, cyclopentyl, cyclopentylpropyl, cyclohexyl, cycloheptyl, and cyclooctyl.

[0112] As used in this document, the term phenylalkyl(C0-6) refers to a phenyl ring linked to the rest of the molecule by a single bond or by a C1-6 alkyl radical as defined above. Examples of phenylalkyl(C0-6) include, but are not limited to, phenyl and benzyl.

[0113] As used in this document, the term hydroxyl refers to -OH.

[0114] Several (listed) forms of disclosure are described in this document. It will be recognized that the features specified in each form may be combined with other specified features to provide additional forms of disclosure.

[0115] Embodiment 1. A compound of Formula (I) or a pharmaceutically acceptable salt thereof, as described above.

[0116] Embodiment 2. A compound, according to embodiment 1, or a pharmaceutically acceptable salt thereof, wherein Ri is hydroxy.

[0117] Embodiment 3. A compound, according to embodiment 1 or 2, or a pharmaceutically acceptable salt thereof, wherein R2 is selected from Petition 870260074748, dated 07 / 27 / 2026, p. 26 / 295 17 / 105 in particular above. R3 where m, η, X and R3 are as defined

[0118] Embodiment 4. A compound, according to any one of embodiments 1 to 3, or a pharmaceutically acceptable salt thereof, wherein R2 is : en is 1, 2, or 3. In one modality, R2 is 1.

[0119] Embodiment 5. A compound, according to any one of embodiments 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R2 is

[0120] Embodiment 6. A compound, according to any one of embodiments 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R2 is

[0121] Embodiment 7. A compound, according to any one of embodiments 1 to 4, or a pharmaceutically acceptable salt thereof, wherein R2 is Petition 870260074748, dated 07 / 27 / 2026, p. 27 / 295 18 / 105 r3 I l\l II I. In one embodiment, R3 is hydrogen, C1-6 alkyl, or C1-6 hydroxyalkyl.

[0122] Modality 8. A compound, according to any of the modalities 1 to 5, of Formula (l)-A:

[0123] or a pharmaceutically acceptable salt thereof, wherein Ri is selected In one embodiment, Ri is hydroxyl. In one embodiment, R2 is as defined in Formula (I). In one embodiment, the C16 position has stereochemistry (R). In one embodiment, the C16 position has stereochemistry (S).

[0124] Embodiment 9. A compound, according to any one of embodiments 1 to 8, or a pharmaceutically acceptable salt thereof, wherein said compound is C16-(l,l-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Compound 1): Petition 870260074748, dated 07 / 27 / 2026, p. 28 / 295 19 / 105

[0125] Embodiment 10. A compound, according to any one of embodiments 1 to 9, or a pharmaceutically acceptable salt thereof, present as a single diastereoisomer at C16. In one embodiment, the C16 position has stereochemistry (R). In another embodiment, the C16 position has stereochemistry (S).

[0126] Embodiment 11. A compound, according to any one of embodiments 1 to 9, or a pharmaceutically acceptable salt thereof, present as a diastereomeric mixture at C16.

[0127] Modality 12. A compound, according to any of the embodiments 1 to 10, of Formula (I)-B,

[0128] or a pharmaceutically acceptable salt thereof, where Ri and R2 are as defined for Formula (I). In one embodiment, R2 is Petition 870260074748, dated 07 / 27 / 2026, p. 29 / 295 20 / 105

[0129] Embodiment 13. A compound of Formula (I) or a pharmaceutically acceptable salt thereof, wherein said compound is (S)-C16-(l,ldioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1):

[0130] Embodiment 14. A compound of Formula (I) or a pharmaceutically acceptable salt thereof, wherein said compound is (R)-C16-(l,ldioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2):

[0131] Modality 15. A compound of Formula (I) or a pharmaceutically acceptable salt thereof, wherein said compound is selected from: Petition 870260074748, dated 07 / 27 / 2026, p. 30 / 295 21 / 105 Compound Structure Example 3 HO / ,. x O^V =oo 0 ο r HOJ o J on \ 0 Jr. V* * Absolute stereochemistry at C16 not assigned Example 4 HO / ,. XO^S Ξ ' / 0O Vo 0 0' Vo HOJ JL ), J-. r~ N 1 ' N \ * Absolute stereochemistry at C16 not assigned Example 5 HO / ,.^\ ο'Αχ'-''η =11 - ο Vo 0 0 Γ HOJ 1 VV cv = N 0H Petition 870260074748, dated 07 / 27 / 2026, p. 31 / 295 22 / 105 Compound Structure * Absolute stereochemistry at C16 not assigned Example 6 Example 7 C16 diastereomers HO / , ...... X^^X / ^^ CM V °yV n0 T HOJ NO l J, Ã* / 'X * Absolute stereochemistry at C16 not assigned Example 8 Example 9 C16 diastereomers ÇM V VV °' Vo HOJ l NO * Absolute stereochemistry at C16 not assigned Example 10 Example 11 C16 diastereomers 9 ÇM \HOY*°X η 0 1 HOJ / \'° Λ ONO ★ Absolute stereochemistry at C16 not assigned Petition 870260074748, dated 07 / 27 / 2026, p. 32 / 295 23 / 105 Compound Structure Example 12 Example 13 Single diastereoisomer at C16 ,NNN Nv Or''-''^ «A: „ ot L <χ A * Unassigned absolute stereochemistry at C16 Example 14 Example 15 diastereoisomers at C16 O çP O^ ^ O*^^'''^ Xz / \zz\ ÇM O^. / ^ O HO^T 0 / ^OONO \ * Unassigned absolute C16 stereochemistry Example 16 HO^^OT^ O^'^ 3 Ç? Petition 870260074748, dated 07 / 27 / 2026, p. 33 / 295 24 / 105 Compound Structure Example 17 N^N Ac o^AOAAA^ A° A 1 9 N 0 / * Absolute stereochemistry at C16 unassigned Example 18 Α^^'Α υ AaAAA AA· Α Α Λ 9 N ο > 1 J, Á* A\ * Absolute stereochemistry at C16 unassigned Example 19 0 / 4 / Ο / ,.ζκ H0 ) Ϊ 1 HO z υla_aa_aa. AV 11 \ XA / Γ) 0 0' TAAA i^ ? No. 2 IJ,, AA * Absolute stereochemistry at C16 unassigned

[0132] The definitions of specific functional groups and chemical terms are described in more detail below. Chemical elements are identified by Petition 870260074748, dated 07 / 27 / 2026, page 34 / 295 25 / 105 according to the Periodic Table of Elements, CAS version, Handbook of Chemistry and Physics, 75th ed., inside cover, and the specific functional groups are generally defined as described therein. Furthermore, the general principles of organic chemistry, as well as specific functional chemical moieties and reactivity, are described in Thomas Sorrell, Organic Chemistry, University Science Books, Sausalito, 1999; Smith and March, March's Advanced Organic Chemistry, 5th ed., John Wiley & Sons, Inc., New York, 2001; Larock, Comprehensive Organic Transformations, VCH Publishers, Inc., New York, 1989; and Carruthers, Some Modern Methods of Organic Synthesis, 3rd ed., Cambridge University Press, Cambridge, 1987.

[0133] Depending on the choice of starting materials and procedures, the compounds in the disclosure may be present in the form of one of the possible stereoisomers or as mixtures thereof for stereocenters not fixed by Formula (I), Formula (I)-A and Formula (I)-B – for example, as pure optical isomers, or as mixtures of stereoisomers, such as racemates and mixtures of diastereomers, depending on the number of asymmetric carbon atoms. The disclosure is intended to include all such possible stereoisomers, including racemic mixtures, diastereomeric mixtures and optically pure forms. Optically active (R) and (S) stereoisomers may be prepared using chiral synthons or chiral reagents, or solved using conventional techniques. If the compound contains a double bond, the substituent may be in the E or Z configuration.If the compound contains a disubstituted cycloalkyl group, the cycloalkyl substituent may have either a cis or trans configuration. All tautomeric forms are also intended to be included.

[0134] The term tautomers refers to compounds that are interchangeable forms of a particular compound structure and that vary in the displacement of hydrogen atoms and electrons. Thus, two structures can be in equilibrium through the movement of π electrons and an atom (usually H). For example, enols and ketones are tautomers because they are rapidly interconverted by acid or base treatment. Another example of tautomerism is the aci and nitro forms of phenylnitromethane, which are similarly formed by acid or base treatment. Tautomeric forms can be relevant for obtaining the ideal chemical reactivity and biological activity of a compound of interest. Petition 870260074748, dated 07 / 27 / 2026, p. 35 / 295 26 / 105

[0135] As used in this document, the terms salt or salts refer to an acid addition or base addition salt of a disclosure compound. Salts include, in particular, pharmaceutically acceptable salts. The term pharmaceutically acceptable salts refers to salts that retain the biological efficacy and properties of the disclosure compounds and that are typically not biologically undesirable, or otherwise undesirable. In many cases, disclosure compounds are capable of forming acid and / or base salts by virtue of the presence of amino and / or carboxyl groups or groups similar thereto. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference.

[0136] Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids.

[0137] Inorganic acids from which salts can be derived include, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like.

[0138] Organic acids from which salts can be derived include, for example, acetic acid, propionic acid, glycolic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, toluenesulfonic acid, sulfosalicylic acid and the like.

[0139] Pharmaceutically acceptable base addition salts can be formed with inorganic and organic bases.

[0140] Inorganic bases from which salts can be derived include, for example, ammonium salts and metals from columns I to XII of the periodic table. In certain embodiments, salts are derived from sodium, potassium, ammonium, calcium, magnesium, iron, silver, zinc, and copper; particularly suitable salts include ammonium, potassium, sodium, calcium, and magnesium salts.

[0141] Organic bases from which salts can be derived include, for example, primary, secondary and tertiary amines, substituted amines which include naturally occurring substituted amines, cyclic amines, basic ion exchange resins and the like. Certain organic amines include isopropylamine, benzathine, choline, diethanolamine, diethylamine, lysine, meglumine, piperazine and tromethamine. Petition 870260074748, dated 07 / 27 / 2026, page 36 / 295 27 / 105

[0142] In another aspect, the disclosure provides compounds in the form of acetate salt, ascorbate, adipate, aspartate, benzoate, besylate, bromide / bromide hydrochloride, bicarbonate / carbonate, bisulfate / sulfate, camphorsulfonate, caprate, chloride / hydrochloride, chlortheophyllonate, citrate, ethandisulfonate, fumarate, gluceptate, gluconate, glucuronate, glutamate, glutarate, glycolate, hippurate, iodide / iodide, isethionate, lactate, lactobionate, lauryl sulfate, malate, maleate, malonate, mandelate, mesylate, methyl sulfate, mucate, naphthoate, napsylate, nicotinate, nitrate, octadecanoate, oleate, oxalate, palmitate, pamoate, phosphate / hydrogen phosphate / dihydrogen phosphate, poligalacturonato, propionato, sebacato, estearato, succinato, sulfossalicilato, sulfato, tartarato, trifenatato de tosilato, trifluoroacetato ou xinafoato.

[0143] Any Formula presented herein is intended to represent unlabeled forms as well as isotopically labeled forms of the compounds. Isotopically labeled compounds have structures represented by the Formulas provided herein, except that one or more atoms are replaced by an atom having a selected atomic mass or mass number. Isotopes that may be incorporated into compounds of the disclosure include, for example, isotopes of hydrogen.

[0144] Furthermore, the incorporation of certain isotopes, particularly deuterium (i.e., 2H or D), can provide certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life, or reduced dosage requirements, or an improvement in the therapeutic index or tolerability. Deuterium in this context is understood to be a substituent for a disclosure compound. The deuterium concentration can be defined by the isotopic enrichment factor. The term isotopic enrichment factor, as used herein, means the ratio of the isotopic abundance to the natural abundance of a specified isotope.If a substituent in a compound of the present disclosure is denoted as deuterium, such compound has an isotopic enrichment factor for each designated deuterium atom of at least 3500 (52.5% deuterium incorporation in each designated deuterium atom), at least 4000 (60% deuterium incorporation), at least 4500 (67.5% deuterium incorporation), at least 5000 (75% deuterium incorporation), at least 5500 (82.5% deuterium incorporation), at least 6000 (90% deuterium incorporation), at least 6333.3 (95% deuterium incorporation), at least 6466.7 (97% deuterium incorporation). Petition 870260074748, dated 07 / 27 / 2026, page 37 / 295 28 / 105 at least 6600 (99% deuterium incorporation) or at least 6633.3 (99.5% deuterium incorporation). It should be understood that the term isotopic enrichment factor can be applied to any isotope in the same way as described for deuterium.

[0145] Other examples of isotopes that may be incorporated into disclosure compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine, and chlorine, such as 3H, 11C, 13C, 14C, 15N, 18F, 31P, 32P, 35S, 36Cl, 123I, 124I, 125I, respectively. Thus, it should be understood that disclosure includes compounds incorporating one or more of any of the isotopes mentioned above, including, for example, radioactive isotopes such as 3H and 14C, or those in which non-radioactive isotopes such as 2H and 13C are present. Such isotopically labeled compounds are useful in metabolic studies (with 14C), kinetic reaction studies (with, for example, 2H or 3H), detection or imaging techniques such as positron emission tomography (PET) or single-photon emission computed tomography (SPECT), including drug or substrate tissue distribution assays, or in radioactive treatment of patients.In particular, a labeled or 18F compound may be particularly desirable for PET or SPECT studies. Isotopically labeled disclosure compounds can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the accompanying Examples and Preparations using an appropriate isotopically labeled reagent in place of the unlabeled reagent previously employed.

[0146] As used in this document, the term pharmaceutical composition refers to a disclosure compound, or a pharmaceutically acceptable salt thereof, together with at least one pharmaceutically acceptable carrier, in a form suitable for oral or parenteral administration.

[0147] As used in this document, the term pharmaceutically acceptable carrier refers to a substance useful in the preparation or use of a pharmaceutical composition and includes, for example, diluents, solvents, dispersing media, surfactants, antioxidants, preservatives, isotonic agents, buffering agents, emulsifiers, absorption retardants, salts, drug stabilizers, binders, excipients, disintegrating agents, lubricants, humectants, sweetening agents, flavoring agents, colorants and suitable combinations thereof, as known to those skilled in the art. Petition 870260074748, dated 07 / 27 / 2026, page 38 / 295 29 / 105 technique (see, for example, Remington The Science and Practice of Pharmacy, 22nd Ed. Pharmaceutical Press, 2013, pages 1049-1070).

[0148] The term a therapeutically effective amount of a disclosure compound refers to an amount of the disclosure compound that will trigger an individual’s biological or medical response, for example, reducing or inhibiting an enzyme or protein activity or attenuating symptoms, alleviating conditions, delaying or slowing disease progression or preventing a disease, etc. In one embodiment, the term a therapeutically effective amount refers to the amount of the disclosure compound that, when administered to an individual, is effective in (1) alleviating, preventing and / or attenuating, at least partially, a condition or disorder or disease (i) mediated by the mTOR pathway, or (ii) associated with mTOR activity, or (iii) characterized by (normal or abnormal) mTOR activity; or (2) reducing or inhibiting mTOR activity; or (3) reducing or inhibiting mTOR expression.In one embodiment, the term a therapeutically effective amount refers to the amount of the disclosure compound that, when administered to a cell or tissue or non-cellular biological material or medium, is effective in at least partially reducing or inhibiting mTOR activity; or at least partially reducing or inhibiting mTOR expression.

[0149] As used in this document, the term individual refers to primates (e.g., human beings, male or female), dogs, cats, rabbits, guinea pigs, pigs, rats, and mice. In certain modalities, the individual is a primate. In still other modalities, the individual is a human being.

[0150] The terms administer, administering or administration, as used in this document, refer to implanting, absorbing, ingesting, injecting, inhaling or otherwise introducing an inventive compound or a pharmaceutical composition thereof.

[0151] As used in this document, the term inhibit, inhibition or that which inhibits refers to the reduction or suppression of a given condition, symptom or disorder or disease or a significant decrease in the baseline activity of a biological activity or process.

[0152] As used in this document, the term treat, treating or treatment of any disease or disorder refers to alleviating, delaying the onset of, improving the disease or disorder (i.e., slowing down or stopping the Petition 870260074748, dated 07 / 27 / 2026, p. 39 / 295 30 / 105 disease development or at least one of its clinical symptoms), or alleviate or improve at least one physical parameter or biomarker associated with the disease or disorder, including those that may not be discernible to the patient. In some modalities, treatment, treating, and treating require that signs or symptoms of the disease, disorder, or condition have developed or been observed. In other modalities, treatment may be administered in the absence of signs or symptoms of the disease or condition. For example, treatment may be administered to a susceptible individual before the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may also be continued after resolution of symptoms, for example, to delay or prevent recurrence.

[0153] As used in this document, the term prevent, preventing, or prevention of any disease or disorder refers to the prophylactic treatment of the disease or disorder; or delaying the onset or progression of the disease or disorder.

[0154] As used in this document, age-related disease or disorder refers to any disease or disorder whose incidence in a population or severity in an individual correlates with age progression. More specifically, an age-related disease or disorder is a disease or disorder whose incidence is at least 1.5 times higher among human individuals over 65 years of age compared to human individuals aged 25 to 35 years. Examples of age-related disorders include, but are not limited to: sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy – also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure,Liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility (e.g., frailty), cognitive decline, tendon stiffness, cardiac dysfunction such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased vigilance. Petition 870260074748, dated 07 / 27 / 2026, page 40 / 295 31 / 105 immunological, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0155] As used in this document, an individual is in need of treatment if that individual benefits biologically, medically, or in quality of life from such treatment.

[0156] All methods described herein may be carried out in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by the context. The use of any and all examples, or exemplary language (e.g., such as), provided herein is intended merely to better illuminate the disclosure and does not place a limitation on the scope of the disclosure other than that claimed.

[0157] Any asymmetric atom (e.g., carbon or similar) of the compound(s) of the disclosure may be present in racemic or enantiomerically enriched configuration, for example, (R), (S), or (R,S). In certain embodiments, each asymmetric atom has at least 50% enantiomeric excess, at least 60% enantiomeric excess, at least 70% enantiomeric excess, at least 80% enantiomeric excess, at least 90% enantiomeric excess, at least 95% enantiomeric excess, or at least 99% enantiomeric excess in the (R) or (S) configuration. Substituents on atoms with unsaturated double bonds may, if possible, be present in cis (Z) or trans (E) form.

[0158] Thus, as used in the present document, a compound of the disclosure may be in the form of one of the possible stereoisomers, rotamers, atropisomers, tautomers or mixtures thereof, for example, as substantially pure geometric stereoisomers (cis or trans), diastereomers, optical isomers (antipodes), racemates or mixtures thereof.

[0159] Any mixtures resulting from stereoisomers can be separated based on the physicochemical differences of the constituents, into pure or substantially pure optical or geometric isomers, diastereomers, racemates, for example, by chromatography and / or fractional crystallization.

