Platforms for characterizing reactivity of t-cell receptors

Abstract

A synthetic platform for detecting epitopes that are recognized by cytotoxic lymphocytes from a plurality epitopes presented by antigen-presenting reporter cells. In one aspect, apoptosis of antigen-presenting reporter cells is delayed to increase a safe sorting window for the reporter cells. Apoptosis of the antigen-presenting reporter cells can be delayed by one or more of expressing one or more anti-apoptotic proteins in the reporter cells, knocking down expression of one or more pro-apoptotic proteins in the reporter cells, or knocking down expression of granzyme or perforin in the cytotoxic lymphocytes. In one aspect, surviving antigen-presenting reporter cells may be washed and proliferated prior to being exposed again to the cytotoxic lymphocytes. The cytotoxic lymphocyte can be an immortalized cell line derived from a T-cell or a natural killer cell.

Description

PLATFORMS FOR CHARACTERIZING REACTIVITY OF T-CELL RECEPTORSCross-Reference to Related Applications

[0001] This application claims priority to, and the benefit of, United States Provisional Patent Application No. 63 / 538232 filed 13 September 2023, the entirety of which is incorporated by reference herein in its entirety for all purposes.Government License Rights

[0002] This invention was made, in part, with government support under Grant No R21CA226321 entitled “Analysis of T-cell antigen diversity by deep sequencing” awarded by the National Cancer Institute. The United States government has certain rights in the invention.Sequence Listing

[0003] This specification includes a sequence listing in XML format with the file name B537 0202-WO.xml and a size of 227.0 KB created on 11 September 2024 which is filed herewith and which is incorporated by reference herein.Technical Field

[0004] Some embodiments relate to the identification of epitopes recognized by T-cells. Some embodiments provide compositions or methods useful in the identification of epitopes recognized by T-cells.Background

[0005] There is a need to carry out high-throughput screening to determine information relating to the interactions of T-cell epitopes and T-cell receptors (TCRs) which recognize such epitopes, including without limitation the identity of T-cell epitopes that are recognized by TCRs, the identity of TCRs which recognize specific T-cell epitopes, and thecharacterization of functional characteristics of such interactions (e.g. the functional potency of one TCR against a plurality of potential epitopes, or the functional potency of one TCR against a specific epitope as compared with other known TCR-epitope interactions). There is a general desire for improved systems and methods to conduct high-throughput analysis of T-cell-epitope interactions.

[0006] Previous literature involving the overexpression of anti-apoptotic proteins (including Bcl-2 family proteins) describes processes to immortalize certain types of primary cells, namely B cells (Linnemann et al., 2015) for use as a replenishable source of antigen- presenting cells in T cell activity assays. In other works, studies into the engineering or modulation of apoptotic pathways, or of the granzyme B / perforin pathway, have been conducted with a view towards knocking-out or knocking-down mechanisms by which tumor cells can evade T cell cytotoxicity (i.e. inducing / increasing granzyme B sensitization for potential therapeutic applications). Generally previous authors have not sought to tune down the activity of apoptotic proteins.

[0007] The Bcl-2 (B-cell lymphoma 2) family of proteins has been extensively studied, and can have either pro-apoptotic or anti-apoptotic activities; see e.g. Youle et al. 2008; Qian et al. 2022. Anti-apoptotic members of the Bcl-2 family of proteins include BCL-2, BCL-XL, BCL-W, A1 / BCL-2A1 / BFL-1 , MCL1 and BFL-1. Pro-apoptotic members of the Bcl-2 family of proteins include BAX, BAK, BOK, BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK and MULE. Caspases are a family of conserved cysteine proteases that play a role in programmed cell death. Certain caspases are considered to be apoptotic caspases that function to initiate and execute apoptosis, including initiator caspases including caspase-2, caspase-8, caspase-9 and caspase-10 and effector caspases including caspase-3, caspase-6 and caspase-7 (see e.g. Kesavardhana et al., 2020). Inhibitor of apoptosis proteins (lAPs) are another example of proteins that are known to have anti-apoptotic activities, including via inhibition of apoptotic caspases, and include NAIP (BIRC1), clAP1 (BIRC2), clAP2 (BIRC3), XIAP (BIRC4), Survivan (BIRC5), Apollon / Bruce (BIRC6), ML-IAP (BIRC7) and ILP2 / TS-IAP (BIRC8); see e.g. Hrdinka and Yabal, 2016; Kesavardhana et al., 2020.

[0008] A small body of literature exists that suggests a process known as ‘anastasis’, or reversal of apoptosis, can occur in cells with an activated apoptosis cascade by washing cells and restoring them to fresh media (Tang and Tang, 2018).

[0009] There remains a need for systems and methods that provide synthetic cell lines that allow for the large-scale discovery of T-cell antigens, including systems and methods that increase the size of libraries of antigens that can be screened and / or enhance the selectivity or sensitivity of detection of T-cell antigens.

[0010] The foregoing examples of the related art and limitations related thereto are intended to be illustrative and not exclusive. Other limitations of the related art will become apparent to those of skill in the art upon a reading of the specification and a study of the drawings.Summary

[0011] One aspect provides a method of detecting that an epitope is recognized by a cytotoxic lymphocyte. Antigen-presenting cells, at least some of which express the epitope of interest, are exposed to the cytotoxic lymphocyte. The antigen-presenting cells express a signaling system that generates a signal when a peptide linkage in the corresponding antigen-presenting cell is enzymatically cleaved by a serine protease from granules of the cytotoxic lymphocyte upon recognition of the epitope by the cytotoxic lymphocyte. The antigen-presenting cells generating the optical signal are isolated, and apoptosis of the isolated antigen-presenting cells caused by the serine protease is delayed.

[0012] In some aspects, the step of delaying apoptosis of the antigen-presenting cell involves using a genetically modified antigen-presenting cell that has been engineered to have enhanced survival upon exposure to the serine protease. In some aspects, such enhanced survival is achieved by using a genetically modified antigen-presenting cell that has been engineered to express or overexpress at least one anti-apoptotic gene. In some aspects, the anti-apoptotic genes are anti-apoptotic members of the Bcl-2 family or IAP family member proteins. In some aspects, the anti-apoptotic genes are one or more of XIAP, MCL1 , BCL2, BCL-XL, BCL-W, A1 / BCL-2A1 / BFL-1 , BFL-1 , XIAP, NAIP, clAP1 , clAP2, Survivan, Apollon / Bruce, ML-IAP and ILP2 / TS-IAP. In some aspects, the anti- apoptotic genes are one or more of XIAP, BCL2 or MCL1. In some aspects, such enhanced survival is also or alternatively achieved by knocking down or otherwise ablating or decreasing expression of one or more pro-apoptotic genes in the antigen-presenting cell. In some aspects, the pro-apoptotic genes are pro-apoptotic members of the Bcl-2 family or caspases. In some aspects, the pro-apoptotic genes are one or more of BAX, BAK, BOK,BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK, MULE, caspase-2, caspase-8, caspase-9, caspase-10, caspase-3, caspase-6 and caspase- 7.

[0013] In some aspects, the step of delaying apoptosis of the antigen presenting cells involves using a genetically modified cytotoxic lymphocyte that has been engineered to have attenuated effector functions. In some such aspects, the cytotoxic lymphocyte is genetically engineered by the introduction of miRNA and / or siRNA to the cytotoxic lymphocyte. In some such aspects, the miRNA and / or siRNA facilitates perforin knockdown in the cytotoxic lymphocyte.

[0014] In some aspects, an antigen-presenting cell that has been genetically modified to have enhanced survival upon exposure to a serine protease is provided. In some aspects, the genetic modification of the antigen-presenting cell includes overexpression of one or more anti-apoptotic genes. In some aspects, the anti-apoptotic genes are anti-apoptotic members of the Bcl-2 family or IAP family member proteins. In some aspects, the anti- apoptotic genes are one or more of XIAP, MCL1 , BCL2, BCL-XL, BCL-W, A1 / BCL- 2A1 / BFL-1 , BFL-1 , XIAP, NAIP, clAP1 , clAP2, Survivan, Apollon / Bruce, ML-IAP and ILP2 / TS-IAP. In some aspects, the anti-apoptotic genes are one or more of XIAP, BCL2 or MCL1. In some aspects, the genetic modification of the antigen-presenting cell also or alternatively includes reducing expression of pro-apoptotic genes in the antigen-presenting cell, for example by knocking down expression of pro-apoptotic genes or ablating pro- apoptotic genes. In some aspects, the pro-apoptotic genes are pro-apoptotic members of the Bcl-2 family or caspases. In some aspects, the pro-apoptotic genes are one or more of BAX, BAK, BOK, BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK, MULE, caspase-2, caspase-8, caspase-9, caspase-10, caspase-3, caspase- 6 and caspase-7.

[0015] In some aspects, a cytotoxic lymphocyte that has been engineered to have attenuated effector functions is provided. In some aspects, the cytotoxic lymphocyte has been genetically engineered by the introduction of miRNAs and / or siRNAs to the cytotoxic lymphocyte. In some aspects, the miRNAs and / or siRNAs facilitate perforin knockdown and / or knockdown of granzyme in the cytotoxic lymphocyte. In other aspects, perforin or granzyme could be knocked down or its expression level reduced in any suitable manner.

[0016] In some aspects, a method of detecting that an epitope is recognized by a cytotoxic lymphocyte is provided. Antigen-presenting cells, at least some of which express the epitope of interest, are exposed to the cytotoxic lymphocyte. The antigen-presenting cells express a signaling system that generates a signal when a peptide linkage in the corresponding antigen-presenting cell is enzymatically cleaved by a serine protease from granules of the cytotoxic lymphocyte upon recognition of the epitope by the cytotoxic lymphocyte. The antigen-presenting cells generating the optical signal are isolated to yield a pool of positive antigen-presenting cells that express the epitope, and the isolated pool of positive antigen-presenting cells are proliferated in fresh media. The steps of exposing the antigen-presenting cells to the cytotoxic lymphocyte and isolating the antigen-presenting cells gerating the optical signal are then repeated.

[0017] In some aspects, a library of cytotoxic lymphocytes are provided, with each one of the cytotoxic lymphocytes expressing at least one of a plurality of T-cell receptor (TCR) sequences. The cytotoxic lymphocytes express the LDL receptor at a higher level than native T-cells and each one of the cytotoxic lymphocytes comprises a corresponding one of a plurality of lentiviral DNA vectors encoding the plurality of TCR sequences. In some aspects, a method of producing a library of cytotoxic lymphocytes expressing a plurality of T-cell receptor (TCR) sequences is provided. Cells that express the LDL receptor at a higher level than native T-cells are provided and are transduced with a library of a plurality of lentiviral DNA vectors encoding the plurality of TCR sequences, so that each one of the cytotoxic lymphocytes in the library of cytotoxic lymphocytes is transduced with a corresponding one of the plurality of lentiviral DNA vectors.

[0018] In some aspects, a kit is provided containing (i) a first DNA construct encoding an HLA allele positioned for co-expression with a cleavable FRET-reporter protein, the HLA allele and the cleavable FRET-reporter protein being separated by a peptide cleavage sequence, and (ii) a second DNA construct encoding a putative T-cell receptor (TCR) epitope.

