Gene editing methods and compositions for treating cystic fibrosis

CA3316089A1Pending Publication Date: 2025-06-26RECODE THERAPEUTICS INC +5
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CA3316089
Authority / Receiving Office
CA · CA
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-06-13
Filing Date
2024-12-20
Publication Date
2025-06-26

AI Technical Summary

Technical Problem

Current treatments for cystic fibrosis, including CFTR modulators, are ineffective for mutations that result in premature stop codons or splicing defects, highlighting a need for alternative gene therapy approaches.

Method used

The use of lipid nanoparticles (LNPs) to deliver a gene editing system comprising a base editor and a guide RNA to lung cells, specifically targeting and correcting mutations in the CFTR gene, such as the R553X stop codon mutation.

Benefits of technology

This approach results in increased expression and function of the full-length CFTR protein, effectively treating cystic fibrosis by correcting the underlying genetic defect at the cellular level.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

Provided are methods to treat cystic fibrosis in a subject. Also provided are methods of modifying the nucleic acid sequence in the CFTR gene in a lung cell type, methods of increasing the expression of the CFTR gene in a lung cell type, and methods of modulating the activity of a CFTR gene in a lung cell type. The present disclosure further relates to the method of treating cystic fibrosis comprising the administration of a lipid nanoparticle (LNP) and a gene editing system, wherein administration of the LNP mediates genome editing in lung cells.
Need to check novelty before this filing date? Find Prior Art

Description

GENE EDITING METHODS AND COMPOSITIONS FOR TREATING CYSTIC FIBROSISCross-Reference to Related Applications

[0001] This application claims priority from U.S. provisional application No. 63 / 614,394 filed December 22, 2023, entitled “GENE EDITING METHODS AND COMPOSITIONS FOR TREATING CYSTIC FIBROSIS” and U.S. provisional application No. 63 / 659,813, filed June 13, 2024, entitled “GENE EDITING METHODS AND COMPOSITIONS FOR TREATING CYSTIC FIBROSIS”, the contents of which are incorporated by reference in its entirety.Incorporation by Reference of Sequence Listing

[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 282152000140SeqList.xml, created December 19, 2024, which is 9,430 bytes in size. The information in the electronic format of the Sequence Listing is incorporated by reference in its entirety.Field

[0003] The present disclosure relates in some aspects to methods and uses of lipid nanoparticles comprising nucleic acids encoding a base editor and a guide RNA, for treating subjects with cystic fibrosis, and related methods, uses, and articles of manufacture.Background

[0004] Cystic Fibrosis (CF) is a genetic disorder that impacts tens of thousands of people worldwide. CF is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an ion channel. These mutations result in dysregulated chloride and bicarbonate transport across the membrane of epithelial cells, causing cells to secrete thick, viscous mucus. This leads to inflammation, infections, tissue damage, respiratory issues, and organ failure, and result in patients having shortened life expectancy. Many CF- causing mutations in CFTR have been identified, but the most common is the gene variant F508del, in which the deletion of three base pairs cause the loss of phenylalanine at position 508. Efforts for CF treatment include options that focus on preventing infections and clearingmucus in the lungs. In terms of curing CF, gene therapy approaches have been considered as a promising avenue. To this end, lipid nanoparticles (LNPs) are being utilized as a delivery platform for delivering adenine base editors (ABEs) in order to correct mutated CFTR genes and cure patients of this life-threatening genetic disease.

[0005] Various strategies for delivering nucleic acid molecules into cells are available, including transfection- and transduction-based techniques. However, there remains a need for improved delivery strategies of nucleic acid molecules into cells and treatments for cystic fibrosis. Provided herein are embodiments that meet such needs.Summary

[0006] The present application provides methods of treating a subject with cystic fibrosis by administering to the subject a composition comprising a lipid nanoparticle (LNP) that comprises a gene editing system.

[0007] Provided herein is a method of treating a subject with cystic fibrosis, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP) that comprises a gene editing system, wherein the gene editing system comprises: (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA (gRNA), and wherein the composition treats the cystic fibrosis in the subject. In some embodiments, the CFTR gene of the subject comprises a R553X stop codon mutation. In some embodiments, the administration of the composition results in an increase in the expression of the full-length cystic fibrosis transmembrane conductance regulator (CFTR) protein in the subject, as compared to a subject with cystic fibrosis and whose CFTR gene comprises a R553X stop codon mutation, and that is not administered the composition.

[0008] In some embodiments, the administration of the composition results in an increase in the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein in the subject, as compared to a subject with cystic fibrosis and whose CFTR gene comprises a R553X stop codon mutation, and that is not administered the composition. In other embodiments, the nucleic acid encoding the base editor is RNA. In some embodiments, the base editor is an adenine base editor (ABE). In other embodiments, the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the ABE is ABE8e.

[0009] In some of any embodiments, the base editor is a cytosine base editor (CBE). In some embodiments, the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity. In some embodiments, the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid. In some of any embodiments, the LNP comprises 5A2-SC8, l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules.

[0010] Provided herein is a method of delivering a gene editing system to a lung cell type in a subject, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP) that comprises a gene editing system, wherein the gene editing system comprises (i) a first nucleic acid encoding an endonuclease or a base editor; and (ii) a second nucleic acid encoding a guide RNA (gRNA), and wherein the gene editing system is delivered to a lung cell type in a subject.

[0011] In some embodiments, the lung cell type is an endothelial cell or an epithelial cell. In some of any embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the endonuclease is a Cas nuclease of the CRISPR-Cas system. In other embodiments, the Cas nuclease is a Cas9 nuclease, a Cas 12 nuclease, or a Cas 13 nuclease. In some embodiments, the nucleic acid encoding the endonuclease is DNA. In some embodiments, the nucleic acid encoding the endonuclease is RNA. In some embodiments, the nucleic acid encoding the base editor is DNA. In some of any embodiments, the nucleic acid encoding the base editor is RNA.

[0012] In some embodiments, the base editor is an adenine base editor (ABE). In some embodiments, the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the ABE is ABE8e. In some embodiments, the base editor is a cytosine base editor (CBE). In some embodiments, the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

[0013] In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 1:1 on a molecule:molecule basis. In some embodiments, the ratio of the first nucleic acid to thesecond nucleic acid is 1: 1 on a weight basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 on a molecule: molecule basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 on a weight basis.

[0014] In some embodiments, the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid. In some embodiments, the LNP comprises 5A2- SC8, l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules. In some embodiments, the one or more SORT molecules comprises permanently positively charged moiety. In some embodiments, the one or more SORT molecules is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt); 18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

[0015] In some embodiments, the one or more SORT molecule comprises DOTAP (1,2- dioleoyl-3-trimethylammonium propane). In some embodiments, the one or more SORT molecule comprises 18PA. In some embodiments, the one or more SORT molecule comprises DODAP. In some embodiments, the DODAP comprises about 20% molar ratio of the total lipids. In some embodiments, the DOTAP comprises about 50% molar ratio of the total lipids. In some embodiments, the 18PA comprises about 10% molar ratio of the total lipids. In some of any embodiments, the one or more SORT molecule comprises DOTMA. In some embodiments, the LNP comprises a ratio of DOPE:DOTMA between 3:1 and 1:3. In embodiments, the ratio of DOPE:DOTMA is about 3:1. In some embodiments, the ratio of DOPE:DOTMA is about 1:1.

[0016] In some embodiments, the SORT molecule comprises from about 5% to about 60% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 50% molar percentage of the LNP. In some embodiments, the LNP binds vitronectin.

[0017] In some embodiments, the guide RNA comprises a circular RNA. In some of any embodiments, the guide RNA comprises a linear RNA. In some embodiments, the guide RNA is a single guide RNA (sgRNA). In some embodiments, the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene. In some embodiments, the nucleotide sequence of the guideRNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

[0018] In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the composition is administered intravenously. In some of any embodiments, the subject is a human. In some embodiments, the subject has cystic fibrosis.

[0019] Provided herein is a method of modifying the nucleic acid sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a lung cell type, wherein the CFTR gene comprises a R553X stop codon mutation, the method comprising: (a) contacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nuclec acid encoding a guide RNA; (b) determining the nucleic acid sequence of the CFTR gene in the lung cell type, wherein the nucleic acid sequence of the CFTR gene in the lung cell type is modified to remove the R553X stop codon mutation. In some embodiments, the modification comprises the replacing of the thymine at 1789 base in exon 11 of the CFTR gene with cytosine.

[0020] Provided herein is a method of increasing the expression of full-length cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type, wherein a CFTR gene in the lung cell type comprises a R553X mutation, the method comprising: (a) contacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA; (b) determining the expression of full-length CFTR protein in the lung cell type, wherein the expression of full-length CFTR protein is increased in the lung cell type, as compared to a lung cell type comprising a CFTR gene comprising a R553X mutation, and that is not contacted with the composition.

[0021] Provided herein is a method of modulating the activity of the cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type, wherein the CFTR gene in the lung cell type comprises a R553X mutation, the method comprising: (a) contacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA; (b) determining the activity of the CFTR protein in the lung cell type, wherein the activity of the CFTR protein is modulated in the lung cell type, as compared to a lung cell type comprising a CFTR gene comprising a R553X mutation, and that is not contacted with the composition.

[0022] In some embodiments, expression of the CFTR protein is determined in a lung cell type in a subject, wherein the subject has been administered the composition, and wherein the expression is determined by one or more bioassays comprising sweat chloride concentration assay, β-adrenergic sweat assay, and nasal potential difference assay. In some embodiments, expression of the CFTR protein is determined by analysis of chloride levels in the sweat of the subject. In some embodiments, the chloride levels in the sweat of the subject after being administered the composition are decreased as compared to the chloride levels in the sweat of the subject before being administered the composition. In some embodiments, the expression is measured using western blotting, immunoprecipitation, and anti-CFTR antibodies. In some embodiments, the activity of the CFTR protein is increased in the lung cell type, as compared to a lung cell type comprising a CFTR gene comprising a R553X mutation, and that is not contacted with the composition.

[0023] In some embodiments, the lung cell type is an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell.

[0024] In some embodiments, the nucleic acid encoding the base editor is DNA. In some embodiments, the nucleic acid encoding the base editor is RNA. In some embodiments, the base editor is an adenine base editor (ABE). In some embodiments, the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the base editor is a cytosine base editor (CBE). In some embodiments, the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

[0025] In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 1:1 on a molecule:molecule basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a weight basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 molecule: molecule basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 on a weight basis.

[0026] In some embodiments, the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid. In some embodiments, the LNP comprises 5A2- SC8, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and oneor more selective organ targeting (SORT) molecules. In some embodiments, the one or more SORT molecules comprises permanently positively charged moiety. In some embodiments, the one or more SORT molecule is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt); 18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

[0027] In some embodiments, the one or more SORT molecules comprises DOTAP (1,2- dioleoyl-3-trimethylammonium propane). In some embodiments, the one or more SORT molecules comprises 18PA. In some embodiments, the one or more SORT molecules comprises DODAP. In some embodiments, the DODAP comprises about 20% molar ratio of the total lipids. In some embodiments, the DOTAP comprises about 50% molar ratio of the total lipids. In some embodiments, the 18PA comprises about 10% molar ratio of the total lipids.

[0028] In some embodiments, the SORT molecule comprises DOTMA. In some of any embodiments, the LNP comprises a ratio of DOPE:DOTMA of between 3:1 and 1:3. In some embodiments, the ratio of DOPE:DOTMA is about 3:1. In some embodiments, the ratio of DOPE:DOTMA is about 1:1. In some embodiments, the SORT molecule comprises from about 5% to about 60% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from 50% molar percentage of the LNP. In some embodiments, the LNP binds vitronectin.

[0029] In some embodiments, the guide RNA comprises a circular RNA. In some of any embodiments, the guide RNA comprises a linear RNA. In some embodiments, the guide RNA is a single guide RNA (sgRNA). In some embodiments, the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene. In some embodiments, the nucleotide sequence of the guide RNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

[0030] In some embodiments, the function of the CFTR protein is determined by one or more bioassays comprising sweat chloride concentration assay, β-adrenergic sweat assay, and nasal potential difference assay. In some embodiments, the function of the CFTR protein isdetermined by analysis of chloride levels in the sweat of the subject. In some embodiments, the chloride levels in the sweat of the subject after being administered the composition are decreased as compared to the chloride levels in the subject before being administered the composition.

[0031] In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is a human. In some embodiments, the administration of the composition to the subject is by intravenous administration.

[0032] Provided herein is a method of restoring the function of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a subject with cystic fibrosis, the method comprising: (a) administering to the subject a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA; (b) determining the function of the CFTR gene in the subject, wherein the function of the CFTR gene is restored in the subject.

[0033] In some embodiments, about 5% to about 95% of the function of the CFTR gene is restored. In some embodiments, the restoring of the function of the CFTR gene is determined by the increase of CFTR protein expression. In some embodiments, expression of the CFTR protein is determined by one or more bioassays comprising sweat chloride concentration assay, β- adrenergic sweat assay, and nasal potential difference assay. In some embodiments, expression of the CFTR protein is determined by analysis of chloride levels in the sweat of the subject. In some embodiments, chloride levels in the sweat of the subject after being administered the composition are decreased as compared to levels in a subject before being administered the composition. In some embodiments, the expression is measured using western blotting, immunoprecipitation, and anti-CFTR antibodies.

[0034] In some embodiments, the nucleic acid encoding the base editor is DNA. In some embodiments, the nucleic acid encoding the base editor is RNA. In some embodiments, the base editor is an adenine base editor (ABE). In some embodiments, the base editor is ABE8e. In some embodiments, the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the base editor is a cytosine base editor (CBE). In some embodiments, the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In someof any embodiments, the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

[0035] In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 1:1 on a molecule:molecule basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a weight basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 molecule: molecule basis. In some embodiments, the ratio of the first nucleic acid to the second nucleic acid is 2:1 on a weight basis.

[0036] In some embodiments, the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid. In some embodiments, the LNP comprises 5A2- SC8, l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules. In some embodiments, the one or more SORT molecules comprises permanently positively charged moiety. In some of any embodiments, the one or more SORT molecule is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt); 18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

[0037] In some embodiments, the one or more SORT molecules comprises DOTAP (1,2- dioleoyl-3-trimethylammonium propane). In some embodiments, the one or more SORT molecules comprises 18PA. In some embodiments, the one or more SORT molecules comprises DODAP. In some embodiments, the DODAP comprises about 20% molar ratio of the total lipids. In some embodiments, the DOTAP comprises about 50% molar ratio of the total lipids. In some embodiments, the 18PA comprises about 10% molar ratio of the total lipids. In some embodiments, the one or more SORT molecules comprises DOTMA. In some embodiments, the LNP comprises a ratio of DOPE:DOTMA of between 3:1 and 1:3. In some embodiments, the ratio of DOPE:DOTMA is about 3:1. In some embodiments, the ratio of DOPE:DOTMA is about 1:1. In some embodiments, the one or more SORT molecules comprises from about 5% to about 60% molar percentage of the LNP. In some embodiments, the one or more SORT molecules comprises about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from 50% molar percentage of the LNP. In some embodiments according to any one of the methods described above, the LNP binds vitronectin.

[0038] In some embodiments, the guide RNA comprises a circular RNA. In some embodiments, the guide RNA comprises a linear RNA. In some embodiments, the guide RNA is a single guide RNA (sgRNA). In some embodiments, the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene. In some embodiments, the nucleotide sequence of the guide RNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

[0039] In some embodiments, the composition comprises a pharmaceutically acceptable carrier. In some embodiments, the subject is a human. In some embodiments, the administration of the composition to the subject is by intravenous administration. In some embodiments, the LNP is localized to the lungs of the subject. In some embodiments, the LNP is capable of delivering the first and second nucleic acids to the lungs of the subject.

[0040] Provided herein is a lung cell type comprising a modified cystic fibrosis transmembrane conductance regulator (CFTR) gene, wherein the modification comprises the replacement of the thymine at 1789 base in exon 11 of the CFTR gene with cytosine.

[0041] Provided herein is a method of treating cystic fibrosis in a subject, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA, wherein the first nucleic acid and the second nucleic acid are delivered to a lung cell in the subject.Brief Description of the Drawings

[0042] FIG. 1A-1M shows that direct in vivo gene editing was achieved in mouse lungs that persisted for one year. Diagram showing Lung SORT LNPs delivery of mRNA-encoded gene editors to various lung cell types, including stem cells (FIG. 1A). Diagram showing the experimental procedure used to evaluate the efficiency of lung cell editing in Ai14 tdTom reporter mice, in which Cre recombinase can excise the loxP flanked stop cassette enabling tdTom fluorescence protein expression. Mice were injected with LNP-Cre at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio) with two sequential doses, 48 hours apart. Mice treated with PBS were used as negative control (FIG. IB). Ex vivo fluorescence imaging analyses of mouse lungs 2, 7, 21, 42, 60, 120 ,180, and 360 days after the last injection (FIG. 1C). Quantification analysis of ex vivo lung images was shown as average radiance (FIG. ID) and astotal Flux (FIG. IE). Flow cytometry gating strategy for lung endothelial, epithelial, and immune cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, endothelial cells (CD31 positive), epithelial cells (EpCam positive), or immune cells (CD45 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3) (FIG. IF). Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung basal stem cells (EpCam positive, Ngfr positive) and lung stem cells (EpCam positive, Krt5 or CK5 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3) (FIG. 1G). Time-course flow cytometry analyses showing the percentage of tdTom-positive (tdTOM+) cell was reported among (FIG. 1H) lung cells, (FIG. II) endothelial cells, (FIG. 1J) immune cells, (FIG. IK) epithelial cells, (FIG. IL) Ngfr+stem cells, and (FIG. IM) Krt5+stem cells.

[0043] FIG. 2A-2G depicts durable in vivo gene editing in mouse lung with LNP-Cas9. Schematic representation of experimental procedure used to evaluate the efficiency of lung cell editing in Ai14 tdTomato reporter mice, in which Cas9 / sgTOMl can delete the stop cassette enabling tdTomato fluoresce protein expression (FIG. 2A). Lung SORT LNPs were used to co- deliver Cas9 mRNA and sgTOMl (LNP-Cas9). Mice were intravenously injected with LNP- Cas9 at 2 mg / kg total RNA (Cas9 mRNA: sgTOMl=2:1, wt / wt; total lipid to total RNA=20:1, wt / wt) with three sequential doses, one week apart. Mice treated with PBS was used as negative control. Time-course flow cytometry analyses 7, 21, 60, and 240 days after the last injection showing the percentage of tdTomato-positivie (tdTom+) cell was reported among (FIG. 2B) total lung cells, (FIG. 2C) lung endothelial cells, (FIG. 2D) lung immune cells, (FIG. 2E) lung epithelial cells, (FIG. 2F) Ngfr+ lung basal stem cells, and (FIG. 2G) Krt5+lung basal stem cells. Similar to the result of Cre editing, tdTom+ cells retained persistent expression across the lungs including 38.7% of endothelial cells, 32.5% of epithelial cells, 6.1% of immune cells, 16.7% of Ngfr+lung basal stem cells, and 7.2% of Krt5+lung basal stem cells for up to 240 days.

[0044] FIG. 3A-3D depicts the minimal toxicity observed after LNP-Cas9 treatments. In vivo toxicity of Lung SORT LNPs were evaluated by measuring liver function parameters, ALT (FIG. 3A) and AST (FIG. 3B) and kidney function parameters, BUN (FIG. 3C) and CREA (FIG. 3D) in mouse serum 7, 21, 60, and 240 days after three sequential doses of LNP-Cas9, one week apart (2 mg / kg total RNA, i.v., total lipid / total RNA=20:1). PBS-treated mice were used as a negative control.

[0045] FIG. 4A-4G depicts lung SORT LNP-mediated editing in tracheal and bronchus regions. LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg total RNA, 48 hours apart. The tracheas and bronchus regions were extracted 48 hours following the final injection, and tdTom expression (tdTom+) across various cell types was quantified using flow cytometry. The composition of cells markedly differed between the trachea and bronchus regions of the lung (FIG. 4A). The trachea harbored more immune cells (-55.8%) and fewer epithelial (~13.7%j and endothelial cells (-8.4%) compared to the bronchus (35.4% immune cells, 28.7% epithelial cells, and 23.5% endothelial cells). Percentages of total edited cells, endothelial cells, immune cells, epithelial cells, Ngfr+basal stem cells, and Krt5+basal stem cells in the trachea compared to the bronchus region (FIG. 4B-FIG. 4G).

[0046] FIG. 5A-5B depicts gene editing in mouse lung endothelial progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected at 2 days, 7 days, 21 days, 42 days, 60 days, 120 days, 180 days, 270 days, and 360 days after the last injection. Flow cytometry gating strategy for lung endothelial progenitor cells (FIG. 5A). Single cells prepared from Ail 4 mouse lungs were gated. Single cells prepared from Ail 4 mouse lungs were gated. Viable (Ghost Red negative) lung endothelial progenitor cells (CD45 negative, CD31 positive, CD157 positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. Gene editing in mouse lung hematopoietic lung endothelial progenitor cells were obtained from three mice per each time point (FIG. 5B). Saline treated mice were served as negative control.

[0047] FIG. 6A-6C depicts gene editing in mouse lung hematopoietic progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected at 2 days, 7 days, 21 days, 42 days, 60 days, 120 days, 180 days, 270 days, and 360 days after the last injection. Flow cytometry gating strategy for lung hematopoietic progenitor cells (FIG. 6A). Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung multipotent progenitor cells (lineage negative, CD45 positive, Seal negative, c-kit positive) or lung hematopoietic stem cells (lineage negative, CD45 positive, Seal positive, c-kit positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. Gene editing in mouse lung hematopoietic lung multipotent progenitor cells (FIG. 6B) and lunghematopoietic stem cells (FIG. 6C) were obtained from three mice per each time point. Saline treated mice were served as negative control.

[0048] FIG. 7A-7E depicts lung SORT LNP-mediated efficient delivery into mature lung epithelial cells where vitronectin receptor expressing lung cell types exhibit enhanced editing efficiency. Representative immunofluorescence images of lung sections from LNP-Cre treated Ai14 reporter mice 2, 7, 60, 120, 270, and 360 days after the last injection. Lung sections were stained with 5 different biomarker of various lung epithelial cell types (HOPX for ATI cells, ABCA3 for AT2 cells, MUC5AC for globet cells, Tubulin for ciliated cells and SCGB1A1 for club cells) to quantify LNP-Cre-mediated editing in mature lung epithelial cells from Ai14 tdTom reporter mice lung. PBS serves as a negative control. Scale bar = 30 pm. Biomarkers (white); tdTom (red); nuclei (blue) (FIG. 7A). Quantification analysis of LNP-Cre-mediated editing in mature lung epithelium base on IHC images. Results were obtained from five to six random airway per whole slide IHC images and are presented as mean ± SEM (FIG. 7B). Representative native whole slide immunofluorescence images of lung sections from a PBS treated mouse (FIG. 7C) and a LNP-Cre treated mouse (FIG. 7D), DAPI shown as blue and tdTom shown as Red. Representative native tissuecyte image of a single lung left lobe whole section from a LNP-Cre treated mouse (FIG. 7E).

