Engineered crispr-cas9 nucleases

Abstract

Engineered CRISPR-Cas9 nucleases with improved specificity and their use in genomic engineering, epigenomic engineering, genome targeting, and genome editing.

Description

1 Engineered CRISPR-Cas9 Nucleases CROSS-REFERENCE TO RELATED APPLICATIONS This application is a division of CA 2,996,888 filed August 26, 2016, and claims priority to U.S. Patent Application Serial Nos. 62 / 211,553, filed on August 28, 2015; 62 / 216,033, filed on September 9, 2015; 62 / 258,280, filed on November 20, 5 2015; 62 / 271,938, filed on December 28, 2015; and 15 / 015,947, filed on February 4, 2016. The entire contents of the foregoing are hereby incorporated by reference. TECHNICAL FIELD The invention relates, at least in part, to engineered Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) / CRISPR-associated protein 9 10 (Cas9) nucleases with altered and improved target specificity and their use in genomic engineering, epigenomic engineering, genome targeting, genome editing, and in vitro diagnostics. BACKGROUND CRISPR-Cas9 nucleases enable efficient genome editing in a wide variety of 15 organisms and cell types (Sander & Joung, Nat Biotechnol 32, 347-355 (2014); Hsu et al., Cell 157, 1262-1278 (2014); Doudna & Charpentier, Science 346, 1258096 (2014); Barrangou & May, Expert Opin Biol Ther 15, 311-314 (2015)). Target site recognition by Cas9 is programmed by a chimeric single guide RNA (sgRNA) that encodes a sequence complementary to a target protospacer (Jinek et al., Science 337, CA 3286103 Date reçue / Received date 2025-09-15 CA 3286103 Date reçue / Received date 2025-09-15 8 I 6-82 l {20 l 2 )). but also requires n::cogni1ion a short neighboring P / \.1\I {i\Iojica et ). Shah et al. RNA Biol I 0, 891-899 (20 l 3 ), Jiang et aL N?.t Biotechnoi 3 l, 233 .. 2:,9 (20 I 3 ): .lind< et al.. Science 337. 8 l 6--82 l As described herein. Cas9 Prote111s can be cn~ineered to sf10\v increased specificity, theoreticalh· lw reducing_ 1he binding affinity of Cas9 for DNA Thus. described herc111 arc a nurnbcr of Cas9 \iariants r.hat have 111crea~;ed ~;pecificity (i e, induce substantially fo,.ver off t?.rget effects ?.t imperfectly matched or mismatched rn DNA sites) as compared to the \Vild type protein, as well as nH.:thods using them 15 20 25 !n a first a:,pect. the invention provides isolated ':.'fn:ptococc1isp\'ogcncs Cas9 {J~pCas9) proteins "'✓ ith mutations at one, tv,;o, three, four. six or all seven of the comprising a sequence that is at least 80° o identical to the SEO ID NO l \Vith rnur.at,ons :u one. t\\O, r.hree, four, no acid sequence six .. or seven of the following positions L l 6q, "i:' N497, R661. Q695. Q926. D l 135 and optionally one or more of a nucicar localization sequence .. eel] penetrating peptide sequence, and / or 3ffinity tag. A mut?.tion ?.lters the arnino acid to ?.n arnino acid other than the native amino acid 497 is anything but NJ In preferred embodiments the mutation changes the amino acid to any amino acid other than the native one., mne or lysine; in some ernbodirnents, amino acid is alanine. In some embod1ment:,, the variant SpCa::,9 protein:, comprise mutations al one, two, three, or all four of the follmving N . R.66 l, Q695, ?.ncl Q926, e g .. one, two, In some embodiments, the variant SpCas9 proteins comprise mutations at Q695 and / or Q926, and optionally one, two, three, four or all five ofL169, Y450, N497, R661 and Dl 135E, e.g., including but not limited to Y450AiQ695A, Ll69AiQ695A, Q695NQ926A, Q695A / Dl 135E, Q926A / Dl 135E, Y450A:Dl 135E, Ll69AiY450AiQ695A, Ll69AiQ695A / Q926A, Y450AiQ695AiQ926A, 30 R661A / Q695A, / Q926A, N497NQ695NQ926A, Y450NQ695A:D1135E, Y450A / Q926,t.\JD1135E, Q695NQ926A / D1135E, Ll69AiY450AiQ695A / Q926A, L169AiR.661NQ695A, / Q926A,Y450AiR.661NQ695A, / Q926A, 2 CA 3286103 Date reçue / Received date 2025-09-15 N4'r!A / Qo95A / Q926A / D l l 3 c.,E.. R6o l A / Qo95A / ()926AiD l l :; SE, and ln some ernbodiments, the\ ariant SpCas'i proteins comprise rnut,'ltions at R~76:N980:H982:Kl003;K1014: SI Kl 107: El 108. SI 109: Kl l U. RI 114, Sl 1 !6: K ! ! 18. DI 135. SI 136 .. Kl 153:, Kl 155 : K 1158: K L200, 0 ! L H 124 J: () l 2 : Q ! 2 K ! Ki Kl ,RI K 1 .100: H 13 l I •. K I J 2 5. K ! 3 .H. T I J J 7 ,; wi: 01 S I 2 l 6. In some embodiments, the variant SpC proteins zdso cornprise one or more of the fo!kming muw.tions N ! 4A. S ! 5A. S55i\ R6.-)A: R 78A. R 165 • R403 S730A: K775A:, S7 • K8JOA: R83 S l 0401\:. N 1041A.N1044A, I< l A: Kl 059A. R 1060A .. I< 1107A: E 1 !08A, Sl l09A: Kl 1 l3A: Rl 11,-J.A: Sl l 16 / \: Kl l l8A:. Dl 13 Sll3 ·l(ll53A: 20 Kl ISSA: Kl 158t\. Kl200A. ()l221A: Hl241A, Q!2S4A. Q12S6A: Kl289 / \: 25 Kl206A:Kl297 ·R!298A:Kl300A:Hl3l! ·Kl • TI 7 / \ and / or S 1216 / -\< In so1ne e1nbodi1n the variant proteins include HFl {N497 A / R66l A / Q695A / Q926,\)H(8 l HF l ··•··K84SA. fIF l ·f·K855A, l +H98'2A. HF J .,-KS,:;SA / K 1 HF! +K848A / R 1060A, HF 1 +K855AiK l OOJA, HF1+K855A / R1060A, HFl 1·H982,\ / Kl HF1 +ll982A / R 1060A HF l+Kl003A}Rl060A, HF l +K810A}KlOOJAJRl060A, HFl +K848A / K1003A / R1060A. In some embodiments, the variant proteins include HF1+K848A / Kl003A, HFl+K848A / R1060A, HFl+K855A / Kl003A, HF1+K855A!R1060A, HF1+K1003AiR1060A, HF1+K848AiK1003A / R1060A. In 30 some embodiments, the variant proteins include Q695NQ926A / R780A, Q695A / Q926A / R976A, Q695A / Q926A1H982A, Q695NQ926AiK855A, Q695NQ926A / K848A!K1003A,Q695NQ926A / K848A / K855A, Q695A / Q926A / K848A!H982A, Q695A / Q926A / K 1003A!Rl 060A, 3 CA 3286103 Date reçue / Received date 2025-09-15 s Qb95A / ()()26:\ / K8c+SAiK 1003A / R 1 :)(j(}\ [n some embodiments .. the vc1riams N497A!RoDIAIQD9~A / Q926A / R780A,N407A!R66!A1Q695A!Q926A / K968A, A!R66! N497A / R66 l A,'{)6Ci5 •\ / {)Ci2(:u\ / R l 060 •\ N497 N497 A / R.66 J A / Q695A / Q926A / K855!\ / K l 20 N497A / R66 l ;\ / {)C / 151\ / {)Ci.2(:;;\ / K 9<:i8 / \ / K 1003 A, N497A / R66 l AiQ695A / Q926A / H982A / K l 0031\, N497 A / RJJ(, J A / ()695 A / ()926A / H982AIR] N497 A / R.661 A / Q695A / Q926A / K l 003 AiR l 1060.A., Ai()926A!K l 047 A, 25 N497A / R661AiQ69S•\ / Q926A / KS48A / K1003A / R 1060A, Q69S•\ / Q926A / R780A., Q695AJQ926A / KS l OA, Q695A}Q926AIR832A, Q69SA}Q926AIK8-:f8A, Q695A / Q926A / K855A, Q695NQ926A / K968A, Q695,A / Q926NR976A, Q695A / Q926A / H982A, Q695A / Q926A / K 1003A, Q695A / Q926A1K 1014A, Q695A / Q926NK1047A, Q695NQ926A / Rl060A, Q695NQ926NK848AiK968A, 30 Q695A / Q926A / R976A, Q695A / Q926A / H982A, Q695A / Q926NK855A, Q695A, / Q926A / K848A, / K 1003A, Q695NQ926A / K848AiK85 SA, Q695A / Q926NK848A!H982A,Q6951VQ926A / Kl003A!Rl060A, Q695A / Q926NR832A / Rl 060A, Q695NQ926A!K968NK 1003A, 4 CA 3286103 Date reçue / Received date 2025-09-15 Q695A / Q02<,AiK 8S ::;, ;\ / H082 c\, ()fri5 A / Q•(!J,i\ / K 8SS i\ / K l 003 A, Q69'ii\ / Q926.\ / K855A!R ! 060 / \, ()o95AiQ926AiH98:?.A / K l 003 / \, ()6'J5 Aj(),J26AJl!%1AiR I 060A .. (i, / )5 / \ / ()926 1\ I OOJ / \JR 1060A, f\lutations to amino acids other than alanine are cdso included, and can be rnade and used in the present methods and ons. ill some ernbod:n,ents, \ariant SpCa~;() proteins compnse one or more of the follmving additional mutations R63A, R66A, R69A, R70i\, R7 ! Y72A, R74A, R75A, K76A, N77A .. R7:3•:\ R ! 1SA. Hl60 K !t:,3 / \. R16~,J\, L !69A, R403l\, Rl i Kll k Kl 124 / \, Kl 158A. K1185A, K1100A, Sl216!\ .. Ql22L\. Kl2SO,\ Rl298A, Kl300A, Kl R.1333 Kl334 / \,Ri335 andT!337A ln some embodiments, the variant SpCas9 proteins corn prise multiple substitution mutations N,.J.q7 / R.66 l / Q695 / ()926 ( quadruple variam rrrntantst 20 Q695 / ()926 (double mutant) R661 / ()695 / Q926 and N4971()6Ci5 / ()926 (triple mutants). ln some embodiments, additional substitution rnutations at L l Y450 and / or D l 135 might be added to these double-, triple, and quadruple mutants or added to single mutants bearing substitut10ns at QU)5 or Q926 ln sorr1e ernbodirnents, the rnutants have alanine place of the v,:ild type an-1ino acid. In some embodiments, the 25 mutants have any amino acid other than arginine or lysine (or the native amino acid} In some embodiments, the variant SpCasq proteins also comprise one or more mutations that decrease nuclease activity selected from the group consisting of mutations at DIO, E762, D839, H983, or D986; and at H840 or N863. In some embodiments, the mutations are: (i) DlOA or DION, and (ii) H840A, H840N, or 30 H840Y In some embodiments, the SpCas9 variants can also include one of the following sets of mutations: Dll35V / R1335Q / T1337R (VQR variant); 5 CA 3286103 Date reçue / Received date 2025-09-15 25 D l l 35E / R l335Q / T l337R (E()R I ariz,nt); DI l35 V / G 12 l 8R / R l335Q / T 13:i7R l ,3 7R (\ / RER variant) comprising a sequence that ism least 8U0 o identical to the an1ino acid sequence of SEQ ID NO. l with mutations at one, t\VO, three, four, or e, or si\ of the follo'vving positions Y'.211, '':'2 i:r \V'.229, '{230, R245, T3 optionally one or more of a nuclear localization sequence. cell penetrating peptide SaCas9 variants described herein include tlie amino acid ~;equence of SEO ID NO 2, 1,vith mutations at one., hvo, three. four. t1ve. six, or more of the following • ons Y2 l l, Y'.:' l 2 .. W229. Y230, rnents the variants include one or more of the follo. ...v ing mutations '{2 l l A. '{2 l W229. Y'.:'30A. R245A, T3i.)2A. ln some embodiment:,, the variant Sc1Cas() proteins co1nprise mutations at N4 l 9 and / or R65-t. and optionallv one, t,vo. three, four or more the additional mutations Y2 l l.. Y2 l 2, \V229, Y230 .. R245 and T392, preferably N4 I 9A / R654A, Y2 l l A / R654A. Y2 l I Y2 I l Ai' / 2 l 12 / \IY65 I Y2 l I \'2 l l AIY230A / Y65 i Y21 i AIR245A / \'65 i '{21 i AIR245A / R654A, Y2 l l A / R245 / i. / N419A. Y2 l l l 9A / R654A, Y2 l 2A / \'230A / R245A, Y2 l l 9A / R654A, R245A / T392 / \. / N419A / R654A., Y2111VR245A / T392A / N419A / R654A, or Y211A / W229A / R245A / N419A / R654A. In some embodiments, the variant SaCas9 proteins comprise mutations at Y211; Y212; W229; Y230; R245; T392; N419; IA46; Q488; N492; Q495; R497; 30 N498; R499; Q500; K518; K523; K525; H557; R561; K572; R634; Y651; R654; G655; N658; S662; N667; R686; K692; R694; H700; K751; D786; T787; Y789; T882; K886; N888; 889; L909; N985; N986; R991; R1015; N44; R45; R.51; R55; R59; R60; R116; R.165; Nl69; R.208; R.209; Y211; T238; Y239; K248; Y256; R314; 6 CA 3286103 Date reçue / Received date 2025-09-15 R792; N804, Y868: KS70, K878. K87'J K88 ! : '{8'J7 R90 I•. and / or K ln some ernbodiments, the ·,ariant Sz,Cas9 pruterns cornpri:',e one or more of the fo]k;v-;ing rnut:irions ' / 211 '\. Y:: L2A: W.220 / \, '·O.,OA R245A_ T392i\, N4 l 9A: N667A:R686A,K602A:R694A.H700A:K75lA: D786A,l-787A,Y789A:T882A: K881 A: Y897 A: R.90 l ,\; K906 / \ !n sornc ernbodiments. \ ariam SaC protein~; comprise one or more of the following_ additional mutz,tions Y21 l A, \V229 / \._ Y23 L446A, Y65 l A. R654,1,, D786A, T787A, ''{789A. T882 R208A. T23 R245 T3 N4l9A .. R59A, K248A. \" R3l4A, N394!\ .. Q4l _ K57!\ .. H.611\ .. Hl 11:\_ Kl 141\ .. Vl A, L788A, S790A., R792A, N804A_ Y868A, K870A_ K878A, K87CiA_ K88 l Y R901 20 Kq06A. In some embodiments, the Yariant Sz,Cz,s9 proteins comprise multiple substinxtion mutations R245 / T3 l 9 / R654 and l / R : 9 / R.654 (quadruple variant mutants): N419. / R65-t R245 / R65-t \'22 l / H.654. and Y22 l iN419 {{.iouble mutants); R2,-Vi / N4l C)1R65,-L Y2 l l l 9 / R.654. and T3 l 9iR654 (triple 25 mutants) ln some embodiments the mutants conrn.in alanine in place of the wild type amino acid. In some embodiments, the variant SaCas9 proteins also comprise one or more mutations that decrease nuclease activity selected from the group consisting of mutations atDlO, E477, D556, H701, orD704; and atH557 orN580. In some 30 embodiments, the mutations are: (i) DlOAor DION, (ii) H557A, H557N, or H557Y, (iii) N580A, and / or (iv) D556A. In some embodiments, the variant SaCas9 proteins comprise one or more of the following mutations: E782K, K929R, N968K, or R1015H. Specifically, 7 CA 3286103 Date reçue / Received date 2025-09-15 E782K / N96SK / R l O 15 H (K KH I ari::rntf E782K / K 92c1RiR l O l 5 H (KR H variant): or E782K / K02•)R. / N0(,8K / R. 101SH (KRKH variant) ln some ernbodiments. the \ariant Cas9 proteins include mutmions to one or more of the fo]]0Vvi11g rc':,'.ions to incrcciSC specif1ci --------------------------------------------------------------------------------------------------------------------------------------------------------- Functioned Re,2_ion : SpCas9 Res1dues cuiiracting L 169. Y4.'i0. f\140:, \!407. the DJ\J_A of the \\76S9: R.66 l ~ \-'!()94: ()(:.C).5~ spacer regwn H(JCl8 A728. QCJ26. El 108: Res1dues that potential;,, contact S777. R77S: R7SU: K7S2: the DN;\ of the non- R783: I(7SC_): K':(17: ()805: tmget strand N808_ K8 l 0. R832. ()844: Residues contacting the DNA of the PA}>! region (including direct Pt\iVl contacts) Residues contacting the RN A of the spacer reg10n Residues contacti 11 g the R.1\JA. of the repeati anti-repeat region Residues contacting the RNA stem loops S8-i5: K84S: SS5 t :_ KS:55: R8SC): K862. K890, Q920. K961. S%4. K9<:i8: K974_ R N9SU: H')S2: Kl 003: K 10 l 4: S l 040. N l 041. N l 04,-1: Kl (Jc! 7: K ! 0.'i9: R.1060: Kl200: Hl'..'::-11: 0 l 254. Q 12V\ K 1289: Kl K1297; Ki3 H13lLKl325 R.71: Y : R403; T404. F40S; K1107: SI l( / i. R l l l ·t S l l ! 6; I< 1 ! 18; D11.3:'-i: SJ 136: Kl200 .. ~r 133 7 Y72:R :K76:L10l:Sl04: Fl :. Rl l.'i:, Hl 16:. 1135 .. Hl Kl 63: Y3'25; H328; R.340: F35 l: D364; Q-+o2: R403 Il 110:. [(1 l 13: R1 l Y l 131 R63 ~ R66~ R70: R.7 l ~ R 74~ R.78; R403; T-404; N407; R447; I448; Y450; K510; Y515; R661; Vl009; Y1013 K30; K33; N46; R40; K44; E57; T62; R69; N77; L455; S460; R467; T472; 1473; H721; K742; Kl097; Vl 100; Tl 102; Fl 105; Kl 123; Kl 124; £1225; Ql272; H1349; S1351; Y1356 8 '{2 ! 1. W229: Y230. R2•,t5: T392; N4l9; L446; \' t\:'-i l : RCJ'i4 Ci.488.A.; N,.[92A; Q495A; R497A; )\J498A; R499, Q:500: K:518: K52:i, K525: H:'-i57; R56 I· 7'2:_ R.634; R654; • N667; K ( / )2 R694 :, K75! 1787: Y789: T8S2:, N888:. A889, L909; N985 N986:_ R.991 :. Rl01:'-i N44: R...1-5:_ R5 l; R55: RY): R.60, Rl 16: Rl N l R.208; R209; Y2 ! l: T' 8: Y239: K24S:, Y2.'i6:, R314:, N394. Q414 7: R61. HI l l: Kl 14; V 164; Rl65; L788; S790; R792; N804; Y868; K870; K878; K879; K881; Y897; R901; K906 R47; K50; R54; R58; H62; R209; E213; S219; R452; K459; R774; N780; R781; L783 CA 3286103 Date reçue / Received date 2025-09-15 i\lso pro,. ideci herein 3re fusion prmeins comprising Lhe isolated variant Cas9 proteins described herein fu to a hetero]ogous f'unc:iornd domain, \'vHh an oplional inten·,.::ning linker, ,vherein the linker du,.::s nut inu.::rfere \vith activity the frision protein i11 some cmbodiiiH.'Jlf'., .. the l1eterolo~;ous h1nct101wl domain acts on DNA or protein .. e g .. on chromatin. ln :,ome embodi the heteroiogous functional domain is a transcriptional activation donwin. In some embodiments, the trnnscriptional activation domain is from VPCA or NF-1•.B p65. in some embodiments. the heterologous functional donrni11 is a trnnsniptional silencer or transcriptional repression domain [n some embodimems. the 1ran',cript:onal repre~:sion domain is a !(rtippel-associatcd box (KR.,A.£3') don1.ain~ repressoc domain (ERD), or mSin3;\ interaction don1a111 (S1DJ ln some embodiments, the tran'.,criptional silencer is Heterochrornatin Protein l (HP l ), heterologous hrnct101w.l dorn:11n is an enzyrne that modifies the methy]ation state of DNA. In some t.::rnbodirnents, the ,.:;nzyrne that modifies meth\forion state of DNA , 5 is a DNA rnethyltransfernse (DNI'dT) or the entirety oc the di,Y<vgenase domain of a TET protein. e g. a cataiytic module comprising the cystei 2OGFeDO domain encoded by 7 highly conserved exons, e.g, ex:tension and the Tet l cat al yti c dcnnain corriprising amino acids l 5 T compn:,J amino acids 1290-1905 and comprising amino acids ()66--1678 In some emboclirnents, the TET protein or 20 TFT-derived dioxygenase domain is from TETI f n some embodiments, the hetero!ogous functional domain is an enzyme that modifies a hi stone subunit In some ernbodimenrs. the enzyme tha:. modifies a histonc subunit is a hisi.one acetyitransferase (HATL histone deacetylase (HD 1\C}, histone rnethy!transforase U·IMTJ, or hi stone demetlwlase. In son-1e en-1bodinH:nts, the heterologous functional 25 domain is a biological tether. In sorne ernbodirnenb .. the biological tether is MS2, Csy4 or larnbda N protein In some embodiments, the heterologous functional domain is Fokl Also provided herein are nucleic acids, isolated nucleic acids encoding the variant Cas9 proteins described herein, as well as vectors comprising the isolated 30 nucleic acids, optionally operably linked to one or more regulatory domains for expressing the variant Cas9 proteins described herein. Also provided herein are host cells, e.g., bacterial, yeast, insect, or mammalian host cells or transgenic animals (e.g., 9 CA 3286103 Date reçue / Received date 2025-09-15 mice), comprising the nucleic acids described herein, and optirnrnllv expressing the variant Cas9 protein:, ckscribcd herein. Also provided herein are isolated nucleic c1cids encoding the Cas9variants .. as wel! as vectors co111pris111g the i ated nucleic acids. optiona1lv opernbly linked to s one or more regulatory dornc1ins for e,pressing the variants .. and host ce!ls, e rnarnmalian host cells comprising the nucleic acids, and optionally expn~ssing the vari,mt prmein:~. Also provickd herein are rnethods of altering the genonH.: m epigenome of a cell_ by e,.pressing in the cell or contacting the cell \Vith \ariant Cas9 proteins or fusion proteins as described herein~ and at least on.e coinplcmemary to a selected ponion of!he genorne of the cell \.Vith optirnal nucleotide spacing at the genomic target site The methods cm, incl contactinu the cell with a nucleic acid encoding the Cas0 protein and the guide RJ✓ / -\. , rn a vector; contacting the cell ·,..vith a nucleic acid encoding the Cas9 protein and a nucleic acid encoding the guide RN e g, in multiple vectors: and the cell vvith a complex of purified Caso protein and synthetic or purified gRNA. imer a / io. ln some embodiments. the cell stably e:'<presses one or both of the A or the ant protein / fusion protein, and the other element is transfected or introduced into the cell. For example, the cell may stably a Yariant protein or on protein as 20 described herein, and the methods can include cont.acting the cell ,Nith a synthetic gRN / \, a purified recombinant1y produced gRNA, or a nucleic acid encoding the gRNA. In some embodimenrs, the \arianr protein or fusion protein comprises one or rnore of a nuclec1r localizc1tion sequence, ceil penetrating peptide sequence. and / or 25 affinity tag .,\lso provided herein are rnethods for a!terjng, e ectively altering, an isolated dsDNA molecule m vitro bv contacting the dsDNA ,vith a purified variant protein or fusion protein as described herein, and a guide RNA having a region complementary to a selected portion of the dsDNA molecule. Unless otherwise defined, all technical and scientific terms used herein have 30 the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended CA 3286103 Date reçue / Received date 2025-09-15 rn to be lin,itin,r Ail publications, patt.::nt c1pplications, paLents, sequences, database entries, and other references n,entioned herein are 111corpora1ed by reference in their entirety 1n case of conflict. tht.:: presem specification, includrng definitions, will control Other ie;:-;1ures and ad\anta~.es of the invention \.viii be apparent from the follmving detailed description and figures, and from the c1airns DESCRIPTION OF DRAWINGS FI Gs, lA-E i hkntifirntion and drnrncterization of SpCas9 variants hearing mutations in residues that form rion--spedfic DNA, contacts, A, Schematic depicting vvild-typc SpC:as9 recognition of the PDB 4OO(.r and 4UN3 (adapted from rel\. 