[0019] In some aspects, the cytotoxic lymphocyte is a CD8+ T-cell or an immortalized cytotoxic natural killer cell. In some aspects, the cytotoxic lymphocyte is an immortalized cell line of lymphoid origin, with intact expression of immunoreceptor tyrosine-based activation motif (ITAM)-mediated signaling pathways and intact expression and function of the granzyme / perforin pathway.Brief Description of the Drawings

[0020] Exemplary embodiments are illustrated in referenced figures of the drawings. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.

[0021] FIG. 1 A shows schematically the interaction between an effector cell and a reporter cell wherein the effector cell recognizes an epitope displayed by the reporter cell.

[0022] FIG. 1 B shows schematically the interaction between an effector cell and a reporter cell where the effector cell does not recognize an epitope displayed by the reporter cell.

[0023] FIG. 2A shows an example embodiment of an effector cell-reporter cell pair that can be used in some embodiments.

[0024] FIG. 2B shows the successful expression of T-cell receptor in YT Indy cells transduced with exemplary helper cassettes.

[0025] FIG. 2C, 2D, 2E and 2F show results demonstrating the specificity of the cleavage of the FRET reporter by granzyme B in reporter cells when specific example effector cells are co-cultured with specific example reporter cells.

[0026] FIG. 3A shows an example embodiment of a genetic construct in which the minigene to be screened is genetically separated from the reporter gene.

[0027] FIG. 3B shows a vector map of an example embodiment of a plasmid encoding an exemplary FRET reporter gene to be expressed by an antigen-presenting reporter cell, and FIG. 3C shows a vector map of an example embodiment of a plasmid encoding an exemplary minigene sequence to be expressed by an antigen-presenting reporter cell.

[0028] FIG. 4A shows the uptake of lentiviral DNA by primary T-cells versus YT Indy cells.

[0029] FIG. 4B shows a small scale process for generating a library of YT Indy cells incorporating a library of different TCRs using lentiviral vectors.

[0030] FIGs. 5A, 5B, 5C and 5D show a baseline determination of the safe sorting window using an exemplary embodiment of effector cells and reporter cells that have not been genetically modified to inhibit the apoptosis pathway in the reporter cells.

[0031] FIG. 6 shows the determination of relative levels of granzyme B and perforin in different cytotoxic lymphocyte effector cells.

[0032] FIG. 7 shows the survival of exemplary antigen-presenting reporter cells expressing anti-apoptotic genes after exposure to cytotoxic lymphocyte effector cells.

[0033] FIG. 8 shows the survival of exemplary antigen-presenting reporter cells exposed to cytotoxic lymphocytes expressing anti-apoptotic miRNAs targeting perforin.

[0034] FIG. 9A shows survival and FIG. 9B shows FRET-shift signal for a co-culture of antigen-presenting reporter cells expressing anti-apoptotic genes and cytotoxic lymphocytes expressing a perforin targeting miRNA to knock down perforin.

[0035] FIGS. 10A, 10B and 10C show the survival and outgrowth of exemplary antigen- presenting reporter cells after the apoptotic pathway has been initiated by exposure to cytotoxic lymphocyte effector cells and the antigen-presenting reporter cells have been separated from the cytotoxic lymphocytes.Description

[0036] Throughout the following description specific details are set forth in order to provide a more thorough understanding to persons skilled in the art. However, well known elements may not have been shown or described in detail to avoid unnecessarily obscuring the disclosure. Accordingly, the description and drawings are to be regarded in an illustrative, rather than a restrictive, sense.

[0037] Methods for determining the identity of epitopes recognized by effector cells such as T-cells have been developed by the inventors and are described, for example, in Sharma et al., 2019, Sharma 2018, and WO 2015 / 143558. An encoded library of candidate epitope sequences can be expressed in a reporter cell capable of providing a detectable signal upon cytotoxic attack from a cognate effector cell when the effector cell recognizes the epitope displayed by the reporter cell. The reporter cells that yield a signal can be assayed in order to identify the epitope sequences.

[0038] The inventors have developed improved systems and methods that enable the screening of larger libraries of T-cell antigens and / or which increase the sensitivity with which T-cell antigens can be detected and identified. In some aspects, the effector cellsthat are used are genetically modified to enhance their uptake of lentiviral DNA, to increase the size of libraries that can be generated and screened. In some aspects, the reporter cells that are used are genetically modified or otherwise treated to enhance their ability to survive initiation of apoptosis, to increase the sensitivity of the assay for the identification of T-cell antigens. In some aspects, the reporter cells that are used are panned, i.e. exposed to the effector cells multiple times across the lineage of the reporter cells, to increase the sensitivity of the assay for the identification of T-cell antigens. In some aspects, the genetic constructs that are used in the reporter cells utilize two separate genetic elements to express the putative T-cell antigens and the reporter proteins, respectively, to decouple expression of the reporter proteins from expression of the putative T-cell antigens. In some aspects, two or more of the foregoing aspects are combined.

[0039] In some embodiments, the effector cells are T-cells. In some embodiments, the effector cells are CD8+ T-cells. In some embodiments, the effector cells are CD4+ T-cells. In some embodiments, the effector cells are other cell types such as natural killer cells that are engineered so they are able to initiate apoptosis in a manner similar to CD8+ T-cells or CD4+ T-cells. In some embodiments, the effector cell is an immortalized cell line of lymphoid origin, with intact expression of immunoreceptor tyrosine-based activation motif (ITAM)-mediated signaling pathways and intact expression and function of the granzyme / perforin pathway. In some embodiments, the effector cell is a cell that has an increased level of expression of the low-density lipoprotein (LDL) receptor. In some embodiments, the effector cell is a YT-lndy cell.

[0040] In some embodiments, the effector cells and / or the reporter cells may be modified to knock-out or knock-down endogenous killer IG-like receptors (KIR) or ligands. In some embodiments, the reporter cell line may be modified to knock-out or knock-down expression of endogenous MHC or B7 protein family members (e.g. CD80 or CD86). In some embodiments in which the effector cells are T-cells, the effector cell line may be modified to knock-out or knock-down endogenous TCR expression. In some embodiments, the effector cell line may be modified to knock-out or knock-down endogenous CD28 protein family member expression. In some embodiments, the effector cell is a YT-lndy cell.

[0041] YT-lndy cells were first described by Montel et al. These authors determined that interaction between B7 family proteins (e.g. CD80 or CD86) and CD28 is the main trigger for YT-lndy cells to trigger apoptosis in target cells. These authors also determined that theabsence of B7 molecules on target cells (e.g. K562) prevents YT-lndy cells from initiating an apoptotic response in those target cells. Thus, without being bound by theory, while certain exemplary embodiments are described herein wherein the reporter cells are K562 cells, in other embodiments, other reporter cells may be generated by knocking down CD28 or B7 family member proteins in such cells, which would ensure that the YT-lndy or other effector cells do not trigger apoptosis in the native reporter cells. YT-lndy cells are further described in Sharma et al., 2024.

[0042] In some embodiments, the effector cells are capable of selectively activating an apoptotic pathway, e.g. the granzyme-perforin pathway, in reporter cells that display an epitope that is recognized by the effector cell, i.e. the effector cells do not initiate a cytotoxic response in the reporter cells in the absence of an interaction between the epitope displayed by the reporter cell and the effector cell.

[0043] In some embodiments, the reporter cells are antigen presenting cells. In some embodiments, the reporter cells are MHC-null (i.e. do not express MHC proteins), and specific HLA coding sequences of interest are introduced into the reporter cells so that the reporter cells have an intact antigen processing and presentation pathway, to enable the reporter cells to present prospective epitopes to the effector cells. The reporter cells are also tolerated by the effector cells, unless there is an interaction between the epitope displayed by the reporter cell and the effector cell. In some embodiments, the reporter cell is a cell in which CD28 and / or a B7 family member protein such as CD80 or CD86 is knocked out or knocked down. In some embodiments, the reporter cell is a K562 cell.

[0044] In some embodiments, the effector cells are genetically modified to facilitate their use in assays according to various embodiments. For example, in embodiments in which the effector cells are CD8+ T-cells or another type of cell that has been engineered to initiate apoptosis in a manner similar to CD8+ T-cells, the effector cells can be modified to allow for the exogenous expression of any TCR-a and TCR-p sequences of interest. In some embodiments, the effector cells are modified to induce exogenous expression of CD8a and CD8|3 chain coding sequences.

[0045] In some embodiments, the reporter cells are genetically modified to facilitate their use in assays according to various embodiments. For example, in embodiments in which the effector cells are CD8+ T-cells or another type of cell that has been engineered toinitiate apoptosis in a manner similar to CD8+ T-cells, the effector cells can be modified to allow for expression of each of the four CD3 subunit coding sequences (CD3s, CD35, CD3y, CD3 - In some embodiments, expression of the four CD3 subunit coding sequences is endogenous to the reporter cell. In some embodiments, expression of the four CD3 subunit coding sequences is exogenously provided. In some embodiments, expression of the four CD3 subunit coding sequences is a mixture of both endogenous and exogenously provided expression.

[0046] In some embodiments, the reporter cells are genetically modified to provide exogenous expression of any alleles of major histocompatibility complex (MHC) class I genes, HLA-A, HLA-B and / or HLA-C, along with endogenous or exogenous expression of a B2M coding sequence.

[0047] The reporter cells are also genetically modified to express one or more minigenes or a library of minigenes containing putative epitope sequences, and to exogenously express a reporter that provides a detectable signal that apoptosis has been initiated, for example a granzyme-cleavable fluorescent reporter protein provides an optical signal that apoptosis has been initiated. In other embodiments, other detectable signals that apoptosis has been initiated could be provided, for example recognized reporter cells could generate a cell surface affinity molecule and could be isolated by affinity purification, panning, bead capture or the like using a complementary binding compound. In other embodiments, other ways to provide an optical signal that apoptosis has been initiated include supplying a reagent that undergoes a chemical modification such as cleavage in the presence of one or more activated markers of apoptosis to generate a change in absorbance, bioluminescence, a readout that can be read through a colorimetric assay, or the like.

[0048] The inventors have previously demonstrated that cell lines that have been engineered as described herein so that the effector cells have an intact cytotoxicity mediated by the granzyme-perforin pathway and which are exogenously supplied with or endogenously express a TCR a and TCR p chain of interest as well as the CD8 a and p chain, whether endogenously or exogenously expressed; and so that the reporter cells have an intact antigen processing and presentation pathway and do not initiate a cytotoxic response to the effector cells in the absence of specific activation of the granzyme-perforin pathway in response to display of an antigen that interacts with the TCR of the effector cell, and express the four CD3 subunits (CDs, CD35, CD3y, and CD3 , at least one allele of anMHC class I gene and B2M, all whether endogenously or exogenously provided, along with a putative T-cell antigen and a reporter construct that allows detection of the initiation of apoptosis in the reporter cells, can be used to identify T-cell epitopes (see e.g. Example 1).

[0049] In some embodiments, for example as illustrated in FIG. 2A, in embodiments in which the CD8 a and p chain and the CDs, CD35, CD3y, and CD3 subunits are supplied exogenously to the effector cells and reporter cells, respectively, these peptides can be supplied on appropriate helper cassette constructs which encode the relevant peptide sequences separated by a suitable cleavage sequence, for example, a 2A sequence such as E2A, T2A, P2A or the like as illustrated, or any other suitable cleavage sequence to allow the helper construct to be expressed as a single polypeptide. In other embodiments, an internal ribosome entry site (IRES) sequence can interpose the separate polypeptides to be expressed, to allow translation of each polypeptide separately. In still other embodiments, a separate promoter can be provided to enable transcription and subsequent translation of each polypeptide separately.