[0049] FIG. 8A-8B depicts quantitative TissueCyte analysis of mTmG mice lung following LNP-Cre treatment. Schematic representation of LNP-Cre mediated eGFP fluorescence protein expression replacing the red fluorescence in lung cells after systemic administrations (FIG. 8A). A mouse was injected intravenously with a single LNP-Cre treatment at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The mouse lung was collected two days after the injection. PBS-treated mTmG mouse was used as negative control. Quantitative analysis of GFP positive (GFP+) area % in ENP-Cre treated mTmG mouse lung left lobe by TissueCyte 3D imaging and analysis (FIG. 8B).

[0050] FIG. 9A-9B depicts the protein corona composition adsorbed onto Fung SORT ENP surface as determined by unbiased mass spectrometry proteomics. The most abundant proteins were ranked and plotted as a heat map (FIG. 9A) and classified into physiological classes of the identified proteins (FIG. 9B).

[0051] FIG. 10A-10E depicts vitronectin receptor-expressing lung cell types exhibit enhanced editing efficiency. Quantification of tdTom positivity in vitronectin receptor (CD51+CD61+) expressing cells and the vitronectin receptor population in lung endothelial cell(FIG. 10A), immune cells (FIG. 10B), epithelial cells (FIG. IOC), Ngfr+cells (FIG. 1OD) andKrt5+stem cells (FIG. 1OE). Data are mean + SEM (n = 4 independent replicates). 2-way ANOVA.

[0052] FIG. 11A-11E depicts flow cytometry gating strategy for vitronectin receptor. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial cells (CD31 positive; FIG. 11A), immune cells (CD45 positive; FIG. 11B), epithelial cells (EpCam positive; FIG. 11C), lung basal stem cells (EpCam positive Ngfr positive (FIG. 11D) or EpCam positive Krt5 positive (FIG. HE) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3).

[0053] FIG. 12A-12B depicts the efficient adenine base editing in 16HBEge R553X cells. LNP-ABE (ABE mRNA:sgR553X=2:1 by weight, 1.5 pg total RNA per well) mediated high level base editing efficiency (>95%) in 16HBEge R553X cells at the target T7 position (FIG. 12A). The A«T to G*C conversion on T7 position was analyzed using EditR analysis with Sanger sequencing data. The stoichiometry of ABE mRNA and sgR553X was investigated by measuring the editing level after transfecting 16HBEge cell using a series of LNP-ABE (0.8 pg total RNA per well) with altered ABE mRNA to sgRNA weight ratios (FIG. 12B). Data are shown as mean+SEM (n=2 biologically independent samples).

[0054] FIG. 13A-13F depicts efficient adenine base editing was achieved in lung basal cells across CF models. Workflow for differentiation of HBE from a healthy donor and a CF patient with CFTRR553x / F508delint0airway epithelium and base editing strategy to correct CF R553X mutation (FIG. 13A). Untreated CF HBE cells were used as negative control and HBE from healthy donor with wild-type CFTR gene was used for comparison. LNP-ABE-mediated 60% of allelic base editing in both undifferentiated P2 and fully differentiated P3 culture (FIG. 13B). The frequency of desired product (the box highlighted in blue) and bystander editing was evaluated using NGS sequencing (FIG. 13C). Efficacy of LNP-ABE with or without Trikafta in CFTR protein restoration in CFTRR553x / F508delHBE culture measured by JESS western blotting (FIG. 13D). Band B (FIG. 13E) and Band C (FIG. 13F) intensities were normalized by vinculin (20 pg / mL) as an internal standard. Data are mean ± SEM of n - 3 independent replicates. Unpaired t-test.

[0055] FIG. 14A-14B depicts raw data of gel images of CFTR (FIG. 14A) and Vinculin as internal standard (FIG. 14B) from JESS western blotting.

[0056] FIG. 15A-15B depicts the ability of LNP-ABE to restore HBE culture function.Quantitative data from average current calculated from area under the curve (AUG) representing CFTR activity further confirmed CFTR restoration. Data are mean ± SEM (w = 4 independent replicates); One-way ANOVA (FIG. ISA). CFTR function in HBE culture from non-cystic fibrosis individuals who are wild type for the CFTR gene; Data are mean ± SEM (w = 4 independent replicates) (FIG. 15B).

[0057] FIG. 16A-16G depicts in vivo stem cell editing in CF mouse lungs. Workflow of R553X correction in intestinal organoids using LNP-ABEs and the mechanism of Forskolin- induced swelling (FIS) assay (FIG. 16A). Intestinal stem cells were isolated from R553X homozygous mice to generate intestinal organoids as an ex vivo model to evaluate CFTR function restoration following LNP-ABE treatment. Forskolin-induced CFTR activation can facilitate ion / water transportation leading to organoid swelling. No swelling was observed from untreated group (FIG. 16B), while LNP-ABE treated group showed over 80% of intestinal organoid swelling (FIG. 16C, FIG. 16D); Scale bar: 500 pm. Approximately 50% of base editing was confirmed using DNA sequencing; Data are mean ± SD (« = 8 independent replicates); Unpaired t-test (FIG. 16E). Workflow of assessing LNP-ABE-mediated base editing in mouse lung basal cells after a single administration (FIG. 16F). CF heterozygous R553X mice were injected intravenously with LNP-ABE (1.5 mg kg-1total RNA, ABE mRNA:sgR553X=2:1, weight ratio). Mice were sacrificed 10 days after the injection. Whole lung tissue, isolated lung basal stem cells, and trachea populations were used for DNA extraction, PCR amplification, and NGS sequencing. Base editing efficiency of all adenines within the target protospacer in three lung populations. Data are mean ± SEM (n = 3 independent replicates) (FIG. 16G).

[0058] FIG. 17A-17M shows that direct in vivo gene editing was achieved in mouse lungs that persisted for one year. Schematic representation of LNP-mediated gene editor delivery into lung cells after systemic administration (FIG. 17A). Diagram showing the experimental procedure used to evaluate the efficiency of lung cell editing in Ai14 tdTom reporter mice, in which Cre recombinase can excise the loxP flanked stop cassette enabling tdTom fluorescence protein expression. Mice were injected with LNP-Cre at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio) with two sequential doses, 48 hours apart. Mice treated with PBS were used as negative control (FIG. 17B). Ex vivo fluorescence imaging analyses of mouse lungs 2, 7, 21, 42, 60, 120 ,180, 360, and 660 days after the last injection (FIG. 17C). Quantification analysisof ex vivo lung images was shown as average radiance (FIG. 17D) and as total Flux (FIG. 17E). Flow cytometry gating strategy for lung endothelial, epithelial, and immune cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, endothelial cells (CD31 positive), epithelial cells (EpCam positive), or immune cells (CD45 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3) (FIG. 17F). Flow cytometry gating strategy for lung endothelial, epithelial, and immune cells. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung basal stem cells (EpCam positive, Ngfr positive) and lung stem cells (EpCam positive, Krt5 or CK5 positive) expressing tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3) (FIG. 17G). Time-course flow cytometry analyses showing the percentage of tdTom-positive (tdTOM+) cell was reported among (FIG. 17H) lung cells, (FIG. 171) endothelial cells, (FIG. 17J) immune cells, (FIG. 17K) epithelial cells, (FIG. 17L) Ngfr+stem cells, and (FIG. 17M) Krt5+stem cells. Data are means ± SEMs (n = 3 biologically independent replicates) for treated groups.

[0059] FIG. 18A-18H depicts durable in vivo gene editing in mouse lung with LNP-Cas9. Schematic representation of experimental procedure used to evaluate the efficiency of lung cell editing in Ai14 tdTomato reporter mice, in which Cas9 / sgTOMl can delete the stop cassette enabling tdTomato fluoresce protein expression (FIG. 18A). The location of sgTOMl on the stop cassette (FIG. 18B). Lung SORT LNPs were used to co-deliver Cas9 mRNA and sgTOMl (LNP-Cas9). Mice were intravenously injected with LNP-Cas9 at 2 mg / kg total RNA (Cas9 mRNA: sgTOMl=2:1, wt / wt; total lipid to total RNA=20:1, wt / wt) with three sequential doses, one week apart. Mice treated with PBS was used as negative control. Time-course flow cytometry analyses 7, 21, 60, and 240 days after the last injection showing the percentage of tdTomato-positivie (tdTom+) cell was reported among (FIG. 18C) total lung cells, (FIG. 18D) lung endothelial cells, (FIG. 18E) lung immune cells, (FIG. 18F) lung epithelial cells, (FIG. 18G) Ngfr+ lung stem cells, and (FIG. 18H) Krt5+lung stem cells. Similar to the result of Cre editing, tdTom+ cells retained persistent expression across the lungs including 38.7% of endothelial cells, 32.5% of epithelial cells, 6.1% of immune cells, 16.7% of Ngfr+lung basal stem cells, and 7.2% of Krt5+lung basal stem cells for up to 240 days. Data are presented as individual data points or mean ± SEM, (n = 3 biologically independent replicates).

[0060] FIG. 19A-19E depicts the minimal toxicity observed after LNP-Cas9 treatments. In vivo toxicity of Lung SORT LNPs were evaluated by measuring liver function parameters, ALT(FIG. 19A) and AST (FIG. 19B) and kidney function parameters, BUN (FIG. 19C) and CREA (FIG. 19D) in mouse serum 7, 21, 60, and 240 days after three sequential doses of LNP-Cas9, one week apart (2 mg / kg total RNA, i.v., total lipid / total RNA=20:1) (n = 3 biologically independent replicates). PBS-treated mice were used as a negative control. Data are presented as individual data points or mean ± SEM. Histopathology evaluation performed by H&E staining of heart and spleen tissues 7, 60, and 120 days after LNP-Cas9 treatment (FIG. 19E). PBS- treated mice were used as a negative control. Scale bar: 100 pm.

[0061] FIG. 20A-20G depicts lung SORT LNP-mediated editing in tracheal and bronchus regions. LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg total RNA, 48 hours apart. The tracheas and bronchus regions were extracted 48 hours following the final injection, and tdTom expression (tdTom+) across various cell types was quantified using flow cytometry. The composition of cells markedly differed between the trachea and bronchus regions of the lung (FIG. 20A). The trachea harbored more immune cells (55.8%) and fewer epithelial (13.7%) and endothelial cells (8.4%) compared to the bronchus (35.4% immune cells, 28.7% epithelial cells, and 23.5% endothelial cells). Percentages of total edited cells (FIG. 20B), endothelial cells (FIG. 20C), immune cells (FIG. 20D), epithelial cells (FIG. 20E), Ngfr+stem cells (FIG. 20F), and Krt5+stem cells (FIG. 20G) in the trachea compared to the bronchus region. Data are presented as mean ± SEM in FIG. 20B-FIG. 20G (n = 5 biologically independent replicates).

[0062] FIG. 21A-21B depicts gene editing in endothelial beds of various organs with LNP- Cre. LNP-Cre was intravenously administered to Ai14 mice in two successive doses, 2 mg / kg total RNA, 48 hours apart. tdTom expression (tdTom+) across CD31+endothelial beds of various organs (FIG. 21A) and total cells of various organs (FIG. 21B) were quantified by flow cytometry. Tested organs include heart, lung, liver, spleen, kidney, pancreas, stomach, duodenum, jejunum, ileum, cecum, colon, and rectum. PBS-treated mice were used as negative control. Data are presented as mean ± SEM (n = 3 independent replicates).

[0063] FIG. 22A-22B depicts lung SORT LNP-mediated editing in lung immune cells. LNP-Cre were intravenously administered to Ai14 mice in two successive doses, each being 2 mg / kg total RNA, 48 hours apart. Flow cytometry gating strategy for various lung immune cells (FIG. 22A). Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung immune cells (CD45 positive) including B cells (B220 positive), CD4 T cells (CD3 positive CD4 positive), CD8 T cells (CD3 positive CD8 positive), dendritic cells (CDl lcpositive), neutrophils (Ly-6G positive) and macrophages (F4 / 80 positive) were analyzed by flow cytometry to evaluate tdTomato expression level (tdTomato positive). PBS treated mice were served as negative control. The results showed that 22.6% of neutrophils, 41.7% of macrophage, 32.4% of dendritic cells, 14.9% B cells, 14.9% CD4+T cells and 14.5% of CD8+T cells were edited (FIG. 22B). Data are presented as mean ± SEM (n=3 biologically independent replicates).

[0064] FIG. 23A-23D depicts lung SORT LNP-mediated editing in P. aeruginosa infected mouse lungs. Ail 4 mice were randomly allocated to P. aeruginosa infection group or non- infection group. Mice in infection group were inoculated intranasally with 50 pl of P. aeruginosa at 3.5 x 105 CFU to generate acute infection model (FIG. 23A). LNP-Cre were intravenously administered to Ai14 mice, 2 mg / kg total RNA, 9 h post infection. Neutrophil invasion was observed in infected lungs 9 h after the intranasal infection compared to non- infected lungs (FIG. 23B). VtnR abundance (FIG. 23C) and tdTom expression (tdTom+) across various cell types in infected and non-infected mouse lung (FIG. 23D) were measured using flow cytometry. No significant difference was observed in VtnR abundance and editing efficiency among various tested lung cell types except immune cells between infected and non- infected lungs. PBS-treated infected mice were used as negative control. Data are presented as mean ± SEM (n = 3 independent replicates), Unpaired t-test. P values < 0.05 were considered statistically significant.

[0065] FIG. 24A-24B depicts gene editing in mouse lung endothelial progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected at 2, 7, 21, 42, 60, 120, 180, 270, 360, and 660 days after the last injection. Flow cytometry gating strategy for lung endothelial progenitor cells (FIG. 24A). Single cells prepared from Ail 4 mouse lungs were gated. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung endothelial progenitor cells (CD45 negative, CD31 positive, CD 157 positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. Gene editing in mouse lung hematopoietic lung endothelial progenitor cells were obtained from three mice per each time point (FIG. 24B). PBS treated mice were served as negative control. Data are presented as individual data points or mean ± SEM (n=3 biologically independent replicates).

[0066] FIG. 25A-25C depicts gene editing in mouse lung hematopoietic progenitor cells with LNP-Cre. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs inclusive of tracheas were collected at 2, 7, 21, 42, 60, 120, 180, 270, 360, and 660 days after the last injection. Flow cytometry gating strategy for lung hematopoietic progenitor cells (FIG. 25 A). Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) lung multipotent progenitor cells (lineage negative, CD45 positive, Seal negative, c-kit positive) or lung hematopoietic stem cells (lineage negative, CD45 positive, Seal positive, c-kit positive) expressing tdTomato fluorescence (tdTomato positive) were analyzed by flow cytometry. Gene editing in mouse lung hematopoietic lung multipotent progenitor cells (FIG. 25B) and lung hematopoietic stem cells (FIG. 25C) were obtained from three mice per each time point. PBS treated mice were served as negative control. Data are presented as individual data points or mean ± SEM (n=3 biologically independent replicates).

[0067] FIG. 26 depicts a representative whole slide images showing five to six random segments selection for quantification analysis.

[0068] FIG. 27A-27K depicts lung SORT LNP-mediated efficient delivery into diverse lung cell types with enhanced delivery to VtnR-expressing cells. Representative immunofluorescence images of lung sections from LNP-Cre treated Ai14 reporter mice (2, 7, 60, 120, 270, and 360 days after treatment) to assess LNP-mediated editing in mature lung epithelial cells (HOPX for ATI cells, ABCA3 for AT2 cells, MUC5AC for goblet cells, tubulin for ciliated cells, and SCGB1A1 for club cells). PBS-treated mice served as negative controls. Scale bar = 30 pm. Markers (white); tdTom (red); nuclei (blue) (FIG. 27A). Quantification of LNP-Cre-mediated editing in mature lung epithelium based on immunofluorescence images. Results were obtained from five to six random airway segments per whole slide. Data are presented as means ± SEMs (FIG. 27B). Representative whole slide immunofluorescence images from PBS treated (FIG. 27C) and LNP-Cre treated (FIG. 27D) mice. DAPI is blue and tdTom is red. Scale bars = 1mm. Representative tissuecyte image of a LNP-Cre-treated mouse’s lung whole left lobe (FIG. 27E). Scale bar = 1mm. VtnR (CD51+CD61+) abundance (FIG. 27F) and quantification of tdTom positivity in VtnR+ (CD51+CD61+) cells and VtnR- (CD51-CD61-) fraction in lung endothelial cells (FIG. 27G), immune cells (FIG. 27H), epithelial cells (FIG. 271), NGFR+ cells (FIG. 27J), and KRT5+ stem cells (FIG. 27K). Data are means ± SEMs (n = 3 biologicallyindependent replicates), Unpaired t-test. P values < 0.05 were considered statistically significant, ns = not significant.

[0069] FIG. 28A-28B depicts gene editing and persistence of gene editing in mouse lung ionocytes following systemic LNP-Cre administration. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected 2 days and 660 days after the last injection. Flow cytometry gating strategy for lung ionocytes. FOXI1 positive lung ionocytes were gated and analyzed for the expression of tdtomato fluorescence (FIG. 28A). Editing levels, correlated with tdtomato expression in mouse lung ionocytes, were measured from three mice at each time point (FIG. 28B). PBS treated mice served as the negative control. Data are presented as mean ± SEM (n=3 biologically independent replicates).

[0070] FIG. 29A-29B depicts quantitative TissueCyte analysis of mTmG mice lung following LNP-Cre treatment. Schematic representation of LNP-Cre mediated eGFP fluorescence protein expression replacing the red fluorescence in lung cells after systemic administrations. A mouse was injected intravenously with a single LNP-Cre treatment at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The mouse lung was collected two days after the injection. PBS-treated mTmG mouse was used as negative control (FIG. 29A). Quantitative analysis of GFP positive (GFP+) area % in LNP-Cre treated mTmG mouse lung left lobe by TissueCyte 3D imaging and analysis (FIG. 29B). Data are presented as individual data points (n=1).

[0071] FIG. 30A-30B depicts the protein corona composition adsorbed onto Lung SORT LNP surface determined by unbiased mass spectrometry proteomics. The most abundant proteins were ranked and plotted as a heat map (FIG. 30A) and classified into physiological classes of the identified proteins (FIG. 30B).

[0072] FIG. 31A-31D depicts how vitronectin regulates SORT and non-SORT LNP efficacy in vitronectin receptor (VtnR) expressing cells in vitro. 5-component 5A2-SC8 SORT LNPs, 5- component DLin-MC3-DMA (MC3) SORT LNPs, and 4-component non-SORT LNPs (standard MC3 LNPs) were preincubated with 0.25 g Vtn / g lipid prior to treating Vtn-negative liver cancer cells (Huh-7), Vtn-expressing kidney cancer cells (A-498), and Vtn-expressing human lung epithelial (16HBE14o-) cells to measure functional mRNA delivery (bioluminescence) (FIG. 31A). The activity of functional luciferase translated from mRNA delivered by uncoated LNPs (labeled “-”) or Vtn-coated LNPs (labeled “+”) in relevant cell lines (25 ng mRNA, 24 h,n = 4) (FIG. 31B). Cells were saturated with 0.2 pg Vtn / mL prior to treatment with Vtn-coated SORT and non-SORT LNPs (which do not bind Vtn) to assess functional mRNA delivery (bioluminescence) (FIG. 31C). The activity of functional luciferase translated from mRNA delivered by Vtn-coated LNPs in cells with or without Vtn saturation (FIG. 31D). (25 ng mRNA, 24 h, n = 4). Statistical significance was determined using an unpaired t test. P values < 0.05 were considered statistically significant. Data are shown as mean ± SEM.

[0073] FIG. 32 depicts the flow cytometry gating strategy for vitronectin receptor. Single cells prepared from Ai14 mouse organs were gated. Viable (Ghost Red negative) total cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial cells (CD31 positive), immune cells (CD45 positive), epithelial cells (EpCAM positive), lung stem cells (EpCAM positive NGFR positive or EpCAM positive KRT5 positive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry (n=3).

[0074] FIG. 33A-33B depicts LNP delivery in VtnR-expressing lung endothelial cells, lung multipotent progenitor cells, and lung hematopoietic stem cells. VtnR (CD51+CD61+) abundance (FIG. 33A) and quantification of tdTom positivity in VtnR+(CD51+CD61+) cells and VtnR" (CD5TCD61") fraction in lung endothelial cells, lung multipotent progenitor cells, and lung hematopoietic stem cells (FIG. 33B). Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). The lungs were collected 2 days after the last injection. Single cells prepared from Ai14 mouse lungs were gated. Viable (Ghost Red negative) total lung cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial progenitor cells (CD31 positive CD 157 positive), lung resident multipotent immune progenitor cells (lineage negative, CD45 positive, Seal negative, c-kit positive), or lung resident hematopoietic stem cells (lineage negative, CD45 positive, Seal positive, c-kit positive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. Lung endothelial cells (22.4%), lung multipotent progenitor cells (22.5%), and lung hematopoietic stem cells (38.6%) all exhibit high levels of VtnR expression. Lung SORT LNPs transfect a very high fraction of endothelial and lung hematopoietic stem cells, which may mask any potential contribution of VtnR versus other receptor interactions. Data are mean ± SEM (n = 3 independent replicates).

[0075] FIG. 34A-34C depicts profiling of VtnR expression in mouse tissues and LNP delivery in VtnR-expressing lung endothelial and non-endothelial cells. VtnR (CD51+CD61+) abundance (FIG. 34A) and quantification of tdTom positivity in VtnR+(CD51+CD61+) cells andVtnR" (CD5TCD6F) fraction in endothelial cells (FIG. 34B) or non-endothelial cells (FIG. 34C) across various organs. Ai14 mice were dosed with two sequential LNP-Cre treatments (two days apart) at 2 mg / kg total RNA (20:1, total lipid to RNA weight ratio). Organs were collected 2 days after the last injection. Single cells prepared from Ai14 mouse organs were gated. Viable (Ghost Red negative) total cells, vitronectin receptor expressing (CD51 positive CD61 positive) endothelial cells (CD31 positive) or non-endothelial cells (CD31 negative) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. Comparing to heart (3.0%), liver (2.5%), spleen (3.7%), kidney (1.1%), pancreas (1.4%), duodenum (2.2%), ovaries / testes (4.3%), lung exhibit highest level of VtnR expression (24.4%). Endothelial cells of all tested organs displayed no preference for tdTom in VtnR+or VtnR- fraction. However, in non-endothelial cell population, tdTom expression was enriched within the VtnR+fraction compared to the VtnR" fraction in heart (24.8% vs 2.9%), lung (23.3% vs 2.9%), liver (88.8% vs 52.3%), spleen (10.4% vs 4.6%) and kidney (24.6% vs 2.7%). Data are mean ± SEM (n = 3 independent replicates), unpaired t-test. P values < 0.05 were considered statistically significant.

[0076] FIG. 35A-35B depicts efficient adenine base editing in 16HBEge R553X cells. LNP- ABE (ABE mRNA:sgR553X=2:1 by weight, 1.5 pg total RNA per well) mediated high level base editing efficiency (>95%) in 16HBEge R553X cells at the target T? position (FIG. 35A). The A«T to G*C conversion on T? position was analyzed using EditR analysis with Sanger sequencing data. The stoichiometry of ABE mRNA and sgR553X was investigated by measuring the editing level after transfecting 16HBEge cell using a series of LNP-ABE (0.8 pg total RNA per well) with altered ABE mRNA to sgRNA weight ratios (FIG. 35B). Data are shown as mean ± SEM (n=2 independent samples).