31 and 3:2, re:,pectively). B. Characterization uf SpCas9 variants that contc1in alanine substitutions in positions that form hydrogen bonds to the Df'✓\ backbone. \Viicl-type SpC assessed using the hurnan cell EGFP disruption assay when ,rnd variants \Vere rned with a 15 perfectly matched sgR]\A or four or.her sgRNAs r.hat encode 1111smatd1es to the target site. Error bars represent s.e.m for n 3: mean l backsxrmmd E(iFP represemed by red dashed line ffor this pane] and panel C) C ,tnd On-target disruption assay (panel C) and l 3 endogenous sites by T7E ! assav (panel D) 20 bars represents e.rn. for n , Ratio of on-rnrget act1vity of SpCas9-HF1 to 'vvjldtype SpCas9 (from panels C and D) FIG, 2A-C i Genome-vride spt'fifidties of vriid-t.ype SpCas9 and SpCas9- HFl ,,rith sgRNA.s for standard target sites. ()ff.target sites of wil,:l-type SpCas9 and SpCas9-HF l with eight sgRNAs targeted to endogenous 1mnwn genes, as 25 determined by GUIDE-seq. Read counts represent a measure cleaYage frequency at a given site; mismatched positions within the spacer or P Mi are highlighted in color. B, Summary of the total number of genome-wide off-target sites identified by GUIDE-seq for wild-type SpCas9 and SpCas9-HFl from the eight sgRNAs used in panel A. C, Off-target sites identified for wild-type SpCas9 and SpCas9-HF 1 for the 30 eight sgRNAs, binned according to the total number of mismatches (within the protospacer and PAM) relative to the on-target site. FIG. 3A-C ! Validation of SpCas9-HF1 specificity improvements by targeted deep sequencing of off-target sites identified by GUIDE-seq. A, Mean 11 CA 3286103 Date reçue / Received date 2025-09-15 i.m-t::;rget percent modification detr.::rmrned deep sequenci 1,,ild·-type SpCcis9 and SpCas'i-Jff l \\ith si'-.. sgRT\J\'., from Fig .?.. E11or bars represent s.e.rn for n ••• 3 B, Percentage of deep sequenced on-rnrget sires m,d GU[DE--seq detected off-target sites that comain inde] ,rnn,itio1E Triplicate experiments are plotted for v,·ild-type s SpCas9. SpC::;,: / LH F 1.. and control condition:~ Fiiled circles below the x-axis represent replicates for which nu inse1'tion or deletion mutations \Vere observed. Off .. target s1te:~ that could not be amplified bv PCR are '.,ho1.1,n in red text with an asterisk. Hypothesis testing using a one-sided Fisher e,;ac:. test ,vith pooled read counts found significant differences (p < 0 05 after adjusting frlr multiple cornpmisons using the ,o Benjamini-Hochberg method) fur comparisons between SpCas9•-HF J and the control condition only at F\.!X 1-1 off-target 1 and F!\NCF-3 off-target I Significant and SpCasl).flF l at all off: .. target sites, and bet,veen \Viid-type SpCas9 and the control condition at all off-target sites except RUN)( l-1 off-target :2. C Scatter piot 1he between GUJDEseq read counts {from Fig '2A) and nH.::an percent modi determined by deep sequencing cJt on- ::;nd off-target cle::;vage site:, 'vvith id-type SpCas9. FIG, 4,i\-C : Genome-wide specificities of wild--type SpCas9 and SpCas9-H FI with sgRNAs for non-standard, repetitiH sites. r\ .. (rU [DE-seq :,pecificity profi of \vild-type SpCas9 and SpCas9-HF l using two sgRNAs to cleave 20 large numbers ofofT-target sites (Fu et al. Nat Biotechnol 31, 822-826 (2013): Tsai et al., Nat Biotechnol 33. 187--1 {20 l (}U iDE-seq read counts represent a measure of cleavage efficiency at a given site. misinatched positions within the spacer or PAI'vI are highlighted in color:. red circles indicate sites likely to have the indicated bulge {1in et al., Nucleic Acids Res 7473~748~ l--1)) at the sgRl'-JA.-DNA interface: 25 blue circles indic::;te sites that may have ::;n alternative gapped ::;lignrnent relative to the one sho'vvn (see Fig 8 ). B, Summary of the total number of genome-v,;ide offtarget sites identified by GUIDE-seq for wild-type SpCas9 and SpCas9-HF1 from the two sgRJ_'JAs used in panel A C, Off-target sites identified with wild-type SpCas9 or SpCas9-HF 1 for \lEGF A sites 2 and 3, binned according to the total number of 30 mismatches (within the protospacer and P AivI) relative to the on-target site. Off-target sites marked with red circles in panel A are not included in these counts; sites marked with blue circles in panel A are counted with the number of mismatches in the nongapped alignment. 12 CA 3286103 Date reçue / Received date 2025-09-15 F!G. 5A-I): Arfr, ities of SpCa:,;9-HFl derivatives bearing additional sub§tihitions. i\. Hurna,1 cell EGFP d1sruption act11.ities wild-type SpCas9, SpCasii-HF l, and SpCasCi-HF l-·cle:T\ative vari::rnts with eight sgR'\JAs. SpCas9--HF l harbors l\497\ R66lA ()(,05 and ()'(!J,A rnutc1tions. HF2 ••• HFl + Dl l35E HF3 ••• s HFl ·•· L 169 HF4 ••• HF) + Y450;\ Error bars represent', e rn fi:1r n ••• 3: mean level of background ECiFP loss represented by the red dashed line R Sunnnary of the on-· target c1ctivi1y when using SpCa:: / J-HF \ aricrnts compared to ,v1ld-type SpCas9 with the eight sgRNAs frmn panel a. Them ·an and interquartile range are shown; the interval sho\v:ng >7iJ°o of \\ild-type c1cti\ ity is hi ighted in green. !\Jean percent rnodification by SpCas9 and HF variants at the F 2 and VEGF / \ site 3 on- 2A and 4 / -\ resistant to the effects of SpCas9-HF l. Percent rnndification deterrnined by T7E l _ background indel percentages \Vere subtracted for all experiments. Enor bars represents e.m. for n •• 3. D, Specificity ratic,s of v,ild-type SpCas9 and HF variants with [he FAN CF site 2 or VEGFA site 3 sgRNAs, plotted as the ratio of on-target to panel C} activity (from FI Gs. 5E-F i Genorne-,vide specificities of SpCas9-.f·IF l, ·· and --HF4 with sgRNAs that have off-target :,ites resistant to the effects l\dean CiUIDE-seq • on at the intended on-target site SpCc1s9-HFl GUIDE--seq 20 experiments in panel F SpCas0-HF l ••• N497A / R66 ! ,:\ / Q69<iA / Q926A; HF2 ••• HF l Dl !3 • HF4 HF [ Y450A. Error bars represents e.m. for n 3 F, GUIDE--seq identified off-target sites of SpCas9-HF l, -HF2, or -HF4 wii.11 either the FANCF site 2 or VEGFA site 3 sgRN Read counts represent c1 rnec1sure of cleavage frequency at a given site: mismatched positions ,vithin the spacer or ~d arc highlighted in color. 25 The fo!d-irnprovernent in oiT-wrget discrirnina[ion \A / as cc1iculc1ted by nonnc1lizing the off-target read counts for an SpCas9-HF variant to the read counts at the on-target site prior to comparison between SpCas9-HF variants. FIG. 6A-B I SpCas9 interaction with the sgRi~A and target DNA. A, Schematic illustrating the SpCas9:sgRNA complex, with base pairing between the 30 sgRi'JA and target DNA B, Structural representation of the SpCas9:sgRNA complex bound to the target DNA, from PDB: 4UN3 (ref 32). The four residues that form hydrogen bond contacts to the target-strand DNA backbone are highlighted in blue; the HNH domain is hidden for visualization purposes. 13 CA 3286103 Date reçue / Received date 2025-09-15 F!G. 7A-D: On-h1rgt't :iNhity comparisons of-,,iild-type and SpCas9-HFl with ",wious sgRNAs used for GUDE-s('q r:qwrimrnas. A mid C. !\lean GUIDEseq t:1g integration at the intended c,n--target sire L,r GU[DL-seq experirnents shown in Figs 2;\ and 4i\ (panels 71\ and 7C respec:in:1y) quantified ln restnction fragment b and d .. J'\.-Jean percent modification at the intended 011--targd site for GlJHJE- experirnents shovvn in Figs 2 / \ and 4A (panels 7B and 7D. respectively) detected bv T7El assay. Error bars represent s.e.rn. f(;r n === .5. Ten VEGFA site 2 off-tarnet sites iden CiUIDE--seq (I that potentially be recognized as oil-target ~;ites that contain s111gle nucleotick (Lin et al, Nucleic Acids Res 42. 7,+73-7485 (2014ii\ {right / , zdigned using Geneious (Kearse et al. Bioinforrnatics 2:3. 1647-1649(2012}) vers1on :3. 1.6 FIG. 9 i Activities of wild-type SpCas9 am! SpCas9-H F1 with tnmrntrd ,5 sgRNAsl4. EGFP disruption activities ofv,:ild-type SpCas9 and SpCas9-HFl using fu!l-iength or truncated :~gRNAs targeted to four sites in E:GFP Error represent s.e.rn. for n 3; rnean le\el of background represented by the red dashed ii ne loss in experiments is FIG. 10: \Vild-typr SpCa:s9 and SpC~1s9-HFi activitir:;; with :sgRNAs 20 beadng 5'-mismaadied guanine ba§t:S, EGFP disruption activities of vvild-type SpCas9 and SpCas9--HF l Yvith sgRNAs targeted to fiJur different For each sgRNAs either contain the matched non-guanine 5'-base or a s·-guanine that is intentiona!lv mismatched. FIG. 11 : Titrating the amount of 'Wild-type SpCas9 and SpCa:s9-HFl 25 rxprr:ssifm plasmids. Human cell EGFP disruption activities 1J,on1 transfections with varying amounts of ,vilci-type and SpCas9-l{F l expression plasmids For all transfections, the amount of sgRNA-containing plasmid was fixed at 250 ng. Two sgRJ_'JAs targeting separate sites were used; Error bars represent s,e.m. for n = 3; mean level of background EGFP loss in negative controls is represented by the red dashed 30 line, FIG. 12A-D I Altering the PAl\1 recognition specificity of SpCas9-HF1, A, Comparison of the mean percent modification of on-target endogenous human sites by SpCas9-VQR (ref 15) and an improved SpCas9-\lRQR using 8 sgRNAs, 14 CA 3286103 Date reçue / Received date 2025-09-15 quantified by T7E 1 assay Both, ari::rnts are engineered to recognize ;;in NG,i\N PAi\I Enor bars represc,rt s.e.rn for n ••• 2 or:. B, On-target EGFP disruption activilies of SpCasii-VQR and SpCas9-\'RQR compared to Lheir -HF l counterparts using eight sgRN;\s. Fnur bars repn;,;ent s.e.rn frlr n _·;_ mean level of b,tck~.round EGFP loss s in neg<11ive con1rols represented lJv the red dashed line. C Comparison of the mean on-target percent modification bv SpCas9-VQR and SpCa,;C) .. \'R()R compared to their bars represent s.e.111. for n ••• 3: ND. not dctectab1e D. Sunrn,ary the fold--change in on-target activity when using SpCas9-V()R or SpCw,9-VR()R cornpared to their ,o corresponding -HF l Yariants (frorn panels Band C) The median and interquartile \\ild-type ac:.i\ity is highlighted in green. FI Gs. D,\-H I Activities of wild-type SpCas9, SpCas9-HFl, and wild-type SpCas9 deri, atives bearing one or more alanine su bstitutiom, M positions frrnt , 5 ran potentiaHy rontact the non-target DNA strand A and B. l'.Juckases were assessed using the EGFP disruption assay. with an :,gRNA that i:, perfectiy matched to a site in the U1FJ> gene as well as an sgRNA that is intenti mismatched at pclsitions l land 12 (panel A) or positions 9 and JO (panel B) 1\!ismatched positions are numbered with position 20 the most PAM--clista1 position; red dashed 20 line represenr.s background levels of EGFP disrupi.ion. HF I SpCa~;9 \Vith N497 A / R66 l AIQ695!\ / Q926!\ substitutions. FI Gs. i ,t.\-H I Activity of ,,.Hd-type SpCas9, SpCas9-Hf1, and SpCas9- H Fl derh:atiH'§ bearing one or more alanine substitutions }lt positions that can potentiaHy contact the non-target DNA strand. A and B, Nuclcascs \.Vere assessed 25 using the EGFP disruption assay, with an sgfU✓ A that is perfectly matched to a site in the LGIP gene as ,vell as an sgRl'-JA that is intentionally mismatched at positions 11 and 12 (panel A) or positions 9 and 10 (panel B). Mismatched positions are numbered with position 20 being the most PAlvf-distal position; the red dashed line represents background levels ofEGFP disruption; HFI = SpCas9 with 30 N497A / R661AiQ695A / Q926A substitutions. FIG. 15 ! Activity of wild-type SpCas9, SpCas9-HF1, and SpCas9(Q695A / Q926A) derivatives bearing one or more alanine substitutions at positions that can potentially contact the non-target DNA strand. Nucleases were 15 CA 3286103 Date reçue / Received date 2025-09-15 assessed using the EGFP ck;ruptiun asscl\'. 1vid1 an sgR]\JA 1hat is perfectly rnatched to a site in file / ( i!T gene as \\Ci] as an c;~;RN I\ that i~; intentionally m1smatched at positions l l and l 2 l\iismatched positions are numben.:;d ,vith position 20 being the most P,\!\l-dis,al position the red dashed line 1q11e:,e11ts background levels of EGFP s disruption. HFI SpCa,,o with N497 R6(jlA / Q(j9'i 1\ / Q92(1;\ substitutions. Db!···· SpCas9 v,·ith Q,,9.:; ,; / Q926A substitutions FIG. g: Anivities of wi!i.Hype SpC~is9, SpC}es9-MFl, and eSpCas9-Ll using a matrhed sgRNA and sgRN \s with sing1e mismatches at each position in the spart'L Nucieases were as:,essed using the HrFP disruption as:;ay, 1vnh an sgRNA that is perfectiv matched to a site in the I / · / ' atchecr·; as vveli as ·t,ons 111d1cated. \,'lismatched positions are numbered v,ith position 20 being the rnost PAf\'1--disrnl position SpCas9-HF l ••• N497 ;.\ / R661 A / Q695A / Q926;-\, and eSP I 1 ••• K848A / K I 003 AIR I 060A Fl Gs, ] 7 / :\-B I Activities of ,,ild-type SpCas9 and variants using a ,s nrntd1ed sgRNA and sgRNAs with single mismatches at various positions in the sparer i A) The actl vi ties of SpCa:,9 nucleases containing cornbinatiom: of alanine substitutions (directed to positions that may potentiaily contact or non-target DNA strands} 1vere a:,ses:,ed w,ing the EGFP disruption th an sgRNA that is perfectly rnatchecl to a site in the J};FP C'rnatchecr'; as well as sgRN that are 20 intentionally mismatched at the 1rnJ1cated spacer positions. (B) ,\ subset of these nucleases from (a) were tested using the rernainder of all possible singly mismatched sgRNAs for the matched on-target site. f'viisrnatched positions arc numbered with position 20 being the most P•\M-dista1 posit1on nun mismatch, \VT wild-type, 25 Db Q695AiQ926A,HFl K810A / K1003A / R1060A. and 1 A / R.66 J A / Q695 A!Q9'26A, J. 0 K848,\ / I< 1003:\ / R l 060•\ FIG 18 : Activities of ·wild-type SpCas9 and variants using a matched sgRNA and sgRNAs with mismatches at various individual positions in the spacer. The activities of SpCas9 nucleases containing combinations of alanine substitutions (directed to positions that may potentially contact the target or non-target 30 DNA strands), ,vere assessed using the EGFP disruption assay with an sgRNA that is perfectly matched to a site in the EGFP gene ("matched") as well as sgRNAs that are intentionally mismatched at the indicated positions. Db = Q695A / Q926A, HF 1 = N497 A / R661A / Q695A / Q926A. 16 CA 3286103 Date reçue / Received date 2025-09-15 F!Gs, 19A-B I Arfrvitit'S of ,wild-type SpCas9 and variants using a mMrht·d sgRNA and sgRNAs ,.,·ith mismatrhrs at various individual positions in the sparer u\) The on-target acti\ities cif SpC::isll nucleases containing combimitions of alanine substitutions tdirected to position~; that may potl;nti,illy contact the target or sgRNAs that are pc,i'ecth nrntc!,ed to a site in the!) ;;r gene (B) / \ subset of these nuclease:; from 1a) were tested with sgRN As contc1irnng mi:;mc1tches at positions l 2, l4, 16,or 18(ofsgRNA "site l·)111theirspacersequencetodeterminevvhether intolerance to mismatches \Vas imparted bv these :;ubst1tutions Db··· Q695A / Q926A .. FIG. 20: Suuctural cornpari~;on of SpCas9 (top) and SaCas9 (bottom) illustrating the similarity betv,een the positions the rnutations in the quadruple mutant constructs (shmvn 111 yellov, sphere represem,ttionl. Also. shown in pink sphere representation are other residues that contact the DNA backbone FI Gs, 21A-B I Artivit_y of wild-type SaCas9 am! SaCas9 derivatives headng one or more alanine substitutions A and B. SaCaso substitutions were directed to positions that rnay potentiallv contact the target DNA (panel A) or have previciusly been shown to influence Pr\iVl specificity (panel B) f·✓ ucleases were assessed using the EG-FP clisrnption assay. 1..vith an sgRt'-IA that is perfectly matched to 20 a site in the F(;f,J' gene as \vcll as an sgRN!\ that is intentionally mismatched at positions l l and 12. ]\ !ismatched positions are numbered \Vith position 20 being the rnost PATVi-diswi position; the red dashed line represent.s background levels of EGFP r"n srupu.o n. FI Gs, 22A-B I Artivities of ,vHd-type (\VT) SaCas9 and SaCas<J 25 derivatin•s bearing one or more alanine substitutions }lt n.·sidues that may potentiaHy contact the target DNA strand A and R Nudeases were assessed using the EGFP disruption assay, with an sgRNA that is perfectly matched to a site in the EGJ-,r gene ("matched") and with an sgR.i'JA that is intentionally mismatched at positions 19 and 20. l\tfismatched positions are numbered with position 20 being the 30 most PA1'1f-distal position. FIG. 23 ! Activities of wild-type (WT) SaCas9 and SaCas9 variants bearing triple combinations of alanine substitutions at residues that may potentially contact the target DNA strand. Nucleases were assessed using the 17 CA 3286103 Date reçue / Received date 2025-09-15 EGFP disruption assav Four cl:fferent sgJZNAs 1vere used {mmched l -L! ). \vith ec1ch of the four tcinz.ct :,ire~; also bei tested vvith mismatched St!RI\J\s knmvn to be efikiently used bY ,viid-t\ pe SaCas9 i\Jismatchecl sgR!'-JAs for each site c1re shown to the right of each llrntched sgR NA ( for C'<c1mp1e, the only rni~;rnatched sgRNi\ for s matched site:, is mrn I 18: 12) \ !1smatched positions are numbered with position 21 being the rnost PAl\f~dista] position: mm. mismatch. derivatives bearing one or more abmine substitutions at residues that ma)' , o double (A) or triple (B) co1:-1binations substitutions here assessed against matched and singly mismatched endogenous hunian gene target :,i te~; usi the T7E I assay. from K!einst1\e1 ct al, 1\'at!fn: Biotechnology 20 I 5. rvl,smatched sgRI\As are numbered vvith the mismatch occurring at position 2 l, the most PAM-di position; , 5 rnisrnatched sgRNAs are derived frrn:-1 the rnatched on--target site that is listed to the left of the mismatched :,'.'.R r·✓ A 20 DETAILED DESCRIPTION / \ limitation of the CRJSPR--Cas9 nucleases is their potential to induce undesired '·off-target'' mutations at in-q.,e1tectlv n1atched target sites (see, example. Tsai et a!, Nat Biotechnol 15), in :,orne cases with frequenc1es rival1ng those obsen,ed at the intended on~targct site (Fu et al.. Nat Biotcchnol. 13 J. Previous work with CRlSPR-Cas9 nuc!eases has suggested that reduci the number of sequence-speci fie interactions between the guide RN A (gRt'-i A) and the spacer region of a target site can reduce mutagenic effects at off-target sites of c1 eavagc in human 25 cells {Fu et aL Nat Biotechnol. 2014) This was earlier accomplished by truncating gRl'JAs at their 5' ends by 2 or 3 nts and it was hypothesized that the mechanism of this increased specificity was a decrease in the interaction energy of the gRi'f.AiCas9 complex so that it was poised with just enough energy to cleave the on-target site, making it less likely to have 30 enough energy to cleave off-target sites where there would presumably be an energetic penalty due to mismatches in the target DNA site (\VO2015i099850). It was hypothesized that oft""...target effects (at DNA sites that are impe1fect matches or mismatches with the intended target site for the guide RNA) of SpCas9 18 CA 3286103 Date reçue / Received date 2025-09-15 might bt.:' minimized h\' decrec1sing nun-specific interactions \vith its target DNA. site. SpCas0-sgRNA. curnp]e,:e~; clec1ve rmgel sites composed an NGG PAI\ l sequence (recognizt.:'d b\ SpCasll} { Deltche\,L E. et al Nature -i7 I. 602-607 (20 l l), Jinek.. iVL et al Science 337. 81 i;-82 ! t20 l 2). Jiang, \V. et al... 't\Jat Biotechnol 31 .. 233-230(2013): s Sternberg.SH .. et ai. Nature C,07. 62-(jf (2014)) and an adjacent 20 bp protospacer sequence (which is curnplementarv to the.::: end the sgR\iA) (Jinek. \·I et al. Science 33 7. S 16-821 (20 l 2 ). Jinek ... \!. et ai Elife 2, e004 7 l (2013 ): Mali.. P et al., previously theorized that the SpCas9-:;gRN•\ com pie\ rn pos:;ess rnore energy than ,o is needed for reco,z.nizi its intended A site, thereby enabli cleavage of mismatched off-target site~; (Fu.'