[0160] Any racemates resulting from compounds of disclosure or Petition 870260074748, dated 07 / 27 / 2026, page 41 / 295 32 / 105 Intermediates can be resolved at their optical antipodes by known methods, for example, by separating the diastereomeric salts thereof, obtained with an optically active acid or base, and releasing the optically active acidic or basic compound. In particular, a basic chemical moiety can thus be employed for the resolution of the dissemination compounds at their optical antipodes, for example, by fractional crystallization of a salt formed with an optically active acid, for example, tartaric acid, dibenzoyl tartaric acid, diacetyl tartaric acid, di-O,O'-p-toluoyl tartaric acid, mandelic acid, malic acid or camphor-10-sulfonic acid. The racemic dissemination compounds or racemic intermediates can also be resolved by chiral chromatography, for example, high-performance liquid chromatography (HPLC) using a chiral adsorbent. Methods for preparing compounds of Formula (I)

[0161] In another aspect, the disclosure provides a process for the production of compounds of Formula (I), Formula (l)-A and Formula (l)-B. The compounds of Formula (I), Formula (l)-A and Formula (l)-B can be prepared according to the following process, as described in Schemes 1, 2 and 3: Diagram 1: C32-deoxyrapamycin (Intermediate 1)

[0162] A compound of Formula (I), wherein R2 is as defined for Formula (I), can be obtained by reacting C32-deoxyrapamycin (Intermediate 1) with R2-H, wherein R2 is as defined for Formula (I), in the presence of a suitable reagent for a substitution reaction, for example, p-toluenesulfonic acid, in the presence of a suitable solvent, for example, dichloromethane. Suitable conditions are as follows:

[0163] 1) R2-H, p-toluenesulfonic acid-H2O, dichloromethane, temperature Petition 870260074748, dated 07 / 27 / 2026, page 42 / 295 33 / 105 environment

[0164] 2) R2-H, trifluoroacetic acid, -40 °C, dichloromethane (see EP1212331B1)

[0165] 3) R2-H, LYCIUM4 5 M, Et2O (0.1 M), room temperature (see TL, 1995, 43, 7823)

[0166] 4) R2-H, Cp2HfCl2-AgCl4 (Suzuki catalyst), molecular sieve 4A, dichloromethane, room temperature (see TL, 1995, 43, 7823)

[0167] 5) R2-H, BF3-OEÍ2 or Zn(OTf)2, THF, 0 oC (see TL, 1994, 37, 6835)

[0168] 6) R2-H, ZnCl2, dichloromethane, 0 oC (see JOC, 1994, 59, 6512).

[0169] The C32-deoxyrapamycin used as the starting material can be prepared by methods known in the art, for example, as described in US 5985890 or WO2007085400. Scheme 2: HO, °^o° hoJ 1 ^1° / C32-deoxyrapamycin (Intermediate 1) Rv, 'o' r2-h °; HOX

[0170] A compound HO '' , RrH Co ^yoh ouRrX NIX=halo hoY J, *1^° z* Intermediate 1-A 'h Λ o Ό R2 \ OA of Formula (l)-A, where Ri is selected from I o oh 0 and Petition 870260074748, dated 07 / 27 / 2026, p. 43 / 295 34 / 105 / O'. R2, as defined for Formula (I), can be obtained by reacting Intermediate 1 with Ri-H or Ri-X, followed by reaction with R2-H. In one embodiment, Intermediate 1 is reacted with Ri-H or Ri-X under alkylation, phosphination, or esterification conditions to give Intermediate 1-A. In another embodiment, Intermediate 1-A is reacted with R2-H under substitution reaction conditions, for example, as given herein, to obtain a compound of Formula (I)-A. Scheme 3:

[0171] A compound of Formula (1)-C, where Ri is \eR2é as defined for Formula (1), can be obtained by reacting Intermediate 1 with Ri-H followed by reaction with R2-H. In one embodiment, Intermediate 1 is activated and reacted under nucleophilic conditions to give Intermediate 1-A. In another embodiment, Intermediate 1-A is reacted with R2-H under substitution reaction conditions, for example, as given in this document, to obtain the compound of Formula (1)-C. Petition 870260074748, dated 07 / 27 / 2026, p. 44 / 295 35 / 105

[0172] The reactions can be carried out according to conventional methods, for example, as described in the Examples.

[0173] The processing of the reaction mixtures and the purification of the compounds that can be obtained in this way can be carried out according to known procedures.

[0174] Acid addition salts can be produced from free bases in a known manner and vice versa.

[0175] Starting materials may be known or prepared according to conventional procedures from known compounds, for example, as described in the Examples.

[0176] In another aspect, the disclosure provides a pharmaceutical composition comprising a compound of the disclosure, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. In a further embodiment, the composition comprises at least two pharmaceutically acceptable vehicles, such as those described herein. The pharmaceutical composition may be formulated for particular routes of administration, such as oral administration, parenteral administration (e.g., by injection, infusion, transdermal or topical administration) and rectal administration. Topical administration may also refer to application by inhalation or intranasal administration. The pharmaceutical compositions of the disclosure may be prepared in a solid form (including, without limitation, capsules, tablets, pills, granules, powders or suppositories) or in a liquid form (including, without limitation, solutions, suspensions or emulsions).Tablets may be film-coated or enteric-coated, according to methods known in the art. Typically, pharmaceutical compositions are gelatin tablets or capsules comprising the active ingredient together with one or more of the following:

[0177] a) diluents, for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine;

[0178] b) lubricants, for example, silica, talc, stearic acid, its calcium or magnesium salt and / or polyethylene glycol; for tablets also

[0179] c) binders, for example, magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone; if desired

[0180] d) disintegrants, for example, starches, agar, alginic acid or its salt Petition 870260074748, dated 07 / 27 / 2026, page 45 / 295 36 / 105 sodium, or effervescent mixtures; and

[0181] e) absorbents, colorants, flavorings and sweeteners.

[0182] The disclosure compound, or a pharmaceutically acceptable salt thereof, may also be in the form of a drug-eluting stent, that is, a stent coated with a disclosure compound or a pharmaceutically acceptable salt thereof.

[0183] The disclosed compounds, in free form or in pharmaceutically acceptable salt form, exhibit valuable pharmacological properties, for example, mTOR pathway modulation properties, as indicated in in vitro and in vivo tests, as provided in the following sections, and are therefore indicated for therapy or for use as research chemicals, for example, as working compounds.

[0184] The methods for measuring the potency of mTORC1 inhibitors are well known in the art. Generally, potency is determined by IC50 values, assessed by determining the inhibition of S6 phosphorylation, which is in the mTORC1 signaling pathway. The IC50 values ​​of mTORC1 inhibitors are compared with the IC50 value of rapamycin in the same assay. An mTORC1 inhibitor with an IC50 value within 100 times the IC50 value of rapamycin in the same assay is suitable for use in dissemination – meaning that a less potent rapalog may still be desirable in order to more easily achieve only partial inhibition of mTORC1 activity in certain situations and to improve the ability to measure the molecule in the bloodstream (since higher concentrations are needed for a less potent molecule) – which would be useful for adjusting the blood concentration / efficacy ratio.

[0185] Suitable assays for measuring the potency of mTOR inhibitors are described, for example, in US 5,665,772, as measured by the IC50 value in an MLR (mixed lymphocyte reaction) assay and / or in an IL-6 (interleukin-6)-dependent proliferation-mediated assay.

[0186] The MLR assay is typically performed as follows: Spleen cells (0.5 x 10⁶) from Balb / c mice (females, 8 to 10 weeks old) are co-incubated for 5 days with 0.5 x 10⁶ irradiated (2000 rads) or mitomycin C-treated spleen cells from CBA mice (females, 8 to 10 weeks old). The irradiated allogeneic cells induce a proliferative response in the Balb / c spleen cells, which can be measured by incorporation of labeled precursor into the DNA. Once the cells Petition 870260074748, dated 07 / 27 / 2026, page 46 / 295 37 / 105 stimulating cells are irradiated (or treated with mitomycin C), they do not respond to Balb / c cells with proliferation, but retain their antigenicity. The antiproliferative effect of the tested compounds on Balb / c cells is measured at various dilutions and the concentration that results in 50% inhibition of cell proliferation (IC50) is calculated. The inhibitory capacity of the test sample can be compared to rapamycin and expressed as a relative IC50 (i.e., IC50 of the test sample / IC50 of rapamycin).

[0187] The IL-6-mediated proliferation assay is typically performed as follows: the assay utilizes an interleukin-6 (IL-6)-dependent mouse hybridoma cell line and is performed in 96-well microtiter plates. 5000 cells / well are cultured in serum-free medium (as described by MH Schreier and R. Tees in Immunological Methods, I. Lefkovits and B. Pernis, eds., Academic Press 1981. Vol. II, pages 263-275) supplemented with 1 ng of recombinant IL-6 / ml. After a 66-hour incubation in the absence or presence of a test sample, the cells are pulsed with 1 μCi of (3-H)-thymidine / well for a further 6 hours, harvested, and counted by liquid scintillation. The incorporation of (3-H)thymidine into DNA correlates with an increase in the number of cells and is therefore a measure of cell proliferation. A series of dilutions of the test sample allows the calculation of the concentration that results in 50% inhibition of cell proliferation (IC50).The inhibitory capacity of the test sample can be compared to rapamycin and expressed as a relative IC50 (i.e., IC50 of the test sample / IC50 of rapamycin).

[0188] The potency of mTOR inhibitors can also be determined using a TSC1- / - MEF cell-based assay. TSC1- / - MEF cells are mouse embryonic fibroblasts deficient in tuberous sclerosis protein, TSC1, which negatively regulates mTORC1 signaling. Thus, TSC1 deficiency induces constitutive mTORC1 activation, resulting in phosphorylation (activation) of downstream proteins in mTORC1 signaling pathways. This cell-based assay is used to measure the inhibition (dephosphorylation) of mTORC1 signaling components S6 and 4EBP1 by rapalogs or other mTOR inhibitors.

[0189] The assay is typically performed as follows: MEF TSC1- / cells are plated onto 384-well Griener light-background plates coated with Poly-D-lysine and incubated overnight at 37 °C, 5% CO2. The following day, the cells are washed 8 times with Hard starve solution (1 L DPBS + 1 g D Petition 870260074748, dated 07 / 27 / 2026, p. 47 / 295 38 / 105 (+)glucose + 10 mL of 7.5% sodium bicarbonate + 20 mL of 1 M HEPES) and incubated for another 2 hours in the same solution. The cells are then treated with compounds at decreasing concentrations (8 points in 3.16-fold dilutions) and incubated for 2 hours at 37°C, 5% CO2. The cells are fixed with 4% paraformaldehyde for 30 min and washed 5 times with TBS-EDTA, followed by immunostaining with fluorescently labeled antibodies against pS6 and p4EBP1. Nuclei are visualized by Hoechst staining. Images are obtained from the cells using the respective fluorescence channels, and the potency of mTOR inhibitors is defined by the IC50 (nM) of pS6. Diseases and disorders

[0190] The compounds in the disclosure may be useful in the prevention or treatment of a selected prodromal indication or condition of:

[0191] - Acute or chronic rejection of organ or tissue transplantation;

[0192] - Transplant vasculopathies;

[0193] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0194] - Autoimmune diseases and inflammatory conditions;

[0195] - Treatment and prevention of asthma;

[0196] - Multidrug resistance (MDR);

[0197] - Fungal infections;

[0198] - Inflammation;

[0199] - Infection;

[0200] - Age-related diseases;

[0201] - Neurodegenerative diseases;

[0202] - Proliferative disorders, in particular cancer;

[0203] - Seizures and seizure-related disorders;

[0204] - Mitochondrial myopathy and mitochondrial stress;

[0205] - Treatable conditions that have been shown to increase the likelihood of age-related diseases, such as in situations where there is an increase in senescence-inducing cytokines (e.g., IL6);

[0206] - Disorders that include the process of fibrosis and / or inflammation, for example, liver and kidney disorders. Examples include hepatic fibrosis, which occurs in end-stage liver disease; liver cirrhosis; liver failure due to Petition 870260074748, dated 07 / 27 / 2026, page 48 / 295 39 / 105 toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease. Another example is renal fibrosis, which occurs as a result of acute kidney injury, leading to chronic kidney disease. Additionally, diabetic nephropathy can induce fibrosis and inflammation in the kidneys. Frequently, kidney disease causes heart failure as a result of increased blood pressure; this can also be associated with cardiac fibrosis. Rapalogs have preclinical efficacy in the treatment of heart failure models and are effective in reducing hepatic fibrosis in patients undergoing liver transplantation (Buss, SJ et al. Beneficial effects of Mammalian target of rapamycin inhibition on left ventricular remodeling after myocardial infarction. J Am Coll Cardiol. (2009) 54(25): 2435-2446; Buss, SJ et al. Augmentation of autophagy by mTOR-inhibition in myocardial infarction: When size matters. Autophagy. (2010) 6(2):304-306; Villamil, FG et al.Fibrosis progression in maintenance liver transplant patients with hepatitis C recurrence: a randomized study of everolimus vs. calcineurin inhibitors. Liver Int. (2014) 34(10):1513-1521).

[0207] Treatment of acute or chronic organ or tissue transplant rejection includes treatment of transplant recipients of, for example, heart, lung, combined heart and lung, liver, kidney, pancreas, skin or cornea. Disclosure compounds are also indicated for the prevention of graft-versus-host disease, such as after bone marrow transplantation.

[0208] Transplant vasculopathies include atherosclerosis.

[0209] Autoimmune diseases and inflammatory conditions include, in particular, inflammatory conditions with an etiology including an autoimmune component, such as arthritis (e.g., rheumatoid arthritis, chronic progressive arthritis, and deforming arthritis) and rheumatic diseases.The specific autoimmune diseases for which the compounds of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C may be employed include autoimmune hematological disorders (including, for example, hemolytic anemia, aplastic anemia, pure red cell anemia and idiopathic thrombocytopenia), systemic lupus erythematosus, polychondritis, scleroderma, Wegener's granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Stevens-Johnson syndrome, celiac disease, autoimmune inflammatory bowel disease (including, for example, ulcerative colitis and Crohn's disease), endocrine ophthalmopathy, Graves' disease, sarcoidosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (type I diabetes mellitus), uveitis (anterior and posterior). Petition 870260074748, dated 07 / 27 / 2026, page 49 / 295 40 / 105 keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis and glomerulonephritis (with and without nephrotic syndrome, for example, including idiopathic nephrotic syndrome or minimal change nephropathy) and juvenile dermatomyositis.

[0210] Treatment of multidrug resistance (MDR) involves increasing the effectiveness of other chemotherapeutic agents in the treatment and control of multidrug-resistant conditions, such as multidrug-resistant cancer or multidrug-resistant AIDS. MDR is particularly problematic in cancer patients and patients with AIDS who do not respond to conventional chemotherapy because the drug is pumped out of the cells by Pgp.

[0211] Infection includes infection by pathogens that have Mip or Mip-like factors.

[0212] Age-related diseases include: sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy - also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility (e.g., frailty), cognitive decline, tendon stiffness, cardiac dysfunction, such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer,Immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0213] Neurodegenerative diseases include Huntington's disease, Parkinson's disease, spinocerebellar ataxia type 3, Alzheimer's disease, motor neuron disease, and peripheral neuropathy.

[0214] Proliferative disorders include cancer. Such conditions include those listed in U.S. Patent No. 9,669,032, in particular, renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, uterine cancer. Petition 870260074748, dated 07 / 27 / 2026, page 50 / 295 41 / 105 endometrial, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or neck cancer.

[0215] Seizures and seizure-related disorders include West syndrome, Focal Cortical Dysplasia (FCD), tuberous sclerosis complex (TSC), childhood absence epilepsy, benign childhood focal epilepsies, juvenile myoclonic epilepsy (JME), temporal lobe epilepsy, frontal lobe epilepsy, refractory epilepsy, Lennox-Gastaut syndrome, occipital lobe epilepsy, Proteus syndrome, hemimegalencephaly syndrome (HME), megalencephaly syndrome (MEG), megalencephaly-capillary malformation (MCAP), and megalencephaly-polymicrogyria-polydactyly-hydrocephalus (MPPH) syndrome.

[0216] Mitochondrial myopathy and mitochondrial stress are mitochondrial disorders, as described in Chinnery, PF (2015); EMBO Mol. Med. 7, 1503-1512; Koopman, WJ et al., (2016); EMBO Mol. Med. 8, 311-327 and Young, MJ, and Yound and Copeland, WC (2016); Curr. Opin. Genet. Dev. 38, 52-62.

[0217] Treatable conditions that have been shown to increase the likelihood of age-related diseases include senescence, for example, immunosenescence. This is diagnosed by (i) an increase in circulating cytokines, such as IL-6, but also by (ii) senescent cells found in muscle, kidney, liver, brain, neurons, liver, pancreas, or heart; or also (iii) a decline in the efficiency of DNA repair, which can be demonstrated by an increase in the transcription of repetitive elements, including genes encoded by transposons. For more information, see Baker, DJ et al, Nature, 2016; 530(7589):184-189. doi: 10.1038 / nature16932. Epub 3 February 2016. Treatment methods and uses

[0218] The disclosure provides the use of a compound from the disclosure for use in therapy. In an additional embodiment, the therapy is selected from a disease or disorder or comorbidity that can be treated by modulation of the mTOR pathway. In one embodiment, the disease is selected from the list mentioned above, in another embodiment an age-related disease, such as respiratory tract infection-related morbidity in the elderly.

[0219] Disclosure provides a disclosure compound for use in therapy. Petition 870260074748, dated 07 / 27 / 2026, p. 51 / 295 42 / 105 In one additional modality, therapy is selected from a disease that can be treated by modulation of the mTOR pathway. In another modality, the disease is selected from the list mentioned above, and in yet another modality, an age-related disease, such as respiratory tract infection-related morbidity in the elderly.

[0220] The disclosure provides the use of a compound from the disclosure for the manufacture of a medicinal product. In a further embodiment, the medicinal product is for the prevention or treatment of a disease that can be treated by modulation of the mTOR pathway. In one embodiment, the disease is selected from the list mentioned above, in one embodiment an age-related disease, such as respiratory tract infection-related morbidity in the elderly.

[0221] In one aspect, the disclosure provides a method of treating a disorder or disease mediated by the mTOR pathway in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof.

[0222] In one aspect, the disclosure provides a method of treating a disease or disorder in an individual, wherein the target tissue or organ associated with the pathology of the disease or disorder has sufficient levels of FKBP12 to inhibit mTORC1, wherein the method comprises administering to the individual in need thereof a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof.

[0223] In one aspect, the disclosure provides a method of treating a disease or disorder in an individual who has, or has been previously determined to have, sufficient levels of FKBP12 to inhibit mTORC1, wherein the method comprises administering to the individual in need thereof an amount Petition 870260074748, dated 07 / 27 / 2026, p. 52 / 295 43 / 105 therapeutically effective compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof.

[0224] In one modality, the disease or disorder is selected from sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis,Endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility, cognitive decline, tendon stiffness, cardiac dysfunction such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as renal failure, blindness, and neuropathy.

[0225] In one form, the disorder is hepatic fibrosis.

[0226] In one aspect, the disclosure provides a method of treating a disease or disorder in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from:

[0227] - Acute or chronic rejection of organ or tissue transplantation; Petition 870260074748, dated 07 / 27 / 2026, p. 53 / 295 44 / 105

[0228] - Transplant vasculopathies;

[0229] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0230] - Autoimmune diseases and inflammatory conditions;

[0231] - Treatment and prevention of asthma;

[0232] - Multidrug resistance (MDR);

[0233] - Fungal infections;

[0234] - Inflammation;

[0235] - Infection;

[0236] - Age-related diseases;

[0237] - Neurodegenerative diseases;

[0238] - Proliferative disorders, in particular cancer;

[0239] - Seizures and seizure-related disorders; and

[0240] - Mitochondrial myopathy and mitochondrial stress.

[0241] In one modality, the disorder is a disorder that includes the process of fibrosis and / or inflammation.

[0242] In one embodiment, the disorder is selected from liver and kidney disorders.

[0243] In one embodiment, the liver disorder is selected from: hepatic fibrosis, which occurs in end-stage liver disease; hepatic cirrhosis; liver failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease.

[0244] In one form, the kidney disorder is renal fibrosis.

[0245] In one form, renal fibrosis occurs as a result of acute kidney injury.