[0077] FIG. 36A-36O depicts efficient adenine base editing was achieved in lung basal cells in patient-derived HBE cells and CF mouse model. Workflow for differentiation of HBE from a healthy donor and a CF patient with CFTRR553x / F508delinto airway epithelium and base editing strategy to correct CF R553X mutation (FIG. 36A). Untreated CF HBE cells were used as negative control and HBEs from a healthy donor with wild-type CFTR gene was used for comparison. LNP-ABE-mediated 60% of allelic base editing in both undifferentiated P2 (n=1) and fully differentiated P3 culture (n=4) (FIG. 36B). The frequency of desired product (the box highlighted in blue) and bystander editing was evaluated using NGS sequencing (FIG. 36C). Efficacy of LNP-ABE with or without Trikafta in CFTR protein restoration in CFTRR553x / F508delHBE culture measured by capillary western blotting (FIG. 36D). Band B (FIG. 36E) and BandC (FIG. 36F) intensities from FIG. 36D were normalized to vinculin (20 pg / mL) as an internal standard. Data are means + SEMs of n = 3 independent replicates. One-way analysis of variance (ANOVA); P values of <0.05 were considered statistically significant. Quantitative data for average current calculated from AUG representing CFTR activity further confirmed CFTR restoration. Data are means ± SEMs of n=4. One-way ANOVA; P values of <0.05 were considered statistically significant (FIG. 36G). CFTR function in HBE culture from non-CF patients who are wild-type for the CFTR gene (n=4 independent replicates) (FIG. 36H). Workflow of R553X correction in intestinal organoids using LNP-ABEs and the mechanism of Forskolin-induced swelling (FIS) assay (FIG. 361). Intestinal stem cells were isolated from R553X homozygous mice to generate intestinal organoids as an ex vivo model to evaluate CFTR function restoration after LNP-ABE treatment. Forskolin-induced CFTR activation can facilitate ion / water transportation leading to organoid swelling. No swelling was observed from untreated group (FIG. 36J), while LNP-ABE treated group showed over 80% of intestinal organoid swelling (FIG. 36K, FIG. 36L); Scale bars: 1000 pm. Approximately 50% of base editing was confirmed using DNA sequencing (FIG. 36M); Data are means ± SEMs of n = 8 independent replicates in FIG. 36L and FIG. 36M. Unpaired t-test; P values of <0.05 were considered statistically significant. Workflow of assessing LNP-ABE-mediated base editing in mouse lung basal cells after a single administration (FIG. 36N). CF heterozygous R553X mice were injected intravenously with LNP- ABE (1.5 mg kg-1total RNA, ABE mRNA:sgR553X=2:1, weight ratio). Mice were euthanized 10 days after the injection. Whole lung tissue, trachea, and isolated lung NGFR+ basal stem cells populations were used for DNA extraction, PCR amplification, and NGS sequencing. Base editing efficiency of all adenines within the target protospacer in three lung populations (FIG. 360). Data are mean ± SEM (n = 4 independent replicates).

[0078] FIG. 37A-37B depicts raw data of gel images of CFTR (FIG. 37A) and Vinculin as internal standard (FIG. 37B) from Jess™ capillary western blotting.

[0079] FIG. 38A-38B depicts apical and basolateral delivery of LNP-tdTom in P3 differentiated HBE R553X / F508del cultures. Cells were then treated with 12 pg LNP-tdTom (12 pg tdTomato mRNA per well) either to the apical side in liquid bolus or to the basolateral side. Untreated HBE cells were used as control. Single cells prepared from inserts were gated (FIG. 38A). Viable (Scarlet 723 negative) basal cells (KRT5 positive), club cells (SCGB1A1 positive), goblet cells (MUC5AC positive), and ciliated cells (Acetyl-Tubulin positive) with tdTomato fluorescence (tdTom positive) were analyzed by flow cytometry. Quantitative analysis oftdTom+cells in HBE basal and differentiated cell populations (n=3) (FIG. 38B). Data are shown as mean ± SEM. Unpaired t-test. P values < 0.05 were considered statistically significant.Detailed Description

[0080] Cystic fibrosis, also known as mucoviscidosis, is an autosomal recessive genetic disorder that affects most critically the lungs, and also the pancreas, liver, and intestine (Gibson et al., Am J Respir Crit Care Med. (2003) 168(8):918-951 ; Ratjen et al., Lancet Lond Engl. (2003) 361(9358):681-689; O’Sullivan et al., Lancet Lond Engl. (2009) 373(9678):1891-1904). Cystic fibrosis is caused by mutations in the gene encoding for the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) protein. This protein functions as a channel that transports chloride ions across the membrane of cells and is required to regulate the components of mucus, sweat, saliva, tears, and digestive enzymes. Disease-causing mutations in the CFTR protein cause dysfunction of its channel activity resulting in abnormal transport of chloride and sodium ions across the epithelium, leading to the thick, viscous secretions in the lung, pancreas and other organs characteristic of cycstic fibrosis disease (O’Sulliven et al., Lancet Lond Engl. (2009) 373(9678):1891-1904; Rowe et al., N Engl J Med. (2005) 352(19): 1992-2001). Most cycstic fibrosis patients develop severe, chronic lung disease related to airway obstruction partly due to increased levels of sulfated mucins, inflammation, and recurrent infections that are eventually lethal; the median predicted survival age in the US is 40.7 years. Cystic fibrosis is the most frequent lethal genetic disease in the white population.

[0081] Cystic fibrosis (CF) is an autosomal recessive disorder with an estimated 89,000 individuals affected worldwide. Patients with CF have mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, mainly affecting the lungs, liver, pancreas, and intestine. CFTR is a membrane protein that functions as a chloride channel in the apical membrane of epithelial cells. Individuals with CF have dysregulated chloride and bicarbonate transport across the apical surface of secretory epithelia. Almost 2,000 variants have been cataloged in the Cystic Fibrosis Mutation database, including variants that cause substitution of a single amino acid, nonsense mutations, frameshifts, mis-splicing variants, or affect the promoter region. The most common cause of CF is the gene variant F508del, which is defined by a deletion of three base pairs that cause the loss of the amino acid phenylalanine at position 508. The loss of phenylalanine causes incorrect folding of the CFTR protein and subsequentdegradation. Overall, the variants affect the amount of CFTR protein available in the apical cell membrane, reducing the activity and efficiency of the ion channel.

[0082] The lungs of individuals with cystic fibrosis are colonized and infected by bacteria from an early age. This leads to chronic airway infection and inflammation, progressing to bronchiectasis, gas trapping, hypoxemia, and hypercarbia. Pulmonary insufficiency is responsible for 68.1% of CF-related deaths in the US. In the initial stage, common bacteria such as Staphylococcus aureus and Hemophilus influenzae colonize and infect the lungs. Eventually, Pseudomonas aeruginosa (and sometimes Burkholderia cepacia) dominates. By 18 years of age, 80% of patients with classic CF harbor P. aeruginosa, and 3.5% harbor B. cepacia. Once within the lungs, these bacteria adapt to the environment and develop resistance to commonly used antibiotics.

[0083] The decrease or loss of function of CFTR protein leads to multiorgan dysfunction and a shortened life expectancy. The abnormally viscous secretions in the lung airways cause obstructions that lead to inflammation, tissue damage, frequent respiratory infections, and organ failure. Other organ systems that contain epithelia are also affected, including sweat glands and the male reproductive tract. Currently, obstructive lung disease is the primary cause of morbidity.

[0084] Several treatments for cystic fibrosis have been developed since the first causal CFTR mutation was identified in 1989. The gene-targeting therapies aim to augment the function of mutant CFTR or restore CFTR function by correcting the mutations. Other therapies are focused on improving mucociliary clearance and preventing infections. Therapies comprised of a group of small molecules that aim to modulate and restore mutant CFTR function are known as CFTR modulators. The compounds elexacaftor-tezacaftor-ivacaftor enhance the activity of mutant CFTR, and patients with the F508del variant taking this combination have improved lung function from 0.2% in the placebo group to 13.6%. However, these modulators are ineffective for CFTR mutations that lead to premature stop codons or splicing defects. For example, patients with mutations that cause premature stop codons (R553X, G542X, and W1282X) or with a splice-site mutation (3849 + 10 kb C>T) cannot benefit from CFTR modulators. Using gene therapy and gene editing approaches to treat patients with nonsense and splicing CFTR mutations can be a viable alternative. See e.g., Ong, T. et al., , JAMA 2023; Cutting, G., Nature reviews. Genetics 2015; Esposito C. et al., Life (Basel) 2023; Hisert, K. etal., The Lancet 2023; McHugh, D. et al., PloS one 2018; and Krishnamurthy, S. et al., Nucleic acids research 2021, which are incorporated by reference herein in its entirety.

[0085] Gene editing is anticipated to revolutionize the field of medicine by creating durable therapies across a wide spectrum of diseases (J. Y. Wang, J. A. Doudna, CRISPR technology: A decade of genome editing is only the beginning. Science 379, eadd8643 (2023); F. A. Ran et al., Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 8, 2281-2308 (2013); C. A. Hodges, R. A. Conlon, Delivering on the promise of gene editing for cystic fibrosis. Genes Dis 6, 97-108 (2019)). Direct delivery of gene editors to target cells using synthetic nanoparticle- or virus-based systems could facilitate efficient and precise gene editing directly within the patient's body, bypassing the complexities, risks, and costs associated with ex vivo procedures (K. A. Hajj, K. A. Whitehead, Tools for translation: Non- viral materials for therapeutic mRNA delivery. Nat. Rev. Mater. 2, 17056 (2017); T. Wei et al., Delivery of tissue-targeted scalpels: Opportunities and challenges for in vivo CRISPR / Cas-based genome editing. ACS Nano 14, 9243-9262 (2020); M. J. Mitchell et al., Engineering precision nanoparticles for drug delivery. Nat. Rev. Drug Discov. 20, 101-124 (2021); A. Raguram, S. Banskota, D. R. Liu, Therapeutic in vivo delivery of gene editing agents. Cell 185, 2806-2827 (2022)). Although progress has been made targeting differentiated cells such as hepatocytes (J. D. Gillmore et al., CRISPR-Cas9 in vivo gene editing for transthyretin amyloidosis. New. Engl. J. Med. 385, 493-502 (2021)) and T cells (J. G. Rurik et al., CAR T cells produced in vivo to treat cardiac injury. Science 375, 91- 96 (2022)), nanoparticle delivery of gene editors to stem cells has remained elusive. Achieving durable therapeutic responses likely requires editing in stem cells to overcome the loss of corrected DNA in differentiated cells that regularly turnover (C. A. Hodges, R. A. Conlon, Delivering on the promise of gene editing for cystic fibrosis. Genes Dis 6, 97-108 (2019); L. Xu et al. , CRISPR / Cas9-mediated CCR5 ablation in human hematopoietic stem / progenitor cells confers HIV-1 resistance in vivo. Mol. Ther. 25, 1782-1789 (2017)).

[0086] Genetic lung diseases constitute a large unmet medical need (N. E. King et al., Correction of airway stem cells: Genome editing approaches for the treatment of cystic fibrosis. Hum. Gene Ther. 31, 956-972 (2020); S. Suzuki et al., Highly efficient gene editing of cystic fibrosis patient-derived airway basal cells results in functional CFTR correction. Mol. Ther. 28, 1684-1695 (2020)) hindered by delivery challenges to protect genome editors from degradation, achieve cell targeted delivery, and minimize off-target effects while overcoming significant physiological barriers including mucus, macrophages, and endothelial tissues (A. McCarron, P.Cmielewski, V. Drysdale, D. Parsons, M. Donnelley, Effective viral-mediated lung gene therapy: Is airway surface preparation necessary? Gene Ther. 30, 469-477 (2023)).

[0087] Lipid nanoparticles (LNPs) are the most clinically advanced non-viral delivery platform. More than a billion doses of mRNA LNP COVID-19 vaccines have been administered intramuscularly worldwide, demonstrating high safety, efficacy, and repeat dose ability (F. P. Polack et al., Safety and efficacy of the BNT162b2 mRNA Covid- 19 vaccine. New. Engl. J. Med. 383, 2603-2615 (2020); L. R. Baden et al., Efficacy and safety of the mRNA-1273 SARS- CoV-2 vaccine. New. Engl. J. Med. 384, 403-416 (2020)). Treatment of genetic lung diseases including Cystic Fibrosis (CF) would benefit a direct intravenous (IV) delivery approach to bypass formidable local intratracheal (B. Li et al., Combinatorial design of nanoparticles for pulmonary mRNA delivery and genome editing. Nat. Biotechnol., (2023)) and inhalation (A. K. Patel et al. , Inhaled nano formulated mRNA polyplexes for protein production in lung epithelium. Adv. Mater. 31, 1805116 (2019)) barriers including thick sticky mucus (F. Ratjen et al., Cystic fibrosis. Nat. Rev. Dis. Primers 1, 15010 (2015)) and poor access to stem cells that line the basement of the epithelium. Yet, LNPs predominantly accumulate in the liver when administered intravenously, which hampers extrahepatic therapeutic utility.

[0088] Whether Lung Selective Organ Targeting (SORT) LNPs (Q. Cheng et al., Selective ORgan Targeting (SORT) nanoparticles for tissue specific mRNA delivery and CRISPR / Cas gene editing. Nat. Nanotechnol. 15, 313-320 (2020)) could access tissue-resident stem cells was investigated. It was shown that optimized lung-targeting LNPs can deliver CRISPR-Cas9 (M. Jinek et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012)) and adenine base editors (ABE) (N. M. Gaudelli et al., Programmable base editing of A«T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017); E. M. Porto, A. C. Komor, I. M. Slaymaker, G. W. Yeo, Base editing: advances and therapeutic opportunities. Nat. Rev. Drug Discov. 19, 839-859 (2020)) to facilitate reconstitution of lung epithelium with corrected genes, thereby achieving enduring and significant therapeutic effects. Provided herein are methods to treat a disease or disorder (e.g. cystic fibrosis).

[0089] In some embodiments, the methods comprise administering to a subject a lipid nanoparticle (LNP) that comprises a gene editing system. In some embodiments, the gene editing system comprises an adenine base editor (ABE), wherein the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Casprotein capable of binding to a specific nucleotide sequence. In some embodiments, the gene editing system is used to treat a subject with cystic fibrosis.

[0090] The adenine base editor deaminates an adenosine leading to a point mutation from adenine (A) to guanine (G). For example, the adenosine can be converted to an inosine residue. Within the constraints of a DNA polymerase active site, inosine pairs most stably with C and therefore is read or replicated by the cell's replication machinery as a guanine (G). Such base editors are useful for targeted editing of nucleic acid sequences. Such base editors can be used for targeted editing of DNA in vitro, e.g., for the generation of mutant cells or animals.

[0091] Such base editors can be used for the introduction of targeted mutations in the cell of a living mammal. Such base editors may also be used for the introduction of targeted mutations for the correction of genetic defects in cells ex vivo, e.g., in cells obtained from a subject that are subsequently reintroduced into the same or another subject, or for multiplexed editing of a genome. These base editors may be used for the introduction of targeted mutations in vivo, e.g., the correction of genetic defects or the introduction of deactivating mutations in disease- associated genes in a subject, or for multiplexed editing of a genome. In some embodiments, the ABEs described herein are utilized for the targeted editing of G to A mutations (e.g., targeted genome editing). Reference is made to WO2021 / 158921 published August 12, 2021, which is incorporated herein in its entirety.

[0092] All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.

[0093] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.I. METHODS OF USE

[0094] In some embodiments, the methods provided herein comprise the treatment of a lung disease or lung disorder in a subject. In some embodiments, the methods provided herein comprise the treatment of cystic fibrosis. In some embodiments, the methods provided herein for the treatment of a lung disease or lung disorder in a subject comprise administering thedescribed LNPs comprising a gene editing system or administering compositions comprising the described LNPs comprising a gene editing system to the subject. In some embodiments, the methods provided herein for the treatment of cyctic fibrosis in a subject comprise administering the described LNPs comprising a gene editing system or administering compositions comprising the described LNPs comprising a gene editing system to the subject. In some embodiments, the method comprises the treatment of cystic fibrosis in a subject, wherein the method comprises administering to a subject a LNP composition comprising a gene editing system to the subject. LNPs as described in this section are described further in Section II below. Gene editing systems as described in this section are described further in Section III below.

[0095] In some embodiments, the methods provided herein comprise the delivery of a composition to a subject. Compositions as described in this section are described further in Section IV below. In some embodiments, the methods provided herein comprise the delivery of a composition comprising a gene editing system to a lung cell type in a subject. In some embodiments, the composition comprises a LNP and a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a gene editing system, wherein the gene editing system comprises a first nucleic acid and a second nucleic acid. In some embodiments, the first nucleic acid encodes an endonuclease. In some embodiments, the first nucleic acid encodes a base editor. In some embodiments, the second nucleic acid encodes a guide RNA (gRNA). In some embodiments, the gene editing system is delivered to a lung cell type in a subject. In some embodiments, a composition comprising a LNP comprising a gene editing system, wherein the gene editing system comprises a first nucleic acid encoding a base editor and a second nucleic acid encoding a gRNA, is delivered to a lung cell type in a subject. In some embodiments, the composition is delivered to a lung cell type in a subject with cystic fibrosis. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell comprises lung cell types that include, but are not limited to, an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0096] In some embodiments, the methods provided herein comprise the modification of the nucleic acid sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a lung cell type in a subject. In some embodiments, the CFTR gene in a lung type in a subject comprises a point mutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a deletion. In some embodiments, the CFTR gene in a lung type in a subject comprises a F508del deletion. In some embodiments, the CFTR gene in a lung type in a subject comprises a R553X stop codon mutation. In some embodiments, the methods provided herein comprise the modification of the nucleic acid sequence of the CFTR gene wherein the CFTR gene comprises a R553X stop codon mutation. In some embodiments, the modification of the nucleic acid comprises the contacting of the lung cell type with a composition comprising a LNP. In some embodiments, the composition comprises a LNP and a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a first nucleic acid and a second nucleic acid. In some embodiments, the composition comprises an LNP comprising a first nucleic acid, wherein the first nucleic acid encodes a base editor, and a second nucleic acid, wherein the second nucleic acid encodes a gRNA. In some embodiments, the modification of the nucleic acid comprises the determination of the nucleic acid sequence of the CFTR gene in the lung cell type. In some embodiments, the modification of the nucleic acid of the CFTR gene comprises the removal of the R553X stop codon mutation. In some embodiments, the modification of the nucleic acid sequence of the CFTR gene in a lung cell type in a subject, wherein the CFTR gene comprises a R553X stop codon mutation, comprises the contacting of the lung cell type with a composition comprising a LNP, wherein the LNP comprises a first nucleic acid encoding a base editor and a second nucleic acid encoding a gRNA, wherein the nucleic acid sequence of the CFTR gene in the lung cell type is modified to remove the R553X stop codon mutation. In some embodiments, the modification of the nucleic acid of the CFTR gene in a lung cell type occurs in a subject with cystic fibrosis. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell comprises lung cell types that include, but are not limited to, an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0097] In some embodiments, the methods provided herein comprise the increase of the expression of a full-length cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type in a subject. In some embodiments, the lung cell type in a subject comprises a CFTR gene comprising a R553X stop codon mutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a point mutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a deletion. In some embodiments, the CFTR gene in a lung type in a subject comprises a F508del deletion. In some embodiments, the methods provided herein comprise the increase of the expression of a full length CFTR protein in a lung cell type in a subject, wherein the CFTR gene in the lung cell type comprises a R553X mutation, wherein the lung cell type is contacted with a composition comprising a LNP. In some embodiments, the composition comprises a LNP and a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a first nucleic acid and a second nucleic acid. In some embodiments, the composition comprises an LNP comprising a first nucleic acid, wherein the first nucleic acid encodes a base editor, and a second nucleic acid, wherein the second nucleic acid encodes a gRNA. In some embodiments, the increase of the expression of a full-length CFTR protein comprises the determination of the expression of full- length CFTR protein in the lung cell type. In some embodiments, the increase of the expression of a full-length CFTR protein in a lung cell type in a subject, wherein the CFTR gene comprises a R553X stop codon mutation, comprises the contacting of the lung cell type with a composition comprising a LNP, wherein the LNP comprises a first nucleic acid encoding a base editor and a second nucleic acid encoding a gRNA, wherein the expression of full-length CFTR protein is increased in the lung cell type as compared to a lung cell type that is not contacted with the composition. In some embodiments, the increase of the expression of a full-length CFTR protein in a lung cell type occurs in a subject with cystic fibrosis. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell comprises lung cell types that include, but are not limited to, an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0098] In some embodiments, the methods provided herein comprise the modulation of the activity of a cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type in a subject. In some embodiments, the lung cell type in a subject comprises a CFTR gene comprising a R553X stop codon mutation. In some embodiments, the methods provided herein comprise the modulation of the activity of a CFTR protein in a lung cell type in a subject, wherein the CFTR gene in the lung cell type comprises a R553X mutation, wherein the lung cell type is contacted with a composition comprising a LNP. In some embodiments, the composition comprises an LNP and a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a first nucleic acid and a second nucleic acid. In some embodiments, the composition comprises a LNP comprising a first nucleic acid, wherein the first nucleic acid encodes a base editor, and a second nucleic acid, wherein the second nucleic acid encodes a gRNA. In some embodiments, the modulation of the activity of the CFTR protein comprises the determination of the activity of the CFTR protein in the lung cell type. In some embodiments, the modulation of the activity of the CFTR protein in a lung cell type in a subject, wherein the CFTR gene comprises a R553X stop codon mutation, comprises the contacting of the lung cell type with a composition comprising a LNP, wherein the LNP comprises a first nucleic acid encoding a base editor and a second nucleic acid encoding a gRNA, wherein the activity of the CFTR protein is modulated in the lung cell type as compared to a lung cell type that is not contacted with the composition. In some embodiments, the modulation of the activity of the CFTR protein in a lung cell type occurs in a subject with cystic fibrosis. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell comprises lung cell types that include, but are not limited to, an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0099] In some embodiments, the methods provided herein comprise the restoration of the function of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a subject. In some embodiments, the methods provided herein comprise the restoration of the function of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a subject with cystic fibrosis. In some embodiments, the CFTR gene in a lung type in a subject comprises a pointmutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a deletion. In some embodiments, the CFTR gene in a lung type in a subject comprises a F508del deletion. In some embodiments, the CFTR gene in a subject comprises a R553X stop codon mutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a point mutation. In some embodiments, the CFTR gene in a lung type in a subject comprises a deletion. In some embodiments, the CFTR gene in a lung type in a subject comprises a F508del deletion. In some embodiments, the restoration of the function of the CFTR gene comprises the administration of a composition to a subject with cystic fibrosis. In some embodiments, the composition comprises a LNP and a gene editing system. In some embodiments, the composition comprises a LNP, wherein the LNP comprises a first nucleic acid and a second nucleic acid. In some embodiments, the composition comprises a LNP comprising a first nucleic acid, wherein the first nucleic acid encodes a base editor, and a second nucleic acid, wherein the second nucleic acid encodes a gRNA. In some embodiments, the restoration of the function of the CFTR gene comprises the determination of the function of the CFTR gene in the subject. In some embodiments, the restoration of the function of the CFTR gene comprises the administration of a composition to a subject, wherein the composition comprises a LNP, wherein the LNP comprises a first nucleic acid encoding a base editor and a second nucleic acid encoding a gRNA, wherein the function of the CFTR gene is restored in the subject. In some embodiments, the restorationof the function of the CFTR gene occurs in a subject with cystic fibrosis.