{. et al.. Bioteclmol 32 279-284(2014)) One can envision that this property might advantaueous for die imended role of Cc1sq in adaptive bacterial 1rnrnt.mity. g1\ing it the capabili to clea\c foreign sequences that mav become mutated. This excess energy model is aiso supported by previous studies , 5 demcmstrating that off.,target effects can be reduced (but not elirninated; by decreasi SpCas9concentration(Hsu,PD etai Nc1tBiotechnol3i.827 2(2013): Pattanayak, Vet al. Nat Biotechnol 3 L 839-8,D (2013)) or ceduci complementarity length of the :,gRN•\ (Fu. Y, et c1I. Nat Biotechnol 32, 279-284 (2014), although other interpretations for this effect have also proposed (Josephs, 20 A. et al. Nucleic Acids Res 43, 8924-SCi41 (2015) Sternberg, SH, et a] Nature 25 7, ll 0--! 13 (20 ! 5); Kiani, S et al t'.Jat Methods ! 2, l 051 •· ! (2015;}) Structural data suggests that the SpCas9-sgRN DI·✓ A cornplex may be stabilized by several SpCasli-mediated DNA contacts, inclucilng direct hydrogen bonds made by four SpCas9 residues (I\A97, R66 J Q605. Q926) to the phosphate backbone of the target DNA strand (Nishinrnsu. H. et ai Cell 156. 93 (2014): Anders .. C, et al. Nature 513. 569-573 (201,:J)) (Fig. la and Figs. 6a and 6b) The present inventors envisioned that disruption of one or more of these contacts might energetically poise the SpCas9-sgRi'JA complex at a level just suflicient to retain robust on-target activity but with a diminished ability to cleave mismatched off-target sites. 30 As described herein, Cas9 proteins can be engineered to show increased specificity, theoretically by reducing the binding affinity of Cas9 for DNA. Several variants of the widely used Streptococcus pyogenes Cas9 (SpCas9) were engineered by introducing individual alanine substitutions into various residues in SpCas9 that 19 CA 3286103 Date reçue / Received date 2025-09-15 might be expected to interac1 \\ith phusphates un the DNA backbone using structural infornrntion, bc1cteric11 :wlcc,ion-based directed evolution, and combinatorial design The variants were further tested fc,r cellul::ir activitv usi a rnbust i".co!i--based screening ass;=1v to ,h:,es,; the cellular c1cti\ ities of these v:niant~,. 111 this bacterial s system, eel! :~urv1 val depended on ciec1\ c1ge and :~ubsequent destruction of a selection plasmid containing a gene for the toxic gyrase poison ccdB and a '.?3 base pair sequence targeted bv a gRNA c1nd SpC,dJ, and led to identification of residues that ,vtTe associated ,vith retained ur lost activity Jn addition, SpCas9 variant 'vvas identified and characterized, \Vhich ex:hibited irnproved target specificity in human , o cells Furthermore, acti v1 ti es of single al ani nc subs,itut1 on mutants of SpCas9 as assessed in the bacterial cell--based svstem indicc1ted thm sun:ival percentc1ges bet1veen 50-lOOi)o usuallv indicated robust cleavage. ·whereas o suniqil indicated Urnt the enzyme had been functic,nallY cc,mprornised Additional rnurnticms SpCas9 1vere , 5 then assayed in bacteria tu include R63A, R66A, R69A, R70A, R7 l "{72 / \, R74A,. R75A, K76,\, N77A, R78A, Rl 15A, Hl60r\ .. K163A, Rl65 L Kl l23A Kl l Kl! 58A, Kl l85A, Kl200A S l216A, Ql Kl 20 R 1298 / \, K 1300A, Kl 325A, R 1333A, K 1334A. R 1335A, and Tl 337 A. \Vith the exception of 2 mutants (R69A and F405A) that had< 5° i) survival in bacteria, all of these additional si c mutations appeared to ha\C little effect on the on-target activity of SpCas9 survi\ al in the bacterial screen) To funher determine 'vvhether the variants of identified in the bacterial 25 screen fl.mcticined efficientlv in human cells, vc1rious alanine substitution Cas9 mutants were tested using a human U20S cell~based EGFP-disruption assay In this assay, successful cleavage of a target site in the coding sequence of a single integrated, constitutively expressed EGFP gene led to the induction of indel mutations and dismption of EGFP activity, which was quantitatively assessed by flow cytometry 30 (see, for example, Reyon et al., Nat Biotechnol. 2012 May;30(5):460-5). These experiments show that the results obtained in the bacterial cell-based assay correlate ,vell with nuclease activities in human cells, suggesting that these engineering strategies could be extended to Cas9s from other species and different 20 CA 3286103 Date reçue / Received date 2025-09-15 cells. Thus these findings pro\i suppor1 L,r SpCas9 and SaCas9 vari3nts, referred to All of the variants describt.::cl herein can bt.:: rapidly :ncorporated into existing s require only a small number of mutation';, the variant::, :,hould also \Nork \vith other previously described iff1proveme11ts to the SpCas9 platfonn (e.g., truncated sgRNAs (Tsai et aL ]\at Bimechnol JJ, l 87-1 en (20 l)), Fu et al. 1\iat Biotechnol 32., 279-284 15 20 25 30 35 40 45 0014)). nickase rnutations Uvfa1i et al .. Nat Biotech Cell l .S4. l 3SU- l 38Cl (2013 )}, Fok l-dCc1 t1.r::.,io11s ((rui linger et al , Nat Biotechnol 32, (20141: Tsai et al, l'·Jat Biotechnol 32, and engineered CRISPR-C:1sCi nucleases w1 th altered PAf'v1 specifici,.ie~; 1Kleinstiver Thus, prov,ded herein arc Cas9 variant~;, including SpC SpCas9 \vild type sequence is as fo1lov,;s variants. The H 0 J?U F'•:; 4 0 AILRRQEDFY PFLKDNREKI EKILTFRIPY YVGPLARGNS RFAWMTRKSE ETITPWNFEE 490 \FVDKGAS.Lll:..QS 5.50 SGEQKKAIVD 610 IKDKDFLDNE 670 500 510 520 FIERl"'ITNFDK NLPNEKVLPK HSLLYEYFTV 560 570 580 LLFKTNRKVT VKQLKEDYFK KIECFDSVEI 620 630 640 ENEDILEDIV LTLTLFEDRE MIEERLKTYA 680 690 700 530 Yl'JELT K'IK':{\T 590 SGVEDRFNAS 650 HLFDDKVJvIKQ 710 540 TEGMRKPAFL 600 LGTYHDLLKI 660 LKRRRYTGWG 720 RLSRKLINGI RDKQSGKTIL DFLKSDGF}\N RNFMQLIHDD SLTFKEDIQK AQVSGQGDSL 21 CA 3286103 Date reçue / Received date 2025-09-15 7 0 REF 5 1 U LJ\ / RK L :J ,-, i_; 20 25 0 30 ID NO:J) The SpCas9 variants described l1erci11 can include the arnino acid sequence of 35 SEQ ID NO.1 with mutation:, (i e .. replacernent of the native mnino acid vcith a different an.ii no acid, e , alanine. glycine, or serine), at one or rnore of the follovv·ing pos1t1ons· , R661, ()6()5, Q92(J (or at po:,ition:, analogmt:, thereto) In some embodiments, the SpCas9 variants are at least SC!°o, e at least 85°0, 90%. or 95(!o identical to the amino acid sequence of SEQ ID r·✓ O. l. . have differences at up to 40 5'\J, 10° o, 15° o, or 20° o of the residues of SEQ ID NO l replaced, e.g., \.Vith 45 conservative mutations, in addition to the mutations described herein. In preferred embodiments, the variant retains desired activity of the parent, e.g., the nuclease activity ( except where the parent is a nickase or a dead Cas9), and / or the ability to interact with a guide RNA and target DNA). To detem1ine the percent identity of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The 22 CA 3286103 Date reçue / Received date 2025-09-15 !ength of a refi::rence sequence aligned for compc1rison purposes is at least 80°0 of the The nucleotides at corresponding z,minc, c1cid pcsiLions or nudemide positions are then cornp;=1n:d \Vhe11 a position in the first sequence 1s occupied by the same are identical at that position (as used herein nucleic acid '·identity'' is equivalent to nucleic acid 'honwicHI\ "i The percem 1de11titv between the t'vvo sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the !ength of each gap which need to be introduced ,o for optimal alignment the t,vo sequences Percent identity between two polypeptides or nucleic acid sequences i~; detennincd in \ariou 'vvays that are within the ski!l in the a11, for instance, using publicly availz,ble cornputer sofr1vare such as Smith \Vaterman !\lignrncnt (Sm1th, T. F and l\l. S Waterman ( 198 l) J ~do] Biol l47: !()5.7); "BestFiC (Smith and Waterman, Advances in Appii Mathernatics, 482-• and Dayhof ( I 979) Atlas of Protein Sequence and StnJCture .. Dayhof, l\1l O hi. pp 3 -358, BLAST program (Basic Local Al' ent Search TooL (Altschul, S F .. W. Gi et al. ( I 990) J t'vlo! Bio! 215 403-10), BLAST BLAST-[\ BL / \ST-N B ST-X, WU-BLAST- 2, ALIGN. ALIGN<:. CLUST or Megalign { DNASTAR) soft\vare In addition., 20 those skilled in the art can determine appropriate parameters f(x measuring alignment, including any a!gorithrns needed to achie, e maxima! alignment over the of the sequences being coinpared. 1n generaL for proteins or nucleic aci the length of con1par1son can be any length., up to and includi fuU length ( 25 compositions and methods. at least 80°0 of the full length of the sequence is aljgned. 30 For purposes of the present invention, the cornparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. Conservative substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine. 23 CA 3286103 Date reçue / Received date 2025-09-15 in sume embociimems, the SpCz,s9 vz,rianb include one of the following sets of 1nutatioi1s• 1\497 AiR(,6 ! A, 1()695 / Q9,26 / \ ( quadnip] e a!an1i1e n1utm1t;, Q69'ii\ / Q926,\ (douh!e alanine mutant\ R66 l AiQ695A / Q926 / \ and N-FJ7 A!()695AJ()926A (triple alanine irnt:,ints) ln sornc ernbodimems .. the additional s substitution mut<T1ion'; at L 169 and / or Y450 might be c1dded to these double-, triple, and quadruple n-1utants or added to single mutants ·ng subs:.itutions at ()695 or Q920 In some embodiment:,. the mutants ha\e alcJr1ine in pi ace of the vdd type amino acid In some en1bodin1ents, the 1111_:1.ants have any amino acid other than argin:ne or lysine (or the nati\e mrnno acid} In some ernbodirnents, the SpCas9 variants also include une of follovving mi.Hat1ons. \vhich reduce or de~;troy the nuclease activity the C • DIO E762, DIOA / DION and H840A / ll840T·✓ !Jl840\' to render the nuclease ponion of the protein catalytically inactive; substitutions at these positions cou1d alanine are in Nishimasu aL, ne, asparagine, tyrosine, senne, or aspartc1te. e.g .. E762Q, H983N, H983Y .. D986N, N86JD .. N8().3S, or N86JH ( see WO 2 0 l •'f / l ::) In surne ernbodirnents, the variant i udes mutations at DJ OA or H840A (\1,hich creates a :,ingle-:,trand nickase). or 1nutat1ons at DJ OA and .H840A. {\vbich abrogates nuc activity: this mutant is known z,s dead Cas9 or The SpCas9 N497 AIR.66 l A / Q695A / R(.)26A mutations have z,nalogous residues in Staphylococcus aureus Cas9 (SaCas9L see FIG 20. I\!uwtions to residues contacting the DNA or RN!\ backbone Me ex:pected to increase the specificitv of SaCas9 as ,ve ·ve observed for SpCas9. Thus, also provided herein are 25 SaCas9 variants. The SaCas9 wild type sequence is as follows 10 20 30 4 nu 50 TYlKRN~{ I IJC; LI) IGITSVGYGI IDYETRDVID AGVRL FKEAl'\J VENNEGRRSK 60 70 80 9nu 100 30 RGARRLKRRR RHRIQRVKKL LFDYNLLTDH SELSGINPYE ARVKGLSQr'\L 110 120 130 140 150 SE:EEFS.AlALij HLAKRRGVHN VNEVEEDTGN ELSTKEQISR 1'TSKF.1.LEEI{Y\l 160 170 180 190 200 i\E:IjQIJERJ_;KK DGEVRGSINR FKTSDYVKEA KQLLKVQKA.Y HQLDQS FI I)T 35 210 220 230 240 250 YI IJ:LIJE ~£1R.R~1: YYEGPGEGSP FGWKDIKEWY E!v1Liv1GHCTY F PEELR.SVI<YA 260 270 280 290 300 YNADLYNALN DLNNLVITRD ENEKLEYYEK FQIIENVFKQ I<KKPTLKQIA 24 CA 3286103 Date reçue / Received date 2025-09-15 10 15 20 25 30 35 SaCasCi variants described herein include amino acid sequence SEO ID NO·2, \vith rnutations at one .. two, three .. four, five .. or ail s1x of the following positions , cornpnsmg a sequence that is at !east 80° o 1dentical to the arnino acid sequence of SEQ ID N0:2 with mutations at one, t'.YO, three, four five or six of the foliovv'ing positions: Y2 l l .. \\ / 229, R245~ N41 q, and / or R654. In some embodiments, the variant SaCas9 proteins also comprise one or more 40 of the foilowing mutations: Y211A; \V229A; Y230A; R245A; T392A; N419A; L446A; Y651A; R654A; D786A; T787A; Y789A; T882A; K886A; N888A; A889A; L909A; N985A; N986A; R991A; R1015A; N44A; R45A; R51A; R55A; R59A; R60A; Rl16A; R165A; N169A; R208A; R209A; Y211A; T238A; Y239A; K248A; Y256A; R314A; N394A; Q414A; K57A; R61A; HlllA; K114A; V164A; R165A; 45 L788A; S790A; R792A; N804A; Y868A; K870A; K878A; K879A; K881A; Y897A; R901A; K906A 25 CA 3286103 Date reçue / Received date 2025-09-15 in sume embociimems, vc1riam SaCc1 proteins corn prise one or rnore of the fol]o\v:11g addit,onal mutations '{21 I / \, W.?.20 / \, Y2JOA. R~~4-"A T392A .. N4 l 0A, L4,J6:\, v·,y:; Ii\. R65,-L,\, D786A. T787A, '{789A. T882A, KS86 / \, N888A .. ASS(.) / \, L'JOO;\ N°8.c; / \. l\%6\ .. R'i9L\.R!015 / \, l\,,t,11-\. R,,JSA RS! A. R55A. R59A .. s R60A, R l l bA. R lb:\\ N 160,\ R208A, R:200.,\. Y2 l 1 T238A, 'l239A, K248A, L788A.S790A, R792A.N804A,Y86SA, K8 K878A, K879A,KSS!A,Y897A, in some embodiments, the variant SaCas9 protein:~ comprise multiple substitution mutations R::,t5 / T3 and 4 l 9.iR654 (quadruple\ariant rnutuns.L l\4!Ci / R6-"4, R2,,J5 / R6-"4, '{22l / Rb54 .. and Y22l / N4l9 I l) / FZ.6 and 1·3 i 9 / R654 {triple mutants) ln some embodiments the mutanr.s conta:11 ala11111e :11 place of the wild type amino acid. In sorne ernbodiments, the variant SaCas9 proteins also con1prise mutations at E782K. K929R, N%8K. and / or R l O 15H For example. the K variant (E782K / N968K / R l O 15I--n, the KRH variant 2K / KCi29RiRiOJ SI-fr or the KRKH variant \E782KiI<920R / N%8KiR l OJ 5H)i In some embodiments, the variant SaCas9 proteins also cornprise one or more 20 mutations that decrease nuclease activity ecrcd frorn the group consi ng of mutations at D [ 0, , D5 H70 l, or D704: and at H557 or 80. ln some embodiments. the mutations arc. (i) DlOA 01 DlON, (ii) H557A, H557N, or l--[557'{, (i1i) N580A, and / or (i\'1 D55(JA / >Jso provided herein are isolated nucleic acids encoding the Cas9 variants, 25 vectors comprising the isolated nucleic acids .. optionally operably linked to one or more regulatory domains for expressing the variant proteins. and host cells, e g, mammalian host cells, comprising the nucleic acids, and optionally expressing the variant proteins. The variants described herein can be used for altering the genome of a cell; the 30 methods generally include expressing the variant proteins in the cells, along with a guide RNA having a region complementary to a selected portion of the genome of the cell. Methods for selectively altering the genome of a cell are knmvn in the art, see, e.g., US 8,993,233; US 20140186958; US 9,023,649; \VO / 2014i099744; WO 26 CA 3286103 Date reçue / Received date 2025-09-15 78:. W020 I I 52432; l600l73 US201600l7301; LJS20 l S03766)2~ LJS20 l )0.1)6239~ l)S20 J 503 l )S tJS~~O l S029 I 96)~ lJS20150252J58, 1 S201502471 lJS20 l 502J:883· tJS2{) 1 )023288:., lJS20I501 () 150159175, lJS20150l59174: LIS20 l 50093 / -'l73~ lJS20 l 5007968 l ~ LJS20 J 50067922: lJS·20 l S00.56629~ tJS20 l 50044772., lJS20 l 50024500~ lJS20 l 500244(}9· tJS201 )0020223.,~ 7-~.,)-~,S ' ·-· -~"' ~- ~- , 7 US20!40273037: US20140!8Ci89(\ US20140113376: US20140Cfn941:. lJS2.0l 30330778: LJS20130288251 :. LJS201200886 lJS20 l l 0300538:, US201 l02365:rn, US201102!77YJ: US201 l0002889: US201000760S7:. US20l IO I 89776: US20 l l 0223638: US20l301302-:!.8, US20 l 50050699: US20150024500: US201403778CJ8: US201403575JO, US20140349400 1JS20 l 40335620~ l..JS20 I 14033~063~ l 403 J 0830; lJS20140310828; l!S20140309487: lJS20l40J04853: lJS20140298547, US20l40295556: US20140294 3: US20 l 4028'N38; US20 I 20 tJS20 i 40273232~ l)S20 J 4027] 2.1 J: tJS20 l 40273230, LJS20·140171987· lJ S20 l ~10256046: lJS201-402~+8702:. t.J • US20l 700: LJS20l40242699: LJS20l40242664~ l)S20l402J4972:. tJS20l40227787~ US20140212869:. US2014020l857; US20l40199767: US20140l898% .. US20!,,JOl86958: US20140!869l9: US'201 18681-13; US20J,,t0179770: 25 US20140179006: US20140170753:. \V0 / 2008 / 108989: W0 / 2010. / 054 l 08, \\TO / 2012 / 16-~1565~ \\.TQ / 2013 / 0982.44~ \\!Q / 2013 / 176772~ T_TS 20150071899~ Makarova et al., "Evolution and classification of the CRISPR-Cas systems" 9(6) Nature Reviews Microbiology 467-477 (1-23) (Jun. 2011); \Viedenheft et al., "Rl'JAguided genetic silencing systems in bacteria and archaea" 482 Nature 331-338 (Feb. 30 16, 2012); Gasiunas et al., "Cas9-crRNAribonucleoprotein complex mediates specific DNA cleavage for adaptive immunity in bacteria" 109(39) Proceedings of the National Academy of Sciences USA E2579-E2586 (Sep. 4, 2012); Jinek et al., "A Programmable Dual-Rl'JA-Guided DNAEndonuclease in Adaptive Bacterial 27 CA 3286103 Date reçue / Received date 2025-09-15 lmrnunity" 337 Science 8lh--821 { :\ug. l 7.2012 }: CarrolL "A CR[SPR Approach to Gene Targeting" 20(()) 1\ lolecular Therapy I (<~8- ! (160 (Sep 2U l 2;. U S Appl. No. 6 l:652J)8o, filed 1\lay 2:\ 2012: Al--Att.1r et al .. Clustered Regubrlv rnterspaced Short Palindromic Rq;eats tCR lSPR.s) The Hal I mark of an Ingenious Antiviral Del"t.~nse s Med1cini,;rn rn Prol-.. arvntes. Bini Chem. (20 l I}\ ol. .3CJ2, hsue 4. pp 277-289: Hale et al., Essential Features and Rational Desi of CRJSPR RN As That Function With the Cas RA\lP / Vlodule Complex: to Cleave RN As. !\folecufar Cell.. (20 l 2) vol 4\ Issue The variant proteins described herein can be u:~ed in place of or in addition to any of the Cas9 proteins described in the focegoi or in combination with mutations described therein. In addition. the \ariants described herern can be used in fusion proteins in place of the ,vild--t)pe Casci or Cas9 muta1ions (such as the dCas9 or Cas9 nickase described above) as known in the art cg. a fusion protein \V•lt !1 a !, etero1 o gc,us f'u nct;•c ,na l cl o mar•n s as d, escn• \V020l4 / l44592: WOJ442SS, W02014 / 204578: \V020l l 89'776: tJS201 l / 0223b38: lJS20'1 l 30248. W0 / 2008 / J 08()89: \V0 / 20 l YVC) / 201 16-4565: \\ / () . / 2013 / 0982•41-i:, \\ / (J / 201 176 • US20 l 50050699:. tJS 20 20150071899 and WO 20 ! ! 24284 For example. the variants. preferably comprising one or more nuclease-reducing. -alteri m --kilii mutation .. can be fused on the Nor C terminus of the Cas9 to a transcriptional activation domain or other hetcrologous functionai dornains kg transcriptional repressors (e.g ... KR.AB, ERD. SID. and others. , aroino acids 47 O the rcprcssor factor lERF) 25 repressor domain (ERDL amino acids 1 97 of the KR.AB domain of KOX1, or amino acids 1-36 of the l'.-Iad mSIN3 interaction domain l SID): see Beerli et aL PNAS USA 95:14628-14633 (1998)) or silencers such as Heterochromatin Protein 1 (HPl, also known as swi6), e.g., HP la or HPl~; proteins or peptides that could recruit long noncoding RNAs (lncfu"l"As) fused to a fixed Ri'l"A binding sequence such as those bound 30 by the MS2 coat protein, endoribonuclease Csy4, or the lambda N protein; enzymes that modify the methylation state of DNA (e.g., DNA methyltransferase (DNl\1T) or TET proteins); or enzymes that modify hi stone subunits ( e.g., hi stone acetyltransferases (R-\T), histone deacetylases (HDAC), histone methyltransferases 28 CA 3286103 Date reçue / Received date 2025-09-15 {e g., for metlr;lation of iYsine or ctrg_inine residues) or hi stone clernethviases {e.g., tor dernethylar.ion ofhs111e or arginine residues}} as are known in the an can also be used. / \ nun,ber of sequences for such domains z,re knc,\vn in the art e g, a dornain that caralyzes hydn;,y]atio11 ofmet11\LHed cyto~;ine~; in DNA Exemplary proteins include s the Ten-Fieven-Trnnsiorntion (TET) l-3 fmn:ly. enzymes that con\er1s 5- rnethylcvtosine (S-mC) to 5-hydrnxvff:ethvlcy,.osine (5--hmC) in Dl'\A Sequence::, for hurncrn TET 1..:; are kno1',n in the cirt and are shmvn in the followin,z table GeriBanli: Accession Nos. Gene ]\Jucleic Acid TETl ]\J\] 030625.2 ]'.J\1 001127208.2 NM Oi 7628.4 j------------------------------------------- ------------------------------------------------------------------------ ------------------------------------------------------------------------- TET 3 ~-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- * Variant ( 1) represents the longer transcript and encodes the longer isoforrn rn (a). Variant (2; differs in the 5' LTR and in the 3' UTR and coding coinpared to variant 1. The resulting isoforrn (b) is shone; and has a d1sti11ct Cterrninus compared to isoforrn a. In some ernbodiments, ail or pan of the full-length sequence of the catalytic dcnmiin can be included .. a catalytic module cornpri:,ing the cysterne-rich extension and the 20GFeDO domain encoded by 7 highly conserved exons, the Tetl catalytic domain cornpri • amino acids 1580-20S2, Tet.?. comprising amino acids l 290- 1905 and compnsi amino acids %6- 1678 Iyer illustrating the catalytic dues in ail three Tel proteins, and the supplementary 20 rnateria1s thereof (ava11ab1e at ftp s1te 25 length sequences (see, e.g., seq 2c); in some embodiments, the sequence includes amino acids 1418-2136 of Tetl or the corresponding region in Tet2 / 3. Other catalytic modules can be from the proteins identified in Iyer et al., 2009. In some embodiments, the heterologous functional domain is a biological tether, and comprises all or part of ( e.g., DNA binding domain from) the MS2 coat protein, endoribonuclease Csy4, or the lambda N protein. These proteins can be used to recruit RNA molecules containing a specific stem-loop structure to a locale 29 CA 3286103 Date reçue / Received date 2025-09-15 specified by the dCas<i glZN:\ rnrgeting sequences For exarnple, a dCas9 ,arim1t fused ro MS1 coat protein, endonbonuclease C'~;\4 or larnbdc1 N can be used to recruit a long nc,n--coding RNA (!ncRt-✓,\) such as XiST or HOTAlR:, see .. e g, Keryer-Bibens ;, that i:, l111ked to :he Csy4. \fS2 or lambda N binciin.g seq:.tence. / \iternati\-e!