[0246] In one form, the kidney disorder is chronic kidney disease.

[0247] In one form, the kidney disorder is diabetic nephropathy.

[0248] In one aspect, the disclosure provides a method of treating an age-related disease or disorder in an individual in need thereof, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula Petition 870260074748, dated 07 / 27 / 2026, p. 54 / 295 45 / 105 (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, wherein the disorder or disease is selected from: sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility, cognitive decline, tendon stiffness, cardiac dysfunction, such as cardiac hypertrophy and / or systolic dysfunction and / or diastolic and / or hypertension,Cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0249] In one aspect, the disclosure provides a method of treating cancer in an individual, wherein the method comprises administering to the individual a therapeutically effective amount of a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof.

[0250] In one embodiment, the method additionally comprises a PD-1 / PDL-1 inhibitor.

[0251] In one embodiment, the cancer is selected from renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, uterine endometrial cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, Petition 870260074748, dated 07 / 27 / 2026, page 55 / 295 46 / 105 glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, and neck cancer.

[0252] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use as a medicament.

[0253] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

[0254] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of a selected disorder or disease of:

[0255] - Acute or chronic rejection of organ or tissue transplantation;

[0256] - Transplant vasculopathies;

[0257] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0258] - Autoimmune diseases and inflammatory conditions;

[0259] - Treatment and prevention of asthma;

[0260] - Multidrug resistance (MDR);

[0261] - Fungal infections; Petition 870260074748, dated 07 / 27 / 2026, p. 56 / 295 47 / 105

[0262] - Inflammation;

[0263] - Infection;

[0264] - Age-related diseases;

[0265] - Neurodegenerative diseases;

[0266] - Proliferative disorders, in particular cancer;

[0267] - Seizures and seizure-related disorders;

[0268] - Mitochondrial myopathy and mitochondrial stress; and

[0269] - Treatable conditions that have been shown to increase the likelihood of age-related diseases, such as in situations where there is an increase in senescence-inducing cytokines.

[0270] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of a disorder or disease that includes the process of fibrosis and / or inflammation.

[0271] In one embodiment, the disorder is selected from liver and kidney disorders.

[0272] In one embodiment, the liver disorder is selected from: hepatic fibrosis, which occurs in end-stage liver disease; hepatic cirrhosis; liver failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease.

[0273] In one form, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.

[0274] In one form, the kidney disorder is chronic kidney disease.

[0275] In one form, the kidney disorder is diabetic nephropathy.

[0276] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof. Petition 870260074748, dated 07 / 27 / 2026, p. 57 / 295 48 / 105 of the same, for use in the prevention or treatment of a selected age-related disorder or disease of sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy - also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility (e.g., frailty), cognitive decline, tendon stiffness, cardiac dysfunction, such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease,Cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0277] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the prevention or treatment of cancer.

[0278] In one aspect, the disclosure provides a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, a pharmaceutical composition comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, or a pharmaceutical combination comprising a compound of Formula (I), Formula (I)-A, Formula (I)-B and Formula (I)-C or a pharmaceutically acceptable salt thereof, for use in the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, uterine endometrial cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, cancer Petition 870260074748, dated 07 / 27 / 2026, page 58 / 295 49 / 105 of prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or neck cancer.

[0279] In one embodiment, the disclosure provides a compound or a pharmaceutically acceptable salt thereof for use in the treatment of an age-related disease, such as respiratory tract infection-related morbidity in the elderly. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In another embodiment, the compound is (R)-C16(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0280] In one modality, the disorder or disease is selected from:

[0281] - Acute or chronic rejection of organ or tissue transplantation;

[0282] - Transplant vasculopathies;

[0283] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0284] - Autoimmune diseases and inflammatory conditions;

[0285] - Treatment and prevention of asthma;

[0286] - Multidrug resistance (MDR);

[0287] - Fungal infections;

[0288] - Inflammation;

[0289] - Infection;

[0290] - Age-related diseases;

[0291] - Neurodegenerative diseases; Petition 870260074748, dated 07 / 27 / 2026, page 59 / 295 50 / 105

[0292] - Proliferative disorders, in particular cancer;

[0293] - Seizures and seizure-related disorders;

[0294] - Mitochondrial myopathy and mitochondrial stress; and

[0295] - Treatable conditions that have been shown to increase the likelihood of age-related diseases, such as in situations where there is an increase in senescence-inducing cytokines (e.g., IL6).

[0296] In one embodiment, the disorder or disease is an age-related disorder or disease selected from sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy - also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility (e.g., frailty), cognitive decline, tendon stiffness, cardiac dysfunction, such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer,Immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0297] In one embodiment, the disorder or disease includes the process of fibrosis and / or inflammation, for example, hepatic and renal disorders. In one embodiment, the disorder is a renal disorder. In one embodiment, the disorder is a hepatic disorder. Examples include hepatic fibrosis, which occurs in end-stage liver disease; hepatic cirrhosis; liver failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease. Another example is renal fibrosis, which occurs as a result of acute kidney injury, leading to chronic kidney disease. In addition, diabetic nephropathy can induce fibrosis and inflammation in the kidneys. Frequently, kidney disease causes heart failure as a result of increased blood pressure; this can also be associated with cardiac fibrosis. Rapalogs have preclinical efficacy in the treatment of heart failure models and Petition 870260074748, dated 07 / 27 / 2026, page 60 / 295 51 / 105 are effective in reducing liver fibrosis in patients undergoing liver transplantation.

[0298] The therapeutically effective dosage of a compound, pharmaceutical composition, or combinations thereof, depends on the individual's species, body weight, age and individual condition, the disorder or disease, or its severity being treated. A physician, clinician, or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients needed to prevent, treat, or inhibit the progression of the disorder or disease.

[0299] The dosage properties cited above are demonstrable in in vitro and in vivo tests using advantageously mammals, for example, mice, rats, dogs, monkeys, or isolated organs, tissues and preparations thereof. The compounds of the disclosure can be applied in vitro in the form of solutions, for example, aqueous solutions, and in vivo via enteral, parenteral, advantageously intravenous routes, for example, as a suspension or in aqueous solution. The in vitro dosage can vary between concentrations of about 10⁻³ molar and 10⁻⁹ molar. A therapeutically effective amount in vivo can vary, depending on the route of administration, between about 0.1 and 500 mg / kg or between about 0.1 and 500 mg per individual.

[0300] The disclosure compound may be administered simultaneously with, or before or after, one or more other therapeutic agents. The disclosure compound may be administered separately, by the same route of administration or a different route of administration, or together in the same pharmaceutical composition as the other agents. A therapeutic agent is, for example, a chemical compound, peptide, antibody, antibody fragment or nucleic acid, which is therapeutically active or enhances therapeutic activity when administered to a patient in combination with a disclosure compound.

[0301] In one embodiment, the disclosure provides a product comprising a disclosure compound and at least one other therapeutic agent as a combination preparation for simultaneous, separate, or sequential use in therapy. In one embodiment, the therapy is the treatment of a disease or condition through partial or total inhibition of mTOR. Products provided as a combination preparation include a composition comprising the disclosure compound and the other therapeutic agent(s) together in the same pharmaceutical composition, or the disclosure compound and the other therapeutic agent(s). Petition 870260074748, dated 07 / 27 / 2026, p. 61 / 295 52 / 105 in separate form, for example, in the form of a case.

[0302] In one embodiment, the disclosure provides a pharmaceutical composition comprising a compound from the disclosure and other therapeutic agent(s). Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier, as described above.

[0303] In one embodiment, the disclosure provides a case comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of the disclosure. In one embodiment, the case comprises means for separately retaining said compositions, such as a container, a divided bottle, or a divided foil package. An example of such a case is a blister pack, such as is typically used for packaging tablets, capsules, and the like.

[0304] The disclosure kit can be used to administer different dosage forms, for example, oral and parenteral, to administer the separate compositions at different dosage intervals, or to titrate the separate compositions against each other. To aid adherence, the disclosure kit typically includes administration instructions.

[0305] In combination therapies, the disclosure compound and the other therapeutic agent may be manufactured and / or formulated by the same manufacturer or by different manufacturers. Furthermore, the disclosure compound and the other therapeutic product may be combined in a combination therapy: (i) before the release of the combination product to physicians (e.g., in the case of a kit comprising the disclosure compound and the other therapeutic agent); (ii) by the physicians themselves (or under the physician's direction) shortly before administration; (iii) in the patients themselves, e.g., during sequential administration of the disclosure compound and the other therapeutic agent.

[0306] Thus, the disclosure provides the use of a disclosure compound to prevent or treat a disease or condition by means of partial or total inhibition of mTOR, wherein the medicine is prepared for administration with another therapeutic agent. The disclosure also provides the use of another therapeutic agent to prevent or treat a disease or condition mediated by mTOR inhibition, wherein the medicine is administered with a disclosure compound.

[0307] The disclosure also provides a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for use in a Petition 870260074748, dated 07 / 27 / 2026, p. 62 / 295 53 / 105 method of preventing or treating a disease or condition mediated by mTOR inhibition, wherein the disclosure compound is prepared for administration with another therapeutic agent. The disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, wherein the other therapeutic agent is prepared for administration with a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof. The disclosure also provides a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, wherein the compound is administered with another therapeutic agent.The disclosure also provides another therapeutic agent for use in a method of preventing or treating a disease or condition mediated by mTOR inhibition, wherein the other therapeutic agent is administered with a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof.

[0308] The disclosure also provides for the use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof to prevent or treat an mTOR-mediated disease or condition, wherein the patient has been previously (e.g., within 24 hours) treated with another therapeutic agent. The disclosure also provides for the use of another therapeutic agent to prevent or treat an mTOR-mediated disease or condition, wherein the patient has been previously (e.g., within 24 hours) treated with a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof.

[0309] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament.

[0310] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a disorder or disease mediated by the mTOR pathway.

[0311] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a selected disorder or disease of: Petition 870260074748, dated 07 / 27 / 2026, p. 63 / 295 54 / 105

[0312] - Acute or chronic rejection of organ or tissue transplantation;

[0313] - Transplant vasculopathies;

[0314] - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of blood vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis;

[0315] - Autoimmune diseases and inflammatory conditions;

[0316] - Treatment and prevention of asthma;

[0317] - Multidrug resistance (MDR);

[0318] - Fungal infections;

[0319] - Inflammation;

[0320] - Infection;

[0321] - Age-related diseases;

[0322] - Neurodegenerative diseases;

[0323] - Proliferative disorders, in particular cancer;

[0324] - Seizures and seizure-related disorders;

[0325] - Mitochondrial myopathy and mitochondrial stress; and

[0326] - Treatable conditions that have been shown to increase the likelihood of age-related diseases, such as in situations where there is an increase in senescence-inducing cytokines.

[0327] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a disorder or disease which includes the process of fibrosis or inflammation.

[0328] In one embodiment, the disorder is selected from liver and kidney disorders.

[0329] In one embodiment, the liver disorder is selected from: hepatic fibrosis, which occurs in end-stage liver disease; hepatic cirrhosis; liver failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease.

[0330] In one form, the kidney disorder is renal fibrosis, which occurs as a result of acute kidney injury.

[0331] In one form, the kidney disorder is chronic kidney disease.

[0332] In one form, the kidney disorder is diabetic nephropathy.

[0333] In another aspect, the disclosure provides a use of a compound of the Formula Petition 870260074748, dated 07 / 27 / 2026, p. 64 / 295 55 / 105 (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of a selected age-related disorder or disease of sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility, cognitive decline, tendon stiffness, cardiac dysfunction, such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension,Cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

[0334] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the prevention or treatment of cancer.

[0335] In another aspect, the disclosure provides a use of a compound of Formula (I), Formula (I)-A and Formula (I)-B or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial uterine cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma or neck cancer.

[0336] Specific individual combinations that may provide particular treatment benefits include a combination of a compound Petition 870260074748, dated 07 / 27 / 2026, page 65 / 295 56 / 105

[0337] or a pharmaceutically acceptable salt thereof and a catalytic mTOR inhibitor, in particular one as mentioned above. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In another embodiment, the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0338] In one embodiment, the disclosure provides a product comprising a compound

[0339] or a pharmaceutically acceptable salt thereof and a catalytic mTOR inhibitor, in particular one as mentioned above as a combination preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof. Petition 870260074748, dated 07 / 27 / 2026, page 66 / 295 57 / 105

[0340] In one embodiment, the disclosure provides a pharmaceutical composition comprising a compound

[0341] or a pharmaceutically acceptable salt thereof and a catalytic mTOR inhibitor, in particular one as mentioned above, and a pharmaceutically acceptable carrier. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In another embodiment, the compound is (R)C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0342] In one embodiment, the other therapeutic agent is selected from a CD4 lymphocyte-depleting agent, such as an anti-CD4 antibody or antigen-binding fragment thereof, such as a humanized anti-CD4 antibody, for example, zanolimumab. Such a therapeutic agent may in particular be used for the treatment of a proliferative disorder, in particular cancer. See also U.S. Pat. No. 8,906,374 and U.S. Pat. No. 9,427,463 for such combination therapy.

[0343] Specific individual combinations that may provide particular treatment benefits include a combination of a compound Petition 870260074748, dated 07 / 27 / 2026, page 67 / 295 58 / 105

[0344] or a pharmaceutically acceptable salt thereof and a CD4 lymphocyte depleting agent, in particular one as mentioned above. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0345] In one embodiment, the disclosure provides a product comprising a compound

[0346] or a pharmaceutically acceptable salt thereof and a CD4 lymphocyte depleting agent, in particular one as mentioned above as a combination preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) Petition 870260074748, dated 07 / 27 / 2026, page 68 / 295 59 / 105 or a pharmaceutically acceptable salt thereof.

[0347] In one embodiment, the disclosure provides a pharmaceutical composition comprising a compound

[0348] or a pharmaceutically acceptable salt thereof, a CD4 lymphocyte depleting agent, in particular one as mentioned above, and a pharmaceutically acceptable carrier. In one embodiment, the compound is (S)-C16(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0349] In one embodiment, the other therapeutic agent is selected from an agent that modulates the activity of immunoinhibitory proteins, such as PD-1 / PDL-1, such as an anti-PD-1 antibody or antibody against PDL-1. Anti-PD-1 antibodies that are useful as a therapeutic agent are as disclosed in U.S. Patent No. 9,683,048. Such a therapeutic agent may be used in the treatment of cancer, in particular for cancer immunotherapy.

[0350] Specific individual combinations that may provide particular treatment benefits include a combination of a compound Petition 870260074748, dated 07 / 27 / 2026, page 69 / 295 60 / 105

[0351] or a pharmaceutically acceptable salt thereof and an agent that modulates the activity of immunoinhibitory proteins, such as PD-1, in particular one as mentioned above. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In another embodiment, the compound is (R)-C16(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0352] In one embodiment, the disclosure provides a product comprising a compound

[0353] or a pharmaceutically acceptable salt thereof and an agent that modulates the activity of immunoinhibitory proteins, such as PD-1, in particular one as mentioned above as a combination preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the compound is (S)-C16-(1,1 Petition 870260074748, dated 07 / 27 / 2026, page 70 / 295 61 / 105 dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16(l,l-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof.

[0354] In one embodiment, the disclosure provides a pharmaceutical composition comprising

[0355] or a pharmaceutically acceptable salt thereof, an agent that modulates the activity of immunoinhibitory proteins, such as PD-1, in particular one as mentioned above, and a pharmaceutically acceptable carrier. In one embodiment, the compound is (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 1) or a pharmaceutically acceptable salt thereof. In one embodiment, the compound is (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-desoxorrapamycin (Example 2) or a pharmaceutically acceptable salt thereof. EXAMPLES

[0356] The disclosure presents the following examples. The synthetic and biological examples described in this application are offered to illustrate the compounds, pharmaceutical compositions and methods provided herein and should not be construed in any way as limiting its scope.

[0357] The compounds provided in this document can be prepared from readily available starting materials using modifications to the specific synthesis protocols set forth below that would be well known to those skilled in the art. It will be appreciated that where typical or preferred process conditions (i.e., reaction temperatures, times, molar ratios of reagents, solvents, pressures, etc.) are given, other process conditions Petition 870260074748, dated 07 / 27 / 2026, page 71 / 295 62 / 105 can also be used, unless otherwise indicated. Optimal reaction conditions may vary with the specific reagents or solvents used, but these conditions can be determined by those skilled in the art through routine optimization procedures.

[0358] Furthermore, as will be evident to those skilled in the art, conventional protecting groups may be necessary to prevent certain functional groups from undergoing undesirable reactions. The choice of a suitable protecting group for a particular functional group, as well as suitable conditions for protection and deprotection, are well known in the art. For example, numerous protecting groups, and their introduction and removal, are described in Greene et al. Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991, and references cited therein.

[0359] Rapamycin and its derivatives, for example, compounds of Formula (I), Formula (I)-A and Formula (I)-B, exist as a pH- and solvent-dependent equilibrium of the six-membered and seven-membered hemiketal forms shown below as E and F (Schemes 4 and 5). See The Journal of Antibiotics (Tokyo) (1991) 44(6):688-690; and Tetrahedron Letters (1992) 33(33):4139-4142. Rapamycin and its derivatives also exist as a mixture of the cis and trans amides shown below as E, H, J and K (Schemes 4 and 5). [See Mierke, DF, Schmieder, P., Karuso, P. and Kessler, H. (1991), Conformational Analysis of cis- and trans-FK506 Isomers by NMR and Molecular Dynamics. Helvetica Chimica Acta, 74: 1027-1047.] The NMR characterization data shown in the examples correspond only to the main equilibrium form observed under the reported deuterated solvent conditions. Scheme 4: Petition 870260074748, dated 07 / 27 / 2026, p. 72 / 295 63 / 105 F in which: hydroxy,

[0360] Ri is selected from the group consisting of

[0361] R2 is selected from the group consisting of

[0362] in which

[0363] m is 0, 1, 2 or 3;

[0364] n is 1, 2 or 3;

[0365] o is 1, 2, 3, 4, 5 or 6;

[0366] p is 1, 2, 3, 4 or 5

[0367] q is 1, 2, 3, 4 or 5, where the sum of peq is 2, 3, 4, 5 or 6; Petition 870260074748, dated 07 / 27 / 2026, page 73 / 295 64 / 105

[0368] r is 2, 3 or 4;

[0369] s is 2, 3 or 4, where the sum of res is 4, 5 or 6;

[0370] XeO, S, NR6 or SO2;

[0371] R3 is hydrogen, Cl-6 alkyl, Cl-6 hydroxyalkyl, cycloalkyl(C38)alkyl(C0-6) or phenylalkyl(C0-6);

[0372] R4 is hydrogen and R5 is hydrogen, hydroxyl or cyano or R4 and R5 together form =O; and

[0373] R6 is hydrogen, Cl-6 alkyl, cycloalkyl(C3-8)alkyl(C0-6), phenylalkyl(C0-6), alkyl(Cl-6)-CO-, cycloalkyl(C3-8)alkyl(CO-6)-CO-, alkyl(Cl 6)-SO2- or cycloalkyl(C3-8)alkyl(C0-6)-SO2-.

[0374] In one embodiment, RI is hydroxy.