[0100] In some embodiments, a patient in need of treatment is a male or female of 2 years or older, of 3 years or older, of 6 years or older, of 7 years or older, of 12 years or older, of 13 years or older, of 18 years or older, of 19 years or older, of 25 years or older, of 25 years or older, of 30 years or older, of 35 years or older, of 40 years or older, of 45 years or older, or of 50 years or older. In some embodiments, a patient in need of treatment is less than 50 years old, less than 45 years old, less than 40 years old, less than 35 years old, less than 30 years old, less than 25 years old, less than 20 years old, less than 19 years old, less than 18 years old, less than 13 years old, less than 12 years old, less than 7 years old, less than 6 years old, less than 3 years old, or less than 2 years old. In some embodiments, a patient in need of treatment is a male or female from 2 to 18 years old, from 2 to 12 years old, from 2 to 6 years old, from 6 to 12 years old, from 6 to 18 years old, from 12 to 16 years old, from 2 to 50 years old, from 6 to 50 years old, from 12 to 50 years old, or from 18 to 50 years old. In some embodiments, a patient in need of treatment is a female who is pregnant or who may become pregnant.

[0101] Patients with cystic fibrosis have more chloride in their sweat than people who do not have cycstic fibrosis. For a child who has cyctic fibrosis, the sweat chloride test results will confirm the diagnosis by showing a high chloride level. A baby has to sweat enough to do the test. Full-term babies usually produce enough sweat by 2 weeks of age. In some embodiments, a patient in need of treatment has a sweat chloride value of >60 mmol / L, >65 mmol / L, >70 mmol / L, >75 mmol / L, >80 mmol / L, >85 mmol / L, >90 mmol / L, >95 mmol / L, >100 mmol / L, >110 mmol / L, >120 mmol / L, >130 mmol / L, >140 mmol / L or >150 mmol / L by quantitative pilocarpine iontophoresis (documented in the subject's medical record). In some embodiments, a patient in need of treatment has chronic sinopulmonary disease and / or gastrointestinal / nutritional abnormalities consistent with cystic fibrosis.

[0102] In some embodiments, forced expiratory volume in 1 second (FEV1) is an established marker of cystic fibrosis disease progression that is used to capture clinical course and evaluate therapeutic efficacy. Thus, in various embodiments a patient in need of treatment has FEVl>50% and <90% (e.g., <85%, <80%, <75%, <70%, <65%, <60%, or <55%) of the predicted normal (i.e., the average FEV of non-cycstic fibrosis patients) based on the patient's age, gender, and height. In some embodiments, a patient in need of treatment has resting oxygen saturation >92% on room air (pulse oximetry). In some embodiments, a patient in need of treatment has a body mass index >17.5 kg / m2 and weight >40 kg.

[0103] In some embodiments, the method results in the production of CFTR protein in the subject. In some embodiments, the method results in an increase of CFTR protein in the subject of at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, or at least about 25-fold compared to baseline.

[0104] In some embodiments, the increase in CFTR protein is detectable within about 6 hours, 8 hours, 12 hours, 24 hours, 36 hours, or 48 hours of administration of the pharmaceutical composition. In some embodiments, the increase in the CFTR protein is detectable by qPCR on RNA purified from tissue samples.

[0105] In some embodiments, a patient in need of treatment has received or is concurrently receiving other lung disease medications. For example, a patient in need of treatment may be receiving lumacaftor / ivacaftor combination drug (ORKAMBI®) or may have been on this treatment for at least 28 days prior to commencement of the treatment according to the present disclosure. Other cystic fibrosis medications may include, but are not limited to, routine inhaledtherapies directed at airway clearance and management of respiratory infections, such as bronchodilators, rhDNase (PULMOZYME (Dornase alfa)), hypertonic saline, antibiotics, and steroids; and other routine CF-related therapies such as systemic antibiotics, pancreatic enzymes, multivitamins, and diabetes and liver medications.

[0106] In some embodiments, the method of treatment comprises (1) providing: a) a nebulizer, and b) a container including the LNP and base editor formulation in a pharmaceutically acceptable carrier, and (2) administering the formulation using the nebulizer. In some embodiments, the volume of the LNP and base editor formulation in the container has a volume of 10 inL. 9 inL. 8 inL. 7 niL. 6 inL. 5 inL. 4 ml. 3 inL. 2 niL. or 1 niL, In some embodiments, formulations and compositions generally include a pharmaceutically acceptable carrier. The carrier is preferably a liquid carrier. In some embodiments, the carrier preferably includes water and may include other components. In some embodiments, the composition including the LNP and base editor formulation is stored in an ampule, a vial, or a single-use vial prior to administrating. In some embodiments, the composition is stored in a single-use vial prior to administering.

[0107] In some embodiments, the administration of the pharmaceutical composition results in the expression of a protein in a lung of the subject. In some embodiments, administration of the LNP and base editor composition results in detection of a protein in a lung of the subject between 6 and 12 hours after delivery to the subject. In some embodiments, detection of the protein in the lung is at 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours or 12 hours. In some embodiments, the protein is detected using known techniques in the art, including, but not limited to, Western blot analysis.

[0108] In some embodiments, a polypeptide delivered according to the described method results in increased protein level or activity an upper airway, a central airway, or peripheral airway of a lung of the subject by, e.g., at least approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 100-fold, 500-fold, 1000-fold, or 1500-fold as compared to a control (e.g., endogenous level of protein or activity without or before the treatment according to the disclosure, or a historical reference level).

[0109] In some embodiments, a CFTR gRNA delivered according to the described method results in increased CFTR protein level or activity an upper airway, a central airway, or peripheral airway of a lung of the subject by, e.g., at least approximately 10%, 20%, 30%, 40%,50%, 60%, 70%, 80%, 90%, 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40- fold, 50-fold, 100-fold, 500-fold, 1000-fold, or 1500-fold as compared to a control (e.g., endogenous level of protein or activity without or before the treatment according to the disclosure, or a historical reference level).

[0110] In some embodiments, mRNA expression may be detected or quantified by qPCR on RNA purified from tissue samples. The protein or expression may be determined by measuring immune responses to the protein. Qualitative assessment of the protein may also be performed by Western blot analysis. The protein activity may be measured by an appropriate activity assay. Various other methods are known in the art and may be used to determine the protein expression or activity.

[0111] The CFTR mRNA expression may be detected or quantified by qPCR on RNA purified from tissue samples. The CFTR protein or expression may be determined by measuring immune responses to CFTR protein. In some embodiments, IgG antibody to CFTR protein is measured by an enzyme-linked immunosorbent assay in collected serum samples. In some embodiments, CFTR-specific T cell responses are assessed using collected peripheral blood mononuclear cells. In some embodiments, T cell responses to CFTR are measured by a human interferon-y enzyme-linked immunospot assay as described by Calcedo et al. (Calcedo et al., Hum Gene Ther Clin Dev. (2013) 24:108-15). Qualitative assessment of CFTR protein may also be performed by Western blot analysis. The CFTR protein activity may be measured by CFTR chloride channel activity in appropriate tissue cells. A stable potential with the mean value of a 10 second scoring interval after perfusion of solution is recorded. CFTR activity is estimated by the change in potential difference following perfusion with chloride-free isoproterenol. Various other methods are known in the art and may be used to determine the CFTR mRNA and CFTR protein expression or activity.

[0112] In some embodiments, the administration of the LNP comprising a gene editing system in accord with the provided methods effectively treats a subject with a mutation in the CFTR gene. In some embodiments, the mutation is a R553X CFTR nonsense mutation. In some embodiments, the expression level of the CFTR gene in a subject administered the LNP comprising a gene editing system is increased at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least90%, at least 95%, or at least 100% as compared to the expression level in the subject prior to administration of the LNP.

[0113] In some embodiments, the expression level of the CFTR gene in a subject administered the LNP comprising a gene editing system is increased between 0 to 10%, between 5% to 15%, between 20% to 30%, between 25% to 35%, between 30% to 40%, between 35% to 45%, between 40% to 50%, between 45% to 55%, between 50% to 60%, between 55% to 65%, between 60% to 70%, between 70% to 80%, between 75% to 85%, between 80% to 90%, between 85% to 95%, between 90% to 100% as compared to the expression level in the subject prior to administration of the LNP.

[0114] In some embodiments, administration of the LNP comprising a gene editing system enhances the expression or activity of CFTR protein by way of increasing the amount of a functional CFTR gene, transcript or protein in the cell (e.g., by at least about 1.1-fold) relative to a corresponding control. In some embodiments, the method yields a therapeutically effective amount of a functional of CFTR gene, transcript or protein in the cell. In some embodiments, the administration of the LNP comprising a gene editing system yields at least about 5%, 10%, 15%, 20%, 25%A 30%, 35%, 40%, 45%, or 50% by mole or by weight, increase in detectable CFTR gene, transcript or protein in the cell as compared to the cell prior to administration of the LNP composition.

[0115] In some embodiments, the method for enhancing the expression or activity of CFTR protein comprises the enhancement (e.g., chloride) ion transport in cell(s) (e.g., by at least about 1.1 -fold) relative to a cell prior to administration of the LNP composition. In some embodiments, the method reduces defective export from or import to cell(s) of chloride, such as chloride anion or in the form of a chloride salt or other chloride-containing compound. In some embodiments, the method enhances or stimulates ion (e.g., chloride) transport in cell(s). In some embodiments, the enhanced or stimulated ion (e.g., chloride) transport results in secretion or absorption of (e.g., chloride) ions. In some embodiments, enhanced (e.g., chloride) ion transport is determined by evaluating CFTR-mediated currents across cell(s) by employing standard Ussing chamber (see Ussing and Zehrahn, Acta. Physiol. Scand. 23:110-127, 1951) or nasal potential difference measurements (see Knowles et al., Hum. Gene Therapy 6:445-455,

[0116] 1995). In some embodiments, the enhanced chloride transport is be determined by the leq (equivalent current) assay using the TECC-24 system as described in Vu et al., J. Med. Chem. 2017, 60, 458-473, which is hereby incorporated by reference in its entirety.

[0117] In some embodiments, the enhanced (e.g., chloride) ion transport is determined by CFTR-dependent whole-cell current measurement(s), as described in International Patent Application No. PCT / US2017 / 032967, published as W02017201091, which is hereby incorporated by reference in its entirety. In some embodiments, the method further comprises deriving (e.g., by cell culturing) a cell composition (e.g., a lung cell composition) from the cell.

[0118] In some embodiments, response assessment may be performed at baseline (e.g. prior to any of the methods provided herein), 1 month, 3 months, 6 months, 9 months, 12 months, 18 months, and / or 24 months following administration of the LNP. In some aspects, response assessment is be performed at baseline, 1 month, 3 months, 6 months, 9 months, 12 months, 18 months, and 24 months following administration of the LNP.

[0119] In some embodiments, the method described herein comprises delivery of one or more polynucleotides to a cell. In some embodiments, the method comprises contacting a cell with a LNP comprising a gene editing system. In some embodiments, the method comprises expressing a protein or an RNA in a cell.

[0120] In some embodiments, the method comprises a method of increasing chloride flux in a cell. In some embodiments, the method comprises contacting the cell with a LNP and base editor composition, wherein optionally the cell comprises homozygous inactivating mutations in the CFTR gene. In some embodiments, the method maintains transpeithelial electrical resistance (TEER) or reduces TEER by at most 10%, at most 20%, or at most 30%. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell comprises lung cell types that include, but are not limited to, an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0121] In some embodiments, the method specifically transduces secretory cells and / or ionocytes compared to other lung cells. In some embodiments, the lung cell is a ciliated cell. In some embodiments, the method specifically transduces ciliated cells compared to other lung cells. In some embodiments, the method comprises nebulizing the LNP and base editor composition to generate an aerosolized composition, then contacting the aerosolizedcomposition with the cell. In some embodiments, the composition is an aerosolized composition, and the method comprises contacting the aerosolized composition with the cell.

[0122] In some embodiments, the method comprises the delivery of the one or more polynucleotides to the lung of a subject, wherein the method comprises administering to the subject a composition comprising a LNP comprising a gene editing system. In some embodiments, the method comprises the treating or preventing lung disease in a subject, wherein the method comprises administering to the subject a composition comprising a LNP comprising a gene editing system.

[0123] In some embodiments, the methods provided herein comprise a method for lung cell editing. In some embodiments, the methods comprise a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a lung (e.g., basal) cell, comprising: contacting the lung (e.g., basal) cell with a composition that comprises a nucleic acid editing system assembled with a lipid composition, thereby delivering the nucleic acid editing system to the lung (e.g., basal) cell.

[0124] In some embodiments, the methods provided herein comprise a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell composition, comprising: contacting the cell composition comprising a plurality of lung (e.g., basal) cells with a composition that comprises a nucleic acid editing system assembled with a lipid composition, thereby delivering the nucleic acid editing system, e.g., to at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 65%, or 70% of the plurality of lung (e.g., basal) cells.

[0125] In some embodiments, the methods provided herein comprise a method for genetic correction of cystic fibrosis transmembrane conductance regulator (CFTR) in a cell composition, comprising: contacting the cell composition with a composition that comprises a nucleic acid editing system assembled with a lipid composition, which cell composition comprise a lung (e.g., basal) cell and a lung non-basal cell, thereby delivering the nucleic acid editing system to the lung (e.g., basal) cell in a greater amount than that delivered to the lung non-basal cell. The non-basal cell may be an ionocyte (e.g., exhibiting or determined to exhibit to FOXI1), a ciliated cell, or a secretory cell (such as goblet cell and club cell).

[0126] In some embodiments, the methods provided herein comprise methods for genetic correction of CFTR. In some embodiments, the lung (e.g., basal) cell or the plurality of lung (e.g., basal) cells is / are determined to exhibit a mutation in CFTR gene. In some embodiments,the lung (e.g., basal) cell or the plurality of lung (e.g., basal) cells exhibit(s) a mutation in CFTR gene.

[0127] In some embodiments, the methods provided herein comprise methods for genetic correction of CFTR wherein the contacting is ex vivo. In some embodiments, the contacting is in vitro. In some embodiments, the contacting is in vivo. In some embodiments, a cell or pluralty of cells is isolated from the subject. The compositions as described elsewhere here may be contacted with the cell outside of the subject. Upon administration of the composition or therapeutic, the cell may be re-injected or otherwise re-introduced into the subject. In some embodiments, the cell is a cell line. In some embodiments, the cell is a lung cell. In some embodiments, the lung cell is a lung airway cell. Examples of lung airway cells that can be targeted by the delivery of the present application includes but is not limited to basal cell, secretory cell such as goblet cell and club cell, ciliated cell and any combination thereof.

[0128] In some embodiments, the method comprising nebulizing the composition prior to the administering step. In some embodiments, the composition is administered, as an aerosolized composition, by inhalation. In some embodiments, the method delivers to the lung an effective amount of the composition. In some embodiments, the composition comprises a LNP comprising a gene editing system.

[0129] In some embodiments, the method delivers to the lung an amount effective of the composition to treat the lung disease. In some embodiments, the method is more effective than contacting the cell with and / or adminsitering to the subject elexacaftor, tezacaftor, lumacaftor, ivacaftor, or a combination thereof. In some embodiments, the method is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, or at least 60% more effective. In some embodiments, the method is 10%-70%, 20%-70%, 30%-70%, 40%-70%, 50%-70%, or 60%- 70% more effective.II. LIPID NANOPARTICLES

[0130] Provided herein are methods of increasing the expression of a gene in a cell, and methods of modifying the nucleic acid sequences of a gene in a cell, including administration and uses, such as therapeutic uses, comprising administration of a lipid nanoparticle (LNP) comprising a gene editing system. In some embodiments, the LNP comprises a nucleic acid encoding a base editor that is administered to a subject.

[0131] Also provided herein are methods of treating a subject with cystic fibrosis. In some emebodiments, the method comprises the administration of a LNP comprising a gene editingsystem to the subject. In some embodiments, the LNP comprises a nucleic acid encoding a recombinase. In some embodiments, the method comprises administration of an LNP comprising a first nucleic acid and a second nucleic acid.A. Components of LNPs

[0132] In some embodiments, the methods comprise the administration of a LNP comprising a gene editing system to a subject. In some embodiments, the LNP comprises an ionizable lipid, a phospholipid, a polyethylene glycol (PEG) lipid, a sterol, and one or more DNA molecules or an RNA molecules. In some embodiments, the methods comprise the delivery of the nucleic acids enveloped by the LNP to a target organ and / or target cell.1. Ionizable Lipids

[0133] In some embodiments, the LNP comprises an ionizable lipid. In some embodiments, the ionizable lipid is an ionizable cationic lipid. In some embodiments, the cationic ionizable lipids contain one or more groups which is protonated at physiological pH but may deprotonated and has no charge at a pH above 8, 9, 10, 11, or 12. The ionizable cationic group comprises one or more protonatable amines which are able to form a cationic group at physiological pH. The cationic ionizable lipid compound may also further comprise one or more lipid components such as two or more fatty acids with C6-C24 alkyl or alkenyl carbon groups. In some embodiments, these lipid groups may be attached through an ester linkage or may be further added through a Michael addition to a sulfur atom. In some embodiments, these compounds may be a dendrimer, a dendron, a polymer, or a combination thereof.

[0134] In some embodiments, the LNP comprises one or more ionizable (e.g., ionizable amino) lipids (e.g., lipids that may have a positive or partial positive charge at physiological pH). Ionizable lipids may be selected from the group comprising, but not limited to, 3- (didodecylamino)-N 1 ,N 1 ,4-tridodecy 1-1 -piperazineethanamine (KL 10) , N 1 - [2- (didodecylamino)ethyl] Nl,N4,N4-tridodecyl-l,4- piperazinediethanamine (KL22), 14,25- ditridecy 1-15,18,21 ,24-tetraaza-octatriacontane (KL25) , 1 ,2-dilinoleyloxy-N,N- dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[l,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin- MC3-DMA), 2,2-dilinoleyl-4-(2 dimethylaminoethyl)-[l,3]-dioxolane (DLin-KC2-DMA), 1,2- dioleyloxy-N,Ndimethylaminopropane (DODMA), 2-({8 [(3(3)-cholest-5-en-3- yloxy]octyl!oxy)N,N dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-l-yloxy]propan-l-amine (Octyl-CLinDMA), (2R)-2-({8-[(3(3)-cholest-5-en-3-yloxy]octylIoxy)-N,N-dimethyl-3-[(9Z,12Z)- octadeca-9,12-dien-l-yloxy]propan-l -amine (Octyl-CLinDMA (2R)), and (2S) 2- ({8-[(3(3)-chol e st-5-en-3 -yloxy] octyl } oxy)-N,N-dimethyl-3 -[(9Z,12Z)-octadeca-9,12-di en-1 - yloxy]propan-l-amine (Octyl-CLinDMA (2S)), 4-hydroxybutyl ) azanediyl)bis (hexane-6,1- diyl)bis(2-hexyldecanoate (ALC-0315), or heptadecan-9-yl 8-((2-hydroxyethyl) (6-oxo-6- (undecyloxy) hexyl) amino) octanoate (SM-102). In some embodiments, the ionizable lipid comprises a cyclic amine group.

[0135] In some embodiments, ionizable lipids can also be the compounds disclosed in International Publication No. WO 2017 / 075531 Al, hereby incorporated by reference in its entirety. In some embodiments, ionizable lipids can also be the compounds disclosed in International Publication No. WO 2015 / 199952 Al, hereby incorporated by reference in its entirety. In some embodiments, the ionizable lipid may be selected from, but not limited to, an ionizable lipid described in International Publication Nos. W02012040184, WO2011153120, WO201 1149733, WO2011090965, WO2011043913, WO2011022460, WO2012061259, WO2012054365, WO2012044638, W02010080724, W0201021865, W02008103276, WO2013086373 and WO2013086354, US Patent Nos. 7,893,302, 7,404,969, 8,283,333, and 8,466,122 and US Patent Publication No. US20100036115, US20120202871, US20130064894, US20130129785, US20130150625, US20130178541 and S20130225836; the contents of each of which are herein incorporated by reference in their entirety.