~r. tl1e .\lS2 or iarnbda ]\J protein binding sequence can be linked to another pro,.ein, e g, as described in Kerver--Bibens et aL suprc1. c1nd the protein can be U:i.rgetecl to the dCc159 variant binding site using the methods and cornpositions described herein. In surne ernbudirnents, the Csy4 is carn!yticc1!ly inactive !n some ernbodimems, the C variant. is fused to Fold as described in USS. 9_f)2.1J:i40: W0 / 10 l 4 / 099744, \VO 10 l W020 ! 4 / 204578: \V020 l 152432:_ \V02 I l tJS20 l 0 / 0076057~ lJS20 l J J 80776~ lJS20 i l variant.. preferably a dCas9 ! 40 l 86958; us 638~ LJS2() l 130248, W0 / 2008 / 108989: \V0 / 20 l 0 / 05-i l 08: W0 / 20 l l (A565; W0 / 20 l 3 / ()()824-t \\7() / 201 1767 • lJ S.201500506q9~ LJS 20150071 and WO J ;:1 / '204578 ln some embodiment:,, the fu:,ion proteins inciude a linker bet,veen the dCas9 variant and the heterologuus functional don-1ains can be used in these fusion proteins (or between fosion protein:, in a concatenated ',tructure) can indude any sequence that does not· function of the fusion proteins. In 20 preferred enibodinien the 1111ke1s arc short, c.g, 2-20 amino acids, and are typically t-~: exr• n1 l• e (1• .e., compn' sm' g amm• o ac1• c't s \Y•: tl' : a l' 11• g f1 freedom such c1s glycine, alanine, and serine) In some embodiments, the linker comprises one or rnore units consisting of GGGS (SEQ U) NO .3) or GCGCS (SEQ !D NO4 ), e two, three, four, or rnore repeats of the GGGS (SEQ ID NO 5; or GCiGGS (SEQ ID NO:6) unit. 25 Other linker sequences cc1n also be used. In some embodiments, the variant protein includes a cell-penetrating peptide sequence that facilitates delivery to the intracellular space, e.g., HIV-derived TAT peptide, penetratins, transportans, or hCT derived cell-penetrating peptides, see, e.g., Caron et ai., (2001) Mol Ther. 3(3):310-8; Langel, Cell-Penetrating Peptides: 30 Processes and Applications (CRC Press, Boca Raton FL 2002); El-Andaloussi et al., (2005) CuIT Pharm Des. 11(28):3597-611; and Deshayes et al., (2005) Cell Mol Life Sci. 62(16):1839-49. 30 CA 3286103 Date reçue / Received date 2025-09-15 l penetrating pepticlt::'., (CPPs) z,re short peptides drnt facilitz,te the movement of a \\ide ran~e ofbiornol es across the cell membrane into the cytoplz,sm or other orgz,neiles, e.g. the mitochondria and 1he nucleus. Exc1mples of mo!ecules that can be deli\ered bv CPP:, include therapeu1ic drug~;, plasmid DNA, s o!igonucieotides, s1RN\. peptide-nucle1c acid (PN;\). proteins peptides., nanopanicles. and liposomes CPPs are gene1·a1lv 30 arninu acids or less, are derived from ncllurnily or no1H1aturaily nccurnng protein or chimeric :,equences, and contain • ti\ dy chan.!;ed arninc, acids, e.g. lysine or arginine, or an alternating pattern of poiar and non-polar arnino acids. CPPs that are ,o comrnonl\ used in the art include Tat (F et al. (i ) Cell. '.'5 l 18() .. j 193, Vives et al., ( 1°97; J. Biol. Chern. 272I6010-1(,Cll 7L pcnet1:11in (Dcro:,si et al., ( 1994) l Biol Chem :269 l 04-i,l- l 0450 ), polyarginrne peptide ( Wender et al , Futaki et ,ii., (2001) l Biol. Chem. 276 5836-•58-iO\ and transprn1an (Pooga e1 z,i., ( l ciqg) Nat. Biotechnol. :5 16:857-861; CPPs can be linked \lv:th their cargo through CO\•cilem or non-covalent strategies \f ethods for covalently jui • a CPP and its are in the e g. chemical cross-linking (Stetsenko et al, (2000) J Org Chern (15 Gait et al (2003) Cell. l\!oL fr. Sci. 60 844·•853) or cloning d fosion protein (Nagahma et 20 al, ( 19()8) Nat. 1\ Ted 4 l 449-1453) Non-covalent coupling bei.\vcen the cargo and short amphipathic CPPs comprising polar and non•-polar domains is established 25 through electrostatic and hydrophobic interact.ions CPPs have been utilized in the art to deli\er potentially therapeutic biornolecuks into cells. E'rnmpks include cyclosporine linked to polyarginine for imrnunosuppression (Rothbard et al, (2000) Nature Medicine 6(1 l) 1 1257)., siRNA against cyclin Bl linked to a CPP called ?vIPG for inhibiting tumorigenesis (Crombez et al., (2007) Biochem Soc. Trans. 35:44-46), tumor suppressor p53 peptides linked to CPPs to reduce cancer cell growth (Takenobu et aL, (2002) Mol. Cancer Ther. 1(12): 1043-1049, Snyder et al, (2004) PLoS Biol. 2:E36), and dominant 30 negative forms of Ras or phosphoinositol 3 kinase (PDK) fused to Tat to treat asthma (Myou et al., (2003) J Immunol. 171 :4399-4405). CPPs have been utilized in the art to transport contrast agents into cells for imaging and biosensing applications. For example, green fluorescent protein (GFP) 31 CA 3286103 Date reçue / Received date 2025-09-15 attached to Tat has heen used tu iabd c::rncer cdls (Shukolenko et al, (:2005) DN / \. Repair 4(4) 51 i -518) Tat conjugated to quantum dots have been used to successfully cross the blouci-brnin barrier t~Jr visu:::ilizmic,n of the rat brain (Santra et ai.. (2005) Chem Commun .. ) 144-.i ! 4(,) CPPc; have cilso been cornbined with magnetic resonance imaging techniques for ceil imaging (Liu et al. Biochem. and Biophys. Res Cornn: 347( I) i 33- i 40; also Rarnsev and Flynn, Pharmacol Ther. 20 i 5 Jui 22 pii • SO 163-7258( 1C.:)0014 l-2. Alternativeiv, or in addition, the variant proteins can include a nuclear localization sequence. e SV40 large T antigen NLS (PKKKRRV 1SEQ ID NO 7)) and nudeopbsmin NLS (I(RPAATKKAG()AKKKK ID l'.JO 8JJ Other NLSs Freitas and Cunha, Curr Genc,rnics. 2009 Dec; 10(8) 550 557 !n sorne ernbodimems. the variants include a moiet1 that has a high affinity for a ligand, for example GST, FL\G or hexahistidine Such affinity tags can , 5 facilitate the purification of recornbinant variant proteins For methocb in \\hich the variant proteins Me delivered to cells, the proteins can be produced using aiw method known in the art, e g., in ation, or expresswn in a suitable host cell from nucleic acid encodrng the ant protein, a number of methods are known in the art for producing proteins. For the 20 proteins can be produced in and purified from yeast, F coli, insect l Jines., plants., transgenic animals, or cultured rnarnmaiian cells: see, Palomares et al, '·'Production of Recombinant Proteins Challenges and Solutions,'' ~dethods Mol Biol :2004:,267· '1 ln addit1c,n, the variant prote1ns can be linked to a nwiety that facilitates trnn into a cell, a lipid nanoparticle, optionally vvith a linker that is 25 cleaved once the protein is inside the cell. e , LaFounrn.ine et ai.. lnt J Pharm 2015Aug 13;494(l)•l80-1Ci4. Expression Systems To use the Cas9 variants described herein, it may be desirable to express them from a nucleic acid that encodes them. This can be perfonned in a variety ohvays. 30 For example, the nucleic acid encoding the Cas9 variant can be cloned into an intermediate vector for transformation into prokaryotic or eukaryotic cells for replication andior expression. Intermediate vectors are typically prokaryote vectors, e.g., plasmids, or shuttle vectors, or insect vectors, for storage or manipulation of the 32 CA 3286103 Date reçue / Received date 2025-09-15 :0 nudeic acid enc,xlin<.?. the C yariz,nt for production of the Cas9 \'ariant. The m,cleic ;=1cid encoding the Cas0 vananr can also be cloned into an expression vector, for administration to a plant celL anmrnl c,,::IL preferably a nnrnrnalian cell or a human cell, fungal cell.. bacterial cell, or protoz:o:rn cell. To obtain e',pression, a :,equence encoding a Cas9 vari,rnt i:, typi Iv subcloned into an l"<pression vector that contains a pron,,otu to direct transcription, Suitable bacter1,;l and eukaryotic promoter', are \Veli kno1c1,n in the ar1 and described, e g, in Sambrook et al , Molecular Cloning, A Labon:lt!)JV \,[anual (3d ed 200 l ;: KriegJer,, Gene Trnn:,fer and E,pression, ;\ Laboratory i\lanual ( l 990). and Current 10; expresswn systems for expressing the engineered protein are available 111, e.g .. F coli, Hoci!!us systen;s are cornrncrc1ai1y available Eukarymic expres~;ion ~;\sterns for mamrna!ian cells, yeast. and insect ce1ls an:: \ve!l knov,n in the an z,nd are also comrnercially ·: s a\.1a.i1able. The promoter w~ed to direct expre:,sion of c1 nucleic c1cid depends on the particular application. For crnmpie, a strong constitutive is typically used t\:ir expression and purification of fi.1s1on protein:,. In contrast. \Vhen the Cas9 variant is to be administered in viYo for regulation, either a constituti1e or an inducible 20 promoter can be used, depending on the particular use of the Cas9 variant In addition, a preferred promoter for adrninistrntion the CasCl variant can be a ,veak promoter, such as HSV TK 01 a promoter lrnvi similar activity The promoter can also include elements tfrnt are responsive to transactivation, e hypoxia response elements, Gal,,[ response clements, lac repressor response ciernent. and small molecule 25 control systerns such c1s tetrncycline-regulated sterns and the RU-486 system (see., e,g., Gossen l?f. Bujard, 1992, Proc Natl. I\cad Sci USA, 89 55,F: Oligino et al, 1998, Gene Ther., 5:491-496; Wang et al., 1997, Gene Ther., 4:432-441; Neering et al., 1996, Blood, 88:1147-55; and Rendahl et al., 1998, Nat. Biotechnol., 16:757-761). In addition to the promoter, the expression vector typically contains a 30 transcription unit or expression cassette that contains all the additional elements required for the expression of the nucleic acid in host cells, either prokaryotic or eukaryotic. A typical expression cassette thus contains a promoter operably linked, e.g., to the nucleic acid sequence encoding the Cas9 variant, and any signals required, CA 3286103 Date reçue / Received date 2025-09-15 e g , for efficient poh'acienvL:ui on 1he trnnscri p1, mrnsc;·i ptional termrnation, diosorne bindin\.'. ~:ites. or tr:rnsla:ion terrninc1tion 1-\dd:tioncil clements of the cassette may include, e g, enhancers, and heterok,guus spliced intronic signals. The pmt1cular expression vector u to tnnEpon the genetic rnformalion into 5 the ceU :s selected Vv'lth re_gard to the intended use of the ("a variant, e.,g,., e.;zpression in plants. aninrn]s, bacteria, fungus, protozoa, etc Standard bacterial expression vectors inciude piasrr1ids :,uch as pBrU22 bw;ed plasnnds. pSKF, pET23D., and commercially avai]abk tag-fusion e-:<p1-cssion svsten-1s such as GST and Lacz. L'Zpres:,ion vectors containing regulatory elernents from eukaryotic viruses are 0 vectors, papillorna virus vectors, and \ectors deri\ ed frorn Epstein-B:uT virus Other C'<:emplary eukaryotic baculovims pDSVF, and any other \CCtor allov,ing expression proteins under the direction of the SV40 early promoter, SV40 late promoter, rnetalimhionein promoter, murine rnarnmary tumor virus prornoteL Rous sarcoma vims yhedrin promoter, or other promoters shrmn effective for expres:,ion in eukaryotic cells The vectors for expressi the Cas9 variants can indude RNA Pol m prornciters to drive e:,pres:,ion of the guide RN!\s, , the Hl, U6 or 7SK promoters. human promoters allov,; for expression of Cas9 variants in manunalian cells 20 f'ollcnving plasmid mrnsfection. Some expression have markers for selection of stably trnnsfected cell lines such as thyrnidine kinase. hygroniycin B phosphotransferase, and dihydrnfoiate reductase. H1gh yield expression system:, are also suitable. such as using a baculovirus vector in insect cel]s, vvith the gRNA encoding sequence under the 25 direction of the polyhedrin promoter or other strong baculovirus promoters. The elements that are typically included in expression vectors also include a replicon that functions in E coli, a gene encoding antibiotic resistance to pennit selection of bacteria that harbor recombinant plasmids, and unique restriction sites in nonessential regions of the plasmid to allow insertion of recombinant sequences. 30 Standard transfection methods are used to produce bacterial, mammalian, yeast or insect cell lines that express large quantities of protein, which are then purified using standard techniques (see, e.g., Colley et al., 1989, J. Biol. Chem., 264: 17619-22; Guide to Protein Purification, in Methods in Enzymology, vol. 182 34 CA 3286103 Date reçue / Received date 2025-09-15 {Deutscher, ed, 1990)} Transt~irm:::ition of eukz,ryotic z,ncl prnkaryotic cells are perfi:_1rmed according to st:md:11\1 techniques (su: e g .. f\lornson, l 977 .. l Bacteriol. l 32 3:i9--35 l: Clarl-:--Cuniss ft Cuniss, \fethods in Enzvn10lo0,v l O I 347--YJ'.2 (\Vu et Any of 1he kno,vn procedures for introducing foreign nucleotide sequences into host ce1ls mav be used These include the use of cium phosphate tnmsfrction, po1ybrene. pn,toplas1 fusion. dectroporntion. nucieofect:on, liposornes, microinjection, naked DNA, plasmid \Cctors, virnl vectors, both episorna1 and integrativ•::\ and any of the other \.r • .:ell-kno\\,n rnethods DN cDJ'-P,, synthetic DNA or other introducing cloned genomic material into a host cell (see. eg., Sambrook et al, supra) Ir. 1s on1v • that the particular genetic engineering procedure used he capable of successful intrnducing at least one gene into the host cell capable of e"pressing the Cas9 variant.. The present methods can also include rnodifying gDNA bv introducing ,5 purified Cas9 protein ,vith a gRNA. into cells as a ribonuclear protein (RNP) cornplex, as wen as introducing a gRNA pius mRNr\ encoding the Cas9 protein. The gRNA can be synthetic gRNA ur a nucleic acid (e g, in an c< guide RN1\. on vector) encoding the The present imention also includes the vectors and ce11s the 20 vectors. 25 EXAI\IPLES The irnention is f\.lrther described in the following exarnples. Yvhich do not lirnit the scope the invention described in the claims :\fcthods Bacterial-based positive H'lecfo;n assay for evolving SpCas9 variants Competent E.coli HW2514 l(t.DE3)23 containing a positive selection plasmid (with embedded target site) were transfonned with Cas9 / sgRNA-encoding plasmids. Following a 60 minute recovery in SOB media, transformations were plated on LB plates containing either chloramphenicol (non-selective) or chloramphenicol + 10 mM 30 arabinose (selective). To identify additional positions that might be critical for genome wide target specificity, a bacterial selection system previously used to study properties of homing 35 CA 3286103 Date reçue / Received date 2025-09-15 endomideases {hereafter referred w c1s the posiLive ection) (Chen & Zhao, Nucleic !n the present c1dc1pt:irion of :his system, Cas<i-rnedi:ircd cleavage of a posilive s selection plasmid encoding an incluc1bie to:",1C gene enables celi su1-v1 vaL due to subsequent degradation and loss of the linearized plasmid i\fter es:.ablishing that SpCc1s9 can function in the positive select10n sy',tem. both \Viid-type and the variants ,vere tested for their abi]i1.y to ckave a selection p]asrnid harboring a target site selected from the kncm n human genome These variants \Vere introduced into bacteria with a positive selection plasn-1id containing a site and plated on selective medium. Cie:1\age of :he positive selection plasrnid \vas estimated by calculating the / , co l onu.. :s on plates (see A subset of plasmids used in this study {sequences shown below) Name JOS246 :\,1SP469 f'v1SP2440 8Pf<2797 f\.~SP2443 8Pf<1520 Addqene iD 43861 pending 65777 Descrirition C!V1\J-T7-hun·ianSpCas9-HF1 (f··~497A., Rl36~fa\, <)t.395A., fJ926A)~NLS~3xFLAC; 2,xFLA.G 2,xFLA.G crt:v~.T7~-f:urnanSpCas9-~\ / R.QR.(D: 135V, G·12: 8R, R1335()) r: 337R.)~-NLS~ 3xFLAG crv1V-T7-humanSpCas9-V[?Of?-HF1 (l\;497A, f?66:,<\ 0695A, 0926A D1: 35V, G1218R, R: 3350, T1337RH'·E.S-3xFL..AG Human cell t~ulture and trnmfretion U2OS.EGFP cells harboring a single integrated copy of a constitutively 20 expressed EGFP-PEST reporter gene15 were cultured in Advanced DlVrEM media (Life Technologies) supplemented with 10%, FBS, 2 mlvf Glutalvfax (Life Technologies), penicillinistreptomycin, and 400 μg / rnl of G418 at 37 °C with 5% CO2. Cells were co-transfected with 750 ng of Cas9 plasmid and 250 ng of sgRNA plasmid (unless otherwise noted) using the DN-100 program of a Lonza 4D- 25 nucleofector according to the manufacturer's protocols. Cas9 plasmid transfected 36 CA 3286103 Date reçue / Received date 2025-09-15 :0 :5 together \Vith an empt\· U6 prumuter plasmid was us,,::cl as a negative control for all Human i:eH EGFP disnipfarn assay !-J-~'JF. P,. r\.l.~:c•·1> ·:r.,_ 1··J,1. · \.-_,,,-.1 o'--v·'1- 1-°·".--·· 11·, :.;..,..,. :,; .:.s...-. · ,~,_, .,,.,,.,,,: ·.,...,. l: ')"\..'. .l.'' .li -.1_. 1·1t,,-\,.c..,. (.i. .._ .'l,_S. '' ;'-i-'•''C'\--·,' <,,'_1 ..J.t C,_. I_\. · (1(.'.CJ"l.•f·f; }.).('.(JJ . l() Transfected cells \Vere analyzed for EGFP expression S2 hours post-trnnsfection using a Fone:~sa flo\v cytorneter (BD Bio:,ciences) Background EGFP loss was gated T7El assay, targeted deep-sequencing, and GU U)E--seq to quantify nudease-indun'd mutation rates T7E l assays \Vere pe;t'orrnecl as previm1sl_1, ·bed for human cells (Kleinstiver BP. et al. Nature )2.1, 48l-48'i (201'i)) For U20S EGFP human cells, genomic DNA \vas extracted frorn transfectecl cells -T2 hours posHrnnsfoction using the Agencourt DT·-..JAd\ance Genomic Dl'-JA. Isolation Kit Coulter Genomics} Roughly 200 ng of purified PCR product wa:, denatured, annealed, and and BioLabs) \futagenesis es \Vere quantified using a ()iaxcel capillary electrophore:,is in:,trurnent (Ql }, as previouslv described for human cells (Kleinstiver et al, Nature 5 , 481--485 {20 ! 5); 20 Reyon et al,. Nat Biotechnol 30, 460-46:'i (2012)) GUIDE-seq experiments \Vere performed as preYiousiy described et al., Nat Biotechno! 33 .. 