[0050] The selective interactions between the effector cells and the reporter cells are illustrated schematically in FIGs. 1A and 1 B. With reference to FIG. 1A, when the T-cell receptor 106 of the effector cell 100 recognizes (illustrated as 104) an epitope 108 among the epitopes 101 displayed by the MHC 110 of the reporter cell 102, the effector cell 100 is activated to produce granules 114 that contain a variety of effector agents, including serine proteases such as granzyme proteases 120 and perforins 118. Exemplary granzymes include granzymes A, B, H, K and M. Granules of the effector cell 100 are transported to the cell surface and released into the intercellular environment adjacent to reporter cell 102 by exocytosis. Perforins 118 assemble and form pores 122 through the cell membrane of reporter cell 102 so that serine proteases such as granzymes and other effector agents enter the cytosol 124 of reporter cell 102. In the illustrated embodiment, a reporter such as a quenched fluorescent protein 125 is unquenched by granzyme cleavage of a peptide link that releases a fluorescent moiety to generate a signal 130 that apoptosis has been initiated. This cleavage thus provides an optical signal, which can be detected in any suitable manner, including for example by using a fluorescently activated cell sorter (FACS).

[0051] With reference to FIG. 1 B, the selectivity of the described process of the initiation of apoptosis is illustrated: in the case of FIG. 1 B, the effector cell 100 does not recognize an epitope 109 displayed by the MHC 110 of a reporter cell 102 expressing a library ofepitopes 134. Thus, no recognition and binding occurs (illustrated as 105), and no signal is generated (illustrated as 132).

[0052] FIG. 2A shows an example embodiment of a pair of effector cells and reporter cells that can be used in some embodiments. The specific embodiment illustrated utilizes a YT- Indy cell as the effector cell (a reconstituted cytotoxic T-lymphocyte, rCTL) and a K562 cell as the reporter cell (an artificial or synthetic antigen presenting cell, sAPC). Pairs of cell lines including immortalized cytotoxic NK cells as effector cells and reporter cells with intact peptide-MHC processing and presentation (exemplified here by YT-lndy and K562), which do not naturally develop a cytotoxic reaction when co-cultured together, can be induced to develop antigen specific cytotoxic reactions when provided with a cognate set of TOR-, MHC-, and peptide-coding DNA sequences along with a necessary set of accessory proteins encoded endogenously or on exogenous helper cassettes. These reactions can be detected, measured, and / or sorted upon when provided with reporter systems such as the granzyme B cleavable FRET-reporter the inventors have described previously.

[0053] In some embodiments, with reference to FIG. 3A, a genetic construct 200 to facilitate detection and collection of reporter cells in which an apoptotic pathway has been initiated is provided in which a first genetic element 202 encodes the target peptide 206 that includes the epitope that will be displayed by the reporter cell and the second genetic element 204 encodes the signal reporter 208, e.g. a FRET-based fluorescent protein signaling system that generates a fluorescent signal when cleaved by an effector agent. In some embodiments, the first and second genetic elements 202, 204 are separate DNA plasmids. In some embodiments, the first and second genetic elements 202, 204 are separate viral vector preparations. In some embodiments, the first and second genetic elements 202, 204 are separate linear DNA donor templates to be used in CRISPR-mediated homology directed repair strategies.

[0054] Without being bound by theory, providing a construct such as genetic construct 200 that allows for the decoupling of the expression of the signal reporter 208 from the target peptide 206 uncouples detection from the potential variation in expression levels of different target peptides 206. E.g. the expression level of target peptide 206 may depend on its specific sequence, and if expression of the signal reporter 208 is coupled to expression of the target peptide 206, then variations in expression levels of the target peptide 206 will also impact the expression levels of signal reporter 208, meaning some reporter cells mayexpress a high level of signal reporter 208 while other cells may express a low level of signal reporter 208. Uncoupling the expression of signal reporter 208 from the expression of target peptide 206 allows for more consistent levels of expression of the signal reporter 208 as between reporter cells, helping to provide more effective detection of cells that do express a target peptide 206 containing an epitope that is recognized by the effector cells.

[0055] An example embodiment of a construct in which the epitope expressed by the reporter cell is expressed separately from the FRET-reporter is illustrated with reference to FIG. 3B and 3C. FIG. 3B shows the configuration of a first genetic construct encoding a FRET reporter gene having the DNA sequence of SEQ ID NO:1 [pHLAI-A0101-FRET], and FIG. 3C shows the configuration of a second genetic construct encoding the target peptide, e.g. a minigene, to be expressed by the reporter cell, having the DNA sequence of SEQ ID NO:2 [pMGI-MAGEA3] (incorporating residues 164-179 of the MAGE-A3 peptide as an exemplary epitope).

[0056] In some embodiments, including the illustrated embodiment of FIG. 3B, the FRET- reporter construct has two fluorescent protein constructs separated by a granzyme B cleavage substrate as the FRET-reporter. The FRET-reporter construct can also encode any proteins it is desired to express in the reporter cell, for example desired HLA alleles. In some embodiments, the FRET-reporter construct encodes at least one HLA allele positioned for co-expression with a cleavable FRET-reporter construct separated therefrom by a peptide cleavage sequence, for example a 2A sequence such as E2A, T2A, P2A or the like.

[0057] In some embodiments, including the illustrated embodiment of FIG. 3C, the target peptide sequence includes features that increase the likelihood of the expressed target peptide being tagged for degradation. Without being bound by theory, tagging the expressed target peptides for degradation may assist in ensuring that the expressed target peptides are loaded onto MHC and displayed by the reporter cells. In some embodiments, the motifs that are added to tag the expressed target peptides for degradation are proteasome targeting motifs, for example the putative ubiquitination motif and the putative C-degron motif illustrated in FIG. 3C.

[0058] In some embodiments, including the illustrated embodiment of FIG. 3C, the construct encoding the target peptide includes a transduction marker that can be used to verify thatcells have taken up the construct encoding the target peptide. In some embodiments, the transduction marker is a gene encoding a fluorescent protein that can be expressed by the cell, e.g. mStrawberry in the illustrated embodiment although any suitable fluorescent protein construct could be used in other embodiments.

[0059] In some embodiments, including the illustrated embodiment of FIG. 30, the construct encoding the target peptide includes an internal ribosome entry site (IRES) sequence interposing the target peptide sequence and the transduction marker, to allow translation of the target peptide and the transduction marker as two separate polypeptides. This is in contrast to other embodiments that include a peptide cleavage sequence such as a 2A sequence (e.g. E2A, T2A, P2A or the like) that require the target peptide and the transduction marker to be translated as one single polypeptide and then cleaved. In some embodiments, translating the target peptide sequence and the transduction marker as two separate polypeptides allows for evaluation of target peptide sequences that have been cloned into the construct out of frame with the transduction marker, or allows for the evaluation of target peptide sequences that may include a stop codon in the transduced minigene to be screened (since target peptides may still be expressed from the portion of the sequence that precedes the stop codon). Such embodiments that include a genetic construct that allows for expression of the target peptide and the transduction marker as two separate polypeptides may be particularly useful for the assessment of partially randomized minigene sequences or minigene libraries derived from randomly sheared cDNA fragments or the like. In still other embodiments, the DNA construct can be generated so that each peptide to be expressed from that genetic construct is under control of its own promoter, so that transcription and translation of each peptide will occur separately. In some such embodiments, the DNA encoding the separate peptides is transcribed in different directions, to minimize any risk of spillover or the like.

[0060] In some embodiments, the cytotoxic lymphocytes are a cell that has an increased level of expression of the low-density lipoprotein (LDL) receptor. In some embodiments, the cytotoxic lymphocytes are YT-lndy cells. In some embodiments, the cytotoxic lymphocytes are transduced with lentiviral DNA so that each one of the cytotoxic lymphocyte cells takes up approximately one lentiviral DNA vector. More specifically, the inventors have demonstrated that YT Indy exhibits surprisingly effective uptake of lentiviral vector DNA than do comparable lymphocytes such as T-cells. For example, as shown in FIG. 4A,lentiviral vector uptake by YT Indy cells is up to three orders of magnitude more efficient than primary T-cells.

[0061] The inventors have exploited the effective uptake of lentiviral vector by YT Indy cells to generate libraries of cytotoxic lymphocytes for screening wherein each cytotoxic lymphocyte is transduced with, on average, only one corresponding lentiviral DNA, to facilitate the generation of large libraries of cytotoxic lymphocytes for screening.

[0062] Without being bound by theory, it is believed that the YT Indy cells take up lentiviral DNA so effectively because the LDL receptor is expressed at a higher level in YT Indy cells than in native T-cells. Thus, it can be predicted that other cell lines which express the LDL receptor at a level that is higher than the level of expression of the LDL receptor in native T- cells could also be used to produce large libraries of putative T-cell epitopes for screening as described herein. For example, Finkelshtein et al. have demonstrated that VSV-G pseudotyped lentiviral vectors rely on the LDL receptor for cell entry. The inventors have demonstrated through RNA-seq data that YT-lndy cells express approximately 3.3 times more LDLR transcript than do primary T-cells, which places the LDLR gene in the 85thpercentile of genes for overexpression in YT-lndy versus primary T-cells.

[0063] In one embodiment, as illustrated in FIG. 4B, small-scale production of a library of cytotoxic lymphocytes is carried out by transducing cell lines individually (for example, in separate wells of a multiwell plate), so that the cytotoxic lymphocytes within that cell each receive a single TCR-expressing lentiviral vector from the library. Because the YT Indy cells are able to so effectively take up the lentiviral vector, a very small amount of virus can be used to carry out the transduction, allowing the generation of large libraries, e.g. up to hundreds of different cell lines produced in parallel within the wells of a multiwell plate as shown in FIG. 4B.

[0064] In another embodiment, large scale bulk preparation of a lentiviral vector encoding a TCR is combined with cells that overexpress the LDL receptor such as YT Indy cells in a one pot step to create a bulk library having between 20 million and 70 million unique TCR sequences, including at least 30 million, at least 40 million, at least 50 million or at least 60 million unique TCR sequences. As demonstrated in Example 2, given a standard size library vector production run and an input library richness of 70 million unique sequences, near complete delivery of a high-diversity TCR library to cells that overexpress the LDL receptor such as YT-lndy based cytotoxic lymphocytes could be expected. In contrast, if the same library of 70 million unique sequences is transduced into primary T-cells as thecytotoxic lymphocyte, a maximum of 10-20% library coverage is achievable without scale- up.

[0065] In some embodiments, the effector cells and / or reporter cells are genetically modified or otherwise subjected to treatment to delay apoptotic destruction of reporter cells subsequent to exposure to the effector cells. Without being bound by theory, delaying the period of time before reporter cells undergo apoptosis and thereby increases the window of time that such cells can be isolated, e.g. by FACS in embodiments in which the detectable signal produced by the reporter cell is a FRET-reporter protein, prior to their degradation (also referred to as a “safe sorting window”). Increasing the safe sorting window may allow, for example, for more contact time between the effector cells and the reporter cells, which may increase the number of signal-generating reporter cells accumulated during the coculture period and thereby increase the sensitivity of the methodology, and / or enable manipulation of recovered reporter cells after sorting.