[0136] In some embodiments, a cationic lipid may be selected from (20Z,23Z)-N,N- dimethylnonacosa-20,23-dien-10-amine, (17Z,20Z)-N,Ndimemylhexacosa-17,20-dien-9-amine, (lZ,19Z)-N5N-dimethylpentacosa-l 6, 19-dien-8-amine, (13Z,16Z)-N,N-dimethyldocosa-13,16- dien-5-amine, (12Z,15Z)-N,N dimethylhenicosa-12,15- dien-4-amine, (14Z,17Z)-N,N- dimethyltricosa-14,1 7-di en-6-amine, (15Z,18Z)-N,N-dimethyltetracosa-15,18-dien-7-amine, (18Z,21Z)-N,Ndimethylheptacosa-18,21-dien-10-amine, (15Z,18Z)-N,N-dimethyltetracosa- 15,18-dien-5-amine, (14Z,17Z)-N,N-dimethyltricosa-14,17-dien-4-amine, (19Z,22Z)- N,Ndimeihyloctacosa-19,22-dien-9-amine, (18Z,21 Z)-N,N-dimethylheptacosa- 18 ,21 -dien-8 — amine, (17Z,20Z)-N,N-dimethylhexacosa- 17,20-dien-7-amine, (16Z,19Z)- N,Ndimethylpentacosa- 16, 19-dien-6-amine, (22Z,25Z)-N,N-dimethylhentriaconta-22,25- dien- 10-amine, (21 Z ,24Z)-N,N-dimethyltriaconta-21,24-dien-9-amine, (18Z)-N,Ndimetylheptacos- 18-en-10-amine, (17Z)-N,N-dimethylhexacos-17-en-9-amine, (19Z,22Z)-N,N- dimethyloctacosa-19,22-dien-7-amine, N,N-dimethylheptacosan-10-amine, (20Z,23Z)-N-ethyl-N-methylnonacosa-20,23-dien-10-amine, 1-[(1 lZ,14Z)-l-nonylicosa-l 1,14-dien-l-yl] pyrrolidine, (20Z)-N,N-dimethylheptacos-20-en-l 0-amine, (15Z)-N,N-dimethyl eptacos-15-en- 1 0-amine, (14Z)-N,N-dimethylnonacos-14-en-10- amine, (17Z)-N,N-dimethylnonacos-17-en- 10-amine, (24Z)-N,N-dimethyltritriacont-24-en- 10-amine, (20Z)-N,N-dimethylnonacos-20-en- 1 0-amine, (22Z)-N,Ndimethylhentriacont- 22-en- 10-amine, (16Z)-N,N-dimethylpentacos-16-en- 8-amine, (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien- 1 — amine, (13Z,16Z)- N,Ndimethy 1 -3-nonyldocosa- 13,16-dien-l — amine, N,N-dimethyl- 1 - [( 1 S ,2R)-2- oetyleyclopropyl] eptadecan- 8-amine, 1 - [( 1 S ,2R)-2-hexylcyclopropy 1 ] -N,Ndimethylnonadecan- 10-amine, N,N-dimethyl-l-[(lS ,2R)-2-oetylcyclopropyl]nonadecan-10-amine, N,N-dimethyl- 21-[(lS,2R)-2-octylcyclopropyl]henicosan-10-amine,N,N-dimethyl-l- [(lS,2S)-2- { [(1R,2R)- 2- p entyl cy clopropyl] methyl } cy cl opropyl ]nonadecan- 10-amine, N,N-di methyl -1 - [(lS,2R)-2-octylcyclopropyl]hexadecan-8-amine, N,N-dimethyl-[(lR,2S)-2 undecyIcyclopropyl]tetradecan-5-amine, N,N-dimethyl-3- {7- [(lS,2R)-2- octylcyclopropyl]heptyll dodecan-1 — amine, l-[(lR,2S)-2-hepty leyclopropyl]- N,Ndimethyloctadecan- 9 — amine, 1 - [( 1 S ,2R)-2-decylcy clopropy 1 ] -N,N-dimethylpentadecan- 6-amine, N,N-dimethy 1 - 1 - [( 1 S ,2R)-2-octylcyclopropyl]pentadecan-8 -amine, R-N,Ndimethy 1 - 1 - [(9Z,12Z)-octadeca-9,12- dien-l-yloxy]-3-(octyloxy)propan-2-amine, S-N,Ndimethyl-l- [(9Z,12Z)-octadeca- 9,12-dien-l-yloxy]-3-(octyloxy)propan-2-amine, 1- {2-[(9Z,12Z)-octadeca- 9,12-dien-l-yloxy]-l-[(octyloxy)methyl]ethyllpyrrolidine, (2S)-N,Ndimethyl-l- [(9Z,12Z)- octadeca-9,12-dien-l-yloxy]-3-[(5Z)-oct-5-en-l-yloxy]propan-2-amine, 1- {2-[(9Z,12Z)- octadeca-9,12-dien-l-yloxy]-l- [(octyloxy)methyl]ethyllazetidine, (2S)-1- (hexyloxy)-N,N- dimethy l-3-[(9Z, 12Z)-octadeca-9, 12-dien-l-yloxy]propan-2- amine, (2S)-l-(heptyloxy)-N,N- dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-lyloxy] propan-2-amine, N,N-dimethyl-l- (nonyloxy)-3-[(9Z,12Z)-octadeca-9,12-dien-l- yl oxy] propan-2-amine, N,N-di methyl-1 -[(9Z)- octadec-9-en-l -yloxy] -3 - (octyl oxy)prop an-2-amine; (2 S)-N,N-dimethyl-l-[(6Z, 9Z,12Z)- octadeca-6, 9,12-tri en-1- yloxy]-3 - (octyloxy )propan-2-amine, (2 S)-l-[(l lZ,14Z)-icosa-l l,14- dien-l-yloxy]-N,Ndimethyl- 3-(pentyloxy)propan-2-amine, (2 S)-l-(hexyl oxy)-3 - [(HZ,14Z)-i co sa-11,14- di en-1 -yloxy]-N,N-dimethylpropan-2-amine, 1- [(HZ,14Z)-icosa-l l,14-dien-l - yloxy]- N,N-dimethy 1-3 -(octyloxy)propan-2-amine, 1 -[(13Z,16Z)-docosa-13,16-dien-l- yloxy]-N,N-dimethyl-3 -(octyloxy )propan-2-amine, (2 S)-l- [(13Z,16Z)-docosa-13,16-dien-l - yl oxy] -3 -(hexyl oxy)-N,N-dimethylprop an-2-amine, (2 S)-l- [(13Z)-doco s- 13 -en-l-yl oxy]- 3 -(hexyloxy)-N,N-dimethylpropan-2-amine, 1 -[(13Z)-docos-13 -en-1 -yloxy] -N,Ndimethyl- 3-(octyl oxy)propan-2-amine, l-[(9Z)-hexadec-9-en-l-yloxy]-N,N-dimethyl-3- (octyloxy )propan- 2-amine, (2R)-N,N-dimethyl-H(l-metoyloctyl)oxy]-3-[(9Z,12Z)- octadeca-9,12-dien-l- yloxy]propan-2-amine, (2R)-l-[(3,7- dim ethyl octyl)oxy] -N,Ndimethyl- 3 - [(9Z,12Z)- octadeca-9,12-di en-l-yloxy] propan-2-amine, N,N-dimethyl-l - (octyloxy)-3-({ 8-[(l S,2 S)-2- [(lR,2R)-2- pentylcyclopropyl]methylIcyclopropyl]octylIoxy)propan-2-amine, N,N-dimethyl-l - [8- (2-oc lyl cycl opropyl)octyl] oxy}-3 -(octyl oxy)prop an-2-amine and (11E,2OZ,23Z)- N,Ndimethylnonacosa- l l,20,2-trien-10-amine or a pharmaceutically acceptable salt or stereoisomer thereof.

[0137] In some embodiments, the ionizable cationic lipids refer to lipid and lipid-like molecules with nitrogen atoms that can acquire charge (pKa). These molecules with amino groups typically have between 2 and 6 hydrophobic chains, often alkyl or alkenyl such as C6-C24alkyl or alkenyl groups, but may have at least 1 or more that 6 tails. In some embodiments, these cationic ionizable lipids are dendrimers, which are a polymer exhibiting regular dendritic branching, formed by the sequential or generational addition of branched layers to or from a core and are characterized by a core, at least one interior branched layer, and a surface branched layer. (See Petar R. Dvornic and Donald A. Tomalia in Chem. in Britain, 641-645, August 1994.) In other embodiments, the term “dendrimer” as used herein is intended to include, but is not limited to, a molecular architecture with an interior core, interior layers (or “generations”) of repeating units regularly attached to this initiator core, and an exterior surface of terminal groups attached to the outermost generation. A “dendron” is a species of dendrimer having branches emanating from a focal point which is or can be joined to a core, either directly or through a linking moiety to form a larger dendrimer. In some embodiments, the dendrimer structures have radiating repeating groups from a central core which doubles with each repeating unit for each branch. In some embodiments, the dendrimers described herein may be described as a small molecule, medium-sized molecules, lipids, or lipid-like material. These terms may be used to describe compounds described herein which have a dendron like appearance (e.g. molecules which radiate from a single focal point).

[0138] While dendrimers are polymers, dendrimers may be preferable to traditional polymers because they have a controllable structure, a single molecular weight, numerous and controllable surface functionalities, and traditionally adopt a globular conformation after reaching a specific generation. Dendrimers can be prepared by sequentially reactions of each repeating unit to produce monodisperse, tree-like and / or generational structure polymericstructures. Individual dendrimers consist of a central core molecule, with a dendritic wedge attached to one or more functional sites on that central core. The dendrimeric surface layer can have a variety of functional groups disposed thereon including anionic, cationic, hydrophilic, or lipophilic groups, according to the assembly monomers used during the preparation.

[0139] Modifying the functional groups and / or the chemical properties of the core, repeating units, and the surface or terminating groups, their physical properties can be modulated. Some properties which can be varied include, but are not limited to, solubility, toxicity, immunogenicity and bioattachment capability. Dendrimers are often described by their generation or number of repeating units in the branches. A dendrimer consisting of only the core molecule is referred to as Generation 0, while each consecutive repeating unit along all branches is Generation 1, Generation 2, and so on until the terminating or surface group. In some embodiments, half generations are possible resulting from only the first condensation reaction with the amine and not the second condensation reaction with the thiol.

[0140] Preparation of dendrimers requires a level of synthetic control achieved through series of stepwise reactions comprising building the dendrimer by each consecutive group. Dendrimer synthesis can be of the convergent or divergent type. During divergent dendrimer synthesis, the molecule is assembled from the core to the periphery in a stepwise process involving attaching one generation to the previous and then changing functional groups for the next stage of reaction. Functional group transformation is necessary to prevent uncontrolled polymerization. Such polymerization would lead to a highly branched molecule that is not monodisperse and is otherwise known as a hyperbranched polymer. Due to steric effects, continuing to react dendrimer repeat units leads to a sphere shaped or globular molecule, until steric overcrowding prevents complete reaction at a specific generation and destroys the molecule's monodispersity. Thus, in some embodiments, the dendrimers of G1-G10 generation are specifically contemplated. In some embodiments, the dendrimers comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeating units, or any range derivable therein. In some embodiments, the dendrimers used herein are GO, Gl, G2, or G3. However, the number of possible generations (such as 11, 12, 13, 14, 15, 20, or 25) may be increased by reducing the spacing units in the branching polymer.

[0141] Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk mediaand the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications.

[0142] In some embodiments, the dendrimers are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. The dendrimers may include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group. Additionally, the repeating units of the dendrimers may contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a polyamine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (-NH2) or a carboxylic acid (-CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester.

[0143] In some embodiments, the cationic ionizable lipids contain one or more asymmetrically-substituted carbon or nitrogen atoms, and may be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. Cationic ionizable lipids may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present application can have the .S- or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be present as constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by any theory, it is believed that such cationic ionizable lipids exist because the starting monomers react first with the primaryamines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines.

[0144] Chemical formulas used to represent cationic ionizable lipids of the present application will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups. Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.

[0145] In some embodiments, the cationic ionizable lipids have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.

[0146] In some embodiments, atoms making up the cationic ionizable lipids include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.

[0147] It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.

[0148] In some embodiments, the ionizable clipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises an ammonium group which is positively charged at physiological pH and contains at least two hydrophobic groups. In some embodiments, the ammonium group is positively charged at a pH from about 6 to about 8. In some embodiments, the ionizable lipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises at least two C6-C24alkyl or alkenyl groups.

[0149] Modifying the functional groups and / or the chemical properties of the core, repeating units, and the surface or terminating groups, their physical properties can be modulated. Someproperties which can be varied include, but are not limited to, solubility, toxicity, immunogenicity and bioattachment capability. Dendrimers are often described by their generation or number of repeating units in the branches. A dendrimer consisting of only the core molecule is referred to as Generation 0, while each consecutive repeating unit along all branches is Generation 1, Generation 2, and so on until the terminating or surface group. In some embodiments, half generations are possible resulting from only the first condensation reaction with the amine and not the second condensation reaction with the thiol.

[0150] Preparation of dendrimers requires a level of synthetic control achieved through series of stepwise reactions comprising building the dendrimer by each consecutive group. Dendrimer synthesis can be of the convergent or divergent type. During divergent dendrimer synthesis, the molecule is assembled from the core to the periphery in a stepwise process involving attaching one generation to the previous and then changing functional groups for the next stage of reaction. Functional group transformation is necessary to prevent uncontrolled polymerization. Such polymerization would lead to a highly branched molecule that is not monodisperse and is otherwise known as a hyperbranched polymer. Due to steric effects, continuing to react dendrimer repeat units leads to a sphere shaped or globular molecule, until steric overcrowding prevents complete reaction at a specific generation and destroys the molecule's monodispersity. Thus, in some embodiments, the dendrimers of G1-G10 generation are specifically contemplated. In some embodiments, the dendrimers comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeating units, or any range derivable therein. In some embodiments, the dendrimers used herein are GO, Gl, G2, or G3. However, the number of possible generations (such as 11, 12, 13, 14, 15, 20, or 25) may be increased by reducing the spacing units in the branching polymer.

[0151] Additionally, dendrimers have two major chemical environments: the environment created by the specific surface groups on the termination generation and the interior of the dendritic structure which due to the higher order structure can be shielded from the bulk media and the surface groups. Because of these different chemical environments, dendrimers have found numerous different potential uses including in therapeutic applications.

[0152] In some embodiments, the dendrimers are assembled using the differential reactivity of the acrylate and methacrylate groups with amines and thiols. In some embodiments, the dendrimers include secondary or tertiary amines and thioethers formed by the reaction of an acrylate group with a primary or secondary amine and a methacrylate with a mercapto group.Additionally, in some embodiments, the repeating units of the dendrimers contain groups which are degradable under physiological conditions. In some embodiments, these repeating units may contain one or more germinal diethers, esters, amides, or disulfides groups. In some embodiments, the core molecule is a monoamine which allows dendritic polymerization in only one direction. In other embodiments, the core molecule is a polyamine with multiple different dendritic branches which each may comprise one or more repeating units. The dendrimer may be formed by removing one or more hydrogen atoms from this core. In some embodiments, these hydrogen atoms are on a heteroatom such as a nitrogen atom. In some embodiments, the terminating group is a lipophilic groups such as a long chain alkyl or alkenyl group. In other embodiments, the terminating group is a long chain haloalkyl or haloalkenyl group. In other embodiments, the terminating group is an aliphatic or aromatic group containing an ionizable group such as an amine (-NH2) or a carboxylic acid (-CO2H). In still other embodiments, the terminating group is an aliphatic or aromatic group containing one or more hydrogen bond donors such as a hydroxide group, an amide group, or an ester.

[0153] In some embodiments, the cationic ionizable lipids contain one or more asymmetrically-substituted carbon or nitrogen atoms, and can be isolated in optically active or racemic form. Thus, all chiral, diastereomeric, racemic form, epimeric form, and all geometric isomeric forms of a chemical formula are intended, unless the specific stereochemistry or isomeric form is specifically indicated. In some embodiments, cationic ionizable lipids occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers. In some embodiments, a single diastereomer is obtained. The chiral centers of the cationic ionizable lipids of the present application can have the S or the R configuration. Furthermore, it is contemplated that one or more of the cationic ionizable lipids may be present as constitutional isomers. In some embodiments, the compounds have the same formula but different connectivity to the nitrogen atoms of the core. Without wishing to be bound by theory, in some embodiments, such cationic ionizable lipids exist because the starting monomers react first with the primary amines and then statistically with any secondary amines present. Thus, the constitutional isomers may present the fully reacted primary amines and then a mixture of reacted secondary amines.

[0154] Chemical formulas used to represent cationic ionizable lipids of the present application will typically only show one of possibly several different tautomers. For example, many types of ketone groups are known to exist in equilibrium with corresponding enol groups.Similarly, many types of imine groups exist in equilibrium with enamine groups. Regardless of which tautomer is depicted for a given formula, and regardless of which one is most prevalent, all tautomers of a given chemical formula are intended.

[0155] The cationic ionizable lipids of the present application may also have the advantage that they may be more efficacious than, be less toxic than, be longer acting than, be more potent than, produce fewer side effects than, be more easily absorbed than, and / or have a better pharmacokinetic profile (e.g., higher oral bioavailability and / or lower clearance) than, and / or have other useful pharmacological, physical, or chemical properties over, compounds known in the prior art, whether for use in the indications stated herein or otherwise.

[0156] In addition, atoms making up the cationic ionizable lipids of the present application are intended to include all isotopic forms of such atoms. Isotopes, as used herein, include those atoms having the same atomic number but different mass numbers. By way of general example and without limitation, isotopes of hydrogen include tritium and deuterium, and isotopes of carbon include13C and14C.

[0157] It should be recognized that the particular anion or cation forming a part of any salt form of a cationic ionizable lipids provided herein is not critical, so long as the salt, as a whole, is pharmacologically acceptable. Additional examples of pharmaceutically acceptable salts and their methods of preparation and use are presented in Handbook of Pharmaceutical Salts: Properties, and Use (2002), which is incorporated herein by reference.

[0158] In some embodiments, the ionizable cationic lipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises an ammonium group which is positively charged at physiological pH and contains at least two hydrophobic groups. In some embodiments, the ammonium group is positively charged at a pH from about 6 to about 8. In some embodiments, the ionizable lipid is a dendrimer or dendron. In some embodiments, the ionizable lipid comprises at least two C6-C24alkyl or alkenyl groups.Dendrimers of Formula (I)

[0159] In some embodiments, the ionizable lipid comprises at least two C8-C24alkyl groups. In some embodiments, the ionizable lipid is a dendrimer further defined by the formula:Core- (Repeating Unit)n-Terminating Group (D-I) wherein one or more hydrogen atoms of the core are replaced with a repeating unit and wherein: the core has the formula:wherein:Xi is amino or C1-C12alkylamino, C1-C12dialkylamino, C3-C12heterocycloalkyl, C5-C12heteroaryl, or a substituted version thereof;R1is amino, hydroxy, mercapto, C1-C12alkylamino, or C1-C12dialkylamino, or a substituted version of either of these groups; and a is 1, 2, 3, 4, 5, or 6; or the core has the formula:Xo ■Z' v Ro\H2)z (D.ni)wherein:X2is N(R5)y;R5is hydrogen, C1-C18alkyl, or substituted C1-C18alkyl; and y is 0, 1, or 2, provided that the sum of y and z is 3;R2is amino, hydroxy, mercapto, C1-C12alkylamino, or C1-C12dialkylamino, or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, or 3; provided that the sum of z and y is 3; or the core has the formula:wherein:X3is -NR6-, wherein R6is hydrogen, C1-C8alkyl, or C1-C8substituted alkyl, -O-, or C1-C8alkylaminodiyl, C1-C8alkoxydiyl, C6-C8arenediyl, C8-C8heteroarenediyl, C3-C8heterocycloalkanediyl, or a substituted version of any of these groups;R3and R4 are each independently amino, hydroxy, mercapto, C1-C12alkylamino, or C1- C12dialkylamino, or a substituted version of either of these groups; or a group of the formula:wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rfare each independently hydrogen, C1-C6alkyl, or substituted C1-C6alkyl; c and d are each independently 1, 2, 3, 4, 5, or 6; or the core is C1-C18alkylamine, C1-C36dialkylamine, C3-C12heterocycloalkane, or a substituted version of any of these groups; wherein the repeating unit comprises a degradable diacyl or a degradable diacyl and a linker; the degradable diacyl group has the formula:wherein:A1and A2are each independently -O- , -S-, or -NRa-, wherein:Rais hydrogen, C1-C6alkyl, or substituted C1-C6alkyl;Y3is C1-C12alkanediyl, C1-C12alkenediyl, C6-C12arenediyl, or a substituted version of any of these groups; or a group of the formula:wherein:X3and X4 are C1-C12alkanediyl, C2-C12alkenediyl, C6-C12arenediyl, or a substituted version of any of these groups;Y5is a covalent bond, C1-C12alkanediyl, C1-C12alkenediyl, C6-C12arenediyl, or a substituted version of any of these groups; andR9is C1-C8alkyl or substituted C1-C8alkyl; the linker group has the formula:wherein:Y1is C1-C12alkanediyl, C1-C12alkenediyl, C6-C12arenediyl, or a substituted version of any of these groups; and wherein eachindependently denotes a point of attachment to another repeating unit or a terminating group; and the terminating group has the formula:wherein:Y4is alkanediyl or an Ci -C18alkanediyl wherein one or more of the hydrogen atoms on the C1-C18alkanediyl has been replaced with -OH, -F, -Cl, -Br, -I, -SH, -OCH3, -OCH2CH3, -SCH3, or -OC(O)CH3;R10is hydrogen, carboxy, hydroxy, C6-C12aryl, C1-C12alkylamino, C1-C12dialkylamino, C3-C12N-heterocycloalkyl, -C(O)N(Rn)- C1-C6alkanediyl- C3-C12heterocycloalkyl, -C(O)- C1-C12alkylamino, — C(O)— C1-C12dialkylamino, or -C(O)- C3-C12N-heterocycloalkyl, wherein:R11 is hydrogen, C1-C6alkyl, or substituted C1-C6alkyl; wherein the final degradable diacyl in the chain is attached to a terminating group; n is 0, 1, 2, 3, 4, 5, or 6; or a pharmaceutically acceptable salt thereof.

[0160] In some embodiments, the terminating group is further defined by the formula:wherein:Y4 is Cl -Cl 8 alkanediyl; andR10is hydrogen. In some embodiments, Ai and A2 are each independently -O- or-NRa-.

[0161] In some embodiments of the dendrimer of formula (D-I), the terminating group is a structure selected from the structures in Table 2.

[0162] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:

[0163] wherein:X2is N(R5)y;R5is hydrogen or C1-C8alkyl, or substituted C1-C18alkyl; and y is 0, 1, or 2, provided that the sum of y and z is 3;R2is amino, hydroxy, or mercapto, or C1-C12alkylamino, C1-C12dialkylamino, or a substituted version of either of these groups; b is 1, 2, 3, 4, 5, or 6; and z is 1, 2, 3; provided that the sum of z and y is 3.

[0164] In some embodiments of the dendrimer of formula (D-I), the core is further defined by the formula:wherein:X3is -NR6-, wherein R6is hydrogen, C1-C8alkyl, or substituted C1-C8alkyl, -O-, or C1-C8alkylaminodiyl, C1-C8alkoxydiyl, C1-C8arenediyl, C1-C8heteroarenediyl, C1-C8heterocycloalkanediyl, or a substituted version of any of these groups;R3and R4 are each independently amino, hydroxy, or mercapto, or C1-C12alkylamino, dialkylamino, or a substituted version of either of these groups; or a group of the formula:wherein: e and f are each independently 1, 2, or 3; provided that the sum of e and f is 3;Rc, Rd, and Rf are each independently hydrogen, C1-C6alkyl, or substituted C1-C6alkyl;c and d are each independently 1, 2, 3, 4, 5, or 6.

[0165] In some embodiments of the dendrimer of formula (I), the terminating group is represented by the formula:wherein:Y4 is alkanediyl(c<18); andR10is hydrogen.

[0166] In some embodiments of the dendrimer of formula (D-I), a core of the structure of formula (D-IV) is:

[0167] In some embodiments of the dendrimer of formula (D-I), the core comprises a structural formula set forth in Table 2 and pharmaceutically acceptable salts thereof, wherein *indicates a point of attachment of the core to a repeating unit (i.e., where a hydrogen of the core is relaced with a repeating unit).

[0168] In some embodiments of the dendrimer of formula (D-I), the degradable diacyl is further defined as:In some embodiments of the dendrimer of formula (D-I), the linker is further defined aswherein Y1is C1-C8alkanediyl or substituted C1-C12alkanediyl.

[0169] In some embodiments, in the core of formula (D-IV), R6is H. In some embodiments, in the core of formula (D-IV), R6is C1-C8alkyl. In some embodiments, in the core of formula (D-IV), R6is substituted alkyl (e.g., alkyl substituted with -NH2, alkyl substituted with -NHCH3, or alkyl substituted with -NHCH2CH3).

[0170] In some embodiments one or two hydrogen atoms of the core are replaced with a repeating unit. In some embodiments three or four hydrogen atoms of the core is replaced with a repeating unit. In some embodiments five hydrogen atoms of the core is replaced with a repeating unit. In some embodiments six hydrogen atoms of the core is replaced with a repeating unit.

[0171] In some embodiments of the dendrimer of formula (D-I), the dendrimer is selected from the group consisting of:and pharmaceutically acceptable salts thereof.Dendrimers of Formula (X)

[0172] In some embodiments of the lipid composition, the ionizable lipid is a dendrimer of the formu . In some embodiments, the ionizable lipid is a dendrimer of theformula

[0173] In some embodiments of the lipid composition, the ionizable lipid is a dendrimer of a generation (g) having a structural formula:or a pharmaceutically acceptable salt thereof, wherein:(a) the core comprises a structural formula (Xcore):wherein:Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b-;R2is independently at each occurrence Rlgor -L2-NRleRlf;R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C6, such as C1-C3) alkyl;Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted (e.g., C1-C12) alkyl;L°, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene] -[heterocycloalkyl] -[alkylene], [alkylene] -(ary lene)- [alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a (e.g., C4-C6) heterocycloalkyl (e.g., containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of Rlcand Rld; and x1is 0, 1, 2, 3, 4, 5, or 6; and(b) each branch of the plurality (N) of branches independently comprises a structural formula (XBranch):wherein:* indicates a point of attachment of the branch to the core;G=0, whenwhen g^l;(c) each diacyl group independently comprises a structural formula, wherein:* indicates a point of attachment of the diacyl group at the proximal end thereof;** indicates a point of attachment of the diacyl group at the distal end thereof;Y3is independently at each occurrence an optionally substituted (e.g., C1-C12); alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene;A1and A2are each independently at each occurrence -O-, -S-, or -NR4-, wherein:R4is hydrogen or optionally substituted (e.g., C1-C6) alkyl; m1and m2are each independently at each occurrence 1, 2, or 3; andR3C, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted (e.g., C1-C8) alkyl; and(d) each linker group independently comprises a structural formula wherein:** indicates a point of attachment of the linker to a proximal diacyl group;*** indicates a point of attachment of the linker to a distal diacyl group; and Y1is independently at each occurrence an optionally substituted (e.g., C1-C12) alkylene, an optionally substituted (e.g., C1-C12) alkenylene, or an optionally substituted (e.g., C1-C12) arenylene; and(e) each terminating group is independently selected from optionally substituted(e.g., C1-C18, such as C4-C18) alkylthiol, and optionally substituted (e.g., C1-C18, such as C4- C18) alkenylthiol.