187-l 97 (20 l 5)). Briefly phosphory]ated, phosphorothioaternodified double-stranded ol1godeoxynw.::leotide:, (dsODNs) were transfected into U20S cells with Cas9 nuclease ,vith CasCi and sgRNA expression plasmids, as 25 described above. dsODN-specific amplification, high-throughput sequencing, and mapping \Vere performed to identify genornic intervals containing DSB activity. For wild-type versus double or quadruple mutant valiant expeliments, off-target read counts were normalized to the on-target read counts to correct for sequencing depth differences between samples. The normalized ratios for wild-type and variant SpCas9 30 ,vere then compared to calculate the fold-change in activity at off-target sites. To determine whether wild-type and SpCas9 variant samples for GUIDE-seq had similar oligo tag integration rates at the intended target site, restriction fragment length polymorphism (RFLP) assays were performed by amplifying the intended target loci CA 3286103 Date reçue / Received date 2025-09-15 ,.vith Phus;c,n Hot--St?.rt Fle-,,; frurn lOO ng ofg,.::nurnic DNA (isolated as described above) Roughh 150 ng or· PCR product \vas di~;es:ed 'Nith 20 U of Ndel (New England BioLabc;) fr;r 3 hour,-; at 37 C prior to cle::11H,p using the Agencourt Arnpure XP kit RFLP results \\ere qwir:tified U'.,ing cl Qiaxcd capill • electrophoresis s instnnnent (Qlagen} to apprn-..:imate oiigo tag integration rate:~ r 1L i assavs were performed for a similar purpose, as described above. Examplr l One potential solution to address tan_zeting specificity c,f CRJSPR--Cas9 RN.A guided gene editing \.vould be to engineer Ca variams ,v1th novel mutations. Based on these earlier results, it 1vvas wishing to be bound by theorv) that the specificity of CR JSPR-C nucleases might be significantly increased by reducing the non-specific binding affinitv of Cas9 for DNA, med:ated by the binding to the phosphate grm1p'., on the DNA or hydrophobic or base stacking interactions ;_.vith the DNA. This appro2,ch would ha1 e 1he 2,dvantage not decreasing the length of the target site recognized by the complex, as in the prevwusly described truncated gR]\JA approach lt was rea'.,oned that non-specific binding affinity of Cas9 for DN,:\ rnight be reduced bv that contact phosphate group:, on the target DNA. arnino acid residues An analogous appro2,ch has used to create ,ariants non--Cas9 nucleases 20 such as TALENs (see for example, Gui linger et al .. T'\Jat 1\ Iethods l I· 429 UOl 4}) In an initial test of the hYpothesis, the inventors attempted to a reduced affinity variant of the widely used S. pyogencs Cas9 (SpCas9) by introducing individual alanine :,ubstitution:, into \arious dues in SpCas9 that might be expected to interact 1vvith phosphates on the DNA backbone. An Ecoli-based 25 screening assay was used to assess the activities of these variants (I<leinstiver et aL Nature 2015 Jul 23;523(7561)481-5; In this bacterial svstem, cell survival depended on cleavage (and subsequent destruction) of a selection plasmid containing a gene for the toxic gyrase poison ccdB and a 23 base pair sequence targeted by a gRNA and SpCas9. Results of this experiment identified residues that retained or lost activity 30 (Table 1). 38 CA 3286103 Date reçue / Received date 2025-09-15 Table 1: Activities of single al.mine subsfoHtion mutants of Cas9 as assessed in the b:wi:erfrd rell-b~rned system shown in flG. 1. rnut;.ition % survivzl nwtztion '¾, survival S4.2 100.4 R78A 56.~~ KJ.113.L\ '._:,1,8 0.1221.l" 98.8 -------------------------- --------------------------------------------------------------------------------------•-------------------------:,-------------------------- R165A 68.9 ~11114 / \ !;,}_~~ i<12E9 / }, S5.2 73.g 97.2 79.0 0 Y51SA 34.1 0 75.0 76.6 0 64 (-j Survival percentages bet\A;een 50- l 01f o usualh 111d1cated robust cl \vhereas ono sur-.iiva1 indicated that the enzyme has been f:.mctiona]l\, cornpron1ised. Additional 5 rnutations that ,vere assayed 111 bacteria (but arc not ~;hov,;n 111 the table above) include: Kl63A, LI T404A, V1015A, Rl 122A, I<l 1' A, ,rnd K 1124A. With the exception of R69A and F405A (v,'l,ich had< 5° o sur\ival in bacteria;, all these additional si e mutations iO appeared to have little effect on rhc on-target activity of SpCas9 survival in the bacterial screen·}. l 5 different SpCas9 variants bearing ail possible single, double, triple and quadruple combinations of the N R66 ! Q695A, and Q926A mutations were constructed to test vvhether contacts n-1ade by these residues be dispensable for 15 on-target activity (Fig, t b / For the:,e experiment:,, a prev1ousiy described human cellbased assay \Vas used in ,vhich cleavage and induction of insertion or deletion mutations (indds) by non-homologous end-joining (NHLJ;-mediated repair within a single integrated EGFP reporter gene leads to loss of cell fluorescence (Reyon, D. et al., Nat Biotechnol. 30, 460-465, 2012). Using a EGFP-targeted sgRNA previously 20 shown to efficiently disrupt EGFP expression in human cells ,vhen paired with ,vildtype SpCas9 (Fu, Yet al., Nat Biotechnol 31, 822-826 (2013), all 15 SpCas9 variants possessed EGFP dismption activities comparable to that of wild-type SpCas9 (Fig. 1 b, grey bars). Thus, substitution of one or all of these residues did not reduce ontarget cleavage efficiency of SpCas9 with this EGFP-targeted sgRNA. 39 CA 3286103 Date reçue / Received date 2025-09-15 1\!exL e:--;perirnents \Vere performed tu assess die relati',·e c1ctivities of all ! 5 SpCas0 ,ariants at 111i:,,1wtched target sites. To do :his. the EGFP disruption assay was repeated vvith deri\ atives of the ECiFP--targeLed sgRN A thed in the pre\·ious experiment ;Jiat comain pairs of substituted bases at s 17 and l8. and l8 and ]9 (nurnbenng starting \Vith i for the nw:;t P,\!Vl-proxima! base and endini! with ~:O for the rnost PAl'vi--di base: Figo lb) This analysis revealed that one of the !Tl pl e mutant:~ { RJJ6 I 51\ / QC;26 and the quadruple rnulant (N497AJR,,6 I AiQ69.:; A!()9'26A) both shO\\•ed levels of E(iFP disruption equivalent ,o Notably. among the l 5 \ ariants, those possessi the lmvest activities with the 20 mismatched sg:R NAs all harbored the Q69SA and ()9~~6A rnuta:.ions Based on these results and similar data from an experiment using a A for c1nother EGFP for additional analysis and designated it as SpCas9-HFl (for high--fi it·; variant I;. On-t:uget adivilies of SpCas9-HFl To determine hmv robustly SpCas0-HF l functions at al nu 011·· target sites, direct comparisons \Vere perfrlJJned between this variant and wild-type SpCas9 using additional sgRN In total, 37 different sgRNAs ,vcre tested: targeted to EGFP (assayed \Vith the EGFP disruption assay) and 13 targeted to endogenous human misrnatch assay). 20 of the (assayed using the T7 Endonuclease I (T'7Effi) \Vith the EGFP disruption assay (Fig. le) and 12 of the 13 sgRN tested on endogenous human sites ( Fig. Id) showed activities with SpCas9-HFl that ,vere at least 7( / 'o as active as wild-type SpCas9 ·with the same sgRN!\ (Fig, le) Indeed. SpCa:,9-HFl shcn.ved highly 25 comparable activities (90-l,:;(f' o) to 'vvild-type SpCas9 with the vast majority of sgRNAs (Fig. 1e). Three of the 37 sgRt\iAs tesied showed essentially no activity with SpCas9-HFl and examination of these target sites did not suggest any obvious differences in the characteristics of these sequences compared to those for which high activities were seen (Table 3). Overall, SpCas9-HFl possessed comparable activities 30 (greater than 70~o of wild-type SpCas9 activities) for 86% (32 / 37) of the sgRNAs tested. 40 CA 3286103 Date reçue / Received date 2025-09-15 _______________________________ _______________________________________________________________ ,l-;,_p1•ogc11cs_sgR,\'.,~:,; ------------------------------------------------------------------------------------------------ EGFP Pncp _ , Name Name FYF! 320 FYFl 64! CKiO FYFl FYFl 430 FYFl 347 BPKi BPh! 350 BPKl NGG NGG NCG l- NGCi NGCi l7&l8 NGG NGG NGG NGG --il\ 1SP7 NGG O) site 5 l\-1SP7 NGG 95 6 FYFl NGG 328 site 7 365 rvISP7 94 FYFl 327 JAF9 SltC 8 NGG site 9 NGG site 10 NGG 97 site 10 BPKl NGG 347 site 11 BPKl NGG 369 site 12 MSP2 NGG 545 site 13 Spacer kn<,>., lh {nt) 20 20 20 20 .20 20 20 20 20 20 20 17 20 20 20 SEQ Spacer SequeHce ID NO: Stqw:_;nre with extended PA\! GGGCACGCGC AGCTTGCCGG CiC'AC'GCiCiCACi CTTGCCGG CGGC,\CccGCA GCTTGCCGG CGGCtgCGGCA GCTTGCCGG CGcgACGGGC \ GCTTGCCGG CccCACCGGCA GCTTGCCGG GTCGCCCTCG AACrrCACCT GTAGGTCAGG GTGGTCACGA GGCGAGGGCG ATGCCACCTA GGTCGCCACC ATGGTGAGCA GGTCAGGGTG GTCACGAGGG CGTGCTGCAG ATGAACTfCA 9. 11, 13. 15. 19. 21. 23, 2-5. GGGC\CGGCiCAGCTTGC CGGTGCT GCACGGGC'AGCTTGCCG GTGGT GCGCACccGCAGCTTGC CGGTGCT GCGCtgGCGCAGCTTGC CGGTCGT GCcgACGGGCAGCTTGC CGGTCGT GccCACGCGCAGCTTGC CGGTCGT GTCGCCCTCGAACTTCA CCTCGGC GTAGGTC;\GGGTGGTCA CGAGGGT GGCGAGGGCGATGCCA CCTACGGC 27. GGTCGCCACCATGGTGA GCAAGGG 2-9. GGTCAGGGTCGTCACGA GGGTGGG 31, GCTGGTGCAGATGAACT TCAGGGT SEQW NO: HJ. 12. 14 .. 18. 20. 24 . 28. 32-. GGTGGTCACG 37. GGTGGTCACGAGGGTGG 38. AGGGTGGGCC GCCAGGG GATGCCGTICT 39. GATGCCGTICTICTGCTI' 40. TCTGCTIGT GTCGGC GCCGTTCTICT 41. GCCGTICTTCTGCTIGTC 42. GCTTGT GGC GTCGCCACCA 43. GTCGCCACCATGGTGAG 44. TGGTGAGCAA CAAGGGC GCACTGCACG 45. GCACTGCACGCCGTAGG 46. CCGTAGGTCA TCAGGGT GTGAACCGCA 47. GTGA.ACCGCATCGAGCT 48. TCGAGCTGAA GAAGGGC 41 CA 3286103 Date reçue / Received date 2025-09-15 IV1SP1 NGG ?() 546 s,k l-l- G / \CTTCA\GG AGG,\GGA C.\,\GGGCAT( GA.\GGG('ATCGA(TTCA ·----------------------------- ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- MSP2 NGCi GCTTC\TGTGG ':il. GCTTCATGTGGTCGGCiG 52. 547 :;itc 15 / O TCGGGGTAG TAGCGGC MSP~) NGG l\lSP2 NGG l\.lSPZ NGCi l\1SP1 NGG 551 sik !9 MSP2 NCC IV1SP1 NGG l\1SP2 NGG lVJSP2 NGG FYFl NGG 33 ! site 2+ FYFi 560 BPKi 348 NGG 2-1 NGG no 5' G NGG BPK i sit-: 25- BPKl 351 G NGG no S'G NGCi BPI< i s,tc 26- 352 rn1n S' G BPK1 373 NGG site 27~ no 5'G 20 20 10 10 2.() 20 20 20 20 GCTGA.\GC.\C TGCACGCCGT CiCCGTCCiTCCT TG.\,\GAAGA GACCAGGATG CiCiCACCACCC CACCiTAGCCT TCGCiCiCATGG c;:\AGTTCCAG CCiCCiA.C.\CCC G.\GCTGGACG GCG:\CGTA.r\A GGCATCGCCC T('G('CCT('G(' GGCC,\C,\AGT TC,\GCGTGTC GGGCGAGGAG CTGTTCACCG GCGAGGAGCT GTTCACCG CCTCGAA.CTTC ACCTCGGCG GCTCGAACTTC ACCTCGGCG CAACTACAAG .1\CCCGCGCCG GAA.CTACAAG ACCCGCGC('G CGCTCCTGGA CGTAGCCTTC 53. GCTGAAGCACTGCA,CGC CGT1\GGT 55. GCCGTCCiTCCTTCiAAGA VJATGGT SI. GACC \GG,\TGGGCACC ACCCCGGT 59. GACGT:\GCCTTCGGGCA TCiGCGGA 61. GAAGTfCGAGCiCiCCiA(. / .._CC('TGGT 63, GAGCTGGACGGCGACGT t\A:\CGGC 65. GG('ATCGCCCTCGCCCT CGCCGGA fi7. GGCCACAAGTTCAGCGT GTCCGGC GCJ. GGGCGAGG,\GCTGTTCA 71. 73, 75, 79. 81. CCGGGGT GCG1\GGAGCTGTTCACC GGGGT CCTCGAACTTCACC'TCG GCGCGGG GCTCGAACTTCACCTCG GCGCGGG CAACTACAAGACCCGCG CCGAGGT GAACTACAAGACCCGCG CCGAGGT CGCTCCTGGACGTAGCC TTCGGGC 54. 6(1 64. G8. 70. 74. 76. 78. 80. 82. ~---------------mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm _________________________________________________ NGG BPKl site 27- 375 mm5' G NGG BPKl site 28- 377 no 5'G NGG BPK 1 site 28- 361 mm 5' G BPK1 NGAA 468 site ] 20 20 20 20 GGCTCCTGGA CGTAGCCTIC AGGGCGAGGA GCTGTICACC GGGGCGAGGA GCTGTTCACC GTTCGAGGGC GACACCCTGG 42 83. 85. 87. CGCTCCTGGACGTAGCC TICGGGC AGGGCGAGGAGCTGTTC ACCGGGG GGGGCGAGGAGCTGTTC ACCGGGG 89. GTICGAGGGCGACACCC TGGTGAA 84. 8G. 88. 90. CA 3286103 Date reçue / Received date 2025-09-15 IV1SP8 NGA.A 07 site 2 MSPt NGAC 70 site 1 MSP7 NGAC l\lSP1 NGAT 7 ! site l 20 20 l\lSPl NGAG 10 MSP3 NGAG EMXJ CTT('ACC.\GG GTGTCGC('CT GCCCACCCrc CTGACCAcc·c GCCCTTGCTC.\ CCATGGTGG CiTCGCCCiTCC AGCfCGACCA GTCiTCCGGCG ACiCiGCGAGGG GCiGGTCiGTGC CCATCCTGGT GCCACCATGG TGAGCA:\GCiG 91. GTTCACCAGGGTGTCG(' CCTCGAA 93. GCCCACCCrCGTGACCA CCC'TGAC 9:i. GCCCTTGCTC ,\CCATCC TGGCGAC 97. CiTCGCCCiTCC1\GCTCGA CCAGGAT 99. GTCiTCCGGCGAGGGCGA GCiGCCiAT 101 GGGGTGGTGCC(•ATCCr GGTCCiAG 103. GC•CACCATGGTGAGCAA GGCi('GAG Endogenous genes 92.. 94. 96. 98. 100. 102.. 104. Spacer . SEQ H) ,- . , s I SEQ H) Prep , Spacer 0(•qm:nce vv1t;1 e), ierwe<1 N: (..,_ r,.i • Name length ~· NO: n.•-'.',~.1 § 1'iame .iequence , ~,~ _________________________( nt) ______________________________________________________________________________________________________________________________________________________________________________________ _ FYFl NGG 20 GAGTCCGAGC :\GAAGAAG:\ 106. A -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ivlSP8 NGG 09 site L VC:47 f'..JGG MSPS NGA i 4 * i site I F:4NCF Prep Nmm.- Name DR34 NGG 8 S?tC l l'v1SP8 NGG i5 site 2 l.V1 SP8 NGC / ' Fl sue ' 2n Spacer kngth ( nt) 20 20 GTC:\CCTCC:\ ATGACTAGGG GGGAAGACTG AGGCTACAL\ GCCACGAAGC AGGCCAATGG Spacer Sequence GGAATCCCTT CTGCAGCACC GCTGCAGAAG GGATTCCATCi GGCGGCTGCA 107. CiTCACCTCCAATGACTA GGCTGGG 109. GGGA,\GACTG,\GGCT1\ CATAGGCT 111. GCCACGA,\GCAGGCCA. SEQ m NO: 11.5, -~ -~ '7 .! .. !. I • ATGGCiGAG Sequence vvith extended P Al\I GGAATCCCTTCTGCACiC ACCTGCiA GCTGCAGAAGGGATTC CATGAGGT GGCGGCTGCACAACCA C AGTGG GTGGAGGC 108. 110. 112.. SEQ rn NO: 114. 116. 118. ------------mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm _________________________________________________ l\1SP8 NGG 17 site 4 GCTCCAGAGC 119. GCTCCAGAGCCGTGCG 120. CGTGCGA.ATG AATGGGGC 20 MSP8 NGA 18 *2 site 1 20 GA.A TCCCTIC 121. GAATCCCTICTGCAGCA TGCAGCACCT CCTGGAT 122. MSP8 NGA 20 *3 site 2 20 GCGGCGGCTG 123. GCGGCGGCTGCACAAC CACAACCAGT CAGTGGAG 124. MSP8 NGA 85 *4 site 3 20 GGTIGTGCAG 125. GGTIGTGCAGCCGCCGC CCGCCGCTCC TC CA GAG 126. 43 CA 3286103 Date reçue / Received date 2025-09-15 RU!V.Yf l\lSPx NGG IVJSPx NGA 16*5 site l Sparer SEQ Sequence with extended PA:\1 kngJh Spacer Seqm,.·nce H) {nt) :~O: 20 GCATTTTCAG (; 1\ (j(J / \ ,,\ (j (; (j 1-\ GGG.\GAAGA AAG,\GAG,\TG T GGTGCATTTT C,\GGAGGAAG 127. GCATTTTCAGGA.CiGAA GCCiATGGC ·1 "i Ci iL~. GGGAGAAGAAAGAGAG ATGTAGGG 1.31.. GGTGCATTTTC,\GGAGG .\AGCGAT SEQ rn NO: 128. 130. 132. ·-------------------------------------- -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 1\lSPX NGA IVlSPl NGAA I\JSP ! 726 l\lSP l 72.g MSP! 730 IVlSPl rn MSPS 29 NGAA NGAC NGAC NGAT site l NGAT 2 l\-1SPl NGAG 734 site I 20 lU GAGATGTAGG GCT,\GAGGGG GGTATC.CAGC AGAGGGG.:\G A GAGGC .:\TCTC TGCACCGAGG GAGGGCTGAG GCTGAAACAG GACCAAAAGT AGATATTACA CTGAGGCATA GCACAGGGG.\ GAAGAAAGA G GCACCGAGCC 133. 137. 139. 141, :1.43. 14.S. GAGATGTAGGGCTAGA GGGGTGAG GGTAT("CAGCAGAGGG GAGGCATCTCTGCACCG ,\GGTG,\,\ GAGGGGTGAGGCTGAA AC,\GTGAC GACCAAAAGTAGA~~T TAC,\AGAC GGAATTCA.\ACTGAGG CATATGAT GCAGAGGGGAGAAGAA 147. GCACCGAGGCATCTCTG ATCTCTGCAC CACCGAC 134. 136. 133. 140. 142. 144. 146. 148. ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- MSPx NGAG GAGATGTAGG 149. GAGATGT\CGGCTAG / \. 150. .28 SltC .!., GCTAGAGGCG GGCGTGAC ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ZSCAN2 Prep Name Name NN67 NGG 5 s:tc VE.'GF-4 Prep Name Name VC29 NGG 7 site l VC29 NGG 9 site 2 VC22 NGG 8 site 3 BPKl NGA 846 site 1 *'7 I Sparer length (nt) Spacer length (nt) 20 20 20 20 Spacer Sequence GTGCGGCAAG AGCTTCAGCC Spacer Sequence GGGTGGGGGG AGTITGCTCC GACCCCCTCC ACCCCGCCTC GGTGAGTGAG TGTGTGCGTG GCGAGCAGCG TCTICGAGAG SEQ rn NO: 151. SEQ ID NO: 153. 155. 157. 159. 44 Sequence with extended PAiH GTGCGGCAAGAGCTTC AGcc··GGGG Sequence with extended PAM GGGTGGGGGGAGTITG CTCCTGGA GACCCCCTCCACCCCGC CTCCGGG GGTGAGTGAGTGTGTG CGTGTGGG GCGAGCAGCGTCITCG AGAGTGAG SEQID NO: 152. SEQTD NO: 154. 156. 158. 160. CA 3286103 Date reçue / Received date 2025-09-15 5 10 ZNF629 Pncp Name NN67 NGA Spacer kn~th (nn SEQ Spacer Sequence i D NO: Sequence with extended PAM GTGCGGCAAG \GCTTC,\GCC H:iL GTGCGGCAAGAGCTTC <r NCiA FAN CT si tc I froff, Klcinstiver ct al, f\.Jature 20 i 5 . NGA fANCF site 4 from Kleinstive;- ct al , Nature 20 i 5 "'5. ]\GA RUf·✓ X 1 site 1 from Kiein:,tiver et al... Nature 2015 1'.JCiA RUN,'\ 1 site 3 from K]einstiver et al.. 1-✓ ature 2015 '':8, NGA ZNF629 site from Kleinstiver et al, Nature 20 l 5 Genome-wide specifidt) of SpCas9-H F 1 SEQW NO: H:i2.. To test vvhether SpCas9-HF l c:,d1ibi ted reduced off-tacgct in hurnan cel!s. the genome-\\ide unbiased identif1cation of double-:;trnnded breaks enabled by sequencing (GUIDE-seq) method \Vas used. GUIDE-seq uses integrntion of a short double-stranded oligodeox:ynucleotide (dsODN I tag into double-:,trand breaks to enable amplification and sequencing of adjacent genomic \vith the number i5 of tag integrations at any gh,en site providing a quamitati\e measure of cleavage efficiency (Tsai, S Q et al,Nat Biotechnol 33. ! 87--197 (2015 )) GUIDE--seq was used to compare the spectrum of off-target effects induced by v-,rild-type SpCas9 and SpCas9-HF I using eight different sgRT'-t\s targeted to various sites in the endogenous The sequences targeted by these 20 sgR.NAs are unique and lrnve variable numbers of predicted mismatched sites in the reference human genome (Table 2; Assessment of 01Harget dsODN tag integration (by restriction fragment length polymorphism (RFLP) assay) and indel formation (by T7EI assay) for the eight sgRNAs revealed comparable on-target activities with wildtype SpCas9 and SpCas9-HFl (Figs. 7a and 7b, respectively). GUIDE-seq 25 experiments showed that seven of the eight sgR.i'JAs induced cleavage at multiple genome-wide off-target sites (ranging from 2 to 25 per sgRl'JA) with wild-type SpCas9, whereas the eighth sgRNA (for FANCF site 4) did not produce any detectable off-target sites (Figs. 2a and 2b). However, six of the seven sgRNAs that 45 CA 3286103 Date reçue / Received date 2025-09-15 induced inde!s \vith \\ild-t\ pe SpCas9 showed c1 stnkingly complete absence GUIDE-seq detectable ofl'-target evems \Vi:h SpCas•i-HF I (Figs. 2a and 2h). and the rem;:iining se\enth sgRN.,\ (fc,r FA]\JCF site :ti induced only a single detectable genonH:-\vide oif-target cleavage event. at a :,ite ]1altH1ri11g one mismatch within the s pn1tospacer seed sequence ( Fig.2~11 Collectiveiy. the off-tcirg,et :,ites that were not detected \vhcn using SpCas9-HF l harbored one tc, si-< n-1isn-1atches in the protospacer and / or PAt\,J :,equence (Fig. 2c) A:; with \\ild-type SpCaso, the eighth sgRNA (for events when tested \Vith SpC,;::,C)-HF l ( Vig, 2a) To confinT1 the GUIDE-seq an-1plicon sequencing was used to more dircctlv measure the frequencies of NHEJ-rn ated inde! mutations induced by 1.vild-type SpCas9 and SpCas9--HF ! _ For d1ese • rnents. hurrian cells \i.·ere transfected only --,vith sgfU✓ A- and Cas0-cncod111g pla~;rni (i e 'Nithout the (iUIDEseq tag) Ne,:t-generation sequencing -.vas then w exrnrnne 36 of the 40 offtarget sites that had been identified 'vvith hild-type SpCas9 si:s: sgRNAs in the GUIDE-seq e:,;penment:; (four of the 40 sites could not be exa1nined because they could not be specifically amplified from genomic DN These deep sequencing experiments showed that (1) v,ild-type SpCas9 and SpCas9-HF l induced comparable frequencies of incl els at each of the six sgR.t'.JA <Figs. 3a and 3bt (2) 20 wild-type SpCas9, as cxpccr.cd showed swtistica11y significant evidence of indel mutations at 35 of the 36 off-target sites (Fig, 3b) at frequencies that correl;:ited well vvitb GUIDE-seq read courns for same sites (Fig. 3r). and (3) the frequencies of indds induced by SpCas9-HFJ at .34 of the 36 crff-target site:, were indistinguishable from the background level of ind els observed in san1ples from control transfections 25 (Fig, 3b) For the two off-target sites that appeared to have statistically significant mutation frequencies v-:ith SpCas9-HF l relative to the negative controL the mean frequencies of indels were 0.049% and 0.037%, levels at which it is difficult to determine whether these are due to sequencing / PCR error or are bona.fide nucleaseinduced indels. Based on these results, it was concluded that SpCas9-HF1 can 30 completely or nearly completely reduce off-target mutations that occur across a range of different frequencies with wild-type SpCas9 to undetectable levels. Next the capability of SpCas9-HFl to reduce genome-wide off-target effects of sgRNAs that target atypical homopolymeric or repetitive sequences was assessed. 46 CA 3286103 Date reçue / Received date 2025-09-15 i\lthough rn:.n\· nmv tn· to a\ o; d on- rnrg_et sitt.::s \, i th d1ese c lrnracteri sti cs due to their SpCasii-HF l might reduce off-target rndeb ev,.::n for these challenging targets. Biotechnol 31..Tsai, s SQ et al . f·✓ ,i.1 Biorechnol .n. 187-1 ,17(2015) \Vere used that target either a cytosinerich hornopo!yrneric sequence ur a sequence containing multiple TG 1·epeats in the human i' / X ;;.:1 gene ( VEGF:\ :,ite 2 and VEGF ;\ :,ite 3 .. respectively) (Table 2) In control t"qx.-riments. each of these sgRNAs induced comparable le\ s ofGt!IDE--seq ds ODN tag incorporation (Fig, '7c) and indel n111wt1on', (Fig. 7d) with both wild-type ,o SpCas9 and SpCas9-HF L dernonstrati that l \vas not impaired in on-target activity \\ith either of these sgRT-✓:\~;. Irnponant!y GUIDE-seq experiments revealed that SpCas9-HF l \Vas highly effecti',·e :.t • ng off-target sites of these sgRNAs, \'>Hh 113 / 144 sites for VEGFA site 2 and 3 J1_·)2 ::;ites for VEGFA site 3 not detected (Figs, :fa and 4b) Examination of these off-target si1es not de1ected v,iith SpCas9-HF l shohed that the\' each possessed a of ffll \vithin their protospacer 3nd Pi\fvl sequences. 2 to 7 rnisnrntches for the VEGFA site 2 sgRNA and l to 4 mismatches for the VEGFA site 3 sgRNA (Fig, 4c): also, nine of targets for VECiFA site 2 may have a potential bulged base (Lin. Y et ai, Nudeic Acids Res ,+2. 