[0066] In one example embodiment, apoptosis of the reporter cells is delayed by treating the effector cells and / or the reporter cells with a pharmacological agent that inhibits a point in an apoptosis pathway. Examples of such pharmacological agents include including Z- VAD-FMK (a pan-caspase inhibitor), isatin sulfonamide 16 (a caspase 3 / 7 inhibitor), BI-6C9 (a tBid inhibitor), AG9 monoclonal antibody (a perforin inhibitor), and MnTBAP (a superoxide radical scavenger).

[0067] In one example embodiment, apoptosis of the reporter cells is delayed by genetically modifying the effector cells and / or the reporter cells to delay and / or prevent apoptosis in reporter cells that have been exposed to a serine protease such as a granzyme expressed by an effector cell. In some embodiments, such genetic modifications are aimed at enhancing the survival of the reporter cells. In some embodiments, such genetic modifications are aimed at attenuating the potency of the effector cells in triggering apoptosis. For example, survival of the reporter cells can be enhanced by expressing one or more anti-apoptotic genes such as XIAP, BCL-2, MCL-1, other anti-apoptotic Bcl2 family member proteins which include MCL1 , BCL2, BCL-XL, BCL-W, A1 / BCL-2A1 / BFL-1 , and BFL-1 , or other IAP family member proteins which include XIAP, NAIP, clAP1 , clAP2, Survivan, Apollon / Bruce, ML-IAP and ILP2 / TS-IAP, and / or the like in the reporter cells, or by expressing miRNAs, siRNAs, or other equivalent construct now known or that may be developed in future that is capable of knocking down expression of apoptotic proteins suchas granzymes or perforins in the effector cells, or knocking down expression of pro- apoptotic genes including caspases (including caspase-2, caspase-8, caspase-9, caspase- 10, caspase-3, caspase-6 or caspase-7) or pro-aptotic members of the Bcl2 protein family (including BAX, BAK, BOK, BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK, or MULE) in the reporter cells. In some embodiments, such genetic modifications are aimed at both enhancing survival of the reporter cells and attenuating the potency of the effector cells in triggering apoptosis. The person skilled in the art can select the number and identity of proteins to target for expression and / or knock down based on the expression levels of proteins involved in triggering or facilitating or inhibiting apoptosis dependent upon the properties of the particular effector cells and reporter cells being used in any given embodiment.

[0068] In some embodiments, a level of perforin expressed by the effector cells is reduced using miRNA or similar methods (e.g. siRNA) to reduce perforin expression. Without being bound by theory, it is believed that that supralytic concentrations of perforin result in rapid necrotic cell death independent of granzyme B, while an optimal dose skews towards slow, controlled apoptotic cell death pathway: see e.g. Lopez et al., 2013.

[0069] In some embodiments, the effector cells and / or reporter cells that have been genetically modified or otherwise subjected to treatment to delay apoptotic destruction of reporter cells subsequent to exposure to the effector cells as described above are used as a tool to conduct research in the field of the mechanisms and pathways of programmed cell death.

[0070] In some embodiments, after reporter cells have been exposed to the effector cells and reporter cells in which the apoptotic pathway has been initiated have been isolated, the isolated reporter cells are cultured in fresh media to facilitate outgrowth of surviving cells. Without being bound by theory, in some instances it is possible to reverse the apoptosis of cells even after the apoptosis pathway has been activated by washing the cells and restoring them to fresh media (see e.g. Tang and Tang, 2018). The inventors have observed that even after the apoptotic cascade has been initiated, a certain proportion of the reporter cells that have been removed from the effector cells and from the culture media through FACS are able to survive, and can enter into a growth phase and proliferate after recovery.

[0071] In some embodiments, such surviving cells are cultured and again subsequently exposed to the effector cells to separate reporter cells in which the apoptotic pathway has been activated from both effector cells and reporter cells in which the apoptotic pathway has not been activated, to select for reporter cells expressing exogenously encoded candidate epitopes eliciting bona fide responses from the effector cells. This process of exposure to effector cells and separation and culture of surviving reporter cells in which the apoptotic pathway had been initiated can be carried out multiple times (i.e. through a plurality of cycles) as a form of iterative enrichment to reduce the incidence of false positives and increase confidence in the identified epitopes.

[0072] In some embodiments, such surviving cells are cultured and again subsequently exposed to the effector cells to separate reporter cells in which the apoptotic pathway has been activated from both effector cells and reporter cells in which the apoptotic pathway has not been activated, to select for reporter cells with an increased level of resistance to apoptosis initiated by the effector cells. This process of exposure to effector cells and separation and culture of surviving reporter cells in which the apoptotic pathway had been initiated can be carried out multiple times (i.e. through a plurality of cycles) as a form of directed evolution to select for reporter cells having increased resistance to apoptosis initiated by the effector cells.Examples

[0073] Specific embodiments are further described with reference to the following examples, which are intended to be illustrative and not limiting in nature.General Materials and Methods

[0074] Plasmid DNA propagation and isolation. - NEB Stable E. coli (New England Biolabs) were used for the propagation of DNA. Bacterial transformation was performed according to manufacturer protocol. E. coli was grown in LB broth at 30°C, shaking at 250 rpm. For solid medium, LB broth was supplemented with Bacto agar (1.5% [w / v]; Difco). Media were further supplemented with 100 pg / mL carbenicillin or 50 pg / mL kanamycin asappropriate. Plasmid DNA was isolated using Invitrogen PureLink HiPure Plasmid Filter Maxiprep Kit and sequence verified by Sanger sequencing (Azenta US)

[0075] Mammalian cell culture. All cell cultures were maintained in RPMI-1640 supplemented with 2 mM GlutaMAX, 1 mM sodium pyruvate, 50 pM p-mercaptoethanol, 10 mM HEPES, 100 U / mL penicillin, 100 U / mL streptomycin, 1X MycoZap™ Prophylactic (Lonza) and 10% heat-inactivated fetal bovine serum. Culture media and supplements were all sourced from Gibco unless otherwise indicated. Cultures were maintained at 37°C and 5% CO2 atmosphere. K562 based cell lines were subcultured every 4 days by diluting cells 1 / 20. YT-lndy based cell lines were subcultured every 3 days by completely removing old media, washing 1X with PBS (Gibco), and re-seeding cultures at 2.5x105cells / mL in U- bottom 96-well plates. HEK-293T cells were passaged every 4 days by trypsinizing, washing 1X with PBS, and re-seeding cells at 4x106cells / flask in T-75 format. Cell counts were performed using an EVE automated cell counter.

[0076] Primary T cell stimulation and expansion. Leukapheresis product (leukopaks) from healthy human donor was obtained from Stemcell Technologies shipped on wet ice. On receipt, leukopaks were processed using a Ficoll-Hypaque density gradient centrifugation and ACK buffer red-blood cell lysis procedure. The resulting isolated PBMCs were aliquoted into individual vials of 1x107cells and cryopreserved in liquid nitrogen vapor phase. Prior to activation, thawed PBMCs were FACS-sorted to isolate CD8+ CD4- CD56- cells and rested for 48 hours in complete RPMI + 300 lU / mL human IL-2 (Miltenyi Biotec) at a cell density of 10x106cells / mL. T-cell activation was performed by transferring CD8+ T cells to wells of a non-TC treated, flat-bottom 96-well plate pre-coated with LEAF-purified anti-CD3 antibody, clone OKT3, and anti-CD28 antibody, clone 28.2 (eBioscience). Cells were stimulated for 20-24 hours on coated wells at 37°C and 5% CO2 atmosphere. After the stimulation period, cells were removed from coated wells, diluted to 5x104cells / mL in complete RPMI + 300 lU / mL hlL-2, and plated in U-bottom 96-well plates. Media was 50% changed every 4 days and used in co-culture experiments 11-14 days after stimulation.

[0077] Virus production. Lentiviral vectors were produced by combining 180 pg of each transfer plasmid with 162 pg of pCMV-AR8.91 and 18 pg of pCMV-VSV-G plasmids. These DNA mixes were incubated with 18 mL OptiMEM (Gibco) and 1 mL of TranslT-LT1 reagent (Mirus) for 30 minutes at room temperature. To 12 x T-75 culture flasks containing between 16 - 24 million HEK-293T cells, old media was removed and replaced with 10 mL fresh,pre-warmed media and 1.5 mL of transfection mix per plate. Media was again replaced 18 hours post-transfection with 10 mL of pre-warmed fresh media. Viral supernatant was then collected at 48 hours post transfection (replacing with 10 mL pre-warmed fresh media) and 72 hours post-transfection. To concentrate virus, pooled supernatants were ultracentrifuged (100,000 RCF, 90 minutes, 4°C). Viral pellets were resuspended at 4°C overnight in 1 mL OptiMEM (Gibco). Titers of viruses were determined by testing 2, 4, 8, 16, 32 or 64 pL of 10X diluted virus on1x105K562 cell / well in a final volume of 500 pL of media in 24-well format. Transduction efficiency was determined by measuring the % of fluorescent cells (generated from encoded fluorescent protein or from antibody-staining transduction marker, as applicable) detected in flow cytometry. Values were used to determine K562-infecting units (KIU) per pL of undiluted virus concentrate.

[0078] Cell line creation. KFRET.HLA cell lines were created by transducing unmodified K562 cell lines with viral vector produced using pHLA-FRET series plasmid-of-interest at an MOI of 1 KlU / cell. Purified KFRET.HLA cell lines were isolated by FACS to recover cells positive for FRET transfer and HLA expression (based on anti-MHC antibody staining). Minigene-expressing target cells were produced by subsequently transducing KFRET.HLA lines with viral vector produced using pMGI series plasmid-of-interest at an MOI of 1 KlU / cell. Purified KFRET.HLA. minigene cell lines were isolated by FACS to recover cells positive for RFP transduction marker. To create survival cassettes for initial testing, KFRET.HLA. minigene lines were additionally subsequently transduced with viral vector produced using pSurvival series of plasmids at an MOI of 1 KlU / cell. PurifiedKFRET.HLA. minigene. survival cell lines were isolated by FACS to recover cells positive for survival cassette transduction marker (based on anti-CD34 antibody staining). YT-lndy based rCTL effector cell lines were created by first double-infecting unmodified YT-lndy cell lines with viral vectors produced using pMND-CD3 and pMND-CD8 plasmids at an MOI of 0.05 KlU / cell of each to yield the cell line “rCTL. empty”. Unsorted double-infected rCTL. empty cells were subsequently transduced with viral vector produced using pMND- TCR series plasmid-of-interest at an MOI of 0.05 KlU / cell. Purified rCTL.TCR cell lines were isolated by FACS to recover cells positive for CD3, CD8, and TCR (based on anti-CD3 and anti-CD8 antibody staining, and RFP expression). Primary TCR-T cells were created by transducing CD8+ T cells in conjunction with anti-CD3 / 28 stimulation (described above) with viral vector produced using pMND-TCR plasmid at an MOI of 30 KlU / cell. Purified TCR-Tcells were isolated by FACS to recover cells positive for recombinant TCR (anti-mouse TCR staining and RFP expression).