[0174] In some embodiments of Xcore, Q is independently at each occurrence a covalent bond, -O-, -S-, -NR2-, or -CR3aR3b. In some embodiments of XcoreQ is independently at each occurrence a covalent bond. In some embodiments of XcoreQ is independently at each occurrence an -O-. In some embodiments of XcoreQ is independently at each occurrence a -S-. In some embodiments of XcoreQ is independently at each occurrence a -NR2and R2isindependently at each occurrence Rlgor -L2-NRleRlf. In some embodiments of XcoreQ is independently at each occurrence a -CR3aR3bR3a, and R3aand R3bare each independently at each occurrence hydrogen or an optionally substituted alkyl (e.g., C1-C6, such as C1-C3).

[0175] In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen, or an optionally substituted alkyl. In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch, hydrogen. In some embodiments of Xcore, Rla, Rlb, Rlc, Rld, Rle, Rlf, and Rlg(if present) are each independently at each occurrence a point of connection to a branch an optionally substituted alkyl (e.g., C1-C12).

[0176] In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from a covalent bond, alkylene, heteroalkylene, [alkylene] - [heterocycloalkyl]- [alkylene], [alkylene]-(arylene)-[alkylene], heterocycloalkyl, and arylene; or, alternatively, part of L1form a heterocycloalkyl (e.g., C4-C6and containing one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur) with one of Rlcand Rld. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a covalent bond. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a hydrogen. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be an alkylene (e.g., C1-C12, such as C1-C6or C1-C3). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a hetero alkylene (e.g., C1-C12, such as C1-C8or C1-C6). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a hetero alkylene (e.g., C2-C8alkyleneoxide, such as oligo(ethyleneoxide)). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a [alkylene] -[heterocycloalkyl] -[alkylene] [(e.g., C1-C6) alkylene] -[(e.g., C4-C6) heterocycloalkyl]-[(e.g., C1-C6) alkylene]. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)- [alkylene] [(e.g., C1-C6) alkylene]-(arylene)-[(e.g., C1-C6) alkylene]. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a [alkylene]-(arylene)- [alkylene] (e.g., [(e.g., C1-C6) alkylene] -phenylene- [(e.g., C1-C6) alkylene]). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be a heterocycloalkyl (e.g., C4-C6heterocycloalkyl). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence can be an arylene (e.g., phenylene). In someembodiments of Xcore, part of L1form a heterocycloalkyl with one of Rlcand Rld. In some embodiments of Xcore, part of L1form a heterocycloalkyl (e.g., C4-C6heterocycloalkyl) with one of Rlcand Rldand the heterocycloalkyl can contain one or two nitrogen atoms and, optionally, an additional heteroatom selected from oxygen and sulfur.

[0177] In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from a covalent bond, C1-C6alkylene (e.g., C1-C3alkylene), C2-C12(e.g., C2-C8) alkyleneoxide (e.g., oligo(ethyleneoxide), such as -(CH2CH2O)I-4-(CH2CH2)-), [(C1-C4) alkylene] -[(C4-C6) heterocycloalkyl] -[(C1-C4) alkylene] (e.g., ), and [(C1-C4) alkylene] -phenylene- [(C1-C4) alkylene] (e.g.,). In some embodiments of Xcore,L°, L1, and L2are each independently at each occurrence selected from C1-C6alkylene (e.g., C1- C3alkylene), -(C1-C3alkylene-O)1-4-(C1-C3alkylene), -(C1-C3alkylene) -phenylene- (C1-C3alkylene)-, and -(C1-C3alkylene)-piperazinyl-(C1-C3alkylene)-. In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence C1-C6alkylene (e.g., C1-C3alkylene).In some embodiments, L°, L1, and L2are each independently at each occurrence C2-C12(e.g., C2- C8) alkyleneoxide (e.g., -(C1-C3alkylene-O)1-4-(C1-C3alkylene)). In some embodiments of Xcore, L°, L1, and L2are each independently at each occurrence selected from [(C1-C4) alkylene]- [(C4-C6) heterocycloalkyl] -[(C1-C4) alkylene] (e.g., -(C1-C3alkylene)-phenylene-(C1-C3alkylene)-) and [(C1-C4) alkylene] -[(C4-C6) heterocycloalkyl] -[(C1-C4) alkylene] (e.g., -(C1-C3alky lene)-piperaziny 1- (C 1 -C3alkylene) -) .

[0178] In some embodiments of Xcore, x1is 0, 1, 2, 3, 4, 5, or 6. In some embodiments of Xcore, x1is 0. In some embodiments of Xcore, x1is 1. In some embodiments of Xcore, x1is 2. In some embodiments of Xcore, x1is 0, 3. In some embodiments of Xcorex1is 4. In some embodiments of Xcorex1is 5. In some embodiments of Xcore, x1is 6.

[0179] In some embodiments of Xcore, the core comprises a structural formula:a structura ormu a: In some em o ments o Xcore, t e core compr sesa structural formula:). In some embodiments of Xcore, the core comprises a structural formula:). In some embodiments of Xcore, the core comprises a structural formula:. In some embodiments of Xcore, the core comprises a structural formula:). In some embodiments of Xcore, the core comprises a structurale embodiments of Xcore, the core comprises a structural formula:, wherein Q’ is -NR2- or -CR3aR3b-; q1and q2are each independently 1or 2. In some embodiments of Xcore, the core comprises a structural formula:some embodiments of Xcore, the core comprises a structural formulaoptionally substituted aryl or an optionally substituted (e.g., C3-C12, such as C3-C5) heteroaryl. In some embodiments of Xcore, the core comprises has a structural formula

[0180] In some embodiments of Xcore, the core comprises a structural formula set forth inTable 2 and pharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.

[0181] In some embodiments, the plurality (N) of branches comprises at least 3 branches, at least 4 branches, at least 5 branches. In some embodiments, the plurality (N) of branchescomprises at least 3 branches. In some embodiments, the plurality (N) of branches comprises at least 4 branches. In some embodiments, the plurality (N) of branches comprises at least 5 branches.

[0182] In some embodiments of XBranch, g is 1, 2, 3, or 4. In some embodiments of XBranch, g is 1. In some embodiments of XBranch, g is 2. In some embodiments of XBranch, g is 3. In some embodiments of XBranch, g is 4.

[0183] In some embodiments of XBranch, Z = 2,g_| )and when g=1, G=0. In some embodimentswhen g^l.

[0184] In some embodiments of XBranch, g=1, G=0, Z=1, and each branch of the plurality of branches comprises a structural formula each branch of the plurality of branches comprises a structural formula

[0185] In some embodiments of XBranch, g=2, G=1, Z=2, and each branch of the plurality of branches comprises a structural formula

[0186] In some embodiments of XBranch, g=3, G=3, Z=4, and each branch of the plurality of branches comprises a structural formula

[0187] In some embodiments of XBranch, g=4, G=7, Z=8, and each branch of the plurality of branches comprises a structural formula

[0188] In some embodiments, the dendrimers described herein with a generation (g) = 1 hasthe structure:

[0189] In some embodiments, the dendrimers described herein with a generation (g) = 1 hasthe structure:

[0190] An example formulation of the dendrimers described herein for generations 1-4 is shown in Table 1. The number of diacyl groups, linker groups, and terminating groups can be calculated based on g.Table 1. Formulation of Dendrimer Groups Based on Generation (g)

[0191] In some embodiments, the diacyl group independently comprises a structural formula* indicates a point of attachment of the diacyl group at the proximal end thereof, and ** indicates a point of attachment of the diacyl group at the distal end thereof.

[0192] In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted; alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the diacyl group of XBranch, Y3is independently at each occurrence an optionally substituted arenylene (e.g., C1-C12).

[0193] In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-, -S-, or -NR4-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -O-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -S-. In some embodiments of the diacyl group of XBranch, A1and A2are each independently at each occurrence -NR4- and R4is hydrogen or optionally substituted alkyl (e.g., C1-C6). In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1, 2, or 3. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 1. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 2. In some embodiments of the diacyl group of XBranch, m1and m2are each independently at each occurrence 3. In some embodiments of the diacyl group of XBranch, R3C, R3d, R3e, and R3fare each independently at each occurrence hydrogen or an optionally substituted alkyl. In some embodiments of the diacyl group of XBranch, R3C, R3d, R3e, and R3fare each independently at each occurrence hydrogen. In some embodiments of the diacyl group of XBranch, R3c, R3d, R3e, and R3fare each independently at each occurrence an optionally substituted (e.g., C1-C8) alkyl.

[0194] In some embodiments of the diacyl group, A1is -O- or -NH-. In some embodiments of the diacyl group, A1is -O-. In some embodiments of the diacyl group, A2is -O- or -NH-. In some embodiments of the diacyl group, A2is -O-. In some embodiments of the diacyl group, Y3is C1-C12(e.g., C1-C6, such as C1-C3) alkylene.

[0195] In some embodiments of the diacyl group, the diacyl group independently at each occurrence comprises a structural formulaoptionally R3c, R3d,R3e, and R3fare each independently at each occurrence hydrogen or C1-C3alkyl.

[0196] In some embodiments, linker group independently comprises a structural formula, ** indicates a point of attachment of the linker to a proximal diacyl group, and *** indicates a point of attachment of the linker to a distal diacyl group.

[0197] In some embodiments of the linker group of XBranchif present, Y 1 is independently at each occurrence an optionally substituted alkylene, an optionally substituted alkenylene, or an optionally substituted arenylene. In some embodiments of the linker group of XBranchif present, Y1is independently at each occurrence an optionally substituted alkylene (e.g., C1-C12). In some embodiments of the linker group of XBranchif present, Y 1 is independently at each occurrence an optionally substituted alkenylene (e.g., C1-C12). In some embodiments of the linker group of Xuranch if present, Y i is independently at each occurrence an optionally substituted arenylene (e.g., C1-C12).

[0198] In some embodiments of the terminating group of XBranch, each terminating group is independently selected from optionally substituted alkylthiol and optionally substituted alkenylthiol. In some embodiments of the terminating group of XBranch, each terminating group is an optionally substituted alkylthiol (e.g., C1-C18, such as C4-C18). In some embodiments of the terminating group of XBranch, each terminating group is optionally substituted alkenylthiol (e.g., C1-C18, such as C4-C18).

[0199] In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18alkenylthiol or C1-C18alkylthiol, and the alkyl or alkenyl moiety isoptionally substituted with one or more substituents each independently selected from halogen, C6-C12aryl, C1-C12alkylamino, C4-C6AMieterocycloalkyl , -OH, -C(O)OH, -C(O)N(CI-C3alkyl)-(C1-C6alkylene)-(C1-C12alkylamino), -C(O)N(CI-C3alkyl)-(C1-C6alkylene)-(C4-C6JV-heterocycloalkyl), -C(O)-(C1-C12alkylamino), and -C(O)-(C4-C6AMieterocyclo alkyl), and the C4-C6N-heterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3alkyl or C1-C3hydroxyalkyl.

[0200] In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkenylthiol or C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl or alkenyl moiety is optionally substituted with one or more substituents each independently selected from halogen, C6-C12aryl (e.g., phenyl), C1-C12(e.g., C1-C8) alkylamino (e.g., C1-C6mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8di-alkylamino (such as)), C4-C6N-heterocycloalkyl (e.g.. / V-pyrrolidinyl (alkyl)-(C1-C6alkylene)-(C1-C12alkylamino (e.g., mono- or di-alkylamino)) (e.g.,Oheterocycloalkyl moiety of any of the preceding substituents is optionally substituted with C1-C3alkyl or C1-C3hydroxyalkyl. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent -OH. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkylthiol, wherein the alkyl moiety is optionally substituted with one substituent selected from C1-C12(e.g., C1-C8) alkylamino (e.g., C1-C6mono-alkylamino (such as -NHCH2CH2CH2CH3) or C1-C8di-alkylamino (such as, )) and C4-C6N-heterocycloalkyl(e.g., A-pyrrolidinyl), A-piperidinyl (), A-azepanyl)). In some embodiments of the terminating group of XBranch, each terminating group is independently C1- C18(e.g., C4-C18) alkenylthiol or C1-C18(e.g., C4-C18) alkylthiol. In some embodiments of the terminating group of XBranch, each terminating group is independently C1-C18(e.g., C4-C18) alkylthiol.Table 2. Example core structures

[0201] In some embodiments of Xcore, the core comprises a structural formula selected frompharmaceutically acceptable salts thereof, wherein * indicates a point of attachment of the core to a branch of the plurality of branches.

[0202] In some embodiments of the terminating group of XBranch, each terminating group is independently a structure selected from the structurea in Table 3. In some embodiments, the dendrimers described herein can comprise a terminating group or pharmaceutically acceptable salt, or thereof selected in Table 3.Table 3. Example terminating group / peripheries structures

[0203] In some embodiments, the dendrimer of Formula (X) is selected from those set forth in Table 4 and pharmaceutically acceptable salts thereof.Table 4. Example ionizable cationic lipo-dendrimersOther Ionizable lipids

[0204] In some embodiments of the lipid composition, the cationic lipid comprises a structural formula (D-I’):wherein: a is 1 and b is 2, 3, or 4; or, alternatively, b is 1 and a is 2, 3, or 4; m is 1 and n is 1; or, alternatively, m is 2 and n is 0; or, alternatively, m is 2 and n is 1; and R1, R2, R3, R4, R5, and R6are each independently selected from the group consisting of H, - CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, -CH2CH2C(=O)NHR7, and -CH2R7, wherein R7is independently selected from C3-C18alkyl, C3-C18alkenyl having one C=C double bond, a protecting group for an amino group, -C(=NH)NH2, a poly(ethylene glycol) chain, and a receptor ligand; provided that at least two moieties among R1to R6are independently selected from - CH2CH(OH)R7, -CH(R7)CH2OH, -CH2CH2C(=O)OR7, -CH2CH2C(=O)NHR7, or -CH2R7, wherein R7is independently selected from C3-C18alkyl or C3-C18alkenyl having one C=Cdouble bond; and wherein one or more of the nitrogen atoms indicated in formula (D-I’) may be protonated to provide a cationic lipid.

[0205] In some embodiments of the cationic lipid of formula (D-I’), a is 1. In some embodiments of the cationic lipid of formula (D-I’), b is 2. In some embodiments of the cationic lipid of formula (D-I’), m is 1. In some embodiments of the cationic lipid of formula (D-I’), n is 1. In some embodiments of the cationic lipid of formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or -CH2CH(OH)R7. In some embodiments of the cationic lipid of formula(D-I’), R1, R2, R3, R4, R5, and R6are each independently H or. In some embodiments of the cationic lipid of formula (D-I’), R1, R2, R3, R4, R5, and R6are each independently H or. In some embodiments of the cationic lipid of formula (D-I’), R is C3-C18alkyl (e.g., C6-C12alkyl).

[0206] In some embodiments, the cationic lipid of formula (D-I’) is 13,16,20-tris(2- hydroxydodecyl)-13,16,20,23-tetraazapentatricontane-l l,25-diol:

[0207] In some embodiments, the cationic lipid of formula (D-I’) is (117?,257?)-13,16,20- tris((7?)-2-hydroxydodecyl)-13,16,20,23-tetraazapentatricontane-l l,25-diol:

[0208] Additional cationic lipids that can be used in the compositions and methods of the present application include those cationic lipids as described in J. McClellan, M. C. King, Cell 2010, 141, 210-217, and International Patent Publication WO 2010 / 144740, WO 2013 / 149140, WO 2016 / 118725, WO 2016 / 118724, WO 2013 / 063468, WO 2016 / 205691, WO 2015 / 184256, WO 2016 / 004202, WO 2015 / 199952, WO 2017 / 004143, WO 2017 / 075531, WO 2017 / 117528, WO 2017 / 049245, WO 2017 / 173054 and WO 2015 / 095340, which are incorporated herein by reference for all purposes. Examples of those ionizable cationic lipids include but are not limited to those as shown in Table 5.ʼnll

[0209] In some embodiments of the lipid composition of the present application, the ionizable lipid is present in an amount of from about from about 20 mol% to about 23 mol%. In some embodiments, the ionizable lipid is present in an amount of about 20 mol%, about 20.5 mol%, about 21 mol%, about 21.5 mol%, about 22 mol%, about 22.5 mol%, or about 23 mol%. In other embodiments, the ionizable lipid is present in an amount of from about 7.5 mol% to about 20 mol%. In some embodiments, the ionizable lipid is present in an amount of about 7.5 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13mol%, about 14 mol%, about 15 mol%, about 16 mol%, about 17 mol%, about 18 mol%, about 19 mol%, or about 20 mol%.

[0210] In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of from about 5 mol% to about 30 mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of from about 10 mol% to about 25 mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of from about 15 mol% to about 20 mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of from about 10 mol% to about 20 mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of from about 20mol% to about 30mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of of at least (about) 5 mol%, at least (about) 10 mol%, at least (about) 15 mol%, at least (about) 20 mol%, at least (about) 25 mol%, or at least (about) 30 mol%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the ionizable lipid in an amount of of at most (about) 5 mol%, at most (about) 10 mol%, at most (about) 15 mol%, at most (about) 20 mol%, at most (about) 25 mol%, or at most (about) 30mol%.2. Phospholipids

[0211] In some embodiments, the LNP comprises a phospholipid. Phospholipids are a subset of non-cationic lipids that comprise a phosphate group. In some embodiments, the lipid component of LNP may include one or more phospholipids, such as one or more (poly) unsaturated lipids. Phospholipids may assemble into one or more lipid bilayers. In general, phospholipids may include a phospholipid moiety and one or more fatty acid moieties. In some embodiments, the phospholipid moiety may be selected from the group including, but not limited to, phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety may be selected from the group including, but not limited to, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0212] In some embodiments, non-natural species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid may be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group may undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions may be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as targeting or imaging moiety (e.g., a dye).

[0213] In some embodiments, the LNP described herein comprises about 5 mol% to about 30 mol% of phospholipid. In some embodiments, the LNP comprises about 10 mol% to about 30 mol%, or about 12 mol% to about 30 mol%, or about 14 mol% to about 30 mol%, or about 16 mol% to about 30 mol%, or about 18 mol% to about 30 mol%, or about 20 mol% to about 30 mol%, or about 22 mol% to about 30 mol%, or about 24 mol% to about 30 mol%, or about 26 mol% to about 30 mol%, or about 28 mol% to about 30 mol%. In some embodiments, the LNP comprises about 10 mol%, or about 11 mol%, or about 12 mol%, or about 13 mol%, or about 14 mol%, or about 15 mol%, or about 16 mol%, or about 17 mol%, or about 18 mol%, or about 19 mol%, or about 20 mol%, or about 21 mol%, or about 22 mol%, or about 23 mol%, or about 24 mol%, or about 25 mol%, or about 26 mol%, or about 27 mo%, or about 28 mol%, or about 29 mol%, or about 30 mol%.

[0214] In some embodiments, the LNP comprises about 5% to about 30% weight of phoshpolipid. In some embodiments, the LNP comprises about 5% weight, or 10%, or 12%, or 15%, or 18%, or 20%, or 25%, or 30% weight of phospholipid.

[0215] In some embodiments of the LNP comprises a molar percentage of the phospholipid to the total lipid composition from about 20 to about 23. In some embodiments, the molar percentage is from about 20, 20.5, 21, 21.5, 22, 22.5, to about 23 or any range derivable therein. In other embodiments, the molar percentage is from about 7.5 to about 60. In some embodiments, the molar percentage is from about 7.5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, to about 20 or any range derivable therein.

[0216] In some embodiments, the LNP comprises the phospholipid at a molar percentage from about 8% to about 23%. In some embodiments, the LNP comprises the phospholipid at a molar percentage from about 10% to about 20%. In some embodiments, the LNP comprises thephospholipid at a molar percentage from about 15% to about 20%. In some embodiments, the LNP comprises the phospholipid at a molar percentage from about 8% to about 15%. In some embodiments, the LNP comprises the phospholipid at a molar percentage from about 10% to about 15%. In some embodiments, the LNP comprises the phospholipid at a molar percentage from about 12% to about 18%. In some embodiments, the LNP comprises the phospholipid at a molar percentage of at least about 8%, at least about 10%, at least about 12%, at least about 15%, at least about 18%, at least about 20%, or at least about 23%. In some embodiments, the LNP comprises the phospholipid at a molar percentage of at most (about) 8%, at most about 10%, at most about 12%, at most about 15%, at most about 18%, at most about 20%, or at most about 23%.

[0217] In some embodiments, phospholipids contained in the LNP are selected from the group comprising, but not limited to, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), l,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-snglycero-phosphocholine (DUPC), l-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), l,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl- snglycero-3-phosphocholine (C16 Lyso PC), l,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2- diarachidonoyl-sn-glycero-3-phosphocholine, l,2-didocosahexaenoyl-sn-glycero-3- phosphocholine, l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2- diphytanoyl-sn-glycero-3-phosphocholine (4ME 16:0 PC), l,2-diphytanoyl-sn-glycero-3- phospho-(l'-rac-glycerol) (sodium salt) (4ME 16:0 PG), l,2-diphytanoyl-sn-glycero-3-phospho- L-serine (sodium salt) (4ME 16:0 PS), l,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, l,2-dilinolenoylsn-glycero-3- phosphoethanolamine, 1 ,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, and l,2-dioleoyl-sn-glycero-3-phospho- rac-(l -glycerol) sodium salt (DOPG), and sphingomyelin.

[0218] In some embodiments, the phospholipid contains one or two long chain (e.g., C6- C24) alkyl or alkenyl groups, a glycerol or a sphingosine, one or two phosphate groups, and, optionally, a small organic molecule. The small organic molecule may be an amino acid, a sugar, or an amino substituted alkoxy group, such as choline or ethanolamine. In someembodiments, the phospholipid is a phosphatidylcholine. In some embodiments, the phospholipid is distearoylphosphatidylcholine or dioleoylphosphatidylethanolamine. In some embodiments, other zwitterionic lipids are used, where zwitterionic lipid defines lipid and lipid- like molecules with both a positive charge and a negative charge. In some embodiments of the lipid compositions, the phospholipid is not an ethylphosphocholine.3. Polymer conjugated lipids

[0219] In some embodiments, the LNP comprises lipids conjugated to polymers, such as lipids conjugated to polyethylene glycol (“PEG-lipid”). Methods for making and using PEG- lipids are described, for example, in Int’l Pat. Pub. No. WO 2012 / 099755 and U.S. Pat. Pub No. 2014 / 0200257.