[0375] In one modality, R2 is

[0376] where:

[0377] RI is and Petition 870260074748, dated 07 / 27 / 2026, p. 74 / 295 65 / 105

[0378] R2 is selected from the group consisting of

[0379] in which

[0380] m is 0, 1, 2 or 3;

[0381] n is 1, 2 or 3;

[0382] o is 1, 2, 3, 4, 5 or 6;

[0383] p is 1, 2, 3, 4 or 5

[0384] q is 1, 2, 3, 4 or 5, where the sum of peq is 2, 3, 4, 5 or 6;

[0385] r is 2, 3 or 4;

[0386] s is 2, 3 or 4, where the sum of res is 4, 5 or 6;

[0387] X is O, S, NR6 or SO2;

[0388] R3 is hydrogen, Cl-6 alkyl, Cl-6 hydroxyalkyl, cycloalkyl(C38)alkyl(C0-6) or phenylalkyl(C0-6);

[0389] R4 is hydrogen and R5 is hydrogen, hydroxyl or cyano or R4 and R5 together form =O; and

[0390] R6 is hydrogen, Cl-6 alkyl, cycloalkyl(C3-8)alkyl(C0-6), phenylalkyl(C0-6), alkyl(Cl-6)-CO-, cycloalkyl(C3-8)alkyl(CO-6)-CO-, alkyl(Cl-6)SO2- or cycloalkyl(C3-8)alkyl(C0-6)-SO2-.

[0391] In one modality, R2 is NN: en is 1, 2, or 3. In one modality, R2 is:

[0392] In one embodiment, the compounds of Formula (I), Formula (l)-A and Formula (l)-B exist as a pH- and solvent-dependent equilibrium of the six-membered and seven-membered hemiketal forms shown below as El and Fl (Scheme 6). In another embodiment, the compounds of Formula (I), Formula (l)-A and Formula (l)-B exist as a mixture of the cis and trans amides El and Hl. Scheme 6: Petition 870260074748, dated 07 / 27 / 2026, page 75 / 295 66 / 105 E-1 F-1 Preparation of the compounds

[0393] The disclosure compounds can be prepared as described in the following examples. Abbreviations: 4-EP 4-ethylpyridine AcOH acetic acid ACN acetonitrile Aq aqueous C Celsius d doublet dd doublet of doublets DCM dichloromethane DIPEA N,N-diisopropylethylamine DMSO dimethyl sulfoxide EDTA ethylenediaminetetraacetic acid ESIMS electrospray ionization mass spectrometry EtOAc ethyl acetate EtOH ethanol FA formic acid Petition 870260074748, dated 07 / 27 / 2026, page 76 / 295 67 / 105 gh gram hour(s) HPLC high-performance liquid chromatography HRMS high-resolution mass spectrometry iPrOH 2-propanol or isopropanol L liter LC liquid chromatography LCMS liquid chromatography and mass spectrometry MeOH methanol MS mass spectrometry M molar m multiplet min minutes mL milliliter(s) μM m / z micromolar mass-to-charge ratio N2 nitrogen gas nM nanomolar NMR nuclear magnetic resonance 1H NMR: proton nuclear magnetic resonance spectroscopy PEI polyethyleneimine PPU propylpyridylurea pTsOH p-toluenesulfonic acid preparative prep racemic rpm revolutions per minute ta room temperature s singlet sat. saturated SFC supercritical fluid chromatography t triplet TCEP tris(2-carboxyethyl)phosphine TFA trifluoroacetic acid THF tetrahydrofuran Petition 870260074748, dated 07 / 27 / 2026, page 77 / 295 68 / 105 TLC thin-layer chromatography vol. volume Methods used in the purification of the examples

[0394] The purification of intermediates and final products was carried out by normal or reverse phase chromatography.

[0395] Normal phase chromatography was performed using cartridges pre-packed with SiO2 (e.g., RediSep® Rf columns from Teledyne Isco, Inc.) eluting with gradients of suitable solvent systems (e.g., hexanes and ethyl acetate; DCM and MeOH; or unless otherwise indicated).

[0396] The SFC was performed using the methods described below: Method 1: Princeton PPU 5 μm (100A) column (30x250 mm); CO2 / MeOH Method 2: Princeton 4-EP 5 pm (60A) column (30x250 mm); CO2 / MeOH Method 3: Reprospher PEI 5 μm (100A) column (30x250 mm); CO2 / MeOH

[0397] The gradients were selected based on analytical separation.

[0398] Reversed-phase preparative HPLC was performed using the methods described below:

[0399] Method 1: C18 Phenomenex Luna (Agilent); 5 pm column (30x250 mm); 0.1% formic acid and 5% water in acetonitrile; 0.1% formic acid and 5% acetonitrile in water. Gradients were selected based on analytical separation.

[0400] Method 2: C18 YMC Actus Triart (EZprep); 5 μm column (20x150 mm); acetonitrile / water. Gradients were selected based on analytical separation.

[0401] Chiral preparative HPLC was performed using the methods described below:

[0402] Method 1: Chiralpak IC; 5 μm column (20x250 mm); n-Heptane / DCM / EtOH

[0403] Method 2: Chiralpak ID; 5 μm column (20x250 mm); n-Heptane / DCM / iProH

[0404] The gradients were selected based on analytical separation.

[0405] LC / MS Method:

[0406] Column: C18 Acquity UPLC BEH, 130 Angstrom, 1.7 uM, 2.1 mm

[0407] Temperature: 50 °C Petition 870260074748, dated 07 / 27 / 2026, page 78 / 295 69 / 105

[0408] Injection: 1 uL

[0409] Solvent A: water + 5 mM ammonium hydroxide

[0410] Solvent B: acetonitrile + ammonium hydroxide 5 mM

[0411] Gradient: Time (min) Flow Rate A% B% Initial Curve 1.000 98.0 2.0 Initial 4.40 1.0 2.0 98.0 6 5.15 1.0 2.0 98.0 6 5.19 1.0 98.0 2.0 6 MRI Instruments MN:

[0412] Bruker UltraShield™ Advance III HD 400MHz with a cryoDCI probe. The data were processed using the MestReNova 11.0 program. Preparation of intermediates 1 to 7 Intermediate 1: C32-desoxorrapamycin Intermediate 1

[0413] Intermediate 1 was prepared in accordance with procedures known in the literature, including those disclosed in US 5985890 and WO2007 / 085400 A1, each of which is incorporated by reference herein in its entirety. Intermediate 2: RAD001 (everolimus; Afinitor®) Petition 870260074748, dated 07 / 27 / 2026, page 79 / 295 70 / 105

[0414] Intermediate 2 was prepared in accordance with procedures known in the literature, including those disclosed in document WO2012103959, which is incorporated herein by reference in its entirety. Intermediate 3:

[0415] Intermediate 3 was prepared in two stages through Intermediate A, as shown below: Intermediate A Petition 870260074748, dated 07 / 27 / 2026, page 80 / 295 71 / 105 Step 1. Synthesis of Intermediate A

[0416] 2-((tert-Butyldimethylsilyl)oxy)ethanol (0.471 g, 2.67 mmol) was dissolved in anhydrous toluene (0.95 mL) in a reaction flask. The flask was stoppered and then purged under vacuum with nitrogen. Λ / , / V-diisopropylethylamine (DIPEA) (0.490 mL, 2.81 mmol) was added via syringe. The mixture was cooled to 0 °C in an ice-water bath. Triflic anhydride (Tf2O) (0.438 mL, 2.59 mmol) was added dropwise at 0 °C over a period of about two minutes. The reaction mixture was stirred at 0 °C for 30 minutes.

[0417] The vial was removed from the cold bath. DIPEA (0.490 mL, 2.81 mmol) was added using a syringe. The vial was opened and solid Intermediate 1 (0.600 g, 0.667 mmol) was quickly added in one portion. The vial was quickly re-stopped and the mixture was purged under vacuum with nitrogen. Toluene (0.5 mL) was added.

[0418] The reaction was stirred at 40°C under nitrogen overnight. The reaction was diluted with saturated aqueous NaHCO3. The stopped mixture was extracted with EtOAc five times. The organic extracts were combined, dried over Na2SO4, filtered under vacuum through celite and concentrated to obtain a white waxy solid crude product.

[0419] The crude product was purified by flash column chromatography on silica gel (0 to 35% acetone-heptane gradient elution, 40 g silica column, TLC on 35% acetone-heptane, UV visualization) to provide the desired Intermediate A (0.245 g, 0.231 mmol, 34.7% yield) as a glass that was immediately used as is in the next step. Intermediate A: ESIMS [M+NH4] 1076.1, ESIMS [MH] 1056.0. Step 2. Synthesis of Intermediate 3

[0420] Intermediate A (0.135 g, 0.128 mmol) was dissolved in anhydrous THF. Petition 870260074748, dated 07 / 27 / 2026, p. 81 / 295 72 / 105 (1.2 mL) in a glass reaction flask. The flask was stoppered and the mixture was purged under vacuum twice with nitrogen. The mixture was cooled to 0°C in an ice-water bath. HF-pyridine (0.12 mL, 1.332 mmol) was added dropwise via syringe over a period of 30 seconds. The reaction was stirred at 0°C for 60 minutes.

[0421] The reaction mixture was added dropwise to a saturated aqueous solution of NaHCO3. The interrupted mixture was extracted five times with EtOAc. The organic extracts were combined, dried over Na2SÜ4, filtered under vacuum through celite and concentrated to obtain a white solid crude product.

[0422] The crude product was purified by flash column chromatography on silica gel (0 to 50% acetone-heptane gradient elution, 40 g silica column, TLC on 50% acetone-heptane, visualize under UV) to give Intermediate 3 (0.087 g, 0.092 mmol, 72.2% yield) as a white solid. Intermediate 3: ESIMS [M+NH4] 962.0, ESIMS [MH] 943.01H NMR (400 MHz, Chloroform-d) δ 6.46 - 6.25 (m, 2H), 6.19 - 6.09 (m, 1H), 5.91 (m, 1H), 5.55 (m, 1H), 5.34 - 5.26 (m, 1H), 5.26 - 5.15 (m, 1H), 4.88 - 4.64 (m, 2H), 4.11 (m, 1H), 3.94 - 3.82 (m, 1H), 3.79 (m, 1H), 3.73 - 3.63 (m, 3H), 3.63 - 3.47 (m, 4H), 3.45 (m, 4H), 3.33 (m, 3H), 3.28 - 3.15 (m, 2H), 3.13 (s, 3H), 3.08 (m, 1H), 2.80 (m, 1H), 2.32 (m, 3H), 2.14 (m, 2H), 2.07 - 1.94 (m, 2H), 1.94 - 1.72 (m, 5H), 1.72 1.56 (m, 8H), 1.56 - 1.40 (m, 3H), 1.39 - 1.21 (m, 7H), 1.21 - 1.09 (m, 1H), 1.08 0.99 (m, 8H), 0.98 - 0.83 (m, 9H), 0.73 (q, J = 12.0 Hz, 1H). Intermediate 4: Intermediate 4

[0423] Intermediate 1 (0.233 g, 0.259 mmol) was combined with 2,6-di-tert-butyl-4-methylpyridine (0.425 g, 2.071 mmol) in anhydrous dichloromethane (2.6 mL). The reaction mixture was purged under vacuum once with nitrogen. The reaction mixture was cooled to 0°C in an ice-water bath. Solid dimethylphosphinic chloride (0.146 g, 1.294 mmol) was added in a portion. The reaction mixture was stirred at 0°C. Petition 870260074748, dated 07 / 27 / 2026, page 82 / 295 73 / 105 for 80 minutes.

[0424] The reaction was diluted with saturated aqueous NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO^, decanted and concentrated to provide a crude colorless tar product (0.768 g).

[0425] The crude product was purified by flash column chromatography on silica gel (0 to 80% acetone-heptane gradient elution, 24 g silica column, TLC on 80% EtOAc-heptane, UV visualization). The fractions containing the product were combined and concentrated to give Intermediate 4 (0.087 g, 0.089 mmol, 34.4% yield) as a white solid. Intermediate 4: ESIMS [M+NH4] 993.7, ESIMS [MH] 974.7.

[0426] HRMS: Calculated: 999.5812 (as sodium adduct). Found: 999.5807. 1H RMN (600 MHz, Clorofórmio-d) δ 6,47 - 6,26 (m, 2H), 6,22 - 6,08 (m, 1H), 6,02 5,83 (m, 1H), 5,54 (m, 1H), 5,35 - 5,26 (m, 1H), 5,21 (m, 1H), 4,85 - 4,76 (m, 1H), 4,12 (m, 2H), 3,93 - 3,81 (m, 1H), 3,67 (t, J = 7,7 Hz, 1H), 3,62 (d, J = 6,7 Hz, 1H), 3,60 - 3,53 (m, 1H), 3,53 - 3,44 (m, 1H), 3,42 - 3,36 (m, 3H), 3,32 (m, 3H), 3,28 3,18 (m, 1H), 3,13 (m, 3H), 3,05 (m, 1H), 2,82 (m, 1H), 2,42 - 2,21 (m, 3H), 2,16 2,08 (m, 3H), 1,99 (m, 1H), 1,95 - 1,83 (m, 1H), 1,83 - 1,72 (m, 4H), 1,71 - 1,57 (m, 9H), 1,57 - 1,43 (m, 12H), 1,39 (m, 1H), 1,34 - 1,20 (m, 4H), 1,20 - 1,10 (m, 1H), 1,05 (m, 4H), 1,00 (d, J = 6,5 Hz, 3H), 0,95 (dd, J = 6,6, 2,1 Hz, 3H), 0,92 (d, J = 6,6 Hz, 3H), 0,91 - 0,84 (m, 4H), 0,77 (q, J = 12,1 Hz, 1H). Intermediário 5: Petição 870260074748, de 27 / 07 / 2026, pág. 83 / 295 74 / 105

[0427] Intermediate 1 (4.372 g, 4.86 mmol) was dissolved in anhydrous dichloromethane (20 mL). Anhydrous toluene (20 mL) was added. The reaction mixture was evaporated to dryness in a rotary evaporator. This azeotropic drying process was repeated two more times.

[0428] The dry starting material was combined with 2,6-lutidine (1,388 mL, 11.91 mmol) in anhydrous dichloromethane (58 mL). The flask was stoppered and the mixture was purged under vacuum twice with nitrogen. The mixture was cooled to -30 °C in an acetonitrile / dry ice bath.

[0429] Triflic anhydride (1.209 mL, 7.16 mmol) was added dropwise via syringe over a period of four minutes. The reaction mixture was stirred at -30°C for 30 minutes. The reaction mixture was transferred to an ice-water bath at 0°C and stirred for 20 minutes at 0°C.

[0430] The reaction mixture was placed in the rotary evaporator and concentrated without heat. Isopropyl acetate (22 mL) was added. Tetrazol (1.170 g, 16.71 mmol) was added in one portion. The flask was quickly stoppered and purged under vacuum twice with nitrogen. N,N-diisopropylethylamine (4.18 mL, 23.94 mmol) was added via syringe over a period of one minute. The reaction mixture was stirred overnight at room temperature.

[0431] The reaction mixture was concentrated in a rotary evaporator. The concentrate was purified by normal-phase silica gel flash column chromatography (0-40% acetone-heptane gradient elution, 80 g silica column, 40% acetone-heptane TLC, UV visualization).

[0432] Fractions of the second elution peak (as determined by UV absorbance at 279 nm) were combined and concentrated to provide Intermediate 5 (2.194 g, 2.304 mmol, 47.4% yield) as a white solid. Intermediate 5: ESIMS [M+NH4] 969.8, ESIMS [MH] 950.8. 1H NMR (400 MHz, DMSO-dβ) δ 9.33 (d, J = 6.4 Hz, 1H), 6.58 - 6.41 (m, 2H), 6.35 - 6.14 (m, 2H), 6.09 - 5.98 (m, 1H), 5.55 - 5.43 (m, 1H), 5.19 (m, 1H), 5.05 (m, 1H), 5.00 - 4.93 (m, 1H), 4.87 - 4.79 (m, 1H), 4.67 - 4.56 (m, 1H), 3.98 - 3.87 (m, 1H), 3.87 (d, J = 6.9 Hz, 1H), 3.61 (m, 2H), 3.55 (dd, J = 11.8, 1.9 Hz, 1H), 3.49 3.38 (m, 1H), 3.31 - 3.17 (m, 4H), 3.10 (m, 4H), 3.04 (s, 3H), 2.88 - 2.75 (m, 1H), 2.29 - 2.09 (m, 3H), 2.07 - 1.86 (m, 3H), 1.88 - 1.60 (m, 9H), 1.59 - 1.44 (m, 7H), Petition 870260074748, dated 07 / 27 / 2026, p. 84 / 295 75 / 105 1.43 - 1.01 (m, 11H), 0.96 (t, J = 7.1 Hz, 5H), 0.95 - 0.77 (m, 7H), 0.72 (m, 4H). Intermediate 6:

[0433] 2-Ethoxyethanol (0.538 mL, 5.55 mmol) was combined in anhydrous toluene (2.0 mL) and anhydrous dioxane (0.22 mL). N,N-diisopropylethylamine (1.067 mL, 6.11 mmol) was added via syringe. The reaction mixture was purged twice under vacuum with nitrogen. The mixture was cooled to 0°C in an ice-water bath.

[0434] Triflic anhydride (0.901 mL, 5.33 mmol) was added dropwise via syringe over a period of two minutes. The reaction was stirred at 0°C for 15 minutes. The cold bath was removed and the reaction was allowed to equilibrate at room temperature for 15 minutes.

[0435] N,N-diisopropylethylamine (1.067 mL, 6.11 mmol) was added dropwise via syringe over a period of 30 seconds. Intermediate 1 (1.00 g, 1.111 mmol) was added in one portion. The reaction mixture was quickly stoppered and purged under vacuum with nitrogen. Anhydrous toluene (2.0 mL) and anhydrous dioxane (0.22 mL) were added via syringe. The reaction mixture was stirred at 55°C for 24 hours.

[0436] The reaction mixture was diluted with brine and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO^, decanted and concentrated to provide a crude colorless tar product (4.25 g).

[0437] The crude product was purified by flash column chromatography on silica gel (0 to 50% acetone-heptane gradient elution, 80 g silica column, TLC on 40% acetone-heptane, visualize under UV). The fractions containing the product were combined and concentrated to give Intermediate 6 (0.443 g, 0.456 mmol, 41.0% yield) as a colorless glass. Petition 870260074748, dated 07 / 27 / 2026, page 85 / 295 76 / 105 Intermediate 6: ESIMS [MH] 970.9.

[0438] HRMS: calculated - 989.6678 (as ammonium adduct); found 989.6655 calculated - 994.6232 (as sodium adduct); found - 994.6215. Intermediate 7:

[0439] Intermediate 7 was prepared in two stages through Intermediate B, as shown below: Intermediate B Step 1. Synthesis of Intermediate B

[0440] 2,2,5-trimethyl-1,3-dioxane-5-carboxylic acid (0.400 g, 2.296 mmol) and Petition 870260074748, dated 07 / 27 / 2026, page 86 / 295 77 / 105 triethylamine (0.320 mL, 2.296 mmol) were combined and dissolved in anhydrous THF (7.6 mL). The reaction mixture was cooled to 0°C. 2,4,6-trichlorobenzoyl chloride (0.359 mL, 2.296 mmol) was added via syringe. The reaction was stirred at 0°C for ten minutes. The cold bath was removed and the reaction was stirred at room temperature for 2.5 hours. A white solid precipitated.

[0441] The reaction mixture was filtered through a syringe filter. The filter was washed with THF (2 mL). The filtrates were combined and concentrated in the rotary evaporator leaving a colorless tar.

[0442] Toluene (7.6 mL) was added to the concentrate. Intermediate 1 (1.447 g, 1.607 mmol) was added in a portion followed by 4-dimethylaminopyridine (0.281 g, 2.296 mmol). The reaction mixture was stirred at room temperature overnight.

[0443] The mixture was diluted with water and extracted four times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted and concentrated to provide a crude yellow tar product (2.15 g).