74 •-'7'+85 {2014) at the sgRNA-DNA inte1face (Fig. 4a and Fig. 8). 20 The sites that \\Cre not detected \Vith SpCas9-HF l possessed 2 to 6 mismatches for the VEGFA site 2 sgRNA and 2 mismatches in single site for the VEGFA site 3 for VEGFA site 2 sgRNA again having a potential bulge ( Fig, 8) Coll ecfrv .. these re:,ul t:, denwn :,trated that S pCas9-H F 1 can be highly effective at reducing effects of As targeted to simple repeat 25 sequences and can also have substantial impacts on sgRNAs targeted to homopolyrneric sequences. 47 CA 3286103 Date reçue / Received date 2025-09-15 Table 2l Summary of potential mismatched sites in the reference human genome for the ten sgRNAs examined by GUIDE-seq mismatches to on-target site* site spacer with PAM 6 total 0 i 273 ! 23: 8 15331 18441 (} 0 68 780 6102 6953 ,----------:-------------•---------------•------------------,------------------------------------ 0 18 288 1475 9f311 11393 2,. ;j 235 2000 13047 15313 0 C) I 1 79 874 6651 7615 <----------•-------------:----------------j------------------+----------------- ------------------ F.ANCF-4 0 0 6 59 fi39 5078 5782 0 189 1644 11546 13387 0 3 i 12 127 1146 10687 11975 0 2 i 35 i 456 17576 21974 VEf.3F.A3 1 7 383 6039 1353fi 35901 55927 --'-- '--'-- - ~--~-----------------------------------------------------------------------------------------------------------•--------->------------------------------------------------•------------------------------------ ,, cleterrnined usin,;:1 Cas--OFF1ncler (Bae et al, Bioinforrnatics 30, i 473- 1475 (2014)) Tabh: 4: Oligonuckolidcs used in tht study de§rripfom of T7E] primers forward primer to amplil\ ETVl X l in U20S human cells seq uenre GGAGC,\C-CTGG-TC,\G AGGGG SE~) ID NO: 173. reverse primer to amplify !X 1 in U20S CCATAC:i-G(:i-i\AG(lG(rG 174. hwrw.n eel [ s forward to arnplifv FAT"-.JCF in U20S human cells reverse primer to amplify FAI·✓ CF in U20S human cells forviard pnmer to ampli(v RUNX l in U20S human cells reverse primer to arnplif\ RUNX l in U20S human cells fonvard primer to amp lit°:) "\ / EGF A in U20S human cells reverse primer to amplify VEGF A in U20S human cells forward primer to amplify VEGF A (NGG site 2) in U20S human cells reverse primer to amplify VEGF A (NGG site 2) in U20S human cells forward primer to amplify ZSCAl'.J2 in U20S human cells reverse primer to amplify ZSCAN2 in U20S human cells 48 1-\CACTGG GGGCCGGGA.AA.GAGT TGCTCi GC"C(:T 1-\T(:TGCTCT CCCTCC ACiCACA,\CTTACrc GC\CTTGAC CATCACCAACCCACAG CCAACiG TCCAGATGGCACATTG TCAG AGGGAGCAGGAAA._GT GAGGT CGAGGAAGAGAGAGA CGGGGTC CTCCAATGCACCCAAG ACAGCAG AGTGTGGGGTGTGTGG GAAG GCAAGGGGAAGACTC TGGCA 175. 176. lTl. 178. 179. 180. 181. 182. 183. 184. CA 3286103 Date reçue / Received date 2025-09-15 fonvard primer to amplifv ZNF629 in U'.:'OS fiurnan celis reverse primer ,o amplil\ ZNF( / .~•i 111 U20S human cells description of deep sequencing prirners fonvard primer to amplit\ EI\lX l ·- 1 unreverse primer to mnp]ii\ ErvfX i •• J 011•- target forward primer to arnpld\ Fl\lX I- iGUIDE seq-OTf: l reverse primeno arnpiil\ El\lX1-lGUIDE seq-OT# l fonvard primer to amplif':; EMX j •• ] •• GU i DE_ seq-(H#2 reverse primer tu ampiit\ i- l- GUIDE seq--OT#2 forward pnrner to arnplify E1\IX 1-1- GUIDE seq-OT#3 reverse primer to ampid\ Er\fX 1-1- GU ff)E seq-OT#.1 fonvard primer tc, amplit\ EI'vlX l-- 1 •· GUIDE seq-OT#4 reverse primer to arnplify CiUlDE seq-.C)T#,.J. forvvard prirncr to arnplit\ El\lX I- iGUIDE seq-OT#5 reverse primer to amplify EMX1-l- GUIDE ___ seq-OT#5 forvvard to amplify EM)(] .. ] .. GUIDE seq-OT#6 reverse primer to amplify GUIDE seq--OT#6 forward prinier to amplify E1\IX 1-1- GUIDE seq-OT#7 reverse prim er to am pl It\ IX 1 - ! - GUIDE_seq-OT#7 fonvard primer to amplify EMX:1-1- GUIDE seq-OT#8 reverse primer to amplify ElVIXl-1- GUIDE _seq-OT#8 forward primer to amplify ElV[Xl-2 ontarget reverse primer to amplify EJ\,fXl-2 ontarget forward primer to amplify EMXl-2- GUIDE seq-OT# 1 49 TACGA(iTGCCTA.GAGT 18.5. GC(r GC 1\G1\TGTAGGTCTTC:r 186. GACiGAC SEQ H) sequence NO: GGAGCAGCTGGTCAG 187. J\GGGG CGATGTCC'TC"CCC i\TT GGCCTG GTCiGCiGAGATTTGCAT CTGTGG."',GG GCTTTTATA CC 1\ TCTT GGGGTT ,\G CAATGTGCTTCAACCC ,\TCACGGC CCATGAATTTGTGATG GATGCACi c; Ac; AA Ge; A c;GTGC A(i GAGCTAGAC C1\TCCCGACCTTC,\TC CCTCCTGG GTAGTTCTGACATTCC TCCTC!\CGC TCA ATACAGCA CAGGGTCGCTCAGTCT GTGTGG ACiCGCACCATTCAC TCCACCTG GGCTGAAGAGGAAGA CCAGACTCAG GGCCCCTCTGAATTCA ATTCTCTGC CCACAGCGAGGAGTG ACAGCC CCA.AGTCTTTCCTAAC TCGJ\CCTTGG CCCTAGGCCCACACCA GCAATG GGGATGGGAATGGGA ATGTGAGGC GCCCAGGTGAAGGTGT GGTTCC CCAAAGCCTGGCCAGG GAGTG AGGCA ..A. AGATCTAGG ACCTGGATGG 188. 189. 190. 191. 192. 193. 194. 195. 1%. 198. 199. 200. 201. 202. 203. 204. 205. 206. 207. CA 3286103 Date reçue / Received date 2025-09-15 reverse primer to mnp1i1\ EJ°vlX i ·-2- GU I DE_ seq-OT# l forward primer to an,plifv Fl\JX 1-2- GUIDE SeLi·OT-H2 reverse primenu amplify El\\X]-2- GUIDE seq-OTt'.2 fonvard primer to amplif\' El\lX l <> GUIDE seq-OT#3 reverse primer to amp1ifv El'viX i -2-· GUiDE_seq-Of':!3 forward pn nwr to arnpli fy E1\ lX 1-2- GU lDE seq-Crf#,.i reverse primer to ampid\ Er,fX 1-2- GU !DE seq-OT#4 fonvard primer to amplit\ EI\lX l -2- GUiDEseq-OT#:=:, 1-everse primer to mnplify GU lDE seq-{H#5 fonvard prirner to arnplil\ El\lX 1-2- GUIDE seq-OTf:(:, reverse primerto ampiil\· El\lX1-2- GUiDE __ seq-OT#6 fonvard primer to amplif':; El\1lX J •• 2 .. GUIDE seq-OT#7 reverse primer to amplify GUIDE seq--OT#7 forward primer to arnplify E1\lX1-2- GUIDE seq-OT#9 reverse primer to ampid\ Er,fX 1 Gl.HDE seq-OT#9 fonvard primer to amplit\ FAI'-JCF- l ontarg; et reverse primer to amplify FAN CF - i onfonvard primer to amplil\ FANCF-1- GUIDE seq-OT# 1 reverse primer to amplil\· FANCF-1- GUiDE __ seq-OT# I forward primer to amplify FANCF-1- GUIDE seq-OT#2 reverse primer to amplify F At~CF-1- GUIDE seq-OT#2 forward primer to amplify FANCF-1- GUIDE __ seq-OT#3 reverse primer to amplify F i\.NCF-1- GUIDE_seq-OT#3 fonvard primer to amplify F Ai'JCF-1- GUIDE seq-OT#4 reverse primer to amplify F ANCF-1- GUIDE _seq-OT#4 50 CCATCTGAGTCAGCCA GCCTTCiTC GGTTCCCTCCCTTCTG AGCCC GG 1\ TA CG A ;\TG A,\ (i ,\ CCCCCTCTCC GGACTGGCTGGCTGTG TGTTTTGAG CTTATCCAGGGCTACC TCATT(rCC GCTGCTGCTGCTTTGi\ TCACTCCTG CTCCTT;\;\:\CCCTCAG AAGC-•TGGc·· GC A CTG-TC A G-CTG ATC CT TCGA GCTGTAGC TGTGCATAACTCATGT TGGC ACT TCCACA!\CTACCCTCA GCTGG!\G CCACTGACAATTCACT C,\ACCCTGC AGGCAGACCAG ATT TGGCAGTC AC A, GGCGC :-\ GTTC A CT GAGA.AG GGGTAGCCTGACTTTG GGCTCC GCCCTCTTGCCTCCAC TCiGTTG CGCGGATGTTCCAATC AGTACGC GCGGGCAGTGGCCiTCT TAGTCG CCCTGCiGTTTGCiTTGG CTGCTC CTCCTTGCCGCCCAGC CGGTC CACTGGGGAAGAGGC GAGGACAC CCAGTGTTTCCCATCC CCAACAC GAATGGATCCCCCCCT AGAGCTC CAGGCCCACAGGTCCT TCTGGA CCACACGGAAGGCTG ACCACG 209. 210. 2.11, 212. 213. 214, 215. 2.16. 2.17. 218. 219. 220. 221. 2.2L 223. 224. 2.25. 226. 227. 228. 229. 230. 231. 232. CA 3286103 Date reçue / Received date 2025-09-15 fonvard primer to amplifv FAT''-iCF--3 on-- GCGC,:\G,:\GAG;:\GCAG 233. target G1\CGfC reverse primer ,u amplif\ FAT'-ICF-.·) on- GCACCTCATGGAATCC 234. target CTTCTGC for1,vard pnmer 10 arnplil\ F1\ F-.3- GUIDE seq-0Tr I reverse primer to arnpiify FA!'-JCF--3- GUiDF seq-OT# l fonvard primer tc, amplit\ FANCF-3- GUIDE_seq-Of':!2 reverse primer to arnp]il~- FANCF-3- GU lDE seq-Crlt(2 forvvard primer to amplify F:\NCF<,GU !DE scq-0T#.1 re· / erse primer to amplify FANCF--3-GUiDEseq- 0T#3 forward primer to ampliJv FAT°'.JCF-3- GU lDE seq--Crr#,.j. reverse primer ,o amplify FAT·✓ CF-.1- GUIDE scq-0Tf:4 fotviard primer rn ampli(v FA]'--JCF-.3- GUiDE __ seq-0T#5 reverse primer to arnp1ify FA!'-KF--3- GU iDE seq-OT#'.' fonvard primer to arnplit\ FANCF-3- GUIDE seq--0T#6 reverse primer to arnp]il~- FANCF-3- GUIDE seq-0T#6 forward primer to amplil\ L\NCF - Gl.HDE seq-OT#7 reverse primer to amplify FAN CF •· GUIDE seq-OT#7 fon,-vard to arnplify RUNX i-1 onreverse primer ;o ampli RUNX l - i ontarget forward primer to ampli(v RUNX 1-1- GUiDE __ seq-0T# l reverse primer to amplify RlTrJXl-1- GUIDE_seq-OT#l forward primer to amplify RUNXl-1- GUIDE seq-OT#2 reverse primer to amplify RUNXI -1- GUIDE ___ seq-OT#2 forward primer to amplify ZSCAl'-f2 ontarget reverse primer to amplify ZSCAN2 ontarget forward primer to amplify ZSCAl'-f2- GUIDE seq-OT# l 51 CA,\(rTGATGCCiACTTC Ci\ACCTC CCCTCAGAGTTCAGCT TAAAAACiACC TGCTTCTCATCCACTCT 1\G1\CTGCT C1\CCAACCAGCCATGT GCCATG CTGCCTGTGCTCCTCG ATGGTG GGGTTCAAAGCTCATC TGCCCC GC,0\TGTGCCTTGAGAT TGCCTGG G;'\C AGAGAA(rC Ci·ACC."',TGTGG CCATCTTCCCCTTTGG CCC AG CCCCAAAAG-TGGCCAA GAGCCTG,\G GTTCTCCA GAGGGGi\ATG GGTGCTGTGTCCTCAT GCATCC CGGCTTGCCTAGGGTC GTTGAG CCTTC A G(}G(}CTCTTC CAGGTC GGGAACTGGCAGGCA CCGAGG GGGTGAGGCTG AC AGTGACC GGGAGGATGTTGCiTTT TAGGGAACTG TCCAATCACTACATGC CATTTTGAAGA CCACCCTCTTCCTTTG ATCCTCCC TCCTCCCTACTCCTTCA CCCAGG GAGTGCCTGACATGTG GGGAGAG TCCAGCTA.A.1\GCCTTT CCCACAC GAACTCTCTGATGCAC CTGAAGGCTG 236. 237. 239, 240. 2.41. 242. 243. 244. 245. 246. 247, 248. 249. 250. 251. 2.52. 253. 254. 255. 256. 257. CA 3286103 Date reçue / Received date 2025-09-15 5 reverse primer to mnp1i1\ ZSC / 2,f'-L?GU I DE_ seq-OT# l forward primer to :m,plifv ZSCAN:!.GUIDE seq-OT-H2 reverse primer 10 amplify ZSCAN2- GUIDE seq-OTt'.2 fonvard primer to amplif,; ZSC:\N:?.GU! DE seq-OT#3 reverse primer to amp1ifv ZSCAN2-GUiDE_ seq-Of':!3 forward pnnwr to arnplify ZSCX\2- GU lDE seq-CH#,.i reverse primer to ampid\ ZSC / \. f·✓ 2- GU !DE seq-OT#4 fonvard primer to amplit\ ZSCA!'.!2-GUiDEseq- OT#:=:. 1-everse primer to mnplify ZSC GU lDE seq--CH#5 fonvard prirner to :m,plil\ ZSCAN2- GUIDE seq-OTf:(:, reverse primer to ampiil~· ZSCAN2- GUiDE __ seq-OT#6 fonvard primer to amplif':; ZSCAN:?.GU !DE seq-OT#7 reverse primer to amplify GUIDE seq .. OT#7 ~CCGTATCAGTGTGAT GCATGTGGT TGGGTTTAATCATGTG TTCTGCACTATG CCCATCTTCCATTCTG CCCTCCAC CAGCTAGTCCATTTGT TCTCI-\GI-\CTGTG GGCCAACATTGTGAAA CCCTGTCTC CCACiGCiACCTGTGCTT GGGTTC C,\CCCCATC-,\CCTGGC :\AGTG AAGTGTTCCTCAGAAT GCC CAGGAGTGCAGTTGTG TTGGG-AGCTGATGA AGA C-AACCCACC CAC / \.CCTGGC,\CCC.\T ATGCiC GATCCACACTGGTGAG AAGCCTTAC CTTCCC CAGATGTAGG Refining the specificity of SpCas9-HF1 258. 2':>9. 260. 261. 262. 263. 264, 265. 2Hi. 267. 268. 269. 270. Previously described methods such as truncated gRNAs (Fu,'{ et al , Nat Biotedmoi 3 2, 279-'284('2014JJ and the SpCas9-D i l3 SE variant (Kieinstiver, P. et a!., Nature , 481-485 (2015)) can partialiy reduce SpCas9 off-target effects, and the present inventors vvondered \vhether these might cornbined vvith SpCas9-HF l to further i1nprove its genome-wide specificity Testing of SpCas9-HF I with matched foll-len2:,rth and truncated sgRNAs targeted to four sites in the human cell-based EGFP disruption assay revealed that shortening sgRi"l'A complementarity length 10 substantially impaired on-target activities (Fig. 9). By contrast, SpCas9-HF'1 with an additional D1135£ mutation (a variant referred to herein as SpCas9-HF2) retained 70% or more activity of wild-type SpCas9 with six of eight sgRNAs tested using a human cell-based EGFP dismption assay (Figs. 5a and 5b). SpCas9-HF3 and SpCas9-HF4 variants were also created harboring Ll69A or Y450A mutations, 15 respectively, at positions whose side chains mediated hydrophobic non-specific interactions with the target DNA on its PAM proximal end (Nishimasu, H. et al., Cell 52 CA 3286103 Date reçue / Received date 2025-09-15 and SpCas'i_Jff4 retained 70n o or more of the activi:ie~; otJ:,erved \.Vith wild-type SpCasii v,ith the same si'-; out eight EGFP--targett.::d sgRNAs (Figs. 5a and :Sb) To deh;rmine \.1.hether SpCc1s9-HF2. -HFJ cind -HF4 could reduce indel frequencies ,;t two oif-t,;rget site:, (for the F1\ F ,,ite 2 and VHJFA site 3 sgRNAs) that ,vere resistant to SpCas9-HF ! , further experiments were performed For the FAN CF site 2 rrff-target. \\hich bears a single rnis,natch in the seed sequence of the protospacer, SpCas<qffi1- reduced incld mutation frequencies tu near background level as judged by T7EJ a:,say while abo beneficially increasing on-target activity lFig. 5r;, resulting in the greatest increase in speci the three variants (Fig. 5d) For the VEGFA site .1 off-target site .. \Vhich bears two protospacer mismatches (one in the seed sequence 3nd one 3t the nucl de most distal from the P,1\t\1 sequence), SpCas9-HF2 shov,ed the grc:1:.e:,t reduction in indel formation while shovving onlv modest effects on on-tm-gt.:;t rnut3tion effici greatest increase in specificity among the three variants (Fig, :Sc), leadi to the (Fig. 5d;. Taken together, these results de,nonstrate the potentiai for reducing off-target effects that are resistant to SpCas9-HF ! by introducing additional nmtatiuns at other residues that mediate non-specific DNA contacts or that may alter Pi\fvl recognition. To generalize the T7E 1 3ssay described above that sho,11 SpCas9--HF4 20 and SpCasc1-HF2 have irnproved discrimination relative to SpCas9-HF I against off .. targets of the FAN CF site 2 and VEGF / \ site 3 sgRN respectively. the e-- \Vide specificities of t11ese ants \Vere c,;arnined using GUIDE-seq. Using an RFLP assay, it \Vas determined that SpCas9--HF4 and SpCas9-HF2 had sirniiar on-target activities to SpCas9-HFl, as assayed by GUIDE-seq tag integration rates (FIG 5E). 25 When analyzing the GUJDE-seq data. none\\• off-target sites were identified for SpCas9-ill2 or SpCas9--HF4 (FIG 5F; Compared to SpCasCi-ill l, off-target activities at all sites were either rendered undetectable by GUIDE-seq or substantially decreased. Relative to SpCas9-HFl, SpCas9-HF4 had nearly 26-fold better specificity against the single FANCF site 2 off-target site that remained recalcitrant to 30 the specificity improvements of SpCas9-HF1 (FIG. SF). SpCas9-HF2 had nearly 4- fold improved specificity relative to SpCas9-HFl for the high-frequency VEGF A site 3 off-target, while also dramatically reducing (>38-fold) or eliminating GUIDE-seq detectable events at other low-frequency off-target sites. Of note, the genomic 53 CA 3286103 Date reçue / Received date 2025-09-15 position of 3 of these LJ\V frequency sites identified SpCas9--HF i are adjacent to previous!v chcJtc1c,nizcd Li,,c1:~.round U20S cdl breakpoint hotspots. Collectively .. these results suggest that the SpCz,s9-l-fr:2 z,nd SpCas9--HF4 1 ariants can irnprove the genonH:-vvide speci / 1 ci l\ of SpCas9-HF 1. SpCas9--HF l robu:~tlv and consistentiv reduced otl-target mutations v,hen using sgRI'-;As designed against s:.andard. non-repetitive target sequences. The two olT--target sites that \vere nwq resistant to SpCa:~C;--HF I ha\e on!y one and two mismatd,es in the protospaccr Together. these observations suggest that •-target mutations might be minimized to undetectable levei', by using SpCas9--HFl and targeting ncm--repetitive sequences that not have cl y ated sites bearing one or t\vo 1nisrnatches eisevvhere in the genome (something th,,t can be easily accomplished using existing publicly ayailz,ble sotr\vare prograrns (Bae. S. et al. Bioinformatics 30, 1473-l47'.'i (2014}) One panuncter that users should keep in mind is that SpCas9-H Fl may not be compatible ,vith tl1r.:c comrnon prnctice of usi 3 G at the 5' end of the gRNA that is srnatched to the protospacer sequence Testi four sgRNAs bearing a 5· G mismatched to its target site showed three of the four had diminjshed activities v-:ith SpCas9-HF ! corn pared to ,vild-type ( Fig. lO), perhaps reflecting the ability of SpCas9-HF l to better ck,crinnnate a panialiy matched sjte Further biochemical ,vork cz,n confirm or clz,rifv the • se rnechanism by 20 which SpCas9-HF 1 achieves its high genorne-w1de specificity Jt does not appear that the four nmtations introduced alter the stabi1itY or steady-state expression of SpCas9 in the cell, because titration experiments with decreasing concentrations of expression plasmids suggested that wild-type SpCas9 and SpCas9-HF 1 behaved cornparnbly as their concentrations are lovvered {Fig. 1 l ). Instead, the simplest 25 mechanistic e:>:p!anation is that these nuttation:, decreased the en cs of internction betvveen the Cas9-sgR1'-JA and the target DNA, with the energv of the complex at a level just sufficient to retain on-target activity but lowered it enough to make offtarget site cleavage inefficient or non-existent. This mechanism is consistent with the non-specific interactions observed betvveen the residues mutated and the target DNA 30 phosphate backbone in structural data (Nishimasu, H. et al., Cell 156, 935---949 (2014); Anders, C et. Al, Nature 513, 569-573 (2014)). A somewhat similar mechanism has been proposed to explain the increased specificities of transcription 54 CA 3286103 Date reçue / Received date 2025-09-15 acfrv;:1tor--l1ke effector m,clectSes bec1ring subs1itutic,ns at positively charu.ed residues lt ,vas possible that SpCas9--HF l might abu be cornbrned with other mutations that ha-...,c been si,O\\Tl to alter Cas9 function For example an SpCas0 mutant bearing s three amino acid sub'oti unions (D l l 3C.:V / R l :U'iQ / T 1.3.37R. also known as the SpCas9- V()R variant), recognizes sites \\ith r-KiAN PA1\ls (with relative efficiencies for (20 l 5)) and a recently identified quadruple SpCas'i nrntant { D l l 35 V / C l 2 l SR / R 1335() / T U:PR. referred to as the SpCa:~(}-VR()R variant) has improved activities relafr,.c to the VOR variant on sites NGA.H (H C, or T) PAlVls {Fig. LZa; lnuoduu.ion of!he fr;ur muw.tion'.:; A1R66! A / ()695 / \ / ()926 / \) from SpCas9-HF l into SpCasll.\iQR and SpCas9--VRQR SpCas9--V()R--HF l and SpCas9-VROR-HF 1, respectivcl y. Both HF vcr~;ions of these nucleases showed 01Harget acti,Jities comparab1e (i e. 70° o or more) to their non--HF counterparts \Vith five of eight sgRNAs targeted to the EGFP reporter and with seven of eight sgRNi\s targeted 10 endogenous human gene sites (Fig:,;, l2b-]2d). \fore broadly these results illw:-1inate a general of addi tionaJ high-fide] i ty \ ariants of CR lSPR-associ atecl nucl eases. ,\ddi ng additional mutations at non-•specific Dt'-JA contacti residues forther reduced sorne the very 20 small number of residual oiT-wrget shes that persist \Vith SpCas9-HF l Thus, variants 25 such as SpCasCJ-HF2. SpCas9--HF3, SpCas9•-HF,.J., and others can be utilized a customized fashion depending on the nature of the off-target. sequences. Furthermore, success \V:tli engineering high-fidelity vananb of SpCas9 suggests that the approach of rnutati non-specific DNA contacts can be e,:tcndcd to other naturally occurring and engineered Cas9 orthologues (Ran, F Esvdt, KM. et aL Nat l'.fothods 10. 1116-1121 (2013); Hou, Z et aL Proc Natl Acad Sci US A (2013); Fonfara, I. et al., Nucleic Acids Res 42, 2577-2590 (2014); Kleinstiver, B.P. et al, Nat Biotechnol (2015) as well as newer CRISPR-associated nucleases (Zetsche, B. et al., Cell 163, 759-771 (2015); Shmakov, S. et al., Molecular 30 Cell 60, 385-397) that are being discovered and characterized with increasing frequency. 55 CA 3286103 Date reçue / Received date 2025-09-15 E:;;ampir 2 Descnbed herein arc SpC \ ariants \\ill, al:rnine ~.ubstitutions in residues that contact the tarSiet strand DN including i"i•·fcl7,,'\_ ()695A. R66 l ,\, and Q926A Beyond these wsidues the present imentors sou t to deterrnine \.\hethcr the s specificity of the:~e var1anh .. e.g .. the SpCas9-HF l varrnnt tN4CJ7A / R66 l A / Q69SA / Q'C(; / \), rnight be f\.11·ther irnpro\ bv adding substitutions in positively-clrnrged SpCas9 residues that appear to ,ru1ke contacts \vlth the nontarget Dl\A strand R 780, K8 l 0, R832, K8,t8, K85:\ KCJ68, R1i76, fF182, Kl 003, Kl0i4, KIC:47_ and / or Rl1ViO {:~ee Slavnrnkeret ai. Science 2016 Jan The act,\itics of \vild-t\pe SpCas9 derivatives ·nsz. sirn!le alanine substitutions at these positions and combinations were initizdly tested using the EGFP clisrup1.ion assay \.Vith a perfectly matched sgRT\:-\ designed to a site in the J);rr gene ito assess on-target acti,ities) and the same sgRNA beanng intentional rnisrnatches at positions l land l2 ,vith position i bci n-1ost P,\J\l-proximal base (to assess activitie:, at mismatched sites, as \vould be found at off-target sites) (Figure DA) (Note that the derivatives beari the triple substi K8 l OA / K l OO]AiR l or K848A / K 1 AIR 1060A are the sa1ne as recentlv described,, ariants knov,n as eSpCas9{ 1 0 / and eSpCas9( 1.1 / , , see ref 1 ). 