[0079] Granzyme FRET-shrf' t assay co-cultures. To prepare assay co-cultures, Target and Effector cells were each adjusted to a density of 2x106cells / mL in fresh, pre-warmed media and 100 pL of each were separately added to 2 individual wells of a 96-well U-bottom plate. To initiate co-culture, one pair of effector / target wells was mixed and re-distributed; the other well pair was left unmixed and combined immediately before flow cytometry to serve as a To loading control. Co-culture plate was placed in 37°C and 5% CO2 atmosphere incubator for designated co-culture time point. On conclusion of co-cultures, cells were stained on-plate with APC-conjugated anti-CD8 antibody, clone SK1 (Biolegend), and Fixable Viability Dye 780 (Thermo) for 15 minutes at 4°C before harvesting co-cultures, diluting in 5X volumes of cold PBS, centrifuging at 300 x g for 5 minutes, and resuspending in 300 pL of cold PBS per sample. Prepared co-culture samples were kept on ice and taken immediately for flow cytometry / FACS. Co-cultures were scaled for some experiments by preparing more U-bottom wells as needed (each well consisting of 1x105Targets and 1x105Effectors per well).

[0080] Flow cytometry / FACS. All flow cytometric analysis was performed on BD LSRII Fortessa and all cell sorting was performed on BD FACSAria Fusion. Relative cell number quantitation was performed by holding flow rate and acquisition time constant (along with resuspension volume in sample preparation). Gating was performed by monitoring eFluor 780 channel (ex. 640, em. 780 / 60 + 750LP), RFP channel (ex. 561 , em 610 / 20 + 600LP), YFP channel (ex. 488, em. 530 / 30 + 505LP), APC channel (ex. 640 / em. 670 / 14) and FRET channel (ex. 405, em. 525 / 50 + 505LP), and CFP channel (ex. 405, em. 450 / 50). For GZMB and PRF intracellular staining assays, cells were fixed and permeabilized using Biolegend reagents and manufacturer protocols.CassettesMaterials and Methods

[0081] Construction of minigene and HLA DNA vectors. The lentiviral transfer plasmid was derived from the commercially available pCCL-c-MNDU3-PGK-EGFP backbone. To produce an acceptor cassette for minigene sequences or HLA allele sequences, the PGK-EGFP portion of the plasmid was replaced with custom synthesized cassettes (IDT) to yield either the pMGI or pHLAI-FRET backbones by endonuclease cloning via Pacl / BamHI restriction cloning (acceptor cassettes were inserted into source plasmid via Bglll restriction site to ablate the source BamHI site). Minigenes were synthesized (IDT) and inserted in pMGI plasmid via l-Scel / PI-Scel restriction endonuclease cloning. Coding sequences for HLA alleles of interest were synthesized (IDT) and cloned into pHLAI-FRET vector via Nhel / Mlul restriction cloning.

[0082] Construction of TCR, CD3, and CD8 DNA vectors. The lentiviral transfer plasmid was derived from the commercially available pCCL-c-MNDU3-PGK-EGFP backbone. To produce an acceptor cassette for TCR, CD3, or CD8 sequences, the PGK-EGFP portion of the plasmid was replaced with custom synthesized cassettes to yield either the pMND-Multi backbone by endonuclease cloning via Pacl / BamHI restriction cloning (acceptor cassettes were inserted into source plasmid via Bglll restriction site to ablate the source BamHI site). TCRa-T2A-TCRp, CD8a-P2A-CD8|3, and CD35-E2A-CD3y-T2A-CD3£-P2A-CD3 sequences were synthesized (IDT) and cloned into pMND-Multi via Pacl / Ascl restriction cloning.Results

[0083] FIG. 2B shows the reconstitution of T-cell receptor (TCR) expression in exemplary YT Indy effector cells via transduction with helper cassettes to restore expression of TCR-a and TCR-p and CD3s, CD35, CD3y, CD3 . After transduction with the TCRa-2A-TCR -2A- RFP transgene along with helper cassettes encoding CD36-2A-CD3y-2A-CD3s-2A-CD3 and CD8a-2A-CD8p, surface expression of TCR was successfully detected using IP26 antibody (a) and Vb-13 antibody (c). Expression level of CD8 and CD3 (b) and TCR (c) matched or exceeded natural expression levels observed in peripheral human T cells.

[0084] FIGs. 2C and 2D show results for exemplary YT Indy effector cells transduced with a TCR sequence previously discovered in the ascites of a high-grade serous ovarian carcinoma patient (Wick et al., 2014) This TCR was found to be specifically responsive to a mutational neo-epitope arising from an L25V substitution in the amino acid sequence of hydroxysteroid dehydrogenase-like protein 1 (HSDL1). YT-lndy.HSDL1 (L25V)-TCR cells transduced with SEQ ID NO:16 were co-transduced with two lentivectors, one encoding allfour CD3 subunits separated by distinct 2A signal sequences (in the nature of SEQ ID NO: 14), and the other encoding the CD8a and CD8|3 genes separated by a 2A sequence (in the nature of SEQ ID NO: 12). K562 cells as exemplary reporter cells were transduced with HLA-C*14:03 (SEQ ID NO:1 but containing SEQ ID NO:17 within the variable HLA gene coding sequence at positions 8142-9236 of SEQ ID NO:1), which restricts the HSDL1 L25V reactive TOR, to generate a K562.C1403 reporter cell line. These cells were then transduced with pMGI library cassettes having wild-type (wt) (SEQ ID NO: 18) or L25V- mutated (SEQ ID NO:19) minigenes in place of the MAGEA3164'179minigene at positions 2- 49 of SEQ ID NO:2 followed by a 2A site and a granzyme-cleavable FRET-reporter to produce KFRET.C1403.HSDL14’43.wt and KFRET.C1403.HSDL14’43.L25V cell lines. These reporter cells were co-cultured with the YT-lndy.HSDL1 (L25V)-TCR cells and then analyzed by flow cytometry, with the results shown in FIGs. 20 and 2D. Robust FRET-shift signal was detected in L25V minigene-expressing cells when co-cultured with YT-rCTL.HSDL1 cells, while no appreciable signal was detected in targets expressing wt minigene.

[0085] With reference to FIGs. 2C and 2D, YT-rCTL expressing the HSDL1 L25V mutant- reactive TOR were co-cultured with mutant minigene-expressing KFRET. C1403.HSDL14-43.L25V cells or the wild-type counterpart KFRET.C1403.HSDL14-43.wt cells at 1 :1 effectontarget ratios for 4 or 12 h. Matched To control co-cultures were also assembled and analyzed for each condition. Representative assay responses are shown in FIG. 20. Data from three independent replicate experiments indicate statistically significantly higher percent FRET-shift signal in mutant minigene co-cultures compared to wild-type minigene (***p < 0.005 by unpaired two-sample f-test) and in mutant minigene co-cultures at the 12 h time point compared to shorter 4 h experiments (**p < 0.01 by unpaired two-sample f-test) (FIG. 2D). For the results shown in FIGs. 2E and 2F, YT-rCTL effector cells expressing the MAGEA3 reactive EB81.103 TOR (SEQ ID NO: 15) were co-cultured with KFRET. A0101 reporter cells transduced with SEQ ID NO:1 and SEQ ID NO:2, KFRET.A0101 (2B10) epitope knockout cells transduced with SEQ ID NO:1 and SEQ ID NO:2 but with expression of the MAGEA3 protein of the K562 cells knocked out via CRISPR editing, or epitope reintroduced KFRET.AO1O1 (2B1O).MAGEA3143'202cells containing SEQ ID NO:1 and SEQ ID NO:21 as the minigene at positions 2-49 of SEQ ID NO:2 at 1 :1 effectortarget ratios for 12 h. Matched To control co-cultures were also assembled and analyzed for each condition. Representative assay responses are shown in FIG. 2E. Data from three independentreplicate experiments indicate statistically significantly higher percent FRET-shift signal in KFRET.A0101 (*p < 0.05 by unpaired two-sample f-test) and KFRET.AO1O1 (2B1 O).MAGEA3143'202(***p < 0.005 by unpaired two-sample f-test) compared to MAGEA3 epitope knockout cells. All bar heights and error bars represent mean ± standard deviation.

[0086] In more detail, the inventors further validated antigen-specificity in the exemplary YT- rCTL / K562-FRET system using a melanoma-reactive TCR, clone 103 from patient EB81 , here shortened to EB81.103 (Karanikas et al., 2003), responsive to a previously characterized peptide epitope (EVDPIGHLY) derived from the human MAGEA3 protein presented in the context of the HLA-A*01 :01 allele. The inventors created a new version of YT-rCTL cells by transducing the EB81.103 TCR (SEQ ID NO:15) into pre-made CD8a|3+, CD36ys+TCRaP' YT-lndy cells (to create YT-rCTL.EB81 .103) and a new K562 subline encoding the HLA-A*01 :01 sequence bicistronically linked to the GZMB FRET-reporter (SEQ ID NO:1) as well as SEQ ID NO:2 (to create KFRET.A0101). As the K562 cell line expresses the MAGEA3 oncogene naturally, the inventors disrupted the EVDPIGHLY epitope within the endogenous MAGEA3 gene using CRISPR / Cas9 editing. Single cell cloned MAGEA3 mutant K562.A0101 (clone 2B10), when co-cultured with YT- rCTL.EB81.103 showed a significant reduction in FRET-shift signal consistent with ablation of the endogenous epitope. Reintroduction of agonistic epitope by lentiviral transduction of a minigene encoding the MAGEA3143'202peptide fragment (i.e. SEQ ID NO:21 as the minigene at positions 2-49 of SEQ ID NO:2) into 2B10 knockout cells resulted in rescue and significant increase of FRET-shift signal relative to endogenous antigen (FIGs. 2E and 2F). Notably, FRET-shift signal developed in YT-rCTL co-culture with KFRET.AO1O1 (2B1 O).MAGEA3143'202closely mirrored that from primary TCR-T cell effectors.

[0087] Taken together, these data indicate that reconstitution of the TCR / CD3 complex in the GZMB / PRF competent natural killer cell-origin immortalized cell line, YT-lndy, induces antigen-specific cytotoxic responses against K562 based target reporter cells only in the presence of an MHC and peptide epitope combination cognate to the recombinant T-cell receptors-of-interest. The inventors have shown in the contexts of mutational neoantigens or overexpressed self-antigens, and in different HLA alleles, that the YT-rCTL / K562-FRET system is a highly selective platform for biologically relevant detection of TCR interactions.