[0444] The crude product was purified by flash column chromatography on silica gel (0 to 40% acetone-heptane gradient elution, 40 g silica column, TLC on 40% acetone-heptane, visualize under UV). The fractions containing the product were combined and concentrated to give Intermediate B (0.438 g, 0.415 mmol, 18.1% yield) as a white foam. Intermediate B: ESIMS [M+NH4] 1074.0, ESIMS [MH] 1055.1. Step 2. Synthesis of Intermediate 7

[0445] Intermediate B (0.431 g, 0.408 mmol) was dissolved in THF (4 mL). HCl (1 M, aq.) (2.0 mL, 2.00 mmol) was added via syringe. The reaction was stirred at room temperature for 36 hours.

[0446] The reaction mixture was diluted with water and extracted four times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to provide a light yellow tar. The tar was dissolved in dichloromethane and diluted with heptane. The mixture was concentrated and dried under high vacuum to provide Intermediate 7 (0.407 g, 0.400 mmol, 98% yield) as a white solid. Intermediate 7: ESIMS [M+NH4] 1034.0, ESIMS [MH] 1015.0. HRMS: calculated - 1033.6576 (as an ammonium adduct); found - 1033.6588; calculated - 1038.6130 (as a sodium adduct); found - 1038.6138. Petition 870260074748, dated 07 / 27 / 2026, page 87 / 295 78 / 105 Example 1: (S)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxorrapamycin Example 2: (R)-C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxorrapamycin Example 1 diastereoisomer (S) at C16 Example 2 diastereoisomer (R) at C16 (illustrated)

[0447] To a stirred solution of Intermediate 1 (2.0 g, 2.222 mmol) and 1,1-isothiazolidine dioxide (4.04 g, 33.3 mmol, 15 equivalents) in anhydrous dichloromethane (5.6 mL) was added p-toluenesulfonic acid«H2O (0.042 g, 0.222 mmol, 0.1 equivalent) in a portion. The reaction was stirred at room temperature under a nitrogen atmosphere for 34 minutes. The entire reaction mixture was chromatographed directly on silica (100% heptane gradient elution to 40% acetone-heptane) to give a mixture of products of both diastereoisomers in a ratio of about 3:1 by UV absorbance at 279 nm in LC / MS analysis.

[0448] The diastereomeric mixture was separated by normal phase chromatography on silica (gradient elution from 100% dichloromethane to 40% acetonitrile-dichloromethane).

[0449] The first eluted diastereoisomer (Fr -0.23 in silica TLC developed in 30% acetonitrile-dichloromethane) gives the diastereoisomer (S) of Example 1 as a white solid. Example 1: ESIMS [M+NH4] 1006.7, ESIMS [MH] 987.8.

[0450] Ή RMN (600 MHz, Clorofórmio-d) δ 6,43 (dd, J = 14,9, 10,4 Hz, 1H), 6,35 (dd, J = 14,9, 10,7 Hz, 1H), 6,16 (dd, J = 15,1, 10,2 Hz, 1H), 6,06 - 6,01 (m, 1H), 5,67 (dd, J = 15,2, 8,6 Hz, 1H), 5,35 (dd, J = 6,4, 1,8 Hz, 1H), 5,26 (d, J = 9,6 Hz, 1H), 4,83 (td, J = 6,6, 4,7 Hz, 1H), 4,12 (d, J = 7,4 Hz, 1H), 3,88 (dd, J = 11,1, 5,1 Hz, 1H), 3,84 - 3,77 (m, 1H), 3,63 - 3,60 (m, 2H), 3,51 (d, J = 7,5 Hz, 1H), 3,46 (s, 3H), 3,45 - 3,42 (m, 3H), 3,35 (s, 3H), 3,29 - 3,14 (m, 3H), 3,06 - 2,96 (m, 2H), 2,93 (ddd, J = 10,4, 6,4, 1,5 Hz, 1H), 2,44 (tt, J = 8,6, 6,2 Hz, 1H), 2,37 - 2,23 (m, 4H), 2,22 - 2,14 (m, Petição 870260074748, de 27 / 07 / 2026, pág. 88 / 295 79 / 105 2H), 2.03 (dt, J = 12.3, 3.8 Hz, 1H), 1.96 (pd, J = 6.4, 5.7, 3.5 Hz, 2H), 1.92 - 1.82 (m, 3H), 1.80 - 1.76 (m, 2H), 1.75 (d, J = 1.2 Hz, 4H), 1.72 (d, J = 3.1 Hz, 1H), 1.68 (d, J = 1.3 Hz, 3H), 1.65 - 1.53 (m, 4H), 1.48 - 1.17 (m, 9H), 1.07 (d, J = 6.5 Hz, 1H), 1.06 (s, 3H), 1,04 (d, J = 7,3 Hz, 3H), 1.01 (d, J = 6.6 Hz, 3H), 0.99 (dd, J = 6.7, 2.3 Hz, 3H), 0.95 (d, J = 6.8 Hz, 3H), 0.74 (q, J = 11.9 Hz, 1H).

[0451] O segundo diastereoisômero luído (Fr ~0.16 em TLC of silica desenvolvida em 30% of acetonitrila-diclorometano) fornece o diastereoisômero (R) do Exemplo 2 como um sólido branco. Exemplo 2: ESIMS [M+NH4] 1006,9, ESIMS [MH] 988,1.

[0452] 1H RMN (Clorofórmio-d) δ 6.48 (dd, J = 14.7, 10.9 Hz, 1H), 6.24 (dd, J = 14,6, 10,6 Hz, 1H), 6,16 (dd, J = 14,9, 10,6 Hz, 1H), 6,01 (d, J = 11,0 Hz, 1H), 5,38 (dd, J = 14,9, 9,8 Hz, 1H), 5,23 (dd, J = 6,2, 2,0 Hz, 1H), 5,12 (d, J = 9,9 Hz, 1H), 4,73 (dd, J = 12,1, 2,9 Hz, 1H), 4,65 (dt, J = 8,3, 3,9 Hz, 1H), 4,14 (d, J = 6,7 Hz, 1H), 3,97 (m, 1H), 3,74 (d, J = 6,7 Hz, 1H), 3,62 (qd, J = 13,9, 12,7, 5,5 Hz, 2H), 3,42 (s, 3H), 3,39 (m, 1H), 3,31 (s, 3H), 3,24 (ddd, J = 12,2, 7,5, 4,6 Hz, 1H), 3,10 (td, J = 8,2, 3,8 Hz, 1H), 3,08 (s, 1H), 3,02 - 2,97 (m, 1H), 2,97 - 2,92 (m, 1H), 2,83 - 2,71 (m, 1H), 2,42 (ddt, J = 13,1, 9,5, 6,4 Hz, 1H), 2,34 (d, J = 4,3 Hz, 1H), 2,31 (s, 1H), 2,28 - 2,23 (m, 1H), 2,22 - 2,19 (m, 1H), 2,19 (s, 2H), 2,12 - 2,08 (m, 2H), 2,03 - 1,99 (m, 1H), 1,90 (s, 3H), 1,88 (s, 1H), 1,79 (s, 1H), 1,77 (s, 1H), 1,76 (s, 1H), 1,72 - 1,68 (m, 1H), 1,48 (s, 1H), 1,46 (s, 1H), 1,40 (d, J = 3,0 Hz, 1H), 1,38 (s, 1H), 1,66 (d, J = 3,0 Hz, 2H), 1,64 (d, J = 2,9 Hz, 1H), 1,62 (s, 2H), 1,62 (s, 2H), 1,58 - 1,53 (m, 1H), 1,37 (s, 1H), 1,36 (d, J = 2,3 Hz, 1H), 1,33 (d, J = 2,9 Hz, 1H), 1,30 (dd, J = 6,7, 1,8 Hz, 1H), 1,28 (s, 2H), 1,28 (s, 2H), 1,24 (s, 1H), 1,09 (s, 1H), 1,07 (d, J = 6,6 Hz, 3H), 1,05 (d, J = 6,6 Hz, 3H), 1,01 (d, J = 3,2 Hz, 1H), 0,95 (d, J = 6,8 Hz, 3H), 0,92 (s, 1H), 0,92 0,90 (m, 3H), 0,88 (d, J = 6,8 Hz, 2H), 0,66 (q, J = 12,0 Hz, 1H),

[0453] The absolute configurations of the substituents at C16 in Example 1 and Example 2 were determined by X-ray crystallographic co-crystallization with FKBP12. [See Stuart L. Schrieber and Jon Clardy, et al., Atomic Structure of the Rapamycin Human Immunophilin FKBP-12 Complex, J. Am. Chem. Soc., 1991, 113, 7433-7434.] The crystal structures are shown in Figures 1A and 1B and in Figures 2A and 2B.

[0454] Pure FKBP12(1-108) protein was concentrated to 9 mg / mL in 50 mM Tris pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM TCEP. The co-crystallization complex was prepared by mixing the protein with 3 mM of compound (from a 50 mM stock prepared in 90% dDMSO, 10% D2O). The complex was incubated for two Petition 870260074748, dated 07 / 27 / 2026, page 89 / 295 The solution was incubated for 80 / 105 hours at 4 °C and then centrifuged at 10,000 rpm for 2 minutes to remove any potential pellets before crystallization. Co-crystals were obtained at 20 °C by vapor diffusion from a resting droplet using microseed matrix screening [Allan D'Arcy et al., An automated microseed matrix-screening method for protein crystallization, Acta Cryst., (2007) D63, 550-554]. The droplets consisted of 200 nL of protein solution, 160 nL of well solution, and 40 nL of seed stock. Crystals appeared within a few days on the A1 condition of a commercially available Qiagen ammonium sulfate screen. The reservoir solution consisted of 2.2 M ammonium sulfate. The crystals were cryoprotected in reservoir solution supplemented with 20% ethylene glycol and flash-frozen in liquid nitrogen. The data were collected at the Swiss Light Source Facility (SLS, Villigen, Switzerland) on the X10SA beamline.

[0455] The data were processed with XDS (Kabsch, W. (2010), XDS. Acta Cryst. D, 66: 125-132). The structures were determined by molecular substitution (Collaborative Computational Project, Number 4 (1994). Acta Cryst. D50, 760-763) using previous FKBP12 X-ray structures as a search model. The REFMAC (Murshudov GN, Skubák P, Lebedev AA, et al., REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallographica Section D: Biological Crystallography. 2011;67(Pt 4):355-367) and COOT (Emsley P, Lohkamp B, Scott WG, Cowtan K. Features and development of Coot, Acta Crystallographica Section D: Biological Crystallography) programs were used.

[0456] In the following examples, the absolute stereochemistry of the substituent at C16 was not determined by X-ray co-crystallization and is not known. In some examples, only the main diastereomeric product of the reaction was isolated and characterized. In other examples, each diastereoisomer was isolated and characterized without absolute stereochemical assignment. Example 3: C16-(4-oxoazetidin-2-yl)-C32-deoxorrapamycin HO> ' O ' ON > OH Petition 870260074748, dated 07 / 27 / 2026, page 90 / 295 81 / 105 Example 3 * Absolute stereochemistry at C16 not assigned

[0457] To a solution of Intermediate 1 (130 mg, 0.144 mmol, 1.0 eq) and azetidin-2-one (205 mg, 2.89 mmol, 20 eq) in acetonitrile (3 mL) was added para-toluenesulfonic acid monohydrate (82 mg, 0.433 mmol, 3 eq). The reaction mixture was stirred at room temperature for 15 min and then diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product was purified by preparative HPLC chromatography (method 1) followed by SFC purification (method 1) to give Example 3 (2.5 mg, 1.7% yield) as a white solid. Example 3: ESIMS [MH] 938.0 Exact weight: 938.59

[0458] 1H RMN (400 MHz, DMSO-dβ) δ 6,45 (dd, J = 14,0, 11,0 Hz, 1H), 6,28 6,11 (m, 2H), 5,98 (d, J = 10,9 Hz, 1H), 5,95 - 5,85 (m, 1H), 5,50 (dd, J = 14,2, 9,5 Hz, 1H), 5,06 (d, J = 4,7 Hz, 1H), 5,02 - 4,97 (m, 1H), 4,94 (d, J = 9,8 Hz, 1H), 4,63 4,53 (m, 2H), 4,34 - 4,22 (m, 1H), 3,99 - 3,92 (m, 1H), 3,84 - 3,74 (m, 1H), 3,61 3,53 (m, 1H), 3,49 (d, J = 7,3 Hz, 1H), 3,46 - 3,39 (m, 1H), 3,37 - 3,25 (m, 3H), 3,22 - 3,12 (m, 4H), 3,10 - 3,04 (m, 1H), 3,04 - 2,95 (m, 1H), 2,92 - 2,65 (m, 4H), 2,27 2,11 (m, 2H), 2,10 - 1,99 (m, 2H), 1,96 - 1,87 (m, 1H), 1,84 - 1,70 (m, 5H), 1,69 1,37 (m, 15H), 1,37 - 1,05 (m, 8H), 1,03 - 0,93 (m, 4H), 0,90 (d, J = 6,4 Hz, 3H), 0,88 - 0,83 (m, 5H), 0,79 (d, J = 6,7 Hz, 3H), 0,75 (d, J = 6,7 Hz, 3H), 0,59 (q, J = 11,8 Hz, 1H). Exemplo 4: C16-(3-metilimidazolidin-2-ona-1-il)-C32-desoxorrapamicina HO> ' OkOH N Exemplo 4 * Estereoquímica absoluta em C16 não atribuída

[0459] To a solution of Intermediate 1 (100 mg, 0.111 mmol, 1.0 eq) and 1 Petition 870260074748, dated 07 / 27 / 2026, page 91 / 295 82 / 105 methylimidazolidin-2-one (167 mg, 1.66 mmol, 15 eq) in DCM (2 mL) was added to para-toluenesulfonic acid monohydrate (63 mg, 0.333 mmol, 3 eq). The reaction mixture was stirred at room temperature for 24 h. The mixture was diluted with H2O and extracted with DCM. The organic extract was evaporated under reduced pressure. The crude product was purified by preparative HPLC chromatography (method 1) to give Example 4 (9.0 mg, 8% yield) as a white solid. Example 4: ESIMS [MH] 966.5 Exact mass: 967.61

[0460] 1H NMR (600 MHz, DMSO-dβ) δ 0.59 (q, J = 11.9 Hz, 1H), 0.74 (d, J = 6.7 Hz, 3H), 0.79 (d, J = 6.7 Hz, 3H), 0.80 - 0.90 (m, 8H), 0.92 - 1.00 (m, 4H), 1.04 - 1.10 (m, 1H), 1.12 - 1.34 (m, 7H), 1.34 - 1.67 (m, 14H), 1.69 (s, 3H), 1.71 - 1.78 (m, 2H), 1.88 - 1.94 (m, 1H), 1.96 - 2.08 (m, 3H), 2.10 - 2.25 (m, 2H), 2.60 - 2.69 (m, 4H), 2.80 - 2.94 (m, 2H), 3.07 - 3.20 (m, 5H), 3.21 - 3.26 (m, 2H), 3.33 (s, 3H), 3.41 - 3.48 (m, 1H), 3.56 - 3.66 (m, 3H), 3.99 (dd, J = 6.5, 3.5 Hz, 1H), 4.53 - 4.63 (m, 3H), 4.95 - 5.00 (m, 2H), 5.07 (d, J = 4.8 Hz, 1H), 5.35 (s, 1H), 5.45 (dd, J = 14.9, 9.8 Hz, 1H), 5.98 (d, J = 11.0 Hz, 1H), 6.15 (dd, J = 14.8, 10.7 Hz, 1H), 6.23 (dd, J = 14.6, 10.7 Hz, 1H), 6.44 (dd, J = 14.6, 11.0 Hz, 1H). Exemplo 5: C16-(2-hydroxytil)-2-oxoimidazolidin-1-il)-C32-desoxorrapamicina Exemplo 5

[0461] A total of 1 (100 mg, 0.111 mmol, 1.0 eq) and 1-(2hydroxytil)limidazolidin-2-ona (289 mg, 1.66 mmol, 15 eq) and DCM (2 mL) followed Petition 870260074748, dated 07 / 27 / 2026, page 92 / 295 83 / 105 4-methylbenzenesulfonic acid monohydrate (119 mg, 0.626 mmol, 3 eq). The reaction was stirred at room temperature overnight. The reaction was diluted with H2O and extracted with DCM. The organic extract was evaporated under reduced pressure. The crude product was purified by preparative HPLC chromatography (method 1) followed by chiral preparative HPLC (method 2) to give Sample 5 (13.7 mg, 12% yield) as a white solid. Example 5: ESIMS [M+H] 998.5 Exact mass: 997.62

[0462] Ή NMR (400 MHz, DMSO-Ó6) δ 6.45 (dd, J = 14.3, 11.0 Hz, 1H), 6.23 (dd, J = 14.3, 10.6 Hz, 1H), 6, 11.14 (ddH, J = 5.98 (d, J = 10.9 Hz, 1H), 5.44 (dd, J = 14.5, 9.8 Hz, 1H), 5.28 (s, 1H), 5.07 (d, J = 4.7 Hz, 1H), 5.02, J = 4.95 (m 4, 1H), 4.64 – 4.53 (m, 3H), 4.03 – 3.96 (m, 1H), 3.71 – 3.57 (m, 3H), 3.52 – 3.42 (m, 2H), 3.202 – 3.279), (m, 3, 6H), (m, 6, 6H). 2.95 – 2.79 (m, 2H), 2.71 – 2.56 (m, 1H), 2.27 – 1.87 (m, 6H), 1.80 – 1.36 (m, 20H), 1.36 – 1.12 (m, 1.6H), − 1.00 − 0.91 (m, 4H), 0.91 − 0.76 (m, 11H), 0.74 (d, J = 6.7 Hz, 3H), 0.59 (q, J = 11.9 Hz, 1H). Example 6: C16-(l,l-dioxide-l,2-thiazetidine-2-yl)-C32-deoxorrapamycin (Diastereoisomer 1) Example 7: C16-(l,l-dioxide-l,2-thiazetidine-2-yl)-C32-deoxorrapamycin (Diastereoisomer 2) HO / ,. HO / , Example 6 and Example 7 * Absolute stereochemistry in unattributed C16

[0463] Diastereoisomer 1: To a solution of Intermediate 1 (150 mg, 0.167 mmol, 1.0 eq) and 1,1-1,2-thiazetidine dioxide (89 mg, 0.833 mmol, 5 eq) in DCM (3 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.5 mL, 0.500 mmol, 3 eq) at 0 °C. The reaction mixture was stirred at room temperature for 2 h. The mixture was diluted with H2O and extracted with ethyl acetate. The extract Petition 870260074748, dated 07 / 27 / 2026, page 93 / 295 84 / 105 organic matter was evaporated under reduced pressure. The crude product of the diastereoisomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0464] Final purification of the first diastereoisomer eluted by preparative HPLC (method 2) yielded Example 6 (18 mg, 10.7% yield) as a white solid. Example 6: ESIMS [M+NH4] 992.6, [M+FA-H] 1019.6. Exact mass: 974.55