[0220] In some embodiments, the LNP comprises a PEG-lipid selected from the non- limiting group including PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG-lipid may be PEG-c- DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.

[0221] In some embodiments, PEG-lipids contained in the LNP are described in Int’l Pat. Pub. No. WO 2012 / 099755, the contents of which is herein incorporated by reference in its entirety. In some embodiments, any of these exemplary PEG-lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In some embodiments, the PEG-lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” is a PEG-lipid having one or more hydroxyl (-OH) groups on the lipid. In some embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy- PEG-lipid comprises an -OH group at the terminus of the PEG chain.

[0222] In some embodiments, the lipid composition further comprises a polymer conjugated lipid. In some embodiments, the polymer conjugated lipid is a PEG-lipid. In some embodiments, the PEG-lipid is a diglyceride which also comprises a PEG chain attached to the glycerol group. In other embodiments, the PEG-lipid is a compound which contains one or more C6-C24long chain alkyl or alkenyl group or a C6-C24fatty acid group attached to a linker group with a PEG chain. Some non-limiting examples of a PEG-lipid includes a PEG modified phosphatidylethanolamine and phosphatidic acid, a PEG ceramide conjugated, PEG modified dialkylamines and PEG modified l,2-diacyloxypropan-3-amines, PEG modified diacylglycerols and dialkylglycerols. In some embodiments, PEG modifieddiastearoylphosphatidylethanolamine or PEG modified dimyristoyl-.sn-glyccrol. In some embodiments, the PEG modification is measured by the molecular weight of PEG component of the lipid. In some embodiments, the PEG modification has a molecular weight from about 100 to about 15,000. In some embodiments, the molecular weight is from about 200 to about 500, from about 400 to about 5,000, from about 500 to about 3,000, or from about 1,200 to about 3,000.The molecular weight of the PEG modification is from about 100, 200, 400, 500, 600, 800, 1,000, 1,250, 1,500, 1,750, 2,000, 2,250, 2,500, 2,750, 3,000, 3,500, 4,000, 4,500, 5,000, 6,000,7,000, 8,000, 9,000, 10,000, 12,500, to about 15,000. Some non-limiting examples of lipids that may be used in the present application are taught by U.S. Patent 5,820,873, WO 2010 / 141069, or U.S. Patent 8,450,298, which is incorporated herein by reference.

[0223] In some embodiments, the PEG-lipid has a structural formula:, wherein: R12and R13are each independently alkyl(c<24), alkenyl(c<24), or a substituted version of either of these groups; Reis hydrogen, alkyl(c<8), or substituted alkyl(c<8>; and x is 1-250. In some embodiments, Reis alkyl(c<8) such as methyl. R12 and R13 are each independently alkyl(c<4-20). In some embodiments, x is 5-250. In one embodiment, x is 5-125 or x is 100-250. In some embodiments, the PEG-lipid is 1,2- dimyristoyl-sn-glycerol, methoxypolyethylene glycol.

[0224] In some embodiments, the PEG-lipid has a structural formula:, wherein: m is an integer between 1 and 100 and n2 and m are each independently selected from an integer between 1 and 29. In some embodiments, m is 5, 10, 15, 20, 25, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43,44, 45, 46, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100, or any range derivable therein. In some embodiments, m is from about 30 to about 50. In some embodiments, n2 is from 5 to 23. In some embodiments, n2 is 11 to about 17. In some embodiments, m is from 5 to 23. In some embodiments, m is 11 to about 17.

[0225] In some embodiments, the compositions may further comprise a molar percentage of the PEG-lipid to the total lipid composition from about 4.0 to about 4.6. In some embodiments, the molar percentage is from about 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, to about 4.6 or any range derivable therein. In other embodiments, the molar percentage is from about 1.5 to about 4.0. In some embodiments, the molar percentage is from about 1.5, 1.75, 2, 2.25, 2.5, 2.75, 3, 3.25, 3.5, 3.75, to about 4.0 or any range derivable therein.

[0226] In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 0.5% to about 10%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 1% to about 8%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 2% to about 7%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 3% to about 5%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage from about 5% to about 10%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage of at least (about) 0.5%, at least (about) 1%, at least (about) 1.5%, at least (about) 2%, at least (about) 2.5%, at least (about) 3%, at least (about) 3.5%, at least (about) 4%, at least (about) 4.5%, at least (about) 5%, at least (about) 5.5%, at least (about) 6%, at least (about) 6.5%, at least (about) 7%, at least (about) 7.5%, at least (about) 8%, at least (about) 8.5%, at least (about) 9%, at least (about) 9.5%, or at least (about) 10%. In some embodiments, the lipid composition comprises the polymer-conjugated lipid at a molar percentage of at most (about) 0.5%, at most (about) 1%, at most (about) 1.5%, at most (about) 2%, at most (about) 2.5%, at most (about) 3%, at most (about) 3.5%, at most (about) 4%, at most (about) 4.5%, at most (about) 5%, at most (about) 5.5%, at most (about) 6%, at most (about) 6.5%, at most (about) 7%, at most (about) 7.5%, at most (about) 8%, at most (about) 8.5%, at most (about) 9%, at most (about) 9.5%, or at most (about) 10%.4. Sterol

[0227] In some embodiments, the LNP comprises a steroid or steroid derivative. As used herein, in some embodiments, the term “steroid” is a class of compounds with a four ring 17 carbon cyclic structure which can further comprises one or more substitutions including alkyl groups, alkoxy groups, hydroxy groups, oxo groups, acyl groups, or a double bond between twoor more carbon atoms. In one aspect, the ring structure of a steroid comprises three fused cyclohexyl rings and a fused cyclopentyl ring as shown in the formula:

[0228] In some embodiments, a steroid derivative comprises the ring structure above with one or more non-alkyl substitutions. In some embodiments, the steroid or steroid derivative is a sterol wherein the formula is further defined as:. In some embodiments, the steroid or steroid derivative is a cholestane or cholestane derivative. In a cholestane, the ring structure is further defined by the formula:. As described above, a cholestane derivative includes one or more non-alkyl substitution of the above ring system. In some embodiments, the cholestane or cholestane derivative is a cholestene or cholestene derivative or a sterol or a sterol derivative. In other embodiments, the cholestane or cholestane derivative is both a cholestere and a sterol or a derivative thereof.

[0229] In some embodiments, the compositions may further comprise a molar percentage of the steroid to the total lipid composition from about 40 to about 46. In some embodiments, the molar percentage is from about 40, 41, 42, 43, 44, 45, to about 46 or any range derivable therein. In other embodiments, the molar percentage of the steroid relative to the total lipid composition is from about 15 to about 40. In some embodiments, the molar percentage is 15, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, or 40, or any range derivable therein.

[0230] In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 15% to about 46%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 20% to about 40%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 25% to about 35%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 30% toabout 40%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage from about 20% to about 30%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage of at least (about) 15%, of at least (about) 20%, of at least (about) 25%, of at least (about) 30%, of at least (about) 35%, of at least (about) 40%, of at least (about) 45%, or of at least (about) 46%. In some embodiments, the lipid composition comprises the steroid or steroid derivative at a molar percentage of at most (about) 15%, of at most (about) 20%, of at most (about) 25%, of at most (about) 30%, of at most (about) 35%, of at most (about) 40%, of at most (about) 45%, or of at most (about) 46%.

[0231] In some embodiments, the cationic agent is a cationic lipid which is a sterol amine. A sterol amine has, for its hydrophobic portion, a sterol, and for its hydrophilic portion, an amine group. The sterol group is selected from, but not limited to, cholesterol, sitosterol, campesterol, stigmasterol or derivatives thereof. The amine group can comprise one to five primary, secondary, tertiary amines, or mixtures thereof. At least one of the amines has a pKa of 8 or greater and is charged at physiological pH. The primary, secondary, or tertiary amines can be part of a larger amine containing functional group selected from, but not limited to -C(=N-)-N-, - C=C-N-, -C=N-, or -N-C(=N-)-N-. The amine can be contained in a three to eight membered heteroalkyl or heteroaryl ring.B. Selective Organ Targeting (SORT) Molecules

[0232] In some embodiments, the method comprises the administration of a LNP comprising a gene editing system, wherein the LNP comprises one or more selective organ targeting (SORT) molecules.

[0233] Selective organ targeting enables the controllable delivery of the nucleic acids encased by the LNP to specific target tissues. Traditionally, LNPs have been limited to intramuscular and intravenous administration where the LNPs target and accumulate in the liver due to physiological factors. In some embodiments, LNPs comprising SORT molecules (i.e. SORT LNPs) include a supplemental SORT molecule, wherein the chemical structure of the SORT molecule determines the tissue- specific activity of the LNP. In some embodiments, the method comprises administration of the LNP comprising a SORT molecule, wherein LNP is delivered to organs and cells other than the liver.

[0234] In some embodiments of the LNP comprising a gene editing system comprising a SORT molecule is preferentially delivered to a target organ. In some embodiments, the targetorgan is a lung, a lung tissue or a lung cell. In some embodiments, the lung cell type is an endothelial cell or an epithelial cell. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or a tracheal epithelial cell. In some embodiments, the lung cell is a secretory cell and or ionocyte.

[0235] As used herein, the term “preferentially delivered” is used to refer to a composition, upon being delivered, which is delivered to the target organ (e.g., lung), tissue, or cell in at least 25% (e.g., at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, or 75%) of the amount administered.

[0236] In some embodiments, the LNP comprises one or more SORT molecules. In some embodiments, the SORT molecule comprises a cationic lipid or an anionic lipid. In some embodiments, the SORT molecule comprises a permanently cationic lipid or a permanently anionic lipid. In some embodiments, the SORT molecule comprises a cationic lipid or a permanently cationic lipid. In some embodiments, the SORT molecule comprises permanently positively charged moiety. The permanently positively charged moiety may be positively charged at a physiological pH such that the SORT molecule comprises a positive charge upon delivery of a polynucleotide to a cell. In some embodiments, the positively charged moiety is quaternary amine or quaternary ammonium ion. In some embodiments, the SORT molecule comprises, or is otherwise complexed to or interacting with, a counterion. In some embodiments, the SORT molecule comprises two or more alkyl or alkenyl chains of C6-C24.

[0237] In some embodiments, the one or more SORT molecule is a permanently cationic lipid (i.e., comprising one or more hydrophobic components and a permanently cationic group). In some embodiments, the permanently cationic lipid may contain a group which has a positive charge regardless of the pH. One permanently cationic group that may be used in the permanently cationic lipid is a quaternary ammonium group.

[0238] In some embodiments, the one or more SORT molecule is ionizable cationic lipid (i.e., comprising one or more hydrophobic components and an ionizable cationic group). The ionizable positively charged moiety may be positively charged at a physiological pH. One ionizable cationic group that may be used in the ionizable cationic lipid is a tertiary ammine group.

[0239] In some embodiments, the one or more SORT molecule comprises 18:1 DOTMA; DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt); 18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)). In some embodiments, the SORT molecule comprises DOTAP (l,2-dioleoyl-3-trimethylammonium propane). In some embodiments, the SORT molecule comprises 18:1 PA. In some embodiments, the SORT molecule comprises DODAP.

[0240] In some embodiments, the SORT molecule comprises between 5% to 70% molar percentage of the LNP. In some embodiments, the SORT molecule comprises up to about 5%, up to about 10%, up to about 15%, up to about 20%, up to about 25%, up to about 30%, up to about 35%, up to about 40%, up to about 45%, up to about 50%, up to about 55%, up to about 60%, up to about 65%, or up to about 70% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 20% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 25% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 30% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 35% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises about 45% molar percentage of the LNP.

[0241] In some embodiments, the SORT molecule comprises from about 5% to about 70% molar percentage of the LNP, from about 10% to about 70% molar percentage of the LNP, from about 15% to about 70% molar percentage of the LNP, from about 20% to about 70% molar percentage of the LNP, from about 25% to about 70% molar percentage of the LNP, from about 30% to about 70% molar percentage of the LNP, from about 35% to about 70% molar percentage of the LNP, from about 40% to about 70% molar percentage of the LNP, from about 45% to about 70% molar percentage of the LNP, from about 50% to about 70% molar percentage of the LNP, from about 55% to about 70% molar percentage of the LNP, from about 60% to about 70% molar percentage of the LNP, from about 65% to about 70% molar percentage of the LNP, from about 5% to about 65% molar percentage of the LNP, from about 10% to about 65% molar percentage of the LNP, from about 15% to about 65% molar percentage of the LNP, from about 20% to about 65% molar percentage of the LNP, from about25% to about 65% molar percentage of the LNP, from about 30% to about 65% molar percentage of the LNP, from about 35% to about 65% molar percentage of the LNP, from about 40% to about 65% molar percentage of the LNP, from about 45% to about 65% molar percentage of the LNP, from about 50% to about 65% molar percentage of the LNP, from about 55% to about 65% molar percentage of the LNP, from about 60% to about 65% molar percentage of the LNP, from about 5% to about 60% molar percentage of the LNP, from about 10% to about 60% molar percentage of the LNP, from about 15% to about 60% molar percentage of the LNP, from about 20% to about 60% molar percentage of the LNP, from about 25% to about 60% molar percentage of the LNP, from about 30% to about 60% molar percentage of the LNP, from about 35% to about 60% molar percentage of the LNP, from about 40% to about 60% molar percentage of the LNP, from about 45% to about 60% molar percentage of the LNP, from about 50% to about 60% molar percentage of the LNP, from about 55% to about 60% molar percentage of the LNP, from about 5% to about 55% molar percentage of the LNP, from about 10% to about 55% molar percentage of the LNP, from about 15% to about 55% molar percentage of the LNP, from about 20% to about 55% molar percentage of the LNP, from about 25% to about 55% molar percentage of the LNP, from about 30% to about 55% molar percentage of the LNP, from about 35% to about 55% molar percentage of the LNP, from about 40% to about 55% molar percentage of the LNP, from about 50% to about 55% molar percentage of the LNP, from about 5% to about 50% molar percentage of the LNP, from about 10% to about 50% molar percentage of the LNP, from about 15% to about 50% molar percentage of the LNP, from about 20% to about 50% molar percentage of the LNP, from about 25% to about 50% molar percentage of the LNP, from about 30% to about 50% molar percentage of the LNP, from about 35% to about 50% molar percentage of the LNP, from about 40% to about 50% molar percentage of the LNP, from about 45% to about 50% molar percentage of the LNP, from about 5% to about 45% molar percentage of the LNP, from about 10% to about 45% molar percentage of the LNP, from about 15% to about 45% molar percentage of the LNP, from about 20% to about 45% molar percentage of the LNP, from about 25% to about 45% molar percentage of the LNP, from about 30% to about 45% molar percentage of the LNP, from about 35% to about 45% molar percentage of the LNP, from about 40% to about 45% molar percentage of the LNP, from about 5% to about 40% molar percentage of the LNP, from about 10% to about 40% molar percentage of the LNP, from about 15% to about 40% molar percentage of the LNP, from about 20% to about 40% molar percentage of theLNP, from about 25% to about 40% molar percentage of the LNP, from about 30% to about 40% molar percentage of the LNP, from about 30% to about 40% molar percentage of the LNP, from about 5% to about 35% molar percentage of the LNP, from about 10% to about 35% molar percentage of the LNP, from about 15% to about 35% molar percentage of the LNP, from about 20% to about 35% molar percentage of the LNP, from about 25% to about 35% molar percentage of the LNP, from about 30% to about 35% molar percentage of the LNP, from about 5% to about 30% molar percentage of the LNP, from about 10% to about 30% molar percentage of the LNP, from about 15% to about 30% molar percentage of the LNP, from about 20% to about 30% molar percentage of the LNP, from about 25% to about 30% molar percentage of the LNP, from about 5% to about 25% molar percentage of the LNP, from about 10% to about 25% molar percentage of the LNP, from about 15% to about 25% molar percentage of the LNP, from about 20% to about 25% molar percentage of the LNP, from about 5% to about 20% molar percentage of the LNP, from about 10% to about 20% molar percentage of the LNP, from about 15% to about 20% molar percentage of the LNP, from about 5% to about 15% molar percentage of the LNP, from about 10% to about 15% molar percentage of the LNP, or from about 5% to about 15% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from about 20% to about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from about 35% to about 40% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from about 40% to about 45% molar percentage of the LNP. In some embodiments, the SORT molecule comprises from about 35% to about 45% molar percentage of the LNP.

[0242] In some embodiments, the SORT molecule facilitates the preferential delivery of the one or more polynucleotides comprising one or more nucleic acids encapsulated in the LNP to a target organ and / or a target cell. In some embodiments, an LNP comprising a SORT molecule delivers a greater percentage of the enveloped nucleic acid than a reference LNP without a SORT molecule. In some embodiments, the LNP comprising a SORT molecule delivers at least 5% more, at least 10% more, at least 15% more, at least 20% more, at least 25% more, at least 30% more, at least 35% more, at least 40% more, at least 45% more, at least 50% more, at least 55% more, at least 60% more, at least 65% more, at least 70% more, at least 75% more, at least 80% more, at least 85% more, at least 90% more, at least 95% more, or at least 99% more encapsulated nucleic acids to the target organ and / or the target cell than a reference LNP not comprising a SORT molecule. In some embodiments, the target organ is the lung. In someembodiments, target cells may comprise, but are not limited to, basal cells, secretory cells such as goblet cells and club cells, ciliated cells, and any combination thereof.

[0243] In some embodiments, the LNP comprising a SORT molecule achieves a greater therapeutic effect compare to a reference LNP that does not comprise a SORT molecule. In some embodiments of the method, the LNP comprising a SORT molecule achieves about 1.1 - fold to about 20-fold therapeutic effect compared to that achieved with a reference LNP. In some embodiments of the method, the LNP comprising a SORT molecule achieves about 1.1 - fold to about 10-fold therapeutic effect compared to that achieved with a reference LNP. In some embodiments of the method, the LNP comprising a SORT molecule achieves about 1.1 - fold to about 5-fold therapeutic effect compared to that achieved with a reference LNP. In some embodiments of the method, the LNP comprising a SORT molecule achieves about 5-fold to about 10-fold therapeutic effect compared to that achieved with a reference LNP. In some embodiments of the method, the LNP comprising a SORT molecule achieves about 10-fold to about 20-fold therapeutic effect compared to that achieved with a reference LNP. In some embodiments of the method, the LNP comprising a SORT molecule achieves at least about 1.1 - fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, or at least about 20-fold therapeutic effect compared to that achieved with a reference LNP.

[0244] In some embodiments of the lipid compositions, the additional lipid is a permanently cationic lipid (z.e., comprising one or more hydrophobic components and a permanently cationic group). The permanently cationic lipid may contain a group which has a positive charge regardless of the pH. One permanently cationic group that may be used in the permanently cationic lipid is a quaternary ammonium group. The permanently cationic lipid may comprise a structural formul (S-I), wherein:Y1, Y2, or Y3are each independently XiC(O)R1or X2N+R3R4R5; provided at least one of Y1, Y2, and Y3is X2N+R3R4R5;R1is C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl;X1is O or NRa, wherein Rais hydrogen, C1-C4alkyl, or C1-C4substituted alkyl;X2 is C1-C6alkanediyl or C1-C6substituted alkanediyl;R3, R4, and R5 are each independently C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl; andAi is an anion with a charge equal to the number of X2N+R3R4R5groups in the compound.

[0245] In some embodiments, the permanently cationic additonal lipid (e.g., SORT lipid) has a structural formula(S-II), wherein: R6-R9 are each independently C1-C24alkyl, C1-C24substituted alkyl, C1-C24alkenyl, C1-C24substituted alkenyl; provided at least one of R6-R9 is a group of C8-C24; and A2 is a monovalent anion.

[0246] In some embodiments of the lipid compositions, the SORT (additional) lipid is an ionizable cationic lipid (z.e., comprising one or more hydrophobic components and an ionizable cationic group, e.g. a tertiary amino group). The ionizable positively charged moiety may be positively charged at a physiological pH. One ionizable cationic group that may be used in the ionizable lipid is a tertiary ammine group. In some embodiments of the lipid compositions disclosed herein, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) has a structural formula:wherein:R1and R2are each independently C8-C24alkyl, C8-C24alkenyl, or a substituted version of either group; and R3and R3' are each independently C1-C6alkyl or substituted C1-C6alkyl.

[0247] In some embodiments of formula (S-I’a) R1and R2are each independently C8-C24alkenyl (e.g. hexadecane, heptadecene, or octadecene). In some embodiments of formula (S-I’a),R3and R3' are each independently C1-C6alkyl (e.g., methyl or ethyl). In some embodiments of formula (S-I’a) R1and R2are each independently C8-C24alkenyl, (e.g. hexadecane, heptadecene, or octadecene) and R3and R3' are each independently C1-C6alkyl (e.g., methyl or ethyl).

[0248] In some embodiments of the lipid compositions, the additional ionizable lipid or permanently cationic lipid comprises a head group of a particular structure. In some embodiments, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) comprises a headgroup having a structural formula:, wherein L is a linker; Z+is positively charged moiety and X" is a counterion. In some embodiment, the linker is a biodegradable linker. Thebiodegradable linker may be degradable under physiological pH and temperature. The biodegradable linker may be degraded by proteins or enzymes from a subject. In some embodiments, the positively charged moiety is a quaternary ammonium ion or quaternary amine.

[0249] In some embodiments of the lipid compositions, the SORT (additional ionizable lipid or permanently cationic) lipid has a structural formula:, wherein R1and R2are each independently an optionally substituted C6-C24alkyl, or an optionally substituted C6-C24alkenyl.

[0250] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) has a structural formula:

[0251] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) comprises a Linker (L). In some embodiments, L iswherein: p and q are each independently 1, 2, or 3; andR4is an optionally substituted C1-C6alkyl.

[0252] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) has a structural formula:wherein:R1and R2are each independently C8-C24alkyl, C8-C24alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently C1-C6alkyl or substituted C1-C6alkyl;R4 is C1-C6alkyl or substituted C1-C6alkyl; andX- is a monovalent anion.

[0253] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) is a phosphatidylcholine (e.g., 14:0 EPC). In some embodiments, the phosphatidylcholine compound is further defined as:wherein:R1and R2are each independently C8-C24alkyl, C8-C24alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently C1-C6alkyl or substituted C1-C6alkyl; andX- is a monovalent anion.

[0254] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) is a phosphocholine lipid. In some embodiments, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) is an ethylphosphocholine. The ethylphosphocholine may be, by way of example, without being limited to, l,2-dimyristoleoyl-sn-glycero-3- ethylphosphocholine, 1 ,2-dioleoyl-sn-glycero-3-ethylphosphocholine, 1 ,2-distearoyl-sn-glycero- 3-ethylphosphocholine, 1 ,2-dipalmitoyl-sn-glycero-3-ethylphosphocholine, 1 ,2-dimyristoyl-sn- glycero-3-ethylphosphocholine, l,2-dilauroyl-sn-glycero-3-ethylphosphocholine, l-palmitoyl-2- oleoy 1- sn-gly cero- 3 -ethy Ipho sphocholine .

[0255] In some embodiments of the lipid compositions, the lipid has a structural formula:wherein:R1and R2are each independently C8-C24alkyl, C8-C24alkenyl, or a substituted version of either group;R3, R3', and R3" are each independently C1-C6alkyl or substituted C1-C6alkyl;X- is a monovalent anion.