[0088] The sequences of the constructs used to generate the exemplary effector cells and reporter cells used in the examples herein include:• pCCL-c-MNDU3-HLA-2A-ECFP-GZMB.substrate-EYFP (a lentiviral transfer vector containing a HLA coding sequence separated by a 2A signal form a GZMB- cleavable mCeruleanFP / EYFP FRET-reporter for co-expressing HLA class I genes- of-interest and granzyme-B cleavable FRET reporter sequence in synthetic reporter cells) (SEQ ID NO:1) [pHLAI-A0101-FRET]• pCCL-c-MNDU3-minigene-IRES-RFP (for expressing short peptide-coding minigene sequences appended with proteasomal targeting motifs along with an independently expressed RFP transduction marker in synthetic reporter cells, downstream separated by an IRES element is the mStrawberryFP transduction marker) (SEQ ID NO:2) [pMGI-MAGEA3], This construct includes as the minigene at positions 2-49 the MAGEA3164'179peptide fragment. Variants of this construct were made having the MAGEA3160'183peptide fragment (SEQ ID NQ:20) or the MAGEA3143'202peptide fragment (SEQ ID NO:21) instead of MAGEA3164'179at positions 2-49 and different constructs were used in different experiments, but no significant differences between these three minigenes were observed.• pCCL-c-MNDU3-CD35-2A-CD3y-2A-CD3E-2A-CD3 (for co-expressing all 4 critical CD3 subunits in effector cells) (SEQ ID NO:14) [pMND-CD3]• pCCL-c-MNDU3-CD8a-2A-CD8p (for co-expressing the CD8 co-receptor complex (alpha and beta) subunits in effector cells) (SEQ ID NO:12) [pMND-CD8]• pCCL-c-MNDU3-TCRa-2A-TCR|3-2A-RFP (for co-expressing TCR genes-of-interest to be interrogated via resurrection in effector cells) (SEQ ID NO:13) [pMND- abTCR(WT-A3)]. This construct was modified as appropriate to express different TCR alpha ane beta inserts as desired, including to make pMND-EB81-103-TCR, SEQ ID NO:15 and pMND-HSDL1-TCR, SEQ ID NO:16.of Lentiviral DNA bv YT Indv Cells

[0089] As shown in FIG. 4A, lentiviral vector uptake by YT Indy cells is three orders of magnitude more efficient in YT Indy cells as compared with primary T-cells. TCR-2A-RFP encoding lentiviral vector was functionally titered over YT-lndy cells by adding increasingamounts of virus to a fixed number of cells in a fixed volume. The resulting fluorescence was measured by flow cytometry 72 hours later. The proportions of positive cells in each condition were fit to a Poisson probability mass function by nonlinear least squares regression to determine a functional titer of 4.55 x 105infectious units / pL against YT-lndy (left panel), with a standard error of 1 .00 x 105, t value of 45.47 and Pr(> 11|) of 0. The same virus was also applied to an activated and proliferating culture of human T-cells. In this experiment 150 pL of viral vector was added to 5x105T-cells to yield a transduction efficiency of 13.47% (right panel). Applying Poisson probability to this result and accounting for input cell and virus quantities, the same product had an effective functional titer of 483 infectious units / pL against T-cells.

[0090] As shown in FIG. 4B, a small-scale process for transducing YT Indy cells with a plurality of lentiviral vectors encoding different TCRs is illustrated. By way of example only, in some embodiments, a typical full scale virus run can yield 2.5x108- 5x108infectious units as titered over K562 standards (which would equate to 8x106- 1 .6x107infectious units per run over T cells [30X fewer units] versus 7.5x109- 1.5x101° infectious units on YT-lndy cells [30X more units] given the higher level of lentiviral DNA uptake by the latter). In one specific example, this typical virus production run is done using 900 cm2of HEK-293T producer cells; the surface area of a single well of a flat bottom 96-well plate well is 0.3 cm2(1 / 3000thof full scale run). Extrapolating these observed quantities, 2.5x106- 5x106YT Indy infectious units would be expected in a volume of 160 pL of supernatant. This would allow for transduction of 1x105YT-lndy cells with 3x105infective units (which would statistically result in a 95% pure transduced population) by transferring a volume of supernatant <160 pL, whereas scaling down virus production to 0.3 cm2scale (a single well of a 96-well plate) would yield 2.5x103- 5x103infective units when considering primary T-cells. Thus, the maximum number of T-cells that could be transduced at the same level as YT-lndy cells above would be approximately 1 ,000 - 2,000 cells. Given that T cells have a limited expansion capacity, such a system is not practical for making libraries of cytotoxic effectors using T-cells, but becomes effective if YT-lndy cells are used.

[0091] In another embodiment, large scale bulk preparation of a lentiviral vector encoding a TCR is combined with cells that overexpress the LDL receptor such as YT Indy cells in a one pot step to create a bulk library. With reference to Table 1 , previous benchmark yields of colony-forming units (CFU) and K562-infecting units (Kill) resulting from normal-scaleDNA and viral vector production runs enable library diversity of up to 70 million unique library sequences represented in 200 - 300 million infectious units of viral vector. Delivery of high-diversity TCR libraries to primary T cells must contend with the main bottleneck of lentivirus transduction efficiency; in order to achieve an effective multiplicity of infection (MOI) = 1 , 30 KlU / cell of viral vector must be applied to cells. Thus, given a standard size library vector production run and an input library richness of 35 million unique sequences, a maximum of 20% library coverage is achievable without scale-up (expecting a 67% transduction efficiency based on Poisson distribution). In contrast, complete delivery of a high-diversity TCR library to YT-lndy based rCTL could be expected from using <5% of the virus produced in a single standard production run.Table 1. YT-lndy Based Synthetic Effector Cell System Alleviates Bottlenecks Associated with Bulk TCR Library Recombinant Expression.* This scale selected as a practical maximum because this number approximately represents the largest number of cells that would feasibly be FACS purity sorted in a single session.Example 3 - Genetic Modification of Effector Cells and Reporter Cells to Optimize FRET- Shift FACS Recovery and Increase Safe Sorting WindowMaterials and Methods

[0092] Construction of survival cassette and miRNA DNA vectors. The lentiviral transfer plasmid was derived from the commercially available pCCL-c-MNDU3-PGK-EGFP backbone. To produce the Golden Gate enabled destination vector, a synthetic DNA fragment comprising aLacZ and a Golden Gate cassette was inserted into Clal / Kpnl- linearized pCCL-c-MNDU3-PGK-EGFP using Gibson assembly to yield pMLV1-Destination plasmid. Golden Gate parts encoding survival cassette or perforin miRNA components were in silico designed to remove Type Ils restriction sites and any naturally occurring predicted caspase and granzyme cleavage sites, as well as predicted ubiquitination sites, and synthesized (Twist). The pSurvival and pMIR series of plasmids were then created by combining the appropriate synthesized DNA parts with pMLV1 -Destination in PaqCI-based Golden Gate assembly reactions.Results

[0093] With reference to FIGs. 5A, 5B, 5C and 5D, results from an experiment in which the effector cells and reporter cells have not been genetically modified to inhibit the apoptosis of the reporter cells is illustrated. Timecourse monitoring of FRET-shift signal and reporter cell killing was carried out. Unmodified YT-lndy cells (FIG. 5A), primary CD8 T cells, transduced with a test TCR, a3a (Cameron et al., 2013) and expanded from human peripheral blood mononuclear cells by anti-CD3 / 28 + IL2 stimulation (FIG. 5B), and YT-lndy-based effector cells expressing the a3a TCR (FIG. 5C) were co-cultured with K562-based sAPC expressing HLA-A*01 :01 coding sequence and a minigene encoding amino acid positions 164-179 of the human protein, MAGE-A3 as in SEQ ID NO:2 at an effectontarget ratio of 0.5:1 as the reporter cells. Three parameters were simultaneously monitored at hourly time points: %FRET-shift signal (indicative of GZMB delivery to and activity in target cells), %apoptotic target cells as measured by cell membrane impermeant vital staining, andrelative cell count compared to parallel mock co-cultures with no effector cells. Reporter cells remain largely intact and FACS-sortable when exposed to TCR-transduced primary cytotoxic T cells, supporting the observation of safe sorting window previously disclosed by the inventors. Reporter cells begin to drop out of co-culture almost immediately upon exposure to YT-lndy based rCTL cells and only approximately 50% remain at the 12 hour mark, indicating that these co-cultures follow different apoptosis kinetics than primary T cell / K562 co-cultures. FIG. 5D shows data for percent FRET-shift signal and percent survival of the target reporter cells (live target reporter cell counts normalized to matched To control) for the YT-lndy-based effector cells expressing the a3a TOR co-cultured with K562-based sAPC shown in FIG. 5C, although on a linear scale rather than the logarithmic scale shown in FIG. 5C. Data are from three independent replicate experiments.

[0094] With reference to FIG. 6, the inventors have demonstrated that YT-lndy based effector cells, at rest, store approximately 70 times more granzyme B and 40 times more perform protein than do primary cytotoxic T-cells. Intracellular staining flow cytometry of granzyme B (GZMB) and perforin in different effector cells was carried out. Primary CD8 T cells, transduced with the a3a TCR and expanded from human peripheral blood mononuclear cells by anti-CD3 / 28 + IL2 stimulation, and YT-lndy based effector cells expressing the a3a TCR were fixed, permeabilized, stained with anti-granzyme B monoclonal antibody (left panel) and anti-perforin monoclonal antibody (right panel). In parallel, Raji cells (a B cell line) were used as a negative staining control. The mean fluorescence intensity (MFI) of each peak is labeled and used as a measurement of internal GZMB and perforin stores in each cell type. Peaks observable in FIG. 6 are, from left to right, Raji-RFP, primary CD8+ a3a TCR-T cells, and YT-lndy-rCTL.a3a cells. The data indicate that YT-lndy based effector cells store approximately 70X more perforin and 40X more GZMB than activated proliferating primary cytotoxic T cells. Based on the observation that YT-lndy based effector cells have higher levels of perforin and granzyme B, without being bound by theory, it is anticipated that reducing expression of these proteins in effector cells such as YT-lndy cells in particular may help to attenuate apoptosis in reporter cells and thereby increase the safe sorting window.

[0095] The inventors have prepared a series of DNA cassettes in lentiviral vector plasmids, referred to as survival cassettes, to enable further characterization of the effects of attenuating the apoptotic pathway on the safe sorting window, including:• pCCL-c-MNDU3-BCL2-2A-XIAP-2A-MCL1-tCD34-WPRE (SEQ ID NO:3) (for coexpressing three anti-apoptotic genes-of-interest in reporter cells and containing synthetic coding sequences of XIAP, BCL2, and MCL1 genes). Constructs were created by engineering reference sequences to remove putative serine protease cleavage motifs and ubiquitination sites; and truncated CD34 is included as an inert, stainable marker to be used for purifying transduced cells.• pCCL-c-MNDU3-XIAP-2A-BCL2-IRES(VCIP)-tCD34-2A-MCL1 -WPRE (SEQ ID NO:4) (alternative configuration of survival cassette including an IRES sequence in place of 2A sequence to avoid effects from a C-terminal molecular scar in recombinant BCL2 proteins).• pCCL-c-MNDU3-XIAP-2A-BCL2-IRES(EMCV)-tCD34-2A-MCL1-WPRE (alternative form of IRES) (SEQ ID NO:5)• pCCL-c-MNDU3-tCD34-miRNA-WPRE (SEQ ID NO:6) (Six variants of this vector have been prepared to knock down expression of perforin in the effector cells, each with a different in silico designed miRNA sequence at positions 5967-6026 of SEQ ID NO:6 having the indicated sequence below for knock-down optimization to target different portions of the perforin mRNA transcript since different miRNA constructs targeting the same gene may have different efficacy and it is common to screen multiple miRNA constructs to find one with good efficacy against the target gene of interest): o PRF miRNAI = GTTCAGTG G AG CTG ACTTTG G CGTTTTG G CCACTG ACTG ACG CCAAAGTG C TCCACTGAA (positions 5967-6026 of SEQ ID NO:6) o PRF miRNA2 = GTTGGAGATAAGCCTGAGGTAGGTTTTGGCCACTGACTGACCTACCTCACT TATCTCCAA (SEQ ID NO:7) o PRF miRNA3 = GAACAGCAGGTCGTTAATGGAGGTTTTGGCCACTGACTGACCTCCATTAGA CCTGCTGTT (SEQ ID NO:8) o PRF miRNA4 =G AAG AGCTTCACATAG G CATCCGTTTTG G CCACTG ACTG ACG GATG CCTGT GAAGCTCTT (SEQ ID NO:9) o PRF miRNA5 = GAGTCCAAGCATACTGGTCCTTGTTTTGGCCACTGACTGACAAGGACCAAT GCTTGGACT (SEQ ID NO: 10)o PRF miRNA6 =GTTTATTGGCCCTTTATCAAGCGTTTTGGCCACTGACTGACGCTTGATAGGG CCAATAAA (SEQ ID NO:11)