[0465] 1H RMN (400 MHz, Clorofórmio-d) δ 6,39 (dd, J = 14,8, 9,8 Hz, 1H), 6,34 (dd, J = 14,8, 10,3 Hz, 1H), 6,18 - 6,10 (m, 1H), 6,02 (d, J = 10,3, 1,5 Hz, 1H), 5,66 (dd, J = 15,1, 8,6 Hz, 1H), 5,38 (s, 1H), 5,32 (dd, J = 6,4, 1,8 Hz, 1H), 5,23 (d, J = 9,6 Hz, 1H), 4,87 - 4,76 (m, 1H), 4,12 - 4,06 (m, 1H), 3,99 (ddd, J = 12,0, 8,2, 6,2 Hz, 1H), 3,92 - 3,86 (m, 1H), 3,84 (dd, J = 10,7, 4,4 Hz, 1H), 3,81 - 3,74 (m, 1H), 3,63 3,59 (m, 2H), 3,59 (d, J = 3,6 Hz, 1H), 3,46 (d, J = 7,6 Hz, 1H), 3,43 (s, 3H), 3,40 3,37 (m, 1H), 3,32 (s, 3H), 3,04 (ddd, J = 8,2, 5,8, 3,8 Hz, 1H), 3,00 - 2,94 (m, 1H), 2,94 - 2,89 (m, 1H), 2,88 - 2,84 (m, 1H), 2,64 (d, J = 6,7 Hz, 1H), 2,47 - 2,38 (m, 1H), 2,36 - 2,27 (m, 2H), 2,21 - 2,12 (m, 1H), 2,03 - 1,97 (m, 1H), 1,95 - 1,77 (m, 7H), 1,76 - 1,67 (m, 5H), 1,65 (s, 3H), 1,60 - 1,50 (m, 6H), 1,47 - 1,39 (m, 2H), 1,38 - 1,27 (m, 4H), 1,25 - 1,10 (m, 3H), 1,08 - 1,04 (m, 1H), 1,03 - 1,01 (m, 3H), 1,00 (d, J = 1,4 Hz, 3H), 0,99 - 0,97 (m, 3H), 0,97 (d, J = 6,6 Hz,3H), 0.93 (d, J = 6.8 Hz, 3H), 0.75 0.66 (m, 1H).,

[0466] Final purification of the second eluted diastereoisomer using SFC chromatography (method 2) yielded Sample 7 (15.8 mg, 9.2% yield) as a white solid. Example 7: ESIMS [M+NH4] 992.7, [M+FA-H] 1019.6 Exact mass: 974.55

[0467] 1H RMN (400 MHz, Clorofórmio-d) δ 6,46 (dd, J = 14,2, 10,9 Hz, 1H), 6,22 (dd, J = 14,2, 10,6 Hz, 1H), 6,14 (dd, J = 14,5, 10,6 Hz, 1H), 6,00 (d, J = 10,9 Hz, 1H), 5,38 (dd, J = 14,5, 9,6 Hz, 1H), 5,27 - 5,19 (m, 1H), 5,12 - 5,05 (m, 1H), 4,66 - 4,59 (m, 1H), 4,59 - 4,53 (m, 1H), 4,25 (d, J = 1,8 Hz, 1H), 4,17 - 4,06 (m, 3H), 4,02 (ddd, J = 11,8, 8,0, 3,5 Hz, 1H), 3,66 (d, J = 7,0 Hz, 1H), 3,60 - 3,52 (m, 2H), 3,43 - 3,34 (m, 4H), 3,28 (s, 3H), 3,17 - 3,07 (m, 1H), 3,03 - 2,95 (m, 1H), 2,95 - 2,89 (m, 1H), 2,84 - 2,73 (m, 1H), 2,65 - 2,62 (m, 1H), 2,35 - 2,26 (m, 1H), 2,27 - 2,21 (m, 1H), 2,21 2,12 (m, 3H), 2,12 - 2,05 (m, 1H), 2,02 - 1,98 (m, 1H), 1,97 - 1,95 (m, 3H), 1,91 Petição 870260074748, de 27 / 07 / 2026, pág. 94 / 295 85 / 105 1.83 (m, 1H), 1.82 - 1.70 (m, 3H), 1.70 - 1.51 (m, 10H), 1.50 - 1.17 (m, 10H), 1.11 1.06 (m, 1H), 1.02 - 1, 0.96 (m, 1H), 0.93 (d, J = 6.8 Hz, 4H), 0.89 (d, J = 6.6 Hz, 3H), 0.86 (d, J = 6.8 Hz, 3H), 0.64 (q, J = 11.9 Hz, 1H). Example 8: C16-(l,l-dioxide-l,2-thiazetidine-2-yl)-C32-deoxo-C40-(2hydroxyethoxy)-rapamycin (diastereoisomer 1) Example 9: C16-(l,l-dioxide-l,2-thiazetidine-2-yl)-C32-deoxo-C40-(2hydroxyethoxy)-rapamycin (diastereoisomer 2) Example 8 and Example 9 * Absolute stereochemistry in unattributed C16

[0468] To a solution of Intermediate 3 (50 mg, 0.053 mmol, 1.0 eq) and 1,2-thiazetidine 1,1-dioxide (56.7 mg, 0.530 mmol, 10 eq) in DCM (1 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.265 mL, 0.265 mmol, 5 eq). The reaction mixture was stirred at room temperature for 1.5 hours. The reaction was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product of the diastereomeric mixture was separated by flash chromatography (silica; MeCN / DCM 0:100 to 100:0).

[0469] Final purification of the first eluted diastereoisomer using preparative HPLC (method 2) yielded Example 8 (3.1 mg, 5.5% yield) as a white solid. Example 8: ESIMS [M+NH4] 1037.0, [M+FA-H] 1064.1 Exact mass: 1018.58

[0470] Ή RMN (400 MHz, DMSO-d6) δ: 6,53 - 6,44 (m, 1H), 6,41 (dd, J = 11,0, 5,6 Hz, 1H), 6,29 - 6,14 (m, 2H), 6,07 (dd, J = 11,0, 1,5 Hz, 1H), 5,54 (dd, J = 14,6, 9,1 Hz, 1H), 5,06 (d, J = 8,9 Hz, 1H), 4,99 - 4,93 (m, 1H), 4,92 - 4,83 (m, 1H), 4,70 4,60 (m, 1H), 4,49 - 4,42 (m, 1H), 4,13 - 4,02 (m, 3H), 3,92 - 3,86 (m, 1H), 3,69 Petição 870260074748, de 27 / 07 / 2026, pág. 95 / 295 86 / 105 3,64 (m, 1H), 3,59 - 3,54 (m, 1H), 3,52 - 3,42 (m, 5H), 3,33 (s, 3H), 3,30 - 3,27(m, 1H), 3,13 (s, 3H), 3,10 - 3,02 (m, 2H), 3,02 - 2,94 (m, 2H), 2,90 - 2,80 (m, 1H), 2,30 - 2,21 (m, 1H), 2,21 - 2,10 (m, 1H), 2,10 - 2,00 (m, 2H), 2,00 - 1,87 (m, 3H), 1,82 (s, 3H), 1,81 - 1,62 (m, 6H), 1,58 - 1,54 (m, 1H), 1,53 - 1,47 (m, 5H), 1,47 - 1,35(m, 5H), 1,36 - 1,23 (m, 2H), 1,23 - 1,09 (m, 4H), 1,06 - 1,01 (m, 1H), 1,01 - 0,95(m, 6H), 0,90 - 0,87 (m, 1H), 0,87 - 0,83 (m, 3H), 0,81 (d, J = 6,7 Hz, 3H), 0,76 - 0,70 (m, 4H), 0,68 - 0,60 (m, 1H).

[0471] Final purification of the second eluted diastereoisomer using preparative HPLC (method 2) yielded Example 9 (2.8 mg, 4.9% yield) as a white solid. Example 9: ESIMS [M+NH4] 1037.2, [M+FA-H] 1064.3 Exact mass: 1018.58

[0472] 1H NMR (400 MHz, DMSO-dβ) δ: 6.48 - 6.40 (m, 1H), 6.27 - 6.19 (m, 1H), 6.19 - 6.13 (m, 1H), 6.10 - 6.05 (m, 1H), 5.52 (dd, J = 14.2, 9.3 Hz, 1H), 5.13 - 5.00 (m, 2H), 4.96 (d, J = 9.4 Hz, 1H), 4.67 - 4.57 (m, 1H). (d, J = 11,2 Hz, 1H), 3.33 (s, 3H), 3.23 - 3.15 (m, 1H), 3.15 - 3.10 (m, 4H), 3.07 - 2.95 (m, 2H), 2.75 - 2.64 (m, 1H), 2.27 - 2.14 (m, 2H), 2.11 - 2.00 (m, 2H), 2.00 - 1.89 (m, 3H), 1.82 (s, 3H), 1.76 - 1.65 (m, 2H), 1.65 - 1.56 (m, 3H), 1.56 - 1.49 (m, 7H), 1.48 - 1.36 (m, 3H), 1.34 - 1,23 (m, 3H), 1.23 - 1.04 (m, 5H), 1.01 - 0.94 (m, 4H), 0.90 (d, J = 6.4 Hz, 3H), 0.88 - 0.83 (m, 5H), 0.80 (d, J = 6.7 Hz, 3H), 0.75 (d, J = 6.7 Hz, 3H), 0.62 (q, J = 11.8 Hz, 1H). Exemplo 10: C16-(1,1-dióxido-1,2-tiazetidin-2-il)-C32-desoxo-C40-dimetilfosfinilrapamicina (Diastereoisômero 1) Exemplo 11: C16-(1,1-dióxido-1,2-tiazetidin-2-il)-C32-desoxo-C40-dimetilfosfinilrapamicina (Diastereoisômero 2) Petition 870260074748, dated 07 / 27 / 2026, page 96 / 295 87 / 105 , PQ, , PO, OH O. HO« O. HO« Example 10 and Example 11 * Absolute stereochemistry at C16 not assigned

[0473] To a solution of Intermediate 4 (100 mg, 0.102 mmol, 1.0 eq) and 1,2-thiazetidine 1,1-dioxide (54.9 mg, 0.512 mmol, 5 eq) in DCM (5 mL) was added zinc(II) chloride (1 M solution in diethyl ether, 0.512 mL, 0.512 mmol, 5 eq). The reaction mixture was stirred at room temperature for 15 minutes. The reaction was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product of the diastereomeric mixture was separated by SFC chromatography (method 3).

[0474] Final purification of the first eluted diastereoisomer using preparative HPLC (method 2) yielded Example 10 (20.7 mg, 18.8% yield) as a white solid. Exemplo 10: ESIMS [M+H] 1051,9, [M+FA-H] 1096,0 Massa exata: 1050,56

[0475] 1H RMN (400 MHz, DMSO-dβ) δ 6,49 - 6,39 (m, 2H), 6,30 - 6,14 (m, 2H), 6,11 - 6,01 (m, 1H), 5,60 - 5,50 (m, 1H), 5,06 - 5,00 (m, 1H), 4,98 - 4,93 (m, 1H), 4,87 (d, J = 9,7 Hz, 1H), 4,67 - 4,58 (m, 1H), 4,17 - 4,01 (m, 3H), 4,01 - 3,92 (m, 1H), 3,92 - 3,85 (m, 1H), 3,73 - 3,64 (m, 1H), 3,60 - 3,52 (m, 1H), 3,50 - 3,42 (m, 1H), 3,35 - 3,26 (m, 4H), 3,15 - 3,12 (m, 3H), 3,11 - 3,01 (m, 2H), 3,01 - 2,95 (m,1H), 2,88 - 2,79 (m, 1H), 2,29 - 2,20 (m, 1H), 2,20 - 2,12 (m, 1H), 2,10 - 1,99 (m,2H), 1,99 - 1,87 (m, 3H), 1,82 (s, 3H), 1,80 - 1,71 (m, 1H), 1,71 - 1,62 (m, 4H), 1,58 -1,54 (m, 1H), 1,52 - 1,48 (m, 5H), 1,47 - 1,31 (m, 13H), 1,28 - 1,11 (m, 4H), 1,07 - 1,02 (m, 1H), 1,01 - 0,95 (m, 8H), 0,87 - 0,84 (m, 3H), 0,82 (d, J = 6,7 Hz, 3H), 0,79 - 0,76 (m, 1H), 0,74 (d, J = 6,7 Hz, 3H), 0,72 - 0,66 (m, 1H). Petition 870260074748, dated 07 / 27 / 2026, page 97 / 295 88 / 105

[0476] Final purification of the second eluted diastereoisomer using preparative HPLC (method 2) yielded Example 11 (13.4 mg, 12.2% yield) as a white solid. Example 11: ESIMS [M+H] 1051.8, [M+FA-H] 1095.8 Exact mass: 1050.56

[0477] Ή RMN (400 MHz, DMSO-Ó6) δ 6,51 - 6,39 (m, 1H), 6,28 - 6,13 (m, 2H), 6,08 (d, J = 11,1 Hz, 1H), 6,04 - 5,88 (m, 1H), 5,57 - 5,46 (m, 1H), 5,05 (s, 1H), 5,03 (d, J = 5,7 Hz, 1H), 4,96 (d, J = 9,9 Hz, 1H), 4,67 - 4,56 (m, 1H), 4,18 - 4,11 (m, 2H), 4,09 - 4,02 (m, 2H), 3,99 - 3,89 (m, 2H), 3,60 - 3,49 (m, 2H), 3,37 (d, J = 13,3 Hz, 1H), 3,30 (S, 3H), 3,18 (dt, J = 7,7, 5,1 Hz, 1H), 3,15 - 3,11 (m, 4H), 3,07 - 3,00 (m, 1H), 2,73 - 2,63 (m, 1H), 2,28 - 2,13 (m, 2H), 2,13 - 2,05 (m, 2H), 2,05 - 1,97 (m, 2H), 1,97 - 1,88 (m, 1H), 1,83 (s, 3H), 1,80 - 1,69 (m, 1H), 1,68 - 1,58 (m, 4H), 1,58 - 1,48 (m, 7H), 1,48 - 1,43 (m, 1H), 1,42 - 1,34 (m, 10H), 1,34 - 1,28 (m, 1H), 1,28 1,22 (m, 2H), 1,22 - 1,13 (m, 2H), 1,13 - 1,03 (m, 1H), 1,03 - 0,94 (m, 5H), 0,94 0,88 (m, 4H), 0,86 (d, J = 6,5 Hz, 3H), 0,81 (d, J = 6,7 Hz, 3H), 0,75 (d, J = 6,6 Hz, 3H), 0,66 (q, J = 12,0 Hz, 1H). Example 12: C16-(1,1-dioxide-1,2-thiazetidin-2-yl)-C32-deoxo-C40-(S)-(1Htetrazol-1-yl)-rapamycin (Diastereoisomer 1) Example 13: C16-(1,1-dioxide-1,2-thiazetidin-2-yl)-C32-deoxo-C40-(S)-(1Htetrazol-1-yl)-rapamycin (Diastereoisomer 2) ,n=n ,n'N Example 12 and Example 13 * Absolute stereochemistry at C16 not assigned

[0478] A solution of Intermediate 5 (118 mg, 0.124 mmol, 1.0 eq) and 1,2-thiazetidine 1,1-dioxide (66.4 mg, 0.620 mmol, 5 eq) in DCM (6 mL) was added Petition 870260074748, dated 07 / 27 / 2026, page 98 / 295 89 / 105 zinc(II) chloride (1 M solution in diethyl ether, 0.620 mL, 0.620 mmol, 5 eq). The reaction mixture was stirred at room temperature for three hours. The reaction was diluted with H2O and extracted with ethyl acetate. The organic extract was evaporated under reduced pressure. The crude product of the diastereomeric mixture was separated by SFC chromatography (method 3).

[0479] Final purification of the first eluted diastereoisomer using preparative HPLC (method 2) yielded Example 12 (14.8 mg, 11.3% yield) as a white solid. Example 12: ESIMS [M+NH4] 1050.0, [M+FA-H] 1072.1 Exact mass: 1026.57

[0480] 1H NMR (400 MHz, DMSO-dβ) δ 9.32 (s, 1H), 6.52 (s, 1H), 6.45 - 6.37 (m, 1H), 6,31 - 6,14 (m, 2H), 6,10 - 6,04 (m, 1H), 5,60 - 5,49 (m, 1H), 5,23 - 5,12 (m, 1H), 5,07 - 5,01 (m, 1H), 4,99 - 4,93 (m, 1H), 4,87 (d, J = 9,7 Hz, 1H), 4,69 - 4,59 (m, 1H), 4,15 - 4,02 (m, 3H), 3,94 - 3,84 (m, 1H), 3,72 - 3,54 (m, 3H), 3,51 - 3,42 (m, 1H), 3,27 (s, 4H), 3,11 (s, 3H), 3,07 (dd, J = 7,3, 5,1 Hz, 1H), 3,01 - 2,91 (m, 1H), 2,85 (td, J = 10,6, 9,5, 4,7 Hz, 1H), 2,28 - 2,13 (m, 3H), 2,10 - 2,00 (m, 2H), 1,98 - 1,88 (m, 3H), 1,82 (s, 3H), 1,80 - 1,75 (m, 1H), 1,73 - 1,67 (m, 4H), 1,59 - 1,53 (m, 4H), 1,53 - 1,45 (m, 6H), 1,45 - 1,34 (m, 3H), 1,33 - 1,20 (m, 3H), 1,20 - 1,07 (m, 3H), 1,05 - 1,01 (m, 1H), 1,00 - 0,94 (m, 6H), 0,88 - 0,82 (m, 6H), 0,80 - 0,75 (m, 1H), 0,73 (d, J = 6,7 Hz, 3H).

[0481] A purificação final do segundo diastereoisômero eluído usando HPLC preparativa (método 2) forneceu o Exemplo 13 (12,3 mg, 9,4% de rendimento) como um sólido branco. Exemplo 13: ESIMS [M+H] 1027,7, [M-H] 1025,6, [M+FA-H] 1071,6 Massa exata: 1026,57

[0482] 1H RMN (400 MHz, DMSO-d6 δ 9,30 (s, 1H), 6,52 - 6,38 (m, 1H), 6,28 6,14 (m, 2H), 6,08 (d, J = 11,1 Hz, 1H), 5,58 - 5,42 (m, 1H), 5,21 - 5,14 (m, 1H), 5,10 - 5,00 (m, 2H), 5,00 - 4,92 (m, 1H), 4,69 - 4,57 (m, 1H), 4,16 - 4,10 (m, 3H), 4,08 4,01 (m, 1H), 3,97 - 3,91 (m, 1H), 3,61 (dt, J = 10,6, 4,1 Hz, 1H), 3,57 - 3,51 (m, 1H), 3,51 - 3,46 (m, 1H), 3,46 - 3,36 (m, 1H), 3,27 (s, 3H), 3,19 - 3,15 (m, 1H), 3,12 (s, 3H), 3,11 - 3,08 (m, 1H), 2,80 - 2,68 (m, 1H), 2,25 - 2,15 (m, 3H), 2,10 - 2,01 (m, 2H), 2,01 - 1,89 (m, 2H), 1,83 (s, 3H), 1,79 - 1,65 (m, 4H), 1,64 - 1,58 (m, 2H), 1,57 - 1,54 (m, 2H), 1,54 - 1,47 (m, 7H), 1,46 - 1,35 (m, 3H), 1,32 - 1,18 (m, 5H), 1,14 1,04 (m, 3H), 0,98 (d, J = 6,6 Hz, 3H), 0,91 - 0,85 (m, 7H), 0,83 (d, J = 6,7 Hz, 3H), Petição 870260074748, de 27 / 07 / 2026, pág. 99 / 295 90 / 105 0,72 (d, J = 6,6 Hz, 3H). Example 14: C16-(l,l-dioxidoisothiazolidin-2-yl)-C32-deoxo-C40-dimethylphosphinylrapamycin (Diastereoisomer 1) Example 15: 016-(1,l-dioxidoisothiazolidin-2-yl)-C32-deoxo-C40-dimethylphosphinylrapamycin (Diastereoisomer 2) Example 14 and Example 15 * Absolute stereochemistry at C16 not assigned

[0483] Intermediate 4 (0.146 g, 0.150 mmol) and isothiazolidine 1,1-dioxide (0.181 g, 1.496 mmol) were dissolved in anhydrous acetonitrile (1.5 mL). Para-toluenesulfonic acid monohydrate (2.84 mg, 0.015 mmol) was added in a portion. The reaction mixture was stirred at room temperature for two hours.