20 As expected, \\ild-type SpCas9 had robust 01Hargct and mismatched-target activities. / \s a controL \Ve also tested SpCas9••HF i in this experiment and found that it rnaintained 01Harget activity ·while reducing mismatched-target activity as expected (Figure U,,\). i\ll of the wild-type SpCasq derivative:, bearing one or more alanine substitutions at positions that might potentiallv contact the no,Harget DNA strand 25 showed on-target activities comparab(e to wild-type SpCas9 (Figure BA) Interestingly, sorne of these derivatives also showed reduced cleavage with the mismatched 11 / 12 sgRNA relative to the activity observed with wild-type SpCas9, suggesting that a subset of the substitutions in these derivatives confer enhanced specificity against this mismatched site relative to wild-type SpCas9 (Figure 13A). 30 However, none of these single substitutions or combinations of substitutions were sufficient to completely eliminate activities observed the l lil2 mismatched sgRNA. When ,ve tested wild-type SpCas9, SpCas9-HFl, and these same wild-type SpCas9 derivatives using an additional sgRNA bearing mismatches at positions 9 and 10 56 CA 3286103 Date reçue / Received date 2025-09-15 in mism:.uched-t::irget auivities were observed for most deriva,i\cs i\'::'.ain th1s derno11str:ired that single, double .. or even triple at these potemial non-target sucind contacting 1es1dues are 111sufficient to eliminate s activities at irnperfectlv matched DN:\ site', Coilecti\eiv. these data dernonstrate that the wild-tvpe SpCas9 varia11ts retain on--target activity 'vVith a matched sgRNA. and that the su[Jstitut:ons contained in these derivatives 011 their ovvn (in the context of vvild-type SpCas9) are 11ut sufficient to e]iminate nuc1ease activities on two different mismatched DNi\ sites ( Vigarrs UA and UB) Given these results. it "'✓ as hvpothesized that SpCas9-HF i derivatives ng one or more addit1onal aniino acid substitution'.:; at resi t112t rnight contact the nontarget DNi\ strand might f\.1rther improve ·ficitv ati';-e to the parental SpCasl) .. HF l protein. Therefore, various SpCas'i-Jff 1-derviatives be,i.ring combinations of single, double. or triple alanine substitutions \Vere tested in die hun1an cell-based , 5 EGFP disruption assav usi a perfectly matched sgRNA. (tu test on--target activities) and the same sgRNA bearing rnisnrntches at positions l l and 12 (to assess activities at a mismatched target site, as would be found for off-target sgRN are the same ones that \Vere used for Figures BA-B This experiment ed most of the SpCas9-HF [ -derivatiw variants \Ve shovved comparable activities 20 to those obsen / ed \\ith both wild-type SpCas9 and SpCas9-HF 1 (Figure 14A) With 25 the l 1 / 12 mismatched sgRN some of the SpCas9--HF1 deri'vatiws tested (such as SpCas9-HF l R83 and SpCas9-HF 1 Kl O l change in cleavage with the 1111smatched sgRN did not shov-,r an appreciable Ho"vever, importantly, most of the SpCas9-HF l derivatives had substantially lmver activitv "'✓ ith the ! 1 / ! 2 mismatched sgRNA than what was observed with SpCas9-HF L eSpCas9(1 or eSpCas9(l .1 ), suggesting that certain combinations of these ne"'i variants have reduced rnisrnatchedtarget activities and thus improved specificities (Figure 14A). Of the 16 SpCas9-HF1 derivatives that reduced mismatched-target activities with the 11 / 12 mismatched sgRNA to near background levels, 9 appeared to have only minimal effects on on- 30 target activity (assessed using the perfectly matched sgRNA; Figure 14A). Additional testing of a subset of these SpCas9-HFl derivatives in the EGFP disruption assay using an sgRNA intentionally mismatched at positions 9 and 10 (Figure 14B) also revealed that these variants possessed lower activities with this mismatched sgRi"\fA CA 3286103 Date reçue / Received date 2025-09-15 :0 i: Figun: UA) or \\i th the same substi rution~; added to \Vi Id-type SpCas9 nuclease (Figure BB) Irnportantl\', five \icffiz,nts showed background l off. target activity Ne'<L whether these aianine su!)stitut1ons of the norHaruet strand could be combined with the SpCas9 variant that contains oniv the ()CJ'i5A and Q926!\ Because rnarr, of the HF i derivatives tested above showed :rn observable (and undesirrrble} decrease in on-target acti\itv. 1t wa:, pothesized that combining only the t\.VO niost important substitutions Figun: i B) \vith one or more non-target strand contacting substitution~; miglu rescue on--target actiYity but still maintain the gz,ins in specificit\' observed when these substitutions ,vere added to the SpCas9-HF 1 van ant. Therefore.\ mious SpCas9(Q695A / Q926A) derivati,es bearing combinations single. double., or triple alanine substitutions at potential non-target Dl'-JA ng positions 'vvere tested in the human cell-ba:,ed ECFP disruption assay usi the sc1me perfectly matched sgRNA targeted to EGFP described above (to test on-target activities) and the same sgRNA bearing rni:,nrntches at positions 1 l and l 2 (to c1:,sess activities at c1 mismatched target site, as would be found for off-target • that 1vere used for 20 Figun's UA-B. This experiment revealed rnost of the SpCasCi(()695A!()926 / \) derivative variants tested shov,ed comparable activities to those observed vvith both wild-type SpCas9 and SpCas9-HF l (Figure 15) Importantly, rnany of the SpCas9-HF l denvatives had substantially lower activity 1vith the 1 l / 12 mismatched sgRNA con1pared vvith what \Vas observed with SpCas9-HFl, eSpCas9(! Ot or 25 eSpCas9(1.1) suggesting that cenain combinations of these new variants have reduced mismatched-target activities and thus improved specificities tFigure 15). Of the 13 SpCas9(Q695AiQ926A) derivatives that reduced mismatched-target activities with the 11 / 12 mismatched sgRNA to near background levels, only 1 appeared to have a substantial effect on on-target activity (assessed using the perfectly matched sgRNA; 30 Figure 15). Overall, these data demonstrate that the addition of one, two, or three alanine substitutions to SpCas9-HFl or SpCas9(Q695AiQ926A) at positions that might contact the non-target DNA strand can lead to new variants with improved abilities to 58 CA 3286103 Date reçue / Received date 2025-09-15 discriminate against rnisrnatchecl off-target sires (rel:uive w tu their irnrentcd clones or or ( 1. l) lrnpo1tm1tly, 1hese sarne subslitutions in the context of v,ild-type SpCas9 do nc,1 appear tu prnvicle any subsrnntial specificity To better define and corn pare the tolerance', of SpCa::,CJ-HF ! and eSpCas9- l. I to misnrntc!,es at the sgRNA-target Dr-P, complernentaritv interface. their activities were examined u:,ing ?;R.f'✓ A:, containing single nfr;,natches at all possible positions in the spacer complen,entaritv region Both the SpCas9-HF l and eSPCas9--1. l variants had ,,irr1ilar activi1ie:~ on most s1ngly ,nis,natched :~gRN,\s \vhen compared to ,o wild-type SpCas\i, ,vith a ft",v c:c<ceptions 1vvhere SpCas9-- i outperformed eSpCas9-- Ne,:t we tested the sim?.le nucleotide rnisnrntch tolerance of sorne variants containing comb111ations of aniino acid substiwr.ion::; rrorn either :.he double mutant {Db= Q695:\ / Q926t\_), SpCas9-HF l ( 1'-J497 A / R66 l A / Q695A / Q926A). eSpCasi.)- l 0 ,s U O K8lOA / KlU03A / RlU60A).oreSpC.s9-ll\il K848A / Kl003A / Rl060A) • · l 1 '. \VH 1 ac cut1• 0na l a l am• n e sun·: ~t1• t uu• o ns •m res1•c 1u e:, tl 1 ar· cont·a ct t I·i e r· .arget st·r anc: i l.. )Ni ' n1 or that potentially contact the norHargct strand DNA {Figures 17:\-H). On-target activity was assessed using a perfectly matched sgRN \Nhile sin·u-· ie nucleotide mismatch tolerance v,;as assessed usinu suRNAs such mismatches at positions 20 4, 8, 12, or lb in the spacer sequence (Figure l7A) A number ofthe~;e variants 25 maintained activity 1Nith substantial reductions in activities observed v,iith the mismatched sgR N Three of these variants (Q695A / K848!\ / Q926AiK 1003 / \ / Rl N497A / R66 l A / ()695,:\ / K855 N4971\ / R66 l AiQ69S,\ / Q926A / H()82A / R 1 1 were fi..irther tested with the remaining single mismatch sgRNAs (containing mismatches at positions 1-3. 5-7., 9- 11, 13-15, and 17-20). These variants demonstrated a more robust intolerance to single nucleotide substitutions in the sgRJ.'-TA compared with eSpCas9-1. l, demonstrating the improved specificity profile of these new variants (Figure 17B} 30 Additional variant nucleases containing alternative combinations of amino acid substitutions were tested using sgRi'fAs containing mismatches at positions 5, 7, and 9 in the spacer (these particular mismatched sgRNAs ,vere used because earlier variants appeared to tolerate mismatches at these positions) (Figure 18). A number of these 59 CA 3286103 Date reçue / Received date 2025-09-15 nudeases had imprm.ecl sp,xitkiLir.::s against the mismatched sites, with only marginal reductions in 0,1-tmget activ1ries (Figure 18;. To further determine whether additional combinations of mutations could conve\· specificity impn;\crnents a ~;reatl\ e'<panded panel of nuclease variants \Vith s tvvo addiUomd matched :,gfU✓ A', \\as tested to examine 0:Harget activity in our EGFP disruption activity (Figure l9A) A nurnb\'.:i- of these vari:rnts ,naintained robust ontarget c1ctivi1ies. ',uggesting that thev mav be useful for generating further mprovemcnts to specificity tFigure 19B; A number of these variants v✓ ere tested vvith sgRNA.s containing singie substitution:; at position:, 12, 14. 16, or lS to detern1i11e \\ / ]1et11.er specit].cit)' irnpro\,.:erncnts \\ierc greater into!er:111ce to single nucleotide rnisrna Example 3 and \Vere found to e:d:dbit ·t,ons (Figure 19R) 1SaCas9) as we had done with SpCas9 experiments \vere perforrncd to rn,provc the specificity of 15 SaCas9 by introducing alanine :,ubstitution:, in residues that are known to contact the target DN / \ strand (Figure 20 and Figure 2lA), residw:s that contact the non·- target DN,\ {ongoing experiments), and residue:, that \.Ve have previously shown can influence P,:\\f specificity (Figure 21B; Residues that rnav contact the target strand DNA backbone include. '{11 ! , '{112, W229, "(230, R145, T392, N4 I 9, L446 .. \'65 l, 20 and R65,t residues that may contact the non--target strand DNA include Q84S, N492, Q495, R497, I\498, R499, Q500, K5 l 8, K523, H557 .. R561, I<572, R634, R654, G655, N658, S662, l'-!668, R.686, K6C)2, R69,.J., H700. K75 l:. and :residues that contact the P,:\\f include E782. D786. T787, Y78Ci, T882, I<886, N888, A889, L.909, K929, N985, N986, R 991 .. and R 1015. ln a preliminary experiment, single alanine 25 substitutions (or some cornbinations thereof) in either target strand DNA contacting residues or PAM contauing residues (figures 2!A and B, respectively) had variable effects on on-target EGFP disruption activity (using a perfectly matched sgRNA) and were unable to eliminate off-target cleavage (when using an sgRNA mismatched at positions 11 and 12). Interestingly, SpCas9 mutations in the HFl were unable to 30 completely abolish off-target activity with a similarly mismatched targetisgfu~A pair, suggesting that variants containing combinations of target strand / non-target strand substitutions may be necessary to improve specificity at such sites (as we observed with SpCas9). 60 CA 3286103 Date reçue / Received date 2025-09-15 Tc, tlirther assess the strzneg\ of mutating putenti al target stnind D Ni\ contacts ro inip:\)\C S:1Cas9 sp1:x:ii1city. the potential of :,in~;le. double, triple, and quadruple combinatic,ns of nrntations to tolerate misnrntches at positions 19 and 20 in an sgRNA was exmrnned (Figure§ 22A and BJ These conibi1wtions revealed diat alanine s substitutions at 'Y°:?JO and R24:\ \\hen combined \1v1th other sub:;titutions can increase 20 25 30 35 specificity as judged bv the capabili to better discrin-1inate against mismatched sites. Ne-..:.t the o,Harget gene d1srupt10n activities two of these triple alanine examined at 4 on-target sites in EGFP (matched s1 te:, i-4. Figure 23 ). These variants rnaintained robust on-target activities approxinrntely 60-70° o loss of on-target l and '2 but shov✓ ed s1 r.es 3 and 4. Both of these triple alanine substitution variants dramatical irn specificity relative to wild-type SaCasCi as judged by using sgRNAs bearing double mi:m1 positions in the spacers oftargd sites l--4 (Figure 23). at various SaCas\i variants bearing double and triple combi ( Figures 24A and B, re§perfrvely) ofthe:~e alanine sub:,titutions \vere tested 011 si.\ endogenous sites for on target activities and irnprovernents specificitv assessed an sgRN / \ contai a srng!e mismatch at po:,ition 21 (the most PAM distal position to be a challenging mismatch to discriminate against) In some cases. on-tc1rget activities 1vith the matched sgR NA \Vere maintained ,Nith the variants \Vhile ·off activities ,vith the sgRNA mismatched at position 2 l were eliminated <Figures 24A, and B) In other cases. marginal to complete loss of activity ,Nas observed \Vith the matched sgRNA l. 2. 3. 4. Sander, J D & Joung, J I<. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat Biotechnol 32, 34 7-355 (2014). Hsu, P.D., Lander, E.S. & Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell 157, 1262-1278 (2014). Doudna, J.A. & Charpentier, E. Genome editing. The ne\v frontier of genome engineering with CRISPR-Cas9. Science 346, 1258096 (2014). Barrangou, R. & May, A.P. Unraveling the potential of CRISPR-Cas9 for gene therapy. Expert Opin Biol Ther 15, 311-314 (2015). Jinek, M. et al. A programmable dual-Rl~A-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). 61 CA 3286103 Date reçue / Received date 2025-09-15 5 10 15 20 25 30 35 40 45 6 Sternberg. SJL Redding, S, Jinek. i\L Gn_,enc EC & Doudna, J.i'\. DNi\ 1menogatirn1 bv the CRlSPR RN•\-guidecl endo11uclec1:,e Cas9. Nature 507, 62-67 (2014') ,, Hsu. PD et al DNA targeting sp,.::cdki of R!'-JA--guided ('359 nucleases. Nat l3iotechno! 31.,. 827-SJ.2 (2013) 8 q lO l l. l2 !3 14. lS 16. 17 l 8. 19 Tsai, S () et al_ GUIDE- enables genurne-,vide profiling of off--target '"l P'.j' "Cl uc, [,,_.- (' l) : <.;;, J)l-) --c·., ~ !1 ll ("] ,':F't", N, 1 '.1 t 1:, i ,):Pr"}1 n nl n' l 8J- l l)'"I i 'Jt) ! Ci) l.· .....,..._.\.._~ ..... C· ,., , ~ "\.._._, __ . "'I.._ _ (L_, . ,.._ -......._.,_' / ..,..._ __ , '--· _) .. ·'--''- ·'·'--,, - __ . . , t \.:...- 1._ . Hou, Z et al. Fffic,ent genome engineerin~; in hunwn p!uripotem stem cells using Cas9 frc,rn Neisseria rneningitidis Prue Nati Acad Sci US A.(2013). Fon fora. [ e1 ai Phv!ogenv of Cas9 determines functional e,changec1bility of dwd-Rl\J,c\ and Cas9 among ortho!ogous type [[ CRlSPR-Cas systems Nucleic i\cids i{es --+2~ 2~,77--2590 (20 !,~f). Esvelt._ K.!Vl. et al Orthogonal C prott=:: i1s RN•\-guided gene regulation and editing Nat f'vk:thods l 0, ! l 16- l i 2 ! C~0 ! _·; ;. Cong, Let 3!. l\ilu!tiplex genome engineering usrng CRlSPR / Cas systerns. Science 339, 8!9-:323 (2013) I--l:orvath, P et al. Diversitv, activitv, and evolution of CRIS PR loci in Streptococcus thermophi!us J Bactenol l 90. 140 l •- i 4 l 2 {2008) Anders .. C.. Nic\\Oehner. 0. Duerst. A Jin el-.:.., i\f _ StTuc1_urai basis of P AIVIdependent target DNA recognition bv 569-573 (2014). Cas9 endonuclea5e. Nature 5 l 3. Reyon. D. et al FLA.SH assembly ofTALENs for hi -tfnoughput genorne editing. 1'.Jat Biotechnol 30. ,-1-60-465 (20 l 2) Fu, Y et ai. High-frequency off-target mutagenesis induced CRlSPR-Cas nucleases in human ceils Nat Biotechnol 3 i. l3) Chen. Z & Zhao. H. A highl) sensitive selection m directed evolution of horning endonucleases ·Nucleic Acids Re'.:; 33. e 154 (2005) Doyon, LEL Pattmrnvak. V l'vieyer, CB. & Liu, D.R. Directed evolution and substrate specif1city prnfl!e of horning endonuciease l-Scel. J -'un Chern Soc 77-2484 (2006} Jiang, W. Bikard. D. Cox, D. Zhang. F. & Marrnfftni. LA. RNA--guided editing of bacterial genomes u:,ing CRISPR-Cas sy:.;tems. Nat Biotechnol J l, 9(_2013). 20. I\fali, P et al RNA-guided hunun genome engineering Yia ('359_ Science 339, 21. 23. 24. 823 (2013) I·hvang. W Y et al. Efilcient genon1e editing in zebrnfish using a CRISPR-Cas system. Nc1t Biotechnol 3 L. 7-229 (2013) Chylinski, K. Le Rhun, A. & Charpemicr, E The tracrRI·✓ A and Cas9 families of type II CRISPR-Cas immunity systems. Rl'-JA Biol 10, 726-737 (2013). Kleinstiver, B.P., Fernandes, A.O., Gloor, G.B. & Edgell, D.R. A unified genetic, computational and experimental framework identifies functionally relevant residues of the homing endonuclease I-BmoI. Nucleic Acids Res 38, 2411-2427 (2010). Gagnon, J.A. et al. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS One 9, e98186 (2014). Sequences 50 SEQ ID N0:271 - JDS246: C~~J-T7-humanSpCas9-NLS-3xFLAG 62 CA 3286103 Date reçue / Received date 2025-09-15 5 10 '15 20 25 2-0 35 40 45 P.ATGCCG'I'CGrfAGGG.. .t 1""CCGCACTC ...t 1""'I"TAAGAi\..h""'I'ACCCG. .i. \..O""GC'IAGAi\..O""GTGAGTT'T'GTGrl'ATGG'IjGAT TA.CA.l\A .. GTTTJ\.TGACGTCCGTAA..G_._A.._TGATCGCG]J.AAA.GCG_._A,.,,.A,..CAGGAG_._A.._TAGGCAAGGCTACAGCCAl.J.'"i. TA.CTTCTTTTATTCT]!>.J,.C.ATTATG}'.\J,.TTTCTTTP•.A.GA.CGG}'.\J,.A.TCACTCTGGCAAACGGAGAGATA.CGC 50 P,A.1\CGACCTTTAATTG."A,,o,,7\CCAATGGGGAGACAGGTGAAATCGTATGGGA.TAAGGGCCGGGACTTCGCG ACGG'I'GAGAA.o,,li.G'I'TTTGTCCA'I'GCCCCAAGTCAACA'I'AGTAA.7\GAAJ!,.ACTGAGGTGCAGACCGGA.GGG TTTTCA.J'.,..AGG.l-\..i\.TCGATTCTTCCAAA..A....Z\GGAATAGTG.P.. .T AAGCTC.P... T CGCTCGTA.PiAA..A..GGP:..CTGGG.l-\C CCGAA.Al',J\GTACGGTGGCTTCGA.TAGCCCTA.CAGTTGCCTATTCTGTCCTAGTl'.GTGGCA."AJ,.A.GTTGAG AA.. GGGAJ'v.7\_;).1\TCC]J.AGAAACTGAAGTCAGTCAAAGAATTATTGGGG. .A. .. .T .AACGATTATGGAGCGCTCGTCT 55 TTTG.~-C\.P.J\.GPJ:,..CCCCATCGf\~CTTCCTTGf\~GGCGP~JJ..GGTTACPJJ..GG.A}\GTPJJ._l.\_~-~.l\GGJ1 ... TCTC}\TPJ1 ... TT AAA.CTA.CCAAAGTA.TAG'I'CTGTTTGAGTTA.G,o,,li,AA.TGGCCGAAAACGGA'I'GTTGGCTA.GCGCCGGAGAG CTTCA.A..l\. .'. 8.,.GGGGA.A..CGP..ACTCGC. .Z. \CTACCGTCTP..:AATACGTGAATTTCCTGTATTT.l1,.GCGTCCC. .i. \_'TTAC GA.GA.l\GTTGAl'~GGTTCACCTGAAG.. A. ... T l\ACGAli... cAGl\A..GC_._A,.,.A.. . CTTTTTGTTGAGCAGCACAAACl-\TTJ\T CTCGACGAA.A.TCATAGAGCAAATTTCGGAATTCAGTAAGAGAGTCATCCTA.GCTGATGCCAATCTGGAC 60 ."A,,o,,7\G'I'A.TT."A,,7\GCGCATA.CAACAAGCA.CAGGGAT."A,,o,,7\CCCATA.CGTGA.GCA.GGCGGP._"AJ1ATATTATCCAT 63 CA 3286103 Date reçue / Received date 2025-09-15 5 10 15 20 25 30 35 40 45 SEQ ID Nf):272 m VP12: '-l bold: TTGCAGA."A.CGAGA.l\.D,.CTTTACCTCTATTACCTACAY..AATGGAAGGGACATGTATGTTGATCAGGAfa.CTG GA.CAT.AJ-\l-\CCGTTTATCTGATTACG. .A. . .. CGTCGATCACATTGT. .A. . .. CCCCAATCCTTTTTGl-\AGGACG_._A_.TTCF"i. A.TCGACAATAAAGTGCTTACACGCTCGGATAAGAACCGAGGGAAAAGTGACAATGTTCCAAGCGAGGAJ'-,. GTCGTAA_A.GAc,,_,_n.Ji,,_TGA_"A..G. .1. \...ll,._CTATTGGCGGC.P-._GCTCCTAA_A.TGCG.?J\A_CTG.A. . T.?ACGCAA}i,._GAA_A.GTTC 50 GATP·.ACTTAACTAAA_GCTGAGAGGGGTGGCTTGTCTGP.ACTTGACP.AGGCCGGATTTATTAP.ACGTCAG CTCGTGGA"A.ACCCGCgccATCACAAAGCATGTTGCGCAGATACTAGATTCCCGP.ATGAATACGAAATAC G.t\.CGA.Gl'v.7\.CG.l\.T ..A. AGCTGATTCGGGAAGTCAAAGTA.A,.TCACTTT_._A,.,,.AAGTCAA..A.. ..A. . ..T TGGTGTCGGACTTC AGA],_"A,_GGATTTTG\A.TTCTAT,o,,o.l\GTTAGGGAGATA_"AATAACTACCACCATGCGCACGACGCTTATCTT .?ATGCCGTCGTAGGG}i,._CCGCACTC}i,._TTP.._A.GA1\...ll,,_TACCCG.A. ..Z i""GCTAGA1\...Zi,,_GTGAGTTTGTGTATGGTG.P / I1 55 TACA_A.A.GTTT.A_TGACGTCCGTFAG.1.ll,,_TG.P-._TCGCG. .A AP.._A.GCG.1.liJi,._C.P-._GGAG.1.Zi,._TAGGCA.Z\GGCTACAGCCAA_A_ TACTTCTTTTATTCTAACATTATGAP.TTTCTTTAAGACGGAAATCACTCTGGCA"A.ACGGAGAGATACGC AAACGACCTTTAATTG]1.Al-\.CCAATGGGGAGACAGGTGAAATCGTATGGG.t•.TAAGGGCCGGGACTTCGCG ACGGTGAGP-.,o,,o.AGTTTTGTCCATGCCCCAAGTCl\1\CATAGTl\N\GAAAACTGAGGTGCAGACCGGAGGG 64 CA 3286103 Date reçue / Received date 2025-09-15 5 i5 20 25 30 35 40 45 '.l'A.C.1.>..AAGACCATGACGGTG.1.>.. 