[0096] With reference to FIG. 7, the inventors have demonstrated that genetic modification of antigen-presenting reporter cells using exemplary survival cassettes to express anti- apoptotic genes increases the resistance of the reporter cells to granzyme B induced cell death. Three separate K562-based reporter cells expressing genetically-encoded HLA- A*01 :01 and MAGE-A3(164-179) peptide were created by additionally encoding one of three different survival cassette configurations (SEQ ID NO:3 [pSurvivall ], SEQ ID NO:4 [pSurvival2] and SEQ ID NO:5 [pSurvival3]), all including the human genes XIAP, MCL1, and BCL2 expressed as exemplary anti-apoptotic genes. K562 cells are devoid of natural BCL2 expression, and the inventors hypothesized that BCL2 protein replacement would result in decreased granzyme / perforin induced cell death. MCL1 is another anti-apoptotic member of the BCL2 protein family that is known to be directly degraded by granzyme B, and the inventors hypothesized that the addition of a constitutively active MCL1 gene would function to replace protein turned over by GZMB activity. XIAP is a member of the IAP family of proteins, and is a direct inhibitor of late-apoptosis executioner caspases. Thus, without being bound by theory, the inventors selected anti-apoptotic genes for expression in the reporter cells based on their mechanism of action, such as replacing anti-apoptotic proteins poorly expressed in the reporter cells, replacing proteins that are directly degraded / turned over by granzyme in the reporter cells, and / or bolstering proteins known to inhibit the most downstream effector molecules of apoptosis.

[0097] Three separate constructs having different configurations for encoding all three selected proteins were designed, as summarized in Table 2. First, a polycistronic gene cassette consisting of all genes separated by 2A ribosomal-skipping sequences and linked to a truncated CD34 gene for use as a surface stainable marker of transduction. Without being bound by theory, since 2A sequences result in a C-terminal molecular scar in expressed protein and since both BCL2 and MCL1 are membrane-anchored via C-terminal transmembrane domains, the inventors suspected function of both proteins may have been impaired if placed upstream of a 2A sequence. Therefore, the second and third configurations were constructed using internal ribosomal entry site (IRES) sequences,instead of 2A sequences, from either encephalomyocarditis virus (ECMV) or the human VCIP gene (Table 2).Table 2. Summary of Survival Cassettte Designs for Reporter Cells.

[0098] The Survival and Survivals cassettes led to statistically significant prevention of cell dropout but no statistically significant decrease in FRET-shift signal. The Survivall cassette did not lead to significant protection of the target cells, suggesting without being bound by theory that BCL2 is likely partially dampened by the presence of a 2A-derived C-terminal scar, as suspected. Survival resulted in higher survival (>85% cells remaining) than Survivals which, since VCIP IRES has been shown to result in higher expression of the downstream transcripts relative to ECMV IRES, is suggestive of a contributing role of the MCL2 gene in the Survival cassette design. Additionally, XIAP has been shown to inhibit certain members of the caspase protein family, suggesting that knocking down caspase expression in the reporter cells may also provide a way to protect target reporter cells from apoptosis.

[0099] Each of the tested reporter cell lines, along with an empty vector control, were cocultured with YT-lndy-based effector cells expressing the a3a TCR at a 1 :1 effectontarget ratio for 20 hours. Viable remaining reporter cells were quantified in flow cytometry and compared to non-co-cultured To controls to assess relative cell survival. Percent FRET-shift signal and percent survival are displayed in FIG. 7 (**p < 0.01 and *p < 0.05 relative to control by unpaired two-sample t-test, respectively). FRET-shift signal was not statistically significantly different between control targets and any of the survival cassette targets. As expected, control reporter cell populations experienced large cell dropout on prolonged exposure to cytotoxic effector cells. Reporter cells harboring survival cassettes show, in some configurations, significant or nearly complete preservation of the cells throughout the treatment period, demonstrating that expression of anti-apoptotic genes in the antigen-presenting reporter cells can increase the survival of the reporter cells after exposure to the effector cells, which will increase the safe sorting window for such reporter cells.

[0100] With reference to FIG. 8, the inventors have demonstrated that genetic modification of cytotoxic lymphocytes using perforin-targeting miRNA also increases the resistance of the reporter cells to granzyme B induced cell death. The inventors tested three different constructs, SEQ ID NO:6 [pMIR-PRF] and two variants thereof encoding alternative miRNA constructs targeting perforin, SEQ ID NO:7 [PRFmiRNA2], and SEQ ID NO:8 [PRFmiRNA3], K562-based reporter cells expressing genetically-encoded HLA-A*01 :01 and MAGE-A3(164-179) peptide were co-cultured with YT-lndy-based cytotoxic lymphocytes expressing the a3a TCR and further modified by stably integrating, via lentiviral transduction, each of 3 different designed miRNA sequences at an MOI = 1 . Cocultures were assembled at a 1 :1 effectontarget ratio and incubated for 6 hours. Viable remaining sAPC cells were quantified in flow cytometry and compared to non-co-cultured To controls to assess relative cell survival. The PRF miRNA2 experimental condition showed a statistically significantly higher percentage of surviving cells than either PRF miRNAI or 3 (p< 0.05 and p< 0.005, respectively), both of which had an equivalent or slightly higher levels of survival compared to the scrambled miRNA negative control, and PRF miRNA2 resulted in a statistically significant increase in percent survival relative to control (**p < 0.01 by unpaired two-sample f-test). There were no statistically significant changes in FRET-shift signal in all groups, indicating that reduction in cell dropout was not linked to a loss of GZMB delivery.

[0101] Three additional variations on SEQ ID NO:6 [pMIR-PRF], having SEQ ID NOs.:9-11 encoding alternative miRNA sequences targeting perforin, have been prepared by the inventors and will be used to carry out similar studies to investigate the effects of using miRNA to interfere with apoptosis in target cells.

[0102] The inventors also investigated a combination of both strategies of increasing expression of anti-apoptotic proteins in the target antigen-presenting cells and knocking down perforin in the cytotoxic lymphocytes, using the best-performing modification from each of the above-described examples. Co-culture combinations of YT-rCTL.a3a.PRF- miRNA2 (SEQ ID NOT) cytotoxic lymphocytes and KFRET.A0101 ,MAGEA3160’183.Survival2 (SEQ ID NO:2 containing SEQ ID NQ:20 as the minigene instead of positions 2-49 for expressing the MAGEA3164'179peptide fragment in combination with SEQ ID NO:4) antigen-presenting reporter cells were assembled and monitored with respect to percent survival and FRET-shift signal at 24 h, 48 h, and 72 h time points (FIGS. 9A and 9B). Bars from left to right show data for PRFmiRNA27Survival2‘ cells, PRFmiRNA2+ / Survival2‘ cells, PRF miRNA27Survival2+cells, and PRF miRNA2+ / Survival2+cells These data confirm that the survival cassette was nearly completely effective at averting cell death and dropout in the first 24 hours. The inventors also noted that despite nearly total destruction of target cells in the unmodified control conditions after 48 and 72 hours (<20% and <10% of cells remained, respectively), a significant fraction of target cells remained in the survival cassette conditions after 48 and 72 hours (>75% and >55%, respectively). Knockdown of PRF did not appear to enhance this effect although application of PRF miRNA alone did achieve statistically significant (p < 0.05) protection at all time points.

[0103] Based on these data, it can be concluded that granzyme-loaded target antigen presenting reporter cells could be preserved in culture within a safe-sorting window of up to 24 hours post co-culture initiation with cytotoxic lymphocytes. This result allows for the functional screening of high diversity antigen libraries by FRET-shift-based FACS isolation of targeted cells and characterization of these cells by DNA sequencing or other methods.Example 4 - Direct Culture and Biopanning of Targeted Cells for Iterative Re-Screening

[0104] With reference to FIGs. 10A, 10B and 10C, the inventors conducted outgrowth of FRET-shifted reporter cells after their recovery by FACS in one example embodiment. The inventors have observed that a fraction of K562-based reporter cells exposed to YT-lndy based effector cells for 12 hours and loaded with granzyme B, as determined by FRET- reporter status, survive this exposure and are able to resume proliferating.

[0105] YT-lndy-based effector cells expressing the a3a TCR and K562-based reporter cells expressing genetically-encoded HLA-A*01 :01 and MAGE-A3(164-179) peptide were cocultured at a 1 :1 effectontarget ratio for 12 hours. Reporter cells undergoing FRET-shift were isolated by FACS. Recovered cells were immediately assessed for purity by flow cytometry and were determined to be 100% free of any contaminating effector cells (FIG. 10A) or contaminating non-FRET-shifted target cells (FIG. 10B). Recovered FRET-shifted cells (3.25 x 105) were placed into fresh culture media and counted at regular intervals. Cell counts initially declined and reached a minimum total cell count of 2.14 x 105by day 4, butsubsequently reversed their decline and followed an exponential growth curve post-day 4 (FIG. 10C).

[0106] This example demonstrates that antigen-presenting cells that express an epitope of interest can be sequentially detected, separated from the cytotoxic lymphocyte effector cells, proliferated, and re-assessed for expression of the epitope of interest to enrich the number of cells expressing the epitope of interest, which can help to reduce the incidence of false positive results and increase confidence in identified epitopes of interest.

[0107] While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain modifications, permutations, additions and sub-combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications, permutations, additions and sub-combinations as are consistent with the broadest interpretation of the specification as a whole.References

[0108] The following references are of interest with respect to the subject matter described herein. Each of the following references is incorporated by reference in its entirety herein.• Cameron et al., Sci Transl Med. 2013 Aug 7;5(197):197ra103. doi: 10.1126 / scitranslmed.3006034.• Finkelshtein et al. , PNAS 110(18)7306-7311 , 2013. doi: 10.1073 / pnas.1214441110• Holt et al. WO 2015 / 143558• Hrdinka and Yabal, Genes & Immunity 20, 641-650 (2019).• Karanikas et al., J. Immunol. 171 , 4898-4904 (2003).• Kesavardhana et al., Ann. Rev. Imm. 38, 567-595, 2020.• Linnemann et al., Nat Med. 2015 Jan;21 (1):81-5. doi: 10.1038 / nm.3773.• Lopez et al., Blood. 2013 Apr 4;121 (14):2659-68. doi: 10.1182 / blood-2012-07- 446146. Epub 2013 Feb 1.• Montel et al., Cellular Immunology 160:104-114, 1995.• Qian et al., Front. Oncol., 12 - 2022, https: / / doi.org / 10.3389 / fonc.2022.985363• Sharma, G. PhD. Thesis, The University of British Columbia, December 2018. DOI: 10.14288 / 1.0375763.• Sharma et al., Nature Communications (2019)10:4553, https: / / doi.Org / 10.1038 / S41467-019-12444-7. • Sharma et al., npj Precis. One. (2024) 8:182, https: / / doi.org / 10.1038 / s41698-024-00669-9.• Tang and Tang, R Soc Open Sci. 2018 Sep 19;5(9):180442. doi: 10.1098 / rsos.180442.• Wick et al., Clin. Cancer Res. 20, 1125-1134 (2014). • Youle, R., Strasser, A. Nat Rev Mol Cell Biol 9, 47-59 (2008). https: / / d0i.0rg / l 0.1038 / nrm2308

Claims

CLAIMS:1 . A method of detecting that an epitope is recognized by a cytotoxic lymphocyte, the method comprising steps of: exposing antigen-presenting cells to the cytotoxic lymphocyte, wherein at least some of the antigen-presenting cells express the epitope; wherein the antigen-presenting cells express a signaling system that generates a signal whenever a peptide linkage in the corresponding antigen-presenting cell is enzymatically cleaved by a serine protease from granules of the cytotoxic lymphocyte upon recognition of the epitope by the cytotoxic lymphocyte; isolating the antigen-presenting cells generating the optical signal; and delaying apoptosis of the isolated antigen-presenting cells.