[0484] Saturated aqueous NaHCO3 was added. The mixture was extracted several times with ethyl acetate. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to provide a colorless crude tar product.

[0485] The crude product was dissolved in MeOH (2.5 mL) and purified by preparative-scale reverse-phase chromatography injection (40 to 90% acetonitrile-water plus 0.1% TFA modifier on a 100 g C18 ISCO column).

[0486] The eluted first peak fractions were combined and reduced to about 1 / 3 of the volume in a rotary evaporator. The remaining solution was made basic with saturated aqueous NaHCO4 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to give Example 14 (0.055 g, 0.044 mmol, 29.3% yield) as a white solid. Example 14: ESIMS [M+NH4] 1082.8, [MH] 1063.7.

[0487] HRMS: calculated for C55H89N2O14PSNa as sodium adduct 1087.5670. Found - 1087.5725.

[0488] (d, J = 10.8 Hz, 1H), Petição 870260074748, de 27 / 07 / 2026, pág. 100 / 295 91 / 105 5,35 (dd, J = 14,7, 9,8 Hz, 1H), 5,23 - 5,17 (m, 1H), 5,10 (d, J = 9,8 Hz, 1H), 4,67 (m, 2H), 4,47 (d, J = 1,8 Hz, 1H), 4,18 - 4,04 (m, 2H), 4,03 - 3,91 (m, 1H), 3,72 (d, J = 6,5 Hz, 1H), 3,68 - 3,48 (m, 2H), 3,38 (m, 4H), 3,28 (s, 3H), 3,26 - 3,12 (m, 2H), 3,12 2,91 (m, 4H), 2,74 (m, 1H), 2,48 - 2,26 (m, 3H), 2,26 - 2,12 (m, 3H), 2,12 - 2,04 (m, 2H), 1,87 (s, 3H), 1,85 - 1,72 (m, 4H), 1,72 - 1,54 (m, 12H), 1,54 - 1,43 (m, 6H), 1,43 - 1,33 (m, 3H), 1,33 - 1,21 (m, 2H), 1,21 - 1,09 (m, 2H), 1,03 (m, 7H), 1,00 - 0,78 (m, 9H), 0,72 (q, J = 11,9 Hz, 1H).

[0489] The eluted fractions of the second peak were combined and reduced to about 1 / 3 of the volume in the rotary evaporator. The remaining solution was made basic with saturated aqueous NaHCO3. The mixture was extracted several times with ethyl acetate. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to give Example 15 (0.010 g, 7.51 μmol, 5.02% yield) as a white solid. Example 15: ESIMS [M+NH4] 1082.8, [MH] 1063.8.

[0490] 1H NMR (400 MHz, Chloroform-d) δ 6.36 (dd, J = 19.2, 10.3 Hz, 1H), 6.13 (m, 1H), 6.04 - 5.84 (m, 1H), 5.65 (m, 1H), 5.32 (m, 1H), 6.21 (m,1H) (dq, J = 10.9, 6.8, 5.6 Hz, 2H), 3.52 (d, J = 7.1 Hz, 1H), 3.46 - 3.33 (m, 7H), 3.30 (m, 3H), 3.18 (m, 3H), 3.10 - 2.82 (m, 3H), 2.39 (t, J = 4.1 Hz, 1H), 2.28 (m, 3H), 2.14 (m, 3H), 1.90 - 1.77 (m, 4H), 1.74 (m, 4H), 1.66 (d, J = 10.4 Hz, 3H), 1.61 - 1.41 (m, 12H), 1.34 - 1.19 (m, 5H), 1.18 - 1.11 (m, 1H), 1.11 0.79 (m, 19H), 0.78 - 0.68 (m, 1H). Example 16: (R)-C16-(1,1-dioxydoisothiazolidin-2-yl)-C32-deoxo-C40-(2-hydroxyethoxy)-rapamycin Petition 870260074748, dated 07 / 27 / 2026, p. 101 / 295 92 / 105

[0491] Absolute stereochemistry at C16 known as (R) based on the use of Example 2 as starting material.

[0492] Example 16 was prepared in a two-step procedure from 2-((tert-butyldimethylsilyl)oxy)ethanol and Example 2. Stage 1. Preparation of Intermediate C

[0493] 2-((tert-Butyldimethylsilyl)oxy)ethanol (0.142 g, 0.803 mmol) was dissolved in anhydrous toluene (0.4 mL). α-diisopropylethylamine (0.147 mL, 0.843 mmol) was added via syringe. The mixture was purged under vacuum with nitrogen and then cooled to 0°C in an ice-water bath. Triflic anhydride (0.132 mL, 0.779 mmol) was added via syringe over a period of 60 seconds. The reaction was stirred at 0°C for 30 minutes.

[0494] / V,A / -di-isopropylethylamine (0.147 mL, 0.843 mmol), toluene (0.5 mL) and Example 2 (0.198 g, 0.200 mmol) were added. The ice bath was removed and the reaction was stirred overnight at 40°C and then for one hour at 55°C.

[0495] The reaction was diluted with saturated aqueous NaHCO3 and extracted four times with EtOAc. The organic extracts were combined, dried over Na2SO4, filtered under vacuum through celite and concentrated to give a colorless oil as crude product.

[0496] The crude product was purified by flash column chromatography on silica gel (0 to 40% acetone-heptane gradient elution, 12 g silica column, Petition 870260074748, dated 07 / 27 / 2026, page 102 / 295 93 / 105 TLC in 30% acetone-heptane, visualize under UV) to give Intermediate C (0.077 g, 0.067 mmol, 33.5% yield) as a white solid. Intermediate C: ESIMS [M+NH4] 1164.7, [MH] 1147.0. Step 2. Preparing Example 16

[0497] Intermediate C (0.077 g, 0.067 mmol) was combined with pyridine (5.43 μL, 0.067 mmol) in anhydrous THF (0.7 mL). The mixture was purged under vacuum twice with nitrogen and then cooled to 0°C in an ice-water bath. HF-pyridine (0.086 mL, 0.671 mmol) was added dropwise via syringe over a period of 15 seconds. The reaction was stirred at 0°C for 70 minutes.

[0498] The reaction was stopped with saturated aqueous NaHCO3 and extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, filtered under vacuum through celite and concentrated to provide a white solid crude product.

[0499] The crude product was purified by silica gel flash column chromatography (0 to 40% acetone-heptane gradient elution, 12 g silica column, TLC on 40% EtOAc-heptane, UV visualization) to give Example 16 (0.049 g, 0.046 mmol, 69.0% yield) as a white solid. Example 16: ESIMS [M+NH4] 1050.9, [MH] 1031.9.

[0500] 1H RMN (600 MHz, Clorofórmio-d) δ 6,45 (dd, J = 14,6, 10,9 Hz, 1H), 6,22 (dd, J = 14,7, 10,6 Hz, 1H), 6,13 (dd, J = 14,9, 10,6 Hz, 1H), 5,98 (d, J = 10,9 Hz, 1H), 5,35 (dd, J = 14,9, 9,8 Hz, 1H), 5,20 (d, J = 5,9 Hz, 1H), 5,09 (d, J = 9,9 Hz, 1H), 4,71 (d, J = 12,3 Hz, 1H), 4,62 (m, 1H), 4,46 (s, 1H), 4,11 (d, J = 6,8 Hz, 1H), 3,96 (t, J = 11,3 Hz, 1H), 3,78 (m, 1H), 3,70 (m, 3H), 3,63 - 3,55 (m, 3H), 3,43 (s, 3H), 3,28 (s, 3H), 3,24 - 3,15 (m, 2H), 3,12 - 3,04 (m, 2H), 3,07 - 2,98 (m, 1H), 2,97 (q, J = 7,9 Hz, 1H), 2,75 (m, 1H),2,44 - 2,33 (m, 1H), 2,30 (M, 2H), 2,23 (m, 1H), 2,16 (m, 2H), 2,09 (d, J = 13,1 Hz, 1H), 2,01 (m, 1H), 1,88 (s, 3H), 1,84 (d, J = 13,1 Hz, 1H), 1,78 - 1,70 (m, 3H), 1,70 - 1,62 (m, 4H), 1,52 (dd, J = 11,8, 7,7 Hz, 1 H), 1,50 - 1,41 (m, 2 H), 1,43 - 1,32 (m, 1H), 1,34 - 1,27 (m, 1H), 1,30 - 1,17 (m, 8H), 1,04 (dd, J = 9,5, 6,6 Hz, 7H), 1,02 - 0,85 (m, 10H), 0,85 (d, J = 6,8 Hz, 3H), 0,69 (q, J = 12,0 Hz, 1H). Example 17: C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxo-C40-(S)-(1Htetrazol-1-yl)-rapamycin Petition 870260074748, dated 07 / 27 / 2026, page 103 / 295 94 / 105 * Absolute stereochemistry at C16 not assigned

[0501] Intermediate 5 (0.109 g, 0.114 mmol) was combined with isothiazolidine 1,1-dioxide (0.139 g, 1.145 mmol) in anhydrous acetonitrile (1.1 mL). Para-toluenesulfonic acid monohydrate (0.0022 mg, 0.011 mmol) was added. The reaction was stirred at room temperature for two hours.

[0502] The reaction was diluted with saturated aqueous NaHCO3. The mixture was extracted several times with EtOAc. The organic extracts were combined, dried over Na2SO4, decanted, and concentrated to provide a crude yellow tar product.

[0503] The crude product was purified by flash column chromatography on silica gel (0 to 40% acetone-heptane gradient elution, 24 g silica column, TLC on 40% acetone-heptane, visualize under UV) to give Example 17 (0.053 g, 0.046 mmol, 40.0% yield) as a white solid. Example 17: ESIMS [M+H] 1041.8, [MH] 1039.8.

[0504] HRMS: calculated for C54H84N6O12SNa - 1063.5765. Found 1063.5759.

[0505] Ή RMN (600 MHz, Clorofórmio-d) δ 8,86 (s, 1H), 6,39 (dd, J = 14,7, 11,0 Hz, 1H), 6,22 (dd, J = 14,7, 10,7 Hz, 1H), 6,11 (dd, J = 15,0, 10,5 Hz, 1H), 5,99 (d, J = 10,9 Hz, 1H), 5,34 (dd, J = 14,9, 9,8 Hz, 1H), 5,18 (d, J = 5,7 Hz, 1H), 5,10 (d, J = 9,8 Hz, 1H), 4,87 (m, 1H), 4,67 (m, 1H), 4,63 (d, J = 12,2 Hz, 1H), 4,50 (s, 1H), 4,13 (d, J = 6,1 Hz, 1H), 3,97 (t, J = 11,4 Hz, 1H), 3,78 (d, J = 6,2 Hz, 1H), 3,69 - 3,62 (m, 1H), 3,55 (dt, J = 11,2, 4,0 Hz, 1H), 3,50 - 3,39 (m, 1H), 3,39 (s, 3H), 3,38 - 3,30 (m, 1H), 3,27 (s, 3H), 3,25 - 3,13 (m, 1H), 3,07 (td, J = 8,4, 3,8 Hz, 1H), 3,01 (m, 1H), 2,96 (q, J = 7,9 Hz, 1H), 2,70 - 2,63 (m, 2H), 2,39 (m, 1H), 2,35 - 2,21 (m, 3H), 2,18 (d, J = 13,7 Hz, 1H), 2,16 - 2,09 (m, 1H), 1,95 - 1,81 (m, 3H), 1,82 (s, 3H), 1,75 (m, 3H), 1,65 (s, 3H), 1,60 (m, 6H), 1,58 - 1,50 (m, 1H), 1,53 - 1,34 (m, 2H), 1,32 (m, 1H), 1,29 (m, Petição 870260074748, de 27 / 07 / 2026, pág. 104 / 295 95 / 105 1H), 1.25 (m, 6H), 1.12 (m, 1H), 1.05 (d, J = 6.6 Hz, 3H), 1.05 - 0.78 (m, 12H). Example 18: C16-(1,1-dioxidoisothiazolidin-2-yl)-C32-deoxo-C40-(2-ethoxyethoxy)rapamycin Example 18 * Absolute stereochemistry at C16 not assigned

[0506] Intermediate 6 (0.090 g, 0.093 mmol) was combined with isothiazolidine 1,1-dioxide (0.112 g, 0.926 mmol) in anhydrous dichloromethane (0.93 mL). Para-toluenesulfonic acid monohydrate (1.761 mg, 9.26 μmol) was added in a portion. The reaction was stirred at room temperature for 100 minutes.

[0507] The entire reaction mixture was purified by silica gel flash column chromatography (0 to 40% acetone-heptane gradient elution, 24 g silica column, TLC on 40% acetone-heptane, visualize under UV) to provide a mixture of Example 18 and residual unreacted 1,1-isothiazolidine dioxide.

[0508] The mixed material was purified again by silica gel flash column chromatography (0 to 50% acetonitrile-dichloromethane gradient elution, 24 g column, TLC on 30% acetonitrile-dichloromethane, UV visualization) to give Example 18 (0.021 g, 0.019 mmol, 20.4% yield) as a white solid. Example 18: ESIMS [M+NH4] 1078.9, [MH] 1059.9.

[0509] HRMS: calculated for the sodium adduct C57H92N2O14SNa - 1083.6167. Found 1083.6151.

[0510] 1H NMR (600 MHz, Chloroform-d) δ 6.45 (dd, J = 14.5, 11.0 Hz, 1H), 6.21 (dd, J = 14.6, 10.7 Hz, 1H), 6.14 (dd, J = 14.8, 10.8 Hz, 1H), 5.98 (d, J = 10.9 Hz, 1H), 5.35 (dd, J = 14.8, 9.8 Hz, 1H), 5.20 (d, J = 5.8 Hz, 1H), 5.09 (d, J = 9.8 Hz, 1H), 4.72 (d, J = 12.1 Hz, 1H), 4.61 (m, 1H), 4.46 (s, 1H), 4.10 (d, J = 6.9 Hz, 1H), 3.96 (t, J = 11.4 Petition 870260074748, dated 07 / 27 / 2026, p. 105 / 295 96 / 105 Hz, 1H), **3.73 (t, J = 5.5 Hz, 2H), 3.68 (d, J = 6.9 Hz, 1H), 3.59 (m, 4H), 3.53 (m, 2H), 3.46 (s, 3H), 3.28 (s, 3H), 3.21 (m, 1H), 3.13 (m, 1H), 3.07 (m, 2H), 3.05 - 2.99 (m, 1H), 2.97 (q, J = 8.0 Hz, 1H), 2.78 (dq, J = 14.4, 7.1 Hz, 1H), 2.44 - 2.33 (m, 1H), 2.31 (m, 2H), 2.27 - 2.19 (m, 1H), 2.19 - 2.12 (m, 2H), 2.07 - 1.94 (m, 2H), 1.88 (s, 3H), 1.83 (d, J = 12.9 Hz, 1H), 1.74 (m, 3H), 1.66 (m, 7H), 1.56 - 1.44 (m, 1H), 1.43 (m, 2H), 1.41 - 1.15 (m, 12H), 1.04 (m, 7H), 0.91 (m, 8H), 0.84 (d, J = 6.7 Hz, 3H), 0.70 (q, J = 12.0 Hz, 1H). Exemplo 19: C16-(1,1-dioxidoisotiazolidin-2-il)-C32-desoxo-C40-((3-hidróxi-2(hidroximetil)-2-metilpropanoil)óxi)-rapamicina Exemplo 19

[0511] Intermediate 7 (0.088 g, 0.087 mmol) was combined with isothiazolidine 1,1-dioxide (0.105 g, 0.866 mmol) in anhydrous dichloromethane (0.87 mL). Para-toluenesulfonic acid monohydrate (1.647 mg, 8.66 μmol) was added. The reaction was stirred at room temperature for 30 minutes.

[0512] The entire reaction mixture was purified by normal-phase flash column chromatography (0 to 60% acetonitrile-dichloromethane gradient elution, 12 g silica column, TLC on 30% acetonitrile-dichloromethane) to give Example 19 (0.020 g, 0.017 mmol, 19.9% ​​yield) as a white solid. Example 19: ESIMS [M+NH4] 1123.0, [MH] 1104.0.

[0513] HRMS: Calculated for the ammonium adduct C58H92N2O16SNH4 1122.6511; found 1122.652.

[0514] 1H RMN (600 MHz, Clorofórmio-d) δ 6,45 (dd, J = 14,7, 10,9 Hz, 1H), 6,22 (dd, J = 14,7, 10,7 Hz, 1H), 6,13 (dd, J = 14,9, 10,6 Hz, 1H), 5,99 (d, J = 10,9 Hz, 1H), 5,35 (dd, J = 14,9, 9,8 Hz, 1H), 5,21 (d, J = 5,8 Hz, 1H), 5,10 (d, J = 9,9 Hz, 1H), 4,73 (ddd, J = 11,0, 9,2, 4,7 Hz, 1H), 4,69 (d, J = 12,4 Hz, 1H), 4,64 (m, 1H), 4,49 (s, 1H), 4,13 (d, J = 6,5 Hz, 1H), 3,97 (t, J = 11,3 Hz, 1H), 3,84 (dd, J = 18,5, 11,4 Hz, 2H), 3,78 - 3,69 (m, 2H), 3,64 (m, 2H), 3,56 (td, J = 13,5, 3,0 Hz, 1H), 3,43 - 3,31 (m, 4H), 3,28 (m, 3H), 3,26 - 3,17 (m, 2H), 3,12 - 2,92 (m, 3H), 2,76 - 2,68 (m, 1H), 2,45 Petição 870260074748, de 27 / 07 / 2026, pág. 106 / 295 97 / 105 2.34 (m, 1H), 2.31-2.21 (m, 3H), 2.20 - 2.10 (m, 3H), 2.06 (m, 1H), 1.87 (m, 4H), 1.75 (m, 3H), 1.71 - 1.59 (m, 3H), 1.60 (s, 3H), Rs 6.6 Hz, 6H), 0.99 - 0.82 (m, 10H), 0.79 (q, J = 12.0 Hz, 1H). Example 20: Biological Assays and Data

[0515] The activity of a compound according to the disclosure was evaluated by the following in vitro and in vivo methods. Pharmacological characterization Materials and methods

[0516] Cell-based assay for determining the potency of rapalogs. The potency of rapalogs was determined using the MEF TSC1- / - cell-based assay. MEF TSC1- / - cells are mouse embryonic fibroblasts deficient in tuberous sclerosis protein - TSC1, which negatively regulates mTORC1 signaling and therefore exhibits constitutive mTORC1 activation, resulting in phosphorylation (activation) of downstream molecules. This cell-based assay is used to measure the inhibition (dephosphorylation) of S6 and 4EBP1 by rapalogs or other mTOR inhibitors.

[0517] MEF TSC1- / - cells were plated on 384-well Griener light-bottom plates coated with Poly-D-lysine and incubated overnight at 37°C, 5% CO2. The following day, the cells were washed 8 times with Hard starve solution (1 L DPBS + 1 g D-(+)glucose + 10 mL 7.5% sodium bicarbonate + 20 mL 1 M HEPES) and incubated for another 2 hours in the same solution. The cells were then treated with compounds at decreasing concentrations (8 points in 3.16-fold dilutions) and incubated for 2 hours at 37°C, 5% CO2. The cells were fixed with 4% paraformaldehyde for 30 min and washed 5 times with TBSEDTA, followed by immunostaining with fluorescently labeled antibodies against pS6 (Ser240 / 244) (Cell Signaling No. 9468) and p4EBP1 (Thr 37 / 46) (Cell Signaling No. 5123). Nuclei were visualized by Hoechst staining (ThermoFisher Scientific No. H3570).Images were obtained from the cells (InCell 600) using the respective fluorescence channels, and the potency of the mTOR inhibitors was defined by the IC50 (nM) of pS6.

[0518] Animal maintenance, compound treatment, and tissue collection. All procedures involving animals were approved by the Novartis Institutes for Research Institutional Animal Care and Use Committee. Petition 870260074748, dated 07 / 27 / 2026, page 107 / 295 98 / 105 Biomedical, Cambridge, MA, USA. Adult male Sprague Dawley (SD) rats were acquired from Envigo (Indianapolis, USA) or Charles River (USA). Once imported, the rats were kept in specific pathogen-free facilities with controlled temperature and light (22°C, 12-hour light / 12-hour dark cycle: lights on at 06:00 h / lights off at 18:00 h) and with ad libitum access to food and water. The rats were acclimatized for at least 3 days before the start of the experiments.

[0519] Example 2 and RAD001 were formulated for oral dosing (per os, po). Blank formulations (without Example 2 or RAD001) served as vehicle controls. Rats received a single dose of Example 2, RAD001, or a respective po vehicle. At predetermined times after treatment, rats were anesthetized with 3.5% isoflurane and euthanized. Several organs were collected and frozen in liquid nitrogen. Blood was collected via a tail vein or cardiac (terminal) puncture and frozen for subsequent pharmacokinetic analyses. All tissues were stored at -80 °C until analyzed.

[0520] Determination of the concentrations of Example 2 and RAD001 in blood and tissues. Concentrations were determined using HPLC / mass spectrometry.

[0521] Protein extraction and immunoblotting. For protein extraction, rapidly frozen tissues were lysed in MSD lysis buffer (MSD, Rockville, Maryland) supplemented with EDTA-free complete protease inhibitor and PhosSTOP phosphatase inhibitor tablets (Roche, Mannheim, Germany) and centrifuged at 13,000g for 20 min at 4°C. The resulting supernatant was used for immunoblotting. Protein was quantified using the BCA protein assay (Thermo Scientific, MA). Samples were separated onto pre-fabricated protein gels of 4 to 20% Criterion™ TGX™ Precast Midi Protein Gels (BioRad, CA) and transferred to nitrocellulose membranes (Bio-Rad, CA) using a Trans Turbo Blot system (Bio-Rad, CA). Immunoblotting was performed with antibodies against p-S6 and t-S6 from Cell Signaling Technologies (all 1:1000 in TBS-T with 5% BSA). The prefixes pet stand for phosphorylated and total forms, respectively.Rabbit HRP-conjugated secondary antibodies (no. 7074) were from Cell Signaling Technologies, MA. The chemiluminescence signal was generated using the chemiluminescent substrate SuperSignal™ West Femto. Petition 870260074748, dated 07 / 27 / 2026, page 108 / 295 99 / 105 Enhanced Chemiluminescent Substrate (No. 34095, Thermo Scientific, MA) or the Western Lightning® Plus-ECL Enhanced Chemiluminescence Substrate (NEL103001EA, Perkin Elmer, MA) was captured using the ChemiDoc MP Imaging System (Bio-Rad). The resulting digital images were converted to TIFF format and quantified using ImageJ software.

[0522] Generation of knockdown cells for FKBP12. A CRISPR / CAS9 vector containing the gRNA sequence targeting the C-terminal of FKBP12 (GCTTCTAAAACTGGAATGAC) was transfected into 293T cells. Selection was performed with puromycin for 48 hours and the cells were plated to form colonies. FKBP12 knockdown clones were screened by immunoblotting with an anti-FKBP12 antibody (Thermo Scientific, Pierce No. PA1026A). Clones with significantly reduced FKBP12 (approximately 80% reduction compared to levels in unaltered 293T cells) were selected.

[0523] Generation of knockout cells for FKBP12. A CRISPR / Cas9 system was used to deliver ribonucleoprotein complexes containing the guide RNA (gRNA) sequence targeting FKBP12 (GCCACTACTCACCGTCTCCT) into 293T cells using the Amaxa® 4D-Nucleofector™ X Kit (Lonza, V4XC-2032). Cell clones were screened by immunoblotting with an anti-FKBP12 antibody (Novus, NB300-508) and individual clones demonstrating complete FKBP12 knockout (no measurable FKBP12) were selected.

[0524] Treatment of wild-type (WT), FKBP12 knockdown, and FKBP12 knockout 293T cells with RAD001 and Example 2. WT, FKBP12 knockdown, and FKBP12 knockout 293T cells were plated at a density of 30,000 cells per well in 96-well poly-Dlysine-coated plates (Corning, No. 354461) in Dulbecco's modified Eagle medium (ThermoFisher, No. 11995-065) supplemented with 10% fetal bovine serum (ThermoFisher, No. 16140-071). Cells were incubated at 37°C, 5% CO2 for 48 hours until they reached ~80% confluence. Cells were treated with RAD001 and Example 2 using a 12-point dose range from 1000 nM to 0.0033 nM for 2 hours at 37°C in duplicate. Media supplemented with dimethyl sulfoxide (DMSO) blank were used as a control for both compounds. The phosphorylated amounts of S6K1 (Thr389) were detected by a Petition 870260074748, dated 07 / 27 / 2026, page 109 / 295 100 / 105 sandwich ELISA kit (Cell signaling, No. 7063C) following the manufacturer's protocol.

[0525] SPR assay to determine the binding affinity to FK506-binding proteins (FKBP).

[0526] Fusions of FKBP containing the N-terminal avi-his6 tag with FKBP12, FKBP51, and FKBP52 were expressed in E. coli and purified using standard chromatography. Each protein was subsequently immobilized on a streptavidin chip in a Biacore 8K SPR instrument (GE Healthcare). Using single-cycle kinetics, titrations of the compounds were flowed at 45 µL / min over each surface using 2-minute association and 30-minute dissociation phases in a buffer containing 50 mM Tris pH 7.5 / 150 mM NaCl / 0.01% Tween 20 / 1 mM DTT / 2% DMSO. Data were fitted using low molecular weight (LMW) single-cycle kinetics. Equilibrium dissociation constants (Kd) are reported.

[0527] Differential pharmacology of rapalogs can be achieved in different cell or tissue types, depending on 1) the relative abundance of FKBP homologs in those cells / tissues and 2) the binding specificity to those different FKBP homologs (Mol. Cell Biol. (2013) 33:1357-1367). Results

[0528] The in vitro potency of mTOR inhibitors was defined by the IC50 (nM) of pS6 in MEF TSC1- / - cells. Compound CI50 (nM) Rapamycin 0.050 RAD001 0.050 Intermediate 1 0.092 Intermediate 3 0.0591 Intermediate 4 0.066 Intermediate 5 0.106 Example 1 2.4 Example 2 0.274 Example 3 1.45 Example 4 >500 Petition 870260074748, dated 07 / 27 / 2026, page 110 / 295 101 / 105 Example 5 153 Example 6 0.170 Example 7 0.300 Example 8 0.328 Example 9 1.45 Example 10 0.557 Example 11 3.33 Example 12 0.374 Example 13 0.656 Example 14 7.77 Example 15 3.2 Example 16 0.645 Example 17 1.1 Example 18 1.55

[0529] The IC50 values ​​are calculated as the average of several trials.

[0530] The equilibrium dissociation constants (Kd) for FKBP12, FKBP51 and FKBP52. Compound FKBP Binding Protein Average Kd (nM) FKBP12: 500 RAD001 FKBP51: 811 FKBP52: 1765 FKBP12: 0.35 Example 1 FKBP51: 153 FKBP52: 174 FKBP12: 16 Example 2 FKBP51: >10000 FKBP52: >10000 Example 6 FKBP12: 0.32 Petition 870260074748, dated 07 / 27 / 2026, page 111 / 295 102 / 105 FKBP51: 39 FKBP52: 53 FKBP12: 1.2 Example 7 FKBP51: 287 FKBP52: 236 FKBP12: 1.6 Example 10 FKBP51: 95 FKBP52: 176 FKBP12: 16 Example 14 FKBP51: -- FKBP52: 542 FKBP12: 35 Example 16 FKBP51: 4064 FKBP52: 4073

[0531] Pharmacokinetic profile of Example 2 in rats. Four-month-old rats were treated with a single postoperative dose of Example 2 at 3 mg / kg, and blood was collected at 0.25, 0.5, 1, 2, 4, and 7 h post-administration. In this experiment, Example 2 was formulated in 15% polyethylene glycol (PEG) 300, 7.5% Solutol HS15, and 7.5% Cremophore EL in MilliQ water. The concentrations of Example 2 were measured by HPLC-MS (Figure 3).

[0532] Comparative concentrations in the blood and brain of Example 2 and RAD001 in rats.

[0533] Rats aged 4 months were treated orally with Example 2 (formulated as 15% PEG300, 7.5% Solutol HS15, 7.5% Cremophore EL in MilliQ water) at 3, 10, and 30 mg / kg. In another experiment, rats aged 8 weeks were treated orally with RAD001 (formulated as a 2% (w / w) microemulsion and diluted to a final concentration in MilliQ water) at 3, 10, and 30 mg / kg. Blood and brain tissue were collected 3 hours (h) and 24 hours after treatment to determine compound concentrations. When administered at the same doses (3, 10, and 30 mg / kg), blood and brain concentrations of Example 2 were higher compared to those of RAD001 (Figures 4A and 4B).

[0534] To compare the bioavailability of Example 2 versus RAD001 in Petition 870260074748, dated 07 / 27 / 2026, page 112 / 295 In rats aged 103 / 105, the compounds were formulated as solution formulations: Example 1 was formulated in 15% PEG300, 7.5% Solutol HS15, 7.5% Cremophore EL in PBS and RAD001 was formulated in 10% PEG300, 10% Solutol HS15, 10% Cremophore EL in PBS. The compounds were administered to rats aged 7 to 9 weeks (N=3 per group) orally at 3 mg / kg and intravenously (iv) at 1 mg / kg (Figures 4C and 4D). For Example 2 and RAD001, respectively, the bioavailability was 18% and 19%, the terminal IV half-life was 9.9 h and 9.5 h, the clearance was 9 mL / min / kg and 32 mL / min / kg, and the Vdss (volume of distribution at steady state) was 4.4 L / kg and 18.8 L / kg.

[0535] Example 2 inhibits the mTORCl pathway in rat liver. The ability of Example 2 to inhibit the mTORC1 pathway in vivo was determined in 4-month-old rats (Figures 5A to 5D). A single dose of Example 2 at 3, 10, and 30 mg / kg resulted in significant dephosphorylation (inactivation) of S6 in rat livers (compared to the vehicle control) three hours after administration (Figures 5A and 5B). S6 remained inactivated 24 h after administration of 10 (trend p=0.06) and 30 mg / kg (Figures 5C and 5D).

[0536] FKBP12 is required for the inhibitory effect of Example 2, but not RAD001. Phosphorylated amounts of S6K1 (Thr389) were measured in 293T WT cells, knockdown for FKBP12 and knockout for FKBP12 treated with RAD001 or Example 2. S6K1 is a posterior target of mTORC1 and phosphorylation of its rapalog-sensitive Thr389 site is used as a functional readout of mTORC1 activity. Lee, CH, Inoki, K. and Guan, KL (2007). mTOR pathway as a target in tissue hypertrophy. Annu. Rev. Pharmacol. Toxicol. 47, 443-467. In 293T WT cells, both RAD001 and Example 2 were effective in inhibiting S6K1 (Thr389) by ~80% (Figure 6A). In FKBP12 knockdown cells, Example 2 failed to inhibit S6K1(Thr389) phosphorylation to the same level as RAD001: the maximum inhibition of S6K1(Thr389) by RAD001 was ~70%, while the inhibition achieved by Example 2 was ~40% (Figure 6B).In FKBP12 knockout cells, Example 2 failed to inhibit S6K1(Thr389) phosphorylation, while >60% inhibition was still achieved by RAD001 (Figure 6C). These results indicate that the pharmacological effects of Example 2 are restricted to FKBP12. Such specificity of Example 2 for FKBP12 may facilitate targeting to cells and tissues with relatively high levels of FKBP12 expression, avoiding (or minimizing) side effects in tissues where FKBP12 is weakly expressed. Petition 870260074748, dated 07 / 27 / 2026, page 113 / 295 104 / 105 Equivalents and scope

[0537] In claims, articles such as a, an, or others may mean one or more of a, unless otherwise indicated or otherwise evident from the context. Claims or descriptions that include or include one or more members of a group are considered satisfied if one, more than one, or all members of the group are present in, are employed in, or are otherwise relevant to a particular product or process, unless otherwise indicated or otherwise evident from the context. Disclosure includes embodiments in which exactly one member of the group is present in, is employed in, or is otherwise relevant to a particular product or process. Disclosure includes embodiments in which more than one or all members of the group are present in, are employed in, or are otherwise relevant to a particular product or process.

[0538] Furthermore, the disclosure covers all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms of one or more of the listed claims are introduced into another claim. For example, any claim that is dependent on another claim may be modified to include one or more limitations found in any other claim that is dependent on the same underlying claim. Where elements are presented as lists, for example, in Markush group format, each subgroup of the elements is also disclosed, and any element(s) may be removed from the group. It should be understood that, in general, where the disclosure, or aspects of the disclosure, is / are mentioned as comprising particular elements and / or features, certain embodiments of the disclosure or aspects of the disclosure consist of, or essentially consist of, such elements and / or features.Note also that the terms comprising and containing are intended to be open-ended and allow for the inclusion of additional elements or steps. Where ranges are provided, limits are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of a person of ordinary skill in the art, values ​​that are expressed as ranges may assume any specific value or subrange within the ranges mentioned in different embodiments of the disclosure, to the tenth of a unit of the lower limit of the range, unless the context clearly indicates otherwise. Petition 870260074748, dated 07 / 27 / 2026, page 114 / 295 105 / 105

[0539] This application refers to various issued patents, published patent applications, journal articles, and other publications, all incorporated herein by reference. If there is a conflict between any of the incorporated references and this patent, the patent shall prevail. Furthermore, any particular embodiment of the disclosure that falls within the prior art may be explicitly excluded from any one or more of the claims. As such embodiments are considered known to a person of ordinary skill in the art, they may be excluded even if the exclusion is not explicitly stated herein. Any specific embodiment of the disclosure may be excluded from any claim, for any reason, whether or not it relates to the existence of the prior art.

[0540] Skilled in the art will recognize, or be able to determine, through the use of no more than routine experimentation, various equivalents to the specific embodiments described in this document. The scope of the present embodiments described in this document is not intended to be limited to the above Description, but is as set forth in the appended claims. Persons of ordinary skill in the art will appreciate that various alterations and modifications to this description may be made without departing from the spirit or scope of the disclosure, as defined in the following claims. Petition 870260074748, dated 07 / 27 / 2026, p. 115 / 295

Claims

1 / 7 CLAIMS 1. Compound, characterized in that it has Formula (I): or a pharmaceutically acceptable salt thereof, wherein: Ri is selected from the group consisting of: R2 is selected from the group consisting of: and wherein: m is 0, 1, 2 or 3; n is 1, 2 or 3; and R3 is hydrogen, C1-6 alkyl, or C1-6 hydroxyalkyl.

2. Compound according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that: Petition 870260074748, dated 07 / 27 / 2026, page 116 / 295 2 / 7 r3 I R2 is 3. Compound according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that: R2 is 4. A compound according to any one of claims 1 to 3, or a pharmaceutically acceptable salt thereof, characterized in that Ri is hydroxy.

5. Compound according to claim 1, or a pharmaceutically acceptable salt thereof, characterized in that it is selected from: * Absolute stereochemistry at C16 not assigned Petition 870260074748, dated 07 / 27 / 2026, page 117 / 295 3 / 7 * Absolute stereochemistry at C16 not assigned * Absolute stereochemistry at C16 not assigned.

6. Compound, characterized in that it is selected from: Petition 870260074748, dated 07 / 27 / 2026, page 118 / 295 4 / 7 or a pharmaceutically acceptable salt thereof.

7. Pharmaceutical composition, characterized in that it comprises a therapeutically effective amount of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, and one or more pharmaceutically acceptable carriers. Petition 870260074748, dated 07 / 27 / 2026, p. 119 / 295 5 / 7 8. Pharmaceutical combination, characterized in that it comprises a therapeutically effective amount of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, and one or more therapeutically active agents.

9. Use of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, characterized in that it is for the manufacture of a medicament for the prevention or treatment of a disorder or disease selected from among: - Acute or chronic organ or tissue transplant rejection; - Transplant vasculopathies; - Proliferation and migration of smooth muscle cells, leading to thickening of the intima of vessels, obstruction of blood vessels, obstructive coronary atherosclerosis, restenosis; - Autoimmune diseases and inflammatory conditions; - Treatment and prevention of asthma; - Multidrug resistance (MDR); - Fungal infections; - Inflammation; - Infection; - Age-related diseases; - Neurodegenerative diseases; - Proliferative disorders, in particular cancer; - Seizures and seizure-related disorders; and - Mitochondrial myopathy and mitochondrial stress.

10. Use, according to claim 9, characterized in that the disorder or disease is an autoimmune hematological disorder.

11. Use, according to claim 10, characterized in that the autoimmune hematological disorder is hemolytic anemia, aplastic anemia, pure erythrocyte anemia, or idiopathic thrombocytopenia.

12. Use of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, characterized in that it is for the manufacture of a medicament for the prevention or treatment of a disorder or disease that includes the process of fibrosis or inflammation. Petition 870260074748, dated 07 / 27 / 2026, p. 120 / 295 6 / 7 13. Use, according to claim 12, characterized in that the disorder is selected from among hepatic and renal disorders, or in that the hepatic disorder is selected from among hepatic fibrosis, which occurs in end-stage liver disease; hepatic cirrhosis; hepatic failure due to toxicity; non-alcoholic fatty liver disease or NAFLD; and alcoholic fatty liver disease.

14. Use, according to claim 12, characterized in that the renal disorder is renal fibrosis, which occurs as a result of acute kidney injury, or chronic kidney disease, or diabetic nephropathy.

15. Use of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, characterized in that it is for the manufacture of a medicament for the prevention or treatment of an age-related disorder or disease selected from sarcopenia, skin atrophy, cherry angiomas, seborrheic keratoses, cerebral atrophy also known as dementia, atherosclerosis, arteriosclerosis, pulmonary emphysema, osteoporosis, osteoarthritis, high blood pressure, erectile dysfunction, cataracts, macular degeneration, glaucoma, stroke, cerebrovascular disease (cerebrovascular accidents), chronic kidney disease, diabetic kidney disease, liver failure, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, reduced mobility, cognitive decline, tendon stiffness, cardiac dysfunction,such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, cardiac dysfunction resulting in a decline in ejection fraction, immunosenescence, Parkinson's disease, Alzheimer's disease, cancer, immunosenescence leading to cancer due to decreased immune surveillance, infections due to a decline in immune function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of smell, arthritis, and type II diabetes, including complications arising from diabetes such as kidney failure, blindness, and neuropathy.

16. Use of a compound, as defined in any one of claims 1 to 6, or of a pharmaceutically acceptable salt thereof, characterized in that it is for the manufacture of a medicament for the prevention or treatment of cancer.

17. Use according to claim 16, characterized in that it is for the treatment of renal cancer, renal cell carcinoma, colorectal cancer, uterine sarcoma, endometrial uterine cancer, endometrial cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, fibrosarcoma, pancreatic cancer, liver cancer, melanoma, leukemia, multiple myeloma, nasopharyngeal cancer, prostate cancer, lung cancer, glioblastoma, bladder cancer, mesothelioma, head cancer, rhabdomyosarcoma, sarcoma, lymphoma, or neck cancer.

Images