'I'TATAA.AGA 'J.'CA'l'GACA 'J.'CGA'.l'T ACAAGGA.TGACGA'l'GA.CAAGT GA SEQ ID NO:273 - MSP2135: fi P.. .. CTC'l1T.l-\CCCrfCTTT'GP..AGATCGGGP...AArfGAT''I'GAGGAA....~Gfa. .. C'fAA...A....i\...b.,.CA'IACGCT'CACCTGTT'CGAC GATAA.GGTTATGAAACl'.GTTAAAGl'.GGCGTCGCTATACGGGCTGGGGAgccTTGTCGCGGAAACTTATC AA.CGGGl\TAA.GAGAC_._A,.,,.A,..GCAAAGTGGTJV\AA..CT ..A. ...T TCTCG_._A.._TTTTCTA.A.. ..A. ... GAGCGACGGCTTCGCCAJ\T l\GGAP.. . CTTT}\TGg-ccCTG}\TCC.A.TGl-\TGACTCTTT.l\ACCTTC.A.AAG.A.GGl-\T}\T / l,._CP,_A.J\l\.GGCJ1. .. CAGGTT 50 TCCGGACAAGGGGACTCATTGCACGAACP-.TATTGCGAATCTTGCTGGTTCGCCAGCCATCl\AAAAGGGC _A.T.l\.CTCCAGAC.l1,.GTCA.A..A..GTP..,,_GTGGATG. .n. .,.GcTAGTT. .n. .P,.,._GGTCATGGGACGTC.l1,.CA.PiACCGGP:A..AACA'rT' GTAATCGAGATGGCACGCG]!>.J,.AA.TCAAACGACTCAG]!>.J,.GGGGCA.7'.J,.AA.AACAGTCGAGAGCGGATGAAG AGAATAGAt"'\GAGGGTATTA.7'.AGAACTGGGCAGCCAGATCTTAAAGGAGCATCCTGTGGAA.7'._7'._TACCCAA TTGCAGAACGAGA}\,Z\CTTTACCTCTATTACCTACAAA"f\.TGG.AAGGGACATGTATGTTGATCAGGAt'V::TG 55 GACATA~n... . ccGTTT.A.. T CTGATTACG.?.. CGTCG.A. .T CACATTGT.?.. . CCCCA.Z\TCCTTTTTG.?AGGACG.PtTTCA_ ATCGA~~~TA..AAGTGCTTACACGCTCGGATAAGAACCGAGGGA~AAGTGACAATGTTCCAAGCGAGGAA GTCGT.AAAGAAAATG,7'.AGAACTATTGGCGGCAGCTCCTAA.7'..TGCGAAACTGATAACGCAAAGAA."A.GTTC GATAt"'\CTTAACTAAAGCTGAGAGGGGTGGCTTGTCTGAACTTGACAAGGCCGGATTTATTAAACGTCAG CTCGTGGJ,._"f\.A.CCCGCgccATCAC1'A"f\.GCATGTTGCGCAGATACTAGATTCCCG.AATGAATACGAAATAC 65 CA 3286103 Date reçue / Received date 2025-09-15 25 30 35 40 45 SEQ ID iJO; 2 7 4 HSF2133; bold: GA.J'.,..AAG.l\.TTGAGA.A..._n,,_,_u,,_TCCTA.A..CCTTTCGCAT ..U. ,.CCTgccT. .U. ,.TGTGGG...Z\CCCCTGGCCCGAGGG...i\,.U. . CTCT CGGTTCGCA.TGGATG]i,.CAAGA.AA..GTCCGl\A..GAli.. ..A. ,..CGATTACTCCCTGG. .A. .. ..A. ,..TTTTGAGGAAGTTGTCGJ\T AAA.GGTGCGTCAGCTCAATCGTTG•.TCGAGAGG.l•.TGACCgccTTTGACl!>.J,.GAATTTl•.CCGAACGAAAl'J'o. GT}\TTGCCI1~A .. l\GCACAGTTT.?,._CTTTACG.,_li,._GT.P-._TTTC.,_li,._CAGTGT.,_1\C.?ATGAA..CTCACGAA.1\GTTP._A.GTi\T 50 GTCP·.CTGA.GGGCATGCGT]:,.,_,_r,.,ACCCGCCTTTCTAAGCGGAGAACAGAA.GA_AAGCAA.TA.GTAGATCTGTTA TTC. .U. J.i.. . GACCAl\.CCGCA..A..A..GTGACAGTT ..n. ,,_,_U,.GCAATTG. .U. J.i.AGAGGl\.CTACTTT. .n. ,,_,_u,.GA.J'.,..AATTGPA_TGCT'l"'C GATTCTGTCGAG.l•.TCTCCGGGGTA.GAAGl•.TCGATTT],J,.TGCGTCl•.CTTGGTACGTA.TCATG.l•.CCTCCTA P~.. . G~~~T-'~~TTPJ:,._~~G}\TAJl. .. GGf\~CTTCCTGGf\~T-'~~CGPJ:,..G.~G}\ATGP._~~G}\TATCTT.~GP;AGJ1. ..T AT.l~GTGTTG .? .. CTCT:rl\CCCTCTTTG.?AGATCGGG.?J\fa._TGATTGAGGAA.7\G.?,._CTA_~t\...Zi,._CATACGCTCACCTGTTCGP._C 55 GATA_A.GGTTATGAA.7\C.?,._GTTAA.7\G.?,._GGCGTCGCTATACGGGCTGGGG.,_7\gccTTGTCGCGGA_AA.CTTATC AA.CGGGATAA.GA.GA.CAAGCAA_A.GTGGTAA"A.ACTATTCTCGATTTTCTA.AAGAGCGA.CGGCTTCGCCA.AT AGGAl\CTTTA.TGgccCTGA.TCCATG.l•.TGACTCTTTAACCTTCAAAGAGG.l•.TA.TACA.7'.J,.AGGCACAGGTT TCCGGACAAGGGGACTCA.TTGCACGl\1\CA.TATTGCGA.ATCTTGCTGGTTCGCCA.GCCATCAl>J1J\AGGGC 66 CA 3286103 Date reçue / Received date 2025-09-15 5 20 25 30 35 40 45 SEQ ID :NO:275 - HSP469: Tl j_n bold: GGAGAG.l\. .'. 8.,.GA..AAA..A..TGGGTTGTTCGGTAACCTT.P.. .T AGCGCTCTCACT. .Z. \GGCCTGAC. .n. .,.cc.AAATTT''TAAG TCGAACTTCGACTTAGCTGAAGATGCCAAATTGCAGCTTAGTAAGGACACGTACGATGACGATCTCGAC AA.TCT.i\.CTGGCACAA.A.. .T TGGAC-i:ATC ..A. .. . GTATGCGGACTTATTTTTGGCTGCCJV\AAACCTTAGCG_._A..TGCF"!. ATCCTCCrl1A1,CTGACATACTGAG.P-._GTT.l\_,_n.,,_TACTGAG}i,._TTA_CCA.Z\GGCGCCGTT.?.. .T CCGCTTCAA_TGATC 50 AA....~U. .. GGTACG.i\TG.AP-._CATC.,_n.,.ccA_A.GACTTGACACTTCTCA_A.GGCCCTA_GTCCGTCA_GCA.Z\CTGCCTG.A.. G l,.. .A. l-\TP... .T AAGG.l\,.ZlJl.. .T ATTCTTTGATCAGTCGA..AAA..A..CGGGTACGC.l1,.GGTTAT. .Z. \TTGACGGCGG.A_GCGAGT C.AAGAGGAATTCTACAAGTTTATCAAACCCATATTAGl'.GAAGATGGATGGGACGGAAGAGTTGCTTGTA p~,..P tCTC.1-cJ\.TCGCG.A}\GP,._TCTl-\CTGCG.A.P._~_GC}\GCGGf\_CTTTCGP..c.~n,,.cGGTP..GC}\TTCCJ\CT-\.TCAt~J1\.TC CACTTAGGCGAATTGCATGCTA:TACTTAGAAGGCAGGAGG,l>.TTTTTATCCGTTCCTCAJ;Ji._GACl\ATCGT 55 GAA_AJ\G.l\TTGA_GAA..._1\...il,.TCCTAA..CCTTTCGCAT.Ln.,,_cCTTACT.Ln.,,_TGTGGG}\CCCCTGGCCCG.A_GGG}\LllJ2TCT CGGTTCGCATGGATGACAAGAl\.AGTCCGAAGA.AACGATTACTCCATGGAJl..TTTTGAGGAAGTTGTCGAT AAAGGTGCGTCAGCTCAATCGTTCi'.\,TCGAGAGGATGACCAi'.\,CTTTGACi'.\AGAATTTACCGAACGAAAl'J'o. GT}\.TTGCCT}\}\GC.A.Cf\_GTTTP,._CTTTl-\CGAGTP..TTTCAC.A.GTGT}\CP~.. .T Gl-\}\.CTCJi.. . CG.A}\}\GTTl\AGT}\T 67 CA 3286103 Date reçue / Received date 2025-09-15 5 20 25 30 35 40 45 TA.CAA.AGACCA'l'GACGG'I'GA'l''l'ATAAAGA'l'CATGACA'l'CGATTACAAGGATGACGATGACAA.C:,TGA SEQ ID NO:276 •• HSP24,10: ....:..: .L~ .l bold: GAATAC.l.\. .b. .J.i.. . GrfACCT''I'CA..AAGAA..l~'I''I'TAAGGT'G'I'TGGGG.. i. \..O,._CACAGACCGTCATTCGF.. .T TAA...A....½....b.,.GAAT CTTATCGGTGCCCTCCTATTCC-i:AT_._A,.GTGGCGA.A,.,,.A,..CGGCAG_._A,.GGCGACTCGCCTGA.Ali,.CGAACCGCTCGG A.GJ\.r.7\.GGTl-\TA.CACGTCGC.AAGAACCG.Al\.TATGTTACTTAC_._A.. ..A. .. . G.AAATTTTTAGCAATGAGATGGCCAJ'-J.\. GTTGACGATTCTTTCTTTCACCGTTTGGAAGAGTCCTTCCTTGTCGA.AGAGGACA.AGAl\A.CATGAACGG 50 CACCCCATCTTTGGA_AACATAGTAGATG.l>.GGTGGCATATCATGl:,,AAAGTACCCAACGATTTATCACCTC AGl\AAA.J:,..AGCTAGTTGACTCAACTGATA.AAGCGGACCTGAGGTTAATCTACTTGGCTCTTGCCCATATG ATAAAGTTCCGTGGGCACTTTCTCATTG}'.\.GGGTGATCT.AAATCCGGACAACTCGGATGTCG]1.. CAAJ\CTG TTCATCCAGTT.i'.\.GTAC.AAACCTATAATCAGTTGTTTGAAGAGAACCCTATAAATGCAAGTGGCGTGGAT GCG~"A_"f\GGCT.A.TTCTTAGCGCCCGCCTCTCT.l~Z\ATCCCG.A.CGGCTP.~G.lC,..P~.. . CCTG}\TCGCJ\CT-\.A.TT~. .. ccc 55 GGAGAGl\AGAAAAATGGGTTGTTCGGTAACCTTATAGCGCTCTCACTAGGCCTGACACCAAATTTTAA.G TCGA..ACTTCGACTT. .Z. \GCTGA..A.G_A.TGCCAAA.TTGCAGCTT_,_Z\GTAAGGAC. .n. .,.cGTACG.A.TGACGATCT'CGAC AA.TCT.i\.CTGGCACAA.A.. .T TGGAC-i:ATC ..A. .. . GTATGCGGACTTATTTTTGGCTGCCJV\AAACCTTAGCG_._A..TGCF"i. A.TCCTCCTA.TCTGAC_._Z\_TACTGAGAGTTJ\ATACTGAGATTACCAAGGCGCCGTTATCCGCTTCA.A.TGA.TC .~l\.,.Z'.,.A.GGT.8~CG}\TGPJJ..Cl-\TCACCP._~~G}\CTTGPi.C.8~CTTCTCP._~~GGCCCTP..GTCCGTCP..GC}\}\CTGCCTG}\G 68 CA 3286103 Date reçue / Received date 2025-09-15 Tl>.CAAAGACCATGACGGTGATTATAAl>.GATCATGl>.CATCGATTACAAGGATGACGATGI>.CAAGTGA SEQ ID N0:277 - BPK2797: CMV-T7-humanSpCas9-VRQR(Dll35V, Gl218R, R1335Q, T1337R)-NLS-3xFLAG 50 Human codon optimized S. pyogenes Cas9 in normal font, mod.Ll:ied codons in lower case, NLS double underlined, 3xFhAG tag in bold: ATGGA.TAJ\,"'\AAGTATTCTATTGGTTTAG]!>..CATCGGC.i'.\.CTAATTCCGTTGGATGGGCTGTCATAACCGAT GAATACAAAGTACCTTCAAAGAAATTTAAGGTGTTGGGGAACACAGACCGTCATTCGATT.i'.\_n.J\AAGA.AT CTT_A_TCGGTGCCCTCCT.A.TTCG}\TAGTGGCG.1-Z\All,._CGGC"75.,._GAGGCG.A.CTCGCCTG"~Z\ACGJ4..ACCGCTCGG 55 ? ... GP._A.GGT_,_n.,,_TACACGTCGCP.._A.GA1\CCGP....A_TATGTTACTTAC.Ln.~,._GP,._A_A.TTTTTP.._GCA.Z\TGAGATGGCCAA_A_ GTTGACGATTCTTTCTTTCACCGTTTGGAAGAGTCCTTCCTTGTCGAAGAGGACAAGfa~ACATGAACGG CACCCCATCTTTGGA.i'.\ACATAGTAGATGAGGTGGCATATCATGAAAAGTACCCAACGATTTATCACCTC AGJ-v71,AAAAGCTAGTTGACTCAACTGATAAAGCGGACCTGAGGTTAATCTACTTGGCTCTTGCCCATATG AT,Z\All,GTTCCGTGGGCA.CTTTCTCATTGAGGGTGATCTJ>~ATCCGGACJ>.ACTCGGATGTCGACAAA.CTG 69 CA 3286103 Date reçue / Received date 2025-09-15 5 20 25 30 35 40 45 CTCGACGAAATCATAGAGCAA._A.TTTCGGAA.TTCAGTAA.GAGAGTCATCCTAGCTGATGCCAA.TCTGGAC AAl'~GT.i\.TTAA.GCGCAT]l.. . CJ\ACA.A.GC,,.A,..CAGGGAT]J.AACCCAT]J... . CGTGAGC. .A. . .. GGCGGA.A.. l -\ATATTATCCJ\T 50 TTGTTTACTCTTACC]!>.J,.CCTCGGCGCTCCAGCCGCATTCA.i'.\.GTATTTTGACACAACGATAGATCGCAl'J'o. cagT.A.CagaTCTP,._CCf\_7-\GGAGGTGCT.A.GACGCGl-\C-"Z\CTGP..TTC.P~.cc.A.P..TCC}\TC.A.CGGG}\TTl1i.TATGJ\A _ACTCGGATAGi\TTTGTCAC.11,.GCTTGGGGGTGACGG. .Z. \TCCCCCA....Z\GP..AGAA.G. .Z. \GGA.PiAGTCT'CGAGCGAC TACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGTGA 55 SEQ ID NO: 278 - MSP2443: C!vT\T-T7-humanSpCas9-VRQR-HFl (N497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335Q, T1337R)-NLS-3xFLAG Human codon optimized S. pyogenes Cas9 in normal font, modified codons in lower case, NLS double underlined, 3xFLAG tag in bold: 70 CA 3286103 Date reçue / Received date 2025-09-15 5 20 25 30 35 40 45 fa.. .. CGG'l1G.l-\Gl\A_AAGTT"I"I'GrrccATGCCCCAA.GT'Cfa.ACATAG'I'fa..AAGAA....i\...b.,.CTGAGGT'GCAGACCGGfa.. . GGG TTTTC.AAAGGAATCG}'.\.TTCTTCCAl!>.J,.AAGGAATl'.GTGATA.7'..GCTCATCGCTCGTAA.7>._n.AGGACTGGGAC 50 CCGAl\AAAGTACGGTGGCTTCgtgAGCCCTACAGTTGCCTATTCTGTCCTAGTAGTGGCAAAAGTTGAG -~"l\.GGG.AP._"A_l-\TCCP~ ... GP._~n,,.cTGP~ ... GTC"75.,._GTCPJJ._"A_G.A}\TT.A.TTGGGGP ... TP._"A_CG}\TT.A.TGG}\.GCGCTCGTCT TTTGFAA_A.GA . .l\CCCCATCG}i,._CTTCCTTG}i,._GGCGAA .. l\GGTTACA7\GGAA_GTA1\...n.~J\fa._GGATCTCP._TAATT -~~~CTACCA.~~GTATAGTCTGTTTGAGTTAGAA~ATGGCCGA.~~~CGGATGTTGGCTAGCGCCaga~~G CTTCAAJ'v.-7\GGGG ..A. ACGAACTCGCACTACCGTCTAAAT. .A. .. . CGTGAATTTCCTGT_._A.._TTTAGCGTCCCATTl-\C 55 GAGAAGTTGAl-\.AGGTTCACCTGAAGATA.7'..CGAACAG.7'..AGCAACTTTTTGTTGAGCAGCAC.7'._n.ACATTAT CTCGACGM,ATCATAGAGCA.'\P;:TTTCGGAl\TTCAGTAAGAGAGTCATCCTAGCTGATGCCAATCTGGAC ?AA_GTATTFAGCGC.A.. T F.. . CP._A.CFAGCF. .. CP._GGG.A. .T FJ\A_CCC.A. .T F.. . CGTGAGCF.. . GGCGG. .1. \...n.~ATATT}\TCC.P / I1 TTGTTTACTCTTACCP•.ACCTCGGCGCTCCAGCCGCATTC.~r,.GTATTTTGACACA.ACGATAGATCGCAJ\.A ca~iTACagaTCTACC.7'.AGGAGGTGCTAGACGCGACACTGATTCACCAATCCATCACGGGATTATATGAA. 60 ACTCGGATAGATTTGTCACAGCTTGGGGGTGACGGATCCCCCAl\GAAr:.AAGAGGAP.AGTCTCGAGCGAC TACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGATGACAAGTGA 71 CA 3286103 Date reçue / Received date 2025-09-15 SEQ ID N0:279 - BPK1520: c--'--- ll"i 10 OTHER El\1HOD!MENTS lt is to be understood that \'vhiie the invention ha:~ been described in conjunction hith the detailed description description is intended to illustrate and not limit the scope of the imention. which is defined by the scope of the appended claims Other aspects, advantages, and fications are v✓ ithin the scope of the fo11owing ciaim:~. 72

Claims

CA 3286103 Date reçue / Received date 2025-09-15 protein, wirJ1 rnut<uions at one, two, three, fc,ur, fr-. e, si:-.;, ur all seven c,f the fol LJ\vi ng positions LI Y450. N407 R661, Q6°.\ Qii2(i, awi:01DI13:, .. preferably cornprising a sequence U1at is n identical to the amino acid sequence of SEQ ID NO 1 \Nith mutations N497, Rb6 l, QVJ5, ()926, D l 13:'-i and opt1cmally one or more of a nuclear localization sequence, cell penetrating peptide sequence, atltni tag 2 The i-;olatecl protein of claim ! . comprising mutations at one. two, three, or all four of the following. f·;,J4cn, RU; 1.. Q( / )'i. and ()926, preferably one, tv,o, three., or all fc,ur c,f the fc,lLJ'.ving rnutations N1F 17A, R66 l ()695 and Q926A 3. ·T'he isolated protr.::in of clairn l 1 corn prising rnutc1tions at one or both of ()695 and / or ()926. and opiiona11y one, t.\vo three, four.. or all five LI Y4SO, N497, R66 Land D ! 13.::., preferably Y450A / Q695A, L169,\ / ()695 Q695A / Q926 / \., Q695A / Dl 13 Q926A / Dll35 ',{,,[50A / D!!35 Ll69A / Y450A / Q695A .. Y4'i01\ / Q695A / Q926A, R661 ;\ / ()695AiQ926A, N.c197 / \ / Q695 Q695,\ / Q926A / D 11 :;::;E, L 1 <>9A / Y 450A / Q69:'-iA / Q926A, L ! e:1A / R66 ! AIQ695A / Q926:\. Y,.J.SOA / R66 ! AIQ695A / Q926A. i-\ / ()9261\j[) l '] 3 5 or Y450A / Q695A. / Q926A / D 1135 4. The isolated proteins of claim 1 further cornprising mutations at Nl4: S 15: S55: R63: R78: Hl60: Kl 63: Rl : Ll69, R403: l\407, '{450, f'vi49S, N497: K.510; Y515; W659; R661; M694; Q695; H698; A728; S730; K775; S777; R.778; R.780; K782; R783; K789; K797; Q805; N808; K810; R832; Q844; S845; K848; S851; K855; R859; K862; K890; Q920; Q926; K961; S964; K968; K974; R976; N980; H982; Kl003; Yl013; K1014; V1015; S1040; Nl041; N1044; Kl047; Kl059; R1060; K1107; E1108; Sll09; Kll 13; R1114; Sl 116; Kll 18; R1122; K1123; K1124; D1135; S1136; K1153; K1155; K1158; Kl200; Q1221; H1241; Ql254; Q1256; K1289; Kl296; K1297; R1298; K1300; H1311; K1325; K1334; Tl337 and / or S1216, preferably N497A / R661A / Q695A / Q926A / K810A, 73 CA 3286103 Date reçue / Received date 2025-09-15 N497A / R6o1A1Qo95A / Q926A / RI060A, N497A / R66lA / Q695AH)926A / K848 1003 N407A / R661A / Q605A / Q02oA / K848A / RI060A. N497Afll661A / Q695A / Q926A / K855Aflll Nl-i-97.A. / R.66 l 1:l.. / Q69~ .A. / Q926.A. / K 968 .A ... / K j 00 3 N497 ,\ / R66 I 1\ / ()695 AiQ92(>i\ / K 1003 AIR l N497 A / R66 l AIQ695 AIQ926AIK8 ! OA / K ! 003 AIR! 060A, N497A / R66lA / Q695A / Q926A / K848A / Ki003A / RI060A, Q695A / Q926A / R780A, Q695AIQ926AIK8 ! Q695A / Q926A / R832A., Q695A / Q926A / K 848A, ()695 Al()926A!K85 ()695 A / ()926AiK968A, l CJ 14A, Q695A / Q926A!K l (};[7 Q695A / Q926A!R I 060A, Q695 / \ / Q926A_lK848A / K855A, Q695 / \ / Q926i\ / K848A_lH982A, Q695 A / Q926A / K 1003A / R1060A, Q695 A / Q926A / R832A / R 1060A, Q695 A / Q926A / K968A / K 1003A, Q695 A / Q926A / K968A / R1060A, Q695A / Q926A / K848A / R 1060A, Q695NQ926A:K855A:H982A, Q695A / Q926A / K855NK 1003 A, Q695A / Q926NK855NR 1060A, Q695A / Q926A1H982NK 1003 A, Q695NQ926A1H982A / Rl 060A, Q695NQ926A / Kl 003A / Rl 060A, Q695A / Q926NK8 l 0A / Kl 003A / Rl 060A, Q695A / Q926A / Kl003A / K1047A / Rl060A, 74 CA 3286103 Date reçue / Received date 2025-09-15 Q6G5A / QG20A / K8i8A / KI003A / Rl060A :, The isolated protein of clairn l, further comprising one or rnore of the following mutations D ! ! 35E: D ! 135V: DI I 35ViR ! 335Qtr 1337R (VQR variant); D l l J5E / R l :,3_<:.() / T 133 7R (EQR van ant), D l l :,5V / Ci l 2 i 8RiR 1335() / T 133 7R (VRQR variant\ or D ! I 35\i / Ci ! .? l 8RiR 1335 l 3 3 7R ( \'RER variant). (j The isolated protein claim L f11cther cornprisi one or more mutations that rle crease nuc Ie a:,e acti•v i•t y :,e l ect·e o• t"r nrn tli e group con:~•1 :,·•u ng CHr n1ut· at1• ons at· 1u" ' l C) .. E762, D839, H983, or [)(!86; and at H840 or N863. ,, The isolated prok,in of clairn L\ '>vherein mutations that decrease nuclease activitv are. (i) D l OA or D l ON. and {ii) H840 H840N. or H840\'. 8 An isolated \ruphdocr;cci1s mrre11s Cas9 (SaCas9) protein, nrntations at one .. t\vci, three, four. five, :,ix. or rnore of the fdlmving positions. Y2l I. Y2l2 .. W229, T·-..J.,[ ! 9, "{65 ! R65,t, preferably cornpri • a sequence that is at least 80°0 identical to the annno acid sequence of SEQ lD NO. I with mutations at one, two, three, four, or five, or more of the fo1lmving positions Y2 l l, Y2 l 2 .. W229, Y230 .. R:245, T392, N4] 9, '{651, R654, and optiona]]y one or more of a nuclear localization sequence, cell penetrating peptide sequence, and / or affinity tag CJ The isolated protein of claim 8, co,nprisi one or more of the following mutations: Y211A, Y212A, W229, Y230A, R245A, T392A, N419A, Y651, and / or R654A 10. The isolated protein of claim 8, comprising mutations at N419 andior R654, and optionally one, two, three, four or more of the additional mutations Y211, Y212, \V229, Y230, R245 and T392, preferably N419A / R654A, Y211A / R654A, Y211A / Y212A, Y211AiY230A, Y21LI\JR245A, Y212A / Y230A, Y212AiR245A, Y230AiR245A, \V229A / R654A, Y2l1A / Y212,I\JY230A, Y211A / Y212A / R245A, 75 CA 3286103 Date reçue / Received date 2025-09-15 l l. The isolated proteins of claim 8, t11 corn pr: s1 mutations at ·''{2 J l; )'2 l 2; R99l: Rl0l5: N R45:. Y256, R314, NJ94. Q414:. K:'17: R6l.. Hl l J: Kl l-+: Vl6-t R1 • L788, S790:. l2. The isolated protein claim 8. forther cornprisi one or mon.:: of i(.)]I ovvi ng mutations E782K .. K929R. N968K. or R1015H. Specificaliy E782K / N968K / Rl015H (KKH variant): E782K / K92ClfUR1015H !KRH variant); or E782K / K929R!N%8K / R l O ! SH (KRKH variant) l J. The isolated protein of claim 8, fun.her comprising one or more mutations that decrease nuclease activity selected from the group consisti of mutations at D 10, E477. 0556. H70L or D704: and at H557 or N580 l 4 The isolated protein of claim l 3, \Vherein 1.he mutations arc· (i) DlOA or DION, and ior (ii) H557A, H557N, or H557Y, and / or (iii) N580A, and / or (iv) D556A.

15. A.fusion protein comprising the isolated protein of claims 1-14, fused to a heterologous functional domain, with an optional intervening linker, wherein the linker does not interfere with activity of the fusion protein. 76 CA 3286103 Date reçue / Received date 2025-09-15 l 6 The fusion protein of cL-lim l 5, \vhen::in th,,:: het,,::rulogmh functiomil domain is a transcrip;iornd act,\ation dornai11. l 7 The fr1s10;1 pni,ein or· da1rn I 6. \vherein the tr:rnscriptio11al activation domain is from VP64 or 1'-ff-+:B p6c.,. l 8 The f\1s1on protein of claim l ). \Vherein the heterologous hinctional domain is a transcriptional silencer or trn11scriptional repression domain l CJ The fusion protein of claim 18. v,cl,et-cin the transcriptional repression dmnain is a Kn,eppd-as:.;ociated box: ( l<.RAB) clornain. ERF repres:~or domain (ERD). or mSin3A interaction domain (SID) 20 The fusion protein of claim l 8. ,vherein the onal silencer is Heterochrorn:Hin Protein 1 (HP1;, preferably HPlu or HPlf\ 21 The fus1on pn.iiein of claim I 5. vvherein the hcterol hinctional domain is an enzvrne that modifies the mefr1Ylat1on state of D]\JA The frision protein cif claim 21. \Yherein the enzvrne tha1 modifies methylation state of DNA is a Dl'-JA. nH.::thyltransfernse (DT·--J\fT) or a protein. . The fusion protein of clain1 wherein the protein is j The fusion protein of clain1 l 5~ • n the heterologous functional domain is an enzyme t fm t rnoc iJ' tV1 es a f1 1• :.;tone sul•) uni' t.

25. The fusion protein of claim 15, ,Nhercin the enzyme that 1nodifics a hi stone subunit is a histone acetvltrnnsferase (HAT), histone dcacetylase (HDAC), histone methyltrnnsferase (Hl'viT). or hi stone denicthy1ase.

26. The fusion protein of claim 15, wherein the heterologous functional domain is a biological tether.

27. The fusion protein of claim 26, wherein the biological tether is MS2, Csy4 or lambda N protein. 77 CA 3286103 Date reçue / Received date 2025-09-15 28 The fusion protein of cL-lirn ~6, \vhen::in th,,:: het,,::rulogmh functiomil domain is 2'J An isol<i!ed nucleic acid encoding the pr0:ein daims l-14 30 A vector comprising the isolated nucleic ac1d of clairn 20 .. optional1v operably linked tu one or more regulc1tory donrnin:, for expre';s111g the protein of daims l- 24 3 l. A host celL prefernbly a mamrnalian host celL comprising the nucl.eic acid cl:::1im 29, c1nd optwnally e·,pres:~ing the protein of claim:~ l- l 4. "i' A method of altering the genorne or epigenome of a cell, the rnethod comprising expressing in the cell ur contacting the cell 1vvith the i n claims l-- 14, and a guide RN,:\, having a rcg1on cornp]cmenrary to a ected portion of the genome of the cell 33 An isolated nucleic acid encoding the protein of cla1rn 15 34. i\ \ / ector cornpri the isolated nucleic acid of claim 33, optionally operably linked to one or rnon ... regulatory domains for expressing the protein of 35. A host celL prefcrnbly a manunalian host cell comprising the nuc1.eic acid ciaun , and opt1onal1y e:,pres:,i the protein of claim l 5.

36. A. method of c1ltering the genome or epigenome of a ceil, the method comprising expressing in the ce11 or contacting the cell '>Vith the isolated protein of claims 1-- 14, and a guide RN,\ having a on cornpiementary to c1 seiected portion of the genome of the cell 3 7. A method of altering the genome or epigenome of a cell, the method comprising expressing in the cell or contacting the cell with the isolated fusion protein of claims 15-28, and a guide RNA having a region complementary to a selected portion of the genome of the cell.

38. The method of claims 36 or 37, wherein the isolated protein or fusion protein comprises one or more of a nuclear localization sequence, cell penetrating peptide sequence, and / or affinity tag. 78 CA 3286103 Date reçue / Received date 2025-09-15 39 The method of claims 3o or 37, 1vl1t.::rern the cdl is a stem celL preferably an cnibrvonic stern cell. ,11ese11ch\n1a] stern cell. or 111duced p]uripotent stem cell:, is in a li'ving, anirnaL !Jr is in an ernbr\'o 40 A methiJd of alterin0: a double sLrnnded DNA D ( clsDNA) molecule. the rnethod comprising contacting the dsDNA molecule \Vith the isolated protein of clairns l-· 14, and a guide RNA ha\ i ng a region compie,nentary to a :~elected portion of the dsDNA rnc,lecule 4 l. The method of clairn ,.1\J. "'✓ herein the dsDNA molecule is if / \'!fro. 4:2 A metlwcl of altering, a double stranded DNA D (dsDN molecule, the method compnsing contacting the dsDNA molecule with the fu:,ion protein of claim l 5, and a guide RNA having a region cornplernentary to a sel portion of the dsDN A molecule. 43 The method of claim 42, \vhcrc111 the dsDN I\ niolecule i~; iii \'ifrn 79