2. The method as defined claim 1 , wherein the step of delaying apoptosis of the antigen-presenting cell comprises using a genetically modified antigen-presenting cell that has been engineered to have enhanced survival upon exposure to the serine protease.

3. The method as defined in claim 2, wherein the step of delaying apoptosis of the antigen-presenting cell comprises using a genetically modified antigen-presenting cell that has been engineered to express or overexpress at least one anti-apoptotic gene.

4. The method as defined in claim 3, wherein the anti-apoptotic gene is an anti- apoptotic member of the Bcl-2 family or an IAP family member protein, optionally one or more of XlAP, MCL1 , BCL2, BCL-XL, BCL-W, A1 / BCL-2A1 / BFL-1 , BFL-1 , XIAP, NAIP, clAP1 , clAP2, Survivan, Apollon / Bruce, ML-IAP and ILP2 / TS-IAP.

5. The method as defined in claim 4, wherein the anti-apoptotic gene is one or more of XIAP, BCL2 and MCL1, optionally all of XIAP,BCL2 and MCL1.

6. The method as defined in any one of claims 1 to 5, wherein the step of delaying apoptosis of the antigen-presenting cell comprises using a genetically modifiedantigen-presenting cell that has been engineered to knock-down one or more pro- apoptotic genes.

7. The method as defined in claim 6, wherein the one or more pro-apoptotic genes are pro-apoptotic members of the Bcl-2 family or caspases, optionally one or more of BAX, BAK, BOK, BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK, MULE, caspase-2, caspase-8, caspase-9, caspase-10, caspase-3, caspase-6 and caspase-7.

8. The method as defined in any one of claims 1 to 5, wherein the step of delaying apoptosis of the antigen-presenting cell comprises using a genetically modified cytotoxic lymphocyte that has been engineered to have attenuated effector functions.

9. The method as defined in claim 8, wherein the cytotoxic lymphocyte has been genetically engineered by the introduction of miRNAs and / or siRNAs to the cytotoxic lymphocyte, optionally to facilitate perforin knockdown in the cytotoxic lymphocyte, and / or optionally to facilitate knockdown of granzyme in the cytotoxic lymphocyte.

10. The method as defined in any one of claims 1 to 9, wherein the step of using a genetically modified cytotoxic lymphocyte that has been engineered to have attenuated effector functions comprises using a YT-lndy cell as the cytotoxic lymphocyte.1 1. The method as defined in any one of claims 1 to 10, wherein the step of delaying apoptosis of the isolated antigen-presenting cells comprises treating the antigen- presenting cells or the cytotoxic lymphocytes with a pharmacological agent that inhibits the apoptosis pathway, optionally wherein the pharmacological agent comprises VAD-FMK, isatin sulfonamide 16, BI-6C9, AG9 monoclonal antibody, or MnTBAP.

12. An antigen-presenting cell that has been genetically modified to have enhanced survival upon exposure to a serine protease.

13. The antigen-presenting cell as defined in claim 12, wherein the genetic modification comprises overexpression of one or more anti-apoptotic genes, optionally anti- apoptotic members of the Bcl-2 family or IAP family member proteins, optionally one or more of XlAP, MCL1 , BCL2, BCL-XL, BCL-W, A1 / BCL-2A1 / BFL-1 , BFL-1. XIAP, NAIP, clAP1 , clAP2, Survivan, Apollon / Bruce, ML-IAP and ILP2 / TS-IAP further optionally one or more of XIAP, BCL2 and MCL1, optionally all of XIAP, BCL2 and MCL1.

14. The antigen-presenting cell as defined in either one of claims 12 or 13, wherein the genetic modification comprises knock-down of pro-apoptotic genes, wherein the pro- apoptotic genes are optionally pro-apoptotic members of the Bcl-2 family or caspases, optionally one or more of BAX, BAK, BOK, BCL-XS, BID, BIM / BOD, BAD, BMF, NOXA, HRK / DP5, PUMA / BBC3, BIK / BLK / NBK, MULE, caspase-2, caspase-8, caspase-9, caspase-10, caspase-3, caspase-6 and caspase-7.

15. A cytotoxic lymphocyte engineered to have attenuated effector functions, optionally wherein the cytotoxic lymphocyte has been genetically engineered by the introduction of miRNAs and / or siRNAs to the cytotoxic lymphocyte, optionally to facilitate perforin knockdown in the cytotoxic lymphocyte.

16. A method of detecting that an epitope is recognized by a cytotoxic lymphocyte, the method comprising steps of: exposing antigen-presenting cells to the cytotoxic lymphocyte, wherein at least some of the antigen-presenting cells express the epitope; wherein the antigen-presenting cells express a signaling system that generates a signal whenever a peptide linkage in the corresponding antigen-presenting cell is enzymatically cleaved by a serine protease from granules of the cytotoxic lymphocyte upon recognition of the epitope by the cytotoxic lymphocyte; isolating the antigen-presenting cells generating the optical signal to yield a pool of positive antigen-presenting cells that express the epitope; proliferating the isolated pool of positive antigen-presenting cells in fresh media; andrepeating the steps of exposing the antigen-presenting cells to the cytotoxic lymphocyte and isolating the antigen-presenting cells generating the optical signal.

17. A method of selecting reporter cells that are resistant to the initiation of apoptosis by cytotoxic lymphocyte cells comprising: conducting a method as defined in claim 16 for a plurality of cycles; and selecting the antigen-presenting cells generating the optical signal as having increased resistance to the initiation of apoptosis by the effector cells.

18. A library of cytotoxic lymphocytes, each one of the cytotoxic lymphocytes expressing at least one of a plurality of T-cell receptor (TCR) sequences, wherein: the cytotoxic lymphocytes comprise cells expressing the LDL receptor at a higher level than native T-cells, optionally YT-lndy cells; and each one of the cytotoxic lymphocytes comprises a corresponding one of a plurality of lentiviral DNA vectors encoding the plurality of TCR sequences.

19. The library as defined in claim 18, wherein the cytotoxic lymphocytes are capable of expressing CD35, CD3y, CD3s and CD3 .

20. The library as defined in either one of claims 18 or 19, wherein the cytotoxic lymphocytes are capable of expressing CD8a and CD8|3.21 . A method of producing a library of cytotoxic lymphocytes expressing a plurality of T- cell receptor (TCR) sequences, the method comprising the steps of: providing cells that express the LDL receptor at a higher level than native T-cells, optionally YT-lndy cells, as the cytotoxic lymphocytes; and transducing the cytotoxic lymphocytes with a library of a plurality of lentiviral DNA vectors encoding the plurality of TCR sequences, so that each one of the cytotoxic lymphocytes in the library of cytotoxic lymphocytes is transduced with a corresponding one of the plurality of lentiviral DNA vectors.

22. The method as defined in claim 21 , wherein the cytotoxic lymphocytes are capable of expressing CD35, CD3y, CD3s and CD3 .

23. The method as defined in any one claims 21 or 22, wherein the cytotoxic lymphocytes are capable of expressing CD8a and CD8|3.

24. The method as defined in any one of claims 21 to 23, wherein the library of cytotoxic lymphocytes encodes at least 30 million unique TCR sequences.

25. The method as defined in any one of claims 21 to 24, wherein the library of cytotoxic lymphocytes encodes at least 50 million unique TCR sequences.

26. A kit comprising: a first DNA construct encoding an HLA allele positioned for co-expression with a cleavable FRET-reporter protein, the HLA allele and the cleavable FRET- reporter protein being separated by a peptide cleavage sequence; and a second DNA construct encoding a putative T-cell receptor (TCR) epitope.

27. The kit as defined in claim 26, wherein the second DNA construct further encodes a transduction marker.

28. The kit as defined in claim 27, wherein the transduction marker comprises a gene for expressing a fluorescent protein.

29. The kit as defined in the any one of claims 26 to 28, wherein the second DNA construct further encodes a motif that increases the likelihood the expressed putative TCR epitope will be tagged for degradation, optionally wherein the motif comprises a ubiquitination motif and / or a C-degron motif.

30. The kit as defined in claim 29, wherein the transduction marker is separated from the putative TCR epitope by a peptide cleavage sequence.31 . The kit as defined in any one of claims 26 to 30, wherein the peptide cleavage sequence in the first DNA construct comprises a 2A peptide cleavage sequence.

32. The kit as defined in any one of claims 26 to 31 , wherein the peptide cleavage sequence in the second DNA construct comprises an IRES peptide cleavage sequence.

33. The method as defined in any one of claims 1 to 11 or 16 to 17, wherein the signaling system comprises an optical signaling system that generates an optical signal whenever the peptide linkage in the corresponding antigen-presenting cell is enzymatically cleaved by a serine protease from granules of the cytotoxic lymphocyte upon recognition of the epitope by the cytotoxic lymphocyte.

34. The method as defined in claim 33, wherein the optical signal is a FRET-shift.

35. The method as defined in any one of claims 1 to11 or 16 to 17 or the antigen- presenting cell as defined in any one of claims 12 to 14, wherein the antigen- presenting cell is capable of presenting the epitope in the context of a membranebound major histocompatibility complex (MHC) protein.

36. The method or antigen-presenting cell as defined in claim 35, wherein the MHC protein is an MHC class 1 protein.

37. The method as defined in any one of claims 1 to 11 or 16 to 17, wherein the serine protease comprises a granzyme, optionally wherein the granzyme is a granzyme A, B, H, K or M.

38. The method as defined in any one of claims 1 to 11 , 16 to 17, or 33 to 37, wherein isolating the antigen-presenting cells generating the optical signal comprises using a fluorescently activated cell sorter (FACS).

39. The method as defined in any one of claims 1 to 11 , 16 to 17, 21 to 25 or 33 to 38 or the cytotoxic lymphocyte as defined in claim 15 or the library as defined in any one of claims 18 to 20, wherein the cytotoxic lymphocyte comprises a CD8+ T-cell, or an immortalized cell line derived from a T-cell or a natural killer cell.

40. The method as defined in any one of claims 1 to 11 , 16 to 17, 21 to 25 or 33 to 38 or the cytotoxic lymphocyte as defined in claim 15 or the library as defined in any one of claims 18 to 20, wherein the cytotoxic lymphocyte is an immortalized cell line of lymphoid origin, with intact expression of immunoreceptor tyrosine-based activation motif (ITAM)-mediated signaling pathways and intact expression and function of the granzyme / perforin pathway.