[0256] By way of example, and without being limited thereto, a additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) of the structural formula of the immediately preceding paragraph is l,2-dioleoyl-3-trimethylammonium-propane (18:1 DOTAP) (e.g., chloride salt).

[0257] In some embodiments of the lipid compositions, the additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) has a structural formula: (S-II’), wherein:R4 and R4' are each independently alkyl(C6-c24), alkenyl(C6-c24), or a substituted version of either group;R4" is alkyl(c<24), alkenyl(c<24), or a substituted version of either group;R4"' is alkyl(ci-cs), alkenyl(C2-cs), or a substituted version of either group; andX2 is a monovalent anion.

[0258] By way of example, and without being limited thereto, a additonal lipid (e.g., additonal lipid (e.g., SORT lipid)) of the structural formula of the immediately preceding paragraph is dimethyldioctadecylammonium (DDAB).

[0259] In some embodiments of the lipid compositions, the additional lipid is selected from the lipids set forth in Table 6.Table 6. Example additonal lipid (e.g., SORT lipids)X- is a counterion (e.g., O-, Br\ etc.)

[0260] In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 20% to about 65%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 25% to about 60%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 30% to about 55%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 20% to about 50%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 30% to about 60%. In some embodiments of the lipidcomposition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage from about 25% to about 60%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage of at least (about) 25%, at least (about) 30%, at least (about) 35%, at least (about) 40%, at least (about) 45%, at least (about) 50%, at least (about) 55%, at least (about) 60%, or at least (about) 65%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage of at most (about) 25%, at most (about) 30%, at most (about) 35%, at most (about) 40%, at least (about) 45%, at most (about) 50%, at most (about) 55%, at most (about) 60%, or at most (about) 65%. In some embodiments of the lipid composition of the present application, the lipid composition comprises the additonal lipid (e.g., SORT lipid) at a molar percentage of about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, or 65%, or of a range between (inclusive) any two of the foregoing values. Illustrative LNP compositions are presented below in Table 7.

[0261] Table 7: Illustrative LNP compositions.C. Polynucleotides

[0262] In some embodiments, the method disclosed herein comprises the administration of a LNP, wherein the LNP comprises one or more polynucleotides. In some embodiments, delivery of the one or more polynucleotides to a target cell can be used for therapeutic potential. For instance, it can allow delivery of nucleic acids (e.g. mRNA) encoding a protein that stimulates the immune system near the target cell or leads the target cells to express the protein in such a way that immune cells kill the target cell. In some aspects, such delivery is beneficial in the context of treating or preventing tumors or cancer, for prophylactic uses or in the context of vaccination. In some embodiments, the LNP comprises a one or more polynucleotides. In some embodiments, the polynucleotide comprises a gRNA. In some embodiments, the polynucleotide comprises the mRNA of a base editor. In some embodiments, the polynucleotide comprises a gRNA and the mRNA of a base editor.

[0263] In some embodiments, the LNP is used to deliver a polynucleotide to a target cell. In some embodiments, the polynucleotide is a DNA. In some embodiments the polynucleotide comprises a ribonucleic acid (RNA). In some embodiments the RNA is a circRNA, an mRNA, asiRNA, an RNAi, and / or a microRNA. In some embodiments, the RNA enhances the anti-tumor effect or the therapeutic effect of the nanoparticle. In some embodiments, the polynucleotide comprises a deoxyribonucleic acid (DNA). In some embodiments, the RNA and / or enhances the therapeutic effect of the LNP.

[0264] siRNA or small interfering RNA or silencing RNA are RNA molecules that are double stranded, non-coding RNA molecules. These RNA molecules are typically 20-24 base pairs in length and produced through the Dicer enzyme catalyzing production from long double- stranded RNA molecules. siRNA can bind to mRNA with a complementary sequence and lead to mRNA degradation. Delivery of siRNA to a cell can be used to reduce specific mRNA transcripts, leading to decreased protein production from the mRNA. This is a form of RNA interference or RNAi. Another form of RNAi includes microRNA, which are similar to siRNAs but may contain post-transcriptional modifications. MicroRNAs also work to deplete target mRNAs and thereby decrease proteins produced by the mRNAs. Delivery of microRNAs to target cells offer therapeutic potentials by decreasing production of negative proteins.

[0265] mRNA is RNA that can be translated into a protein and its delivery into target cells can lead to localized production of protein within the target cell. mRNA is rapidly degraded and so needs to be efficiently delivered to the target cell. In some embodiments, the nanoparticle is used to deliver mRNA to a target cell.

[0266] In some embodiments, the RNA is a linear RNA molecule. In some embodiments, the linear RNA is at least 600 nucleotides in length, at least 1000 nucleotides in length, or at least 1200 nucleotides in length. In some embodiments, the linear RNA is less than 2000 nucleotides in length. In some embodiments, the linear RNA is at least 600 nucleotides in length but less than 2000 nucleotides in length, at least 1000 nucleotides in length but less than 2000 nucleotides in length, at least 1200 nucleotides in length but less than 2000 nucleotides in length, at least 1400 nucleotides in length but less than 2000 nucleotides in length, at least 600 nucleotides in length but less than 1400 nucleotides in length, or at least 600 nucleotides in length but less than 2000 nucleotides in length. In some embodiments, the RNA comprises a cleaved linear RNA comprising a hydroxyl group at the 5' terminus, and a 2', 3 '-cyclic phosphate at the 3' terminus.

[0267] In some embodiments, the RNA is a messenger RNA (mRNA) molecule. In some embodiments, the nucleic acid is a capped mRNA. In some embodiments, the mRNA molecule is greater than 2000 nucleotides, greater than 2500 nucleotides, greater than 3000 nucleotides,greater than 3500 nucleotides, greater than 4000 nucleotides, greater than 4500 nucleotides, or greater than 5000 nucleotides in length. In some embodiments, the mRNA molecule is about 2000 nucleotides in length. In some embodiments, the mRNA molecule is about 2500 nucleotides in length. In some embodiments, the mRNA molecule is about 3000 nucleotides in length. In some embodiments, the mRNA molecule is about 3500 nucleotides in length. In some embodiments, the mRNA molecule is about 4000 nucleotides in length. In some embodiments, the mRNA molecule is about 4500 nucleotides in length. In some embodiments, the mRNA molecule is about 5000 nucleotides in length.

[0268] CircRNA is a covalently closed continuous loop of single- stranded RNA. CircRNA can be divided into four categories including exonic circRNA (ecircRNA), circular intronic RNA (ciRNA), exon-intron circRNA (ElciRNA), and intergenic circRNA.

[0269] The configuration of circRNA results in several advantages compared to linear mRNA, including resistance to exonuclease-mediated degradation, increased stability, extended half-life, increased protein expression, and reduced immunogenicity (Chen, RNA Biol, 12(4):381-388 (2015); Wesselhoeft et al., Nat Commun, 9(1):2629 (2018)). circRNA generally has a longer half-life compared to their linear mRNA counterparts (Wesselhoeft et al., Nat Commun, 9(1):2629 (2018)). Accordingly, circRNA improves protein expression (e.g., of the encoded gene product) over its lifetime compared to linear mRNAs. CircRNA can be synthesized in vitro by chemical, enzymatic, and ribozymatic approaches. One approach, using permuted intron-exon (PIE) splicing to result in RNA circularization, has been developed to express gene products from circRNA. PIE splicing systems based on Group I introns that are naturally found in the rRNA, tRNA, and mRNA genes of bacteria and non-metazoan eukaryotes can produce circRNA by self-splicing.

[0270] In some embodiments, the circular RNA is at least 600 nucleotides in length, at least 1000 nucleotides in length, or at least 1200 nucleotides in length. In some embodiments, the circular RNA is less than 2000 nucleotides in length. In some embodiments, the circular RNA is at least 600 nucleotides in length but less than 2000 nucleotides in length, at least 1000 nucleotides in length but less than 2000 nucleotides in length, at least 1200 nucleotides in length but less than 2000 nucleotides in length, at least 1400 nucleotides in length but less than 2000 nucleotides in length, at least 600 nucleotides in length but less than 1400 nucleotides in length, or at least 600 nucleotides in length but less than 2000 nucleotides in length.

[0271] In some embodiments, the circular RNA molecule is greater than 2000 nucleotides, greater than 2500 nucleotides, greater than 3000 nucleotides, greater than 3500 nucleotides, greater than 4000 nucleotides, greater than 4500 nucleotides, or greater than 5000 nucleotides in length. In some embodiments, the circular RNA molecule is about 2000 nucleotides in length. In some embodiments, the circular RNA molecule is about 2500 nucleotides in length. In some embodiments, the circular RNA molecule is about 3000 nucleotides in length. In some embodiments, the circular RNA molecule is about 3500 nucleotides in length. In some embodiments, the circular RNA molecule is about 4000 nucleotides in length. In some embodiments, the circular RNA molecule is about 4500 nucleotides in length. In some embodiments, the circular RNA molecule is about 5000 nucleotides in length.

[0272] In some embodiments, the polynucleotide comprises a DNA molecule. In some embodiments, the DNA is a naked DNA molecule. In some embodiments, the DNA is a double- stranded DNA molecule. In some embodiments, the DNA is a single- stranded DNA molecule. In some embodiments, the DNA is a modified DNA molecule. In some embodiments, the DNA is modified to enhance its stability. In some embodiments, the DNA is a closed-ended DNA molecule. In some embodiments, the DNA is a naked closed-ended DNA molecule.

[0273] In some embodiments, the DNA is at least 600 nucleotides, at least 1000 nucleotides, or at least 1200 nucleotides in length. In some embodiments, the DNA is less than 2000 nucleotides in length. In some embodiments, the DNA is at least 600 nucleotides but less than 2000 nucleotides in length, at least 1000 nucleotides but less than 2000 nucleotides in length, at least 1200 nucleotides but less than 2000 nucleotides in length, at least 1400 nucleotides but less than 2000 nucleotides in length, at least 600 nucleotides but less than 1400 nucleotides in length, or at least 600 nucleotides but less than 2000 nucleotides in length.

[0274] In some embodiments, the polynucleotide is from 2000 nucleotides to 5000 nucleotides in length. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length.

[0275] In some embodiments, the polynucleotide has a concentration of 0.5-3.0 mg / mL, of 1.0-3.0 mg / mL, of 2.0-3.0 mg / mL of 1.0 mg / mL. In some embodiments, the polynucleotide hasa concentration of 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1.0 mg / mL, 1.1 mg / mL, 1.2 mg / mL, 1.3 mg / mL, 1.4 mg / mL, or 1.5 mg / mL. In some embodiments, the polynucleotide has a concentration of 1.0 mg / mL.

[0276] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 1.0 mg / mL.

[0277] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.9 mg / mL.

[0278] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.8 mg / mL.

[0279] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at aconcentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.7 mg / mL.

[0280] In some embodiments, the polynucleotide is from 2000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 2500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 3000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 3500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 4000 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL. In some embodiments, the polynucleotide is from 4500 to 5000 nucleotides in length and at a concentration of 0.6 mg / mL.

[0281] In some embodiments, the polynucleotide has an average molecular weight of up to 20,000,000 Da. In some embodiments, the polynucleotide can have an average molecular weight of up to 2,000,000 Da. In some embodiments, the polynucleotide may have an average molecular weight of up to 150,000 Da. In some embodiments, the polynucleotide has an average molecular weight of up to 15,000 Da, 5,000 Da or 1,000 Da.D. Formulations

[0282] In some embodiments, the method described herein comprises the LNP composition, comprising an LNP comprising a gene editing system, wherein the LNP comprises 1,2-dioleoyl- 3 -dimethylammonium propane (DODAP) at a molar percentage less then 25% or less then 20%; cholesterol at a molar percentage greater than 40%; and / or messenger RNA (mRNA) at a lipid:mRNA ratio less than 40:1.

[0283] In some embodiments, the method described herein comprises a LNP composition, comprising an LNP comprising a gene editing system, wherein the LNP specifically transduces lung cells; and / or the LNP delivers mRNA to lung cells or in an amount effective to increase expression and / or function of a polypeptide or polynucleotide encoded by the mRNA. In some embodiments, the lung cells comprise lung cell types that include, but are not limited to, endothelial cells or epithelial cells. In some embodiments, the lung cell type is an immune cell. In some embodiments, the lung cell type is a stem cell. In some embodiments, the epithelial cell is a ciliated cell, non-ciliated cell, a goblet cell, a brush cell (alveolar macrophage), an airway basal cell, a small granule cell, a bronchial epithelial cell, a small airway epithelial cell, and / or atracheal epithelial cell. In some embodiments, the lung cell type is a secretory cell and or ionocyte.

[0284] In some embodiments, the LNP specifically transduces secretory cells and / or ionocytes; and / or wherein the LNP delivers mRNA to lung cells in an amount effective to increase expression and / or function of a polypeptide or polynucleotide encoded by the mRNA.

[0285] In some embodiments, the LNP comprises an ionizable cationic lipid; a neutral phospholipid; a polyethylene-glycol (PEG)-lipid; and / or a / the cholesterol. In some embodiments, the LNP comprises a second ionizable cationic lipid. In some embodiments, the LNP comprises an anionic lipid. In some embodiments, the LNP comprises a permanently cationic lipid.

[0286] In some embodiments, the LNP comprises DODAP at a molar percentage less than 25% or less then 20%. In some embodiments, the LNP comprises a DODAP at a molar percentage of less than 5%, less than 10%, less than 15%, less than 16%, than 17%, than 18%, than 19%, than 20%, than 21%, than 22%, than 22%, than 23%, than 24% or of less than 25%.

[0287] In some embodiments, the LNP comprises DODAP at a molar percentage between 5% and 25%, between 7.5% and 25%, between 10% and 25%, between 15% and 25%, between 20% and 25%, between 5% and 20%, between 7.5% and 20%, between 10% and 20%, between 15% and 20%, between 5% and 15%, between 7.5% and 15%, between 10% and 15%, between 5% and 10%, or between 7.5% and 10%.

[0288] In some embodiments, the LNP comprises DODAP at a molar percentage between 17.5% and 20%, between 17.5% and 22.5%, between 17.5% and 25%, between 5% and 17.5%, between 7.5% and 17.5%, between 10% and 17.5%, between 12.5% and 17.5% or between 15% and 17.5%. In some embodiments, the LNP comprises DODAP at a molar percentage of 16%.

[0289] In some embodiments, the LNP comprises cholesterol at a molar percentage greater than 40%, greater than 45%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90%, greater than 95% or greater than 99%.

[0290] In some embodiments, the LNP comprises cholesterol at a molar percentage between 40% and 60%, between 45% and 60%, between 50% and 60%, between 55% and 60%, between 40% and 55%, between 40% and 50%, between 40% and 45%, between 45% and 55%, between 45% and 50% or between 50% and 55%. In some embodiments, the LNP comprises cholesterol at a molar percentage of 50%. Exemplary LNP formulations are presented below in Table 8.Table 8: Exemplary fomulations

[0291] In some embodiments, the LNP comprises messenger RNA (mRNA). In some embodiments, the LNP comprises mRNA at a lipid:mRNA ratio less than 40:1. In some embodiments, the lipid:mRNA ratio is between 20:1 and 40:1, between 25:1 and 40:1, between30:1 and 40:1, between 35:1 and 40:1, between 20:1 and 35:1, between 25: 1 and 35:1, between30:1 and 35:1, between 20:1 and 30:1, between 25:1 and 30:1, between 20: 1 and 25:1, between25:1 and 30:1, between 25:1 and 35:1, between 20:1 and 36:1, or between 25:1 and 36:1.

[0292] In some embodiments, the lipid:mRNA ratio is 36:1. In some embodiments, the lipid:mRNA ratio is 25:1. In some embodiments, the ionizable cationic lipid is 5A2-SC8or 4A3-SC7; the neutral phospholipid is l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) or l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); and / or the polyethylene-glycol (PEG)- lipid is DMG-PEG, optionally DMG-PEG2000.In some embodiments, the ionizable cationic lipid is 4A3-SC7; the neutral phospholipid is DOPE; and the polyethylene-glycol (PEG)-lipid is DMG-PEG.

[0293] In some embodiments, the LNP comprises a second cationic lipid and the second cationic lipid is DODAP.

[0294] In some embodiments, the LNP comprises a second cationic lipid and the second cationic lipid is l,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA). In some embodiments, the ionizable cationic lipid is 4A3-SC7 and the LNP comprises 4A3-SC7 at a molar percentage between 13% and 15%, between 13.5% and 15%, between 14% and 15%, between 14.5 and 15%, between 13% and 14.5%, between 13.5% and 14.5%, between 14% and 14.5%, between 13% and 14%, between 13.5% and 14% or between 13% and 13.5%.

[0295] In some embodiments, the LNP comprises PEG-lipid at a molar percentage between 2% and 8%, between 4% and 8%, between 6% and 8%, between 2% and 6%, between 4% and 6%, between 2% and 4%, between 2% and 3%, between 3% and 4%, between 2.5% and 3.5%,between 2.5% and 3% or between 3% and 3.5%. In some embodiments, the PEG-lipid at a molar percentage of (about) 3%.

[0296] In some embodiments, the LNP comprises a neutral phospholipid and the neutral phospholipid is DOPE.

[0297] In some embodiments, the LNP comprises DOPE at a molar percentage between 10% and 25%, between 10% and 20%, between 10% and 15%, between 10% and 12.5%, between 15% and 25, between 15% and 20% or between 20% and 25%. In some embodiments, the LNP comprises DOPE at a molar percentage of 11% or 22%.

[0298] In some embodiments, the LNP comprises a poly nucleotide. In some embodiments, the polynucleotide is a messenger RNA (mRNA). In some embodiments, the mRNA comprises between 100 bases and 8 kilobases (kb). In some embodiments, the mRNA comprises between 1 Ikb and 8 kb, between 2 kb and 8 kb, between 3 kb and 8 kb, between 4 kb and 8 kb, between 5 kb and 8 kb, between 6 kb and 8 kb, between 7 kb and 8 kb, between 1 kb and 7 kb, between 2 kb and 7 kb, between 3 kb and 7 kb, between 4 kb and 7 kb, between 5 kb and 7 kb, or between 6 kb and 7 kb, between 1 kb and 6 kb, between 2 kb and 6 kb, between 3 kb and 6 kb, between 4 kb and 6 kb, or between 5 kb and 6 kb.

[0299] In some embodiments, the mRNA comprises (about) 2 kb. In some embodiments, the mRNA comprises (about) 4.6 kb. In some embodiments, the mRNA encodes a cystic fibrosis transmembrane conductance regulator (CFTR) protein. In some embodiments, the nucleic acid sequence of the mRNA is set forth in SEQ ID NOG. In some embodiments, the mRNA encodes a Cre recombinase. In some embodiments, the mRNA encodes a CRISPR-Cas protein. In some embodiments, the CRISPR-Cas protein is Cas9, or a variant thereof. In other embodiments, the CRISPR-Cas protein is Casl2, or a variant thereof. In some embodiments, the mRNA encodes a base editor. In some embodiments, the mRNA encodes an adenine base editor (ABE). In some embodiments, the mRNA encodes a cytosine base editor (CBE).

[0300] In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is an aerosolized composition. In some embodiments, the LNP composition has an encapsulation efficiency of between 50% and 99%, between 60% and 99%, between 70% and 99%, between 80% and 99%, between 90% and 99%, between 95% and 99%, between 50% and 95%, between 60% and 95%, between 70% and 95%, between 80% and 95%, between 85% and 95%, or between 90% and 95%.

[0301] In some embodiments, the LNP composition is substantively free of any anionic lipid, of any permanently cationic lipid, or of any anionic lipid and any permanently cationic lipid. In some embodiments, the LNP composition is substantively free of any ionizable cationic lipids.III. GENE EDITING AND BASE EDITORS

[0302] In some embodiments, the methods disclosed herein comprise the administration of a LNP, wherein the LNP encapsulates a gene editing system. In some embodiments, the LNP comprises a nucleic acid encoding a base editor. In some embodiments, the LNP comprises a nucleic acid encoding a nuclease. In some embodiments, the LNP comprises a nucleic acid encoding a CRIS PR-associated (Cas) polypeptide or a variant thereof. In some embodiments, the LNP comprises a guide RNA (gRNA).A. Overview CRISPR / Cas Systems1. CRISPR / Cas

[0303] The discovery and engineering of clustered regularly interspaced short palindromic repeats (CRISPR)-Cas systems for genome editing has substantially expanded and improved the editing capabilities in eukaryotic cells. Initially identified in bacteria and archaeal organisms, CRISPR-Cas systems are classified into two main groups based on the number of effector proteins involved in the cleavage of nucleic acids: class 1, which cleaves nucleic acids with multiprotein complexes and class 2, which uses single-protein effectors for cleavage (Koonin EV, Makarova KS, Zhang F. Diversity, classification and evolution of CRISPR-Cas systems. Curr Opin Microbiol. 2017 Jun; 37:67-78, which is incorporated by reference herein in its entirety). Class 2 is further subdivided by the type of Cas protein, including the DNA-targeting type-II Cas9 and type-V Casl2, and the RNA-targeting type- VI Casl3; these systems are more widely used due to the technical advantages of using a single-protein effector domain. Other important characteristics to consider when selecting an editing strategy include cell type, cellular environment, expression method of the CRISPR-Cas system, and method of delivery, as they can affect editing efficiency and frequency of undesired genomic editing events.

[0304] CRISPR-Cas class 2 systems are principally comprised of an endonuclease protein encoded by a set of CRIS PR-associated (cas) genes and a short RNA sequence called guide RNA (gRNA) that guides the protein. In naturally occurring systems, CRISPR RNAs (crRNAs)pair with trans-activating crRNAs (tracrRNAs) to facilitate the formation of the ribonucleoprotein complex that precedes editing. Engineered approaches can utilize a single gRNA (sgRNA). sgRNA is a single RNA molecule that contains both the crRNA sequence fused to the tracrRNA sequence. sgRNA can be synthetically generated or made in vitro or in vivo from a DNA template. The DNA-targeting systems also require a protospacer-adjacent motif (PAM), a short-required sequence, to occur near the target DNA site. Type-II CRISPR- Cas9 derived from Streptococcus pyogenes is one of the most commonly used types, and its main components are RNA-guided Cas9 endonuclease and a sgRNA. For Cas9 effectors, the PAM sequence is located 3’ of the protospacer on the DNA strand not complementary to the guide RNA (Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity, Science. 2012 Aug 17;337(6096):816-21, which is incorporated by reference herein in its entirety). The sgRNA and Cas9 nuclease form a Cas9 ribonucleoprotein that can search, bind, and cleave the specific target sequence. Once the target site is located, the endonuclease generates a double- stranded break that is followed by two self-repair mechanisms: the error-prone non-homologous end joining (NHEJ) pathway or the homology-directed repair (HDR) pathway. Editing of the nucleic acids occurs after the nuclease treatment. NHEJ can introduce insertions or deletions (indels), generating frameshift mutations or premature stop codons that inactivate the target gene. The HDR pathway can introduce precise genomic modifications but requires a homologous DNA repair template and is typically less efficient than NHEJ.

[0305] In addition to nucleases that cleave target sequences, there are three other classes of CRISPR-Cas tools: base editors, transposases, and prime editors. These four classes can mediate different types of genomic edits, including conversion, deletion, or insertion of nucleic acids. These tools can use a nuclease dead Cas or deactivated Cas (dCas) system. The nuclease domains are mutated to abolish cleavage activity and obtain a dCas, such as for Cas9, where two point mutations are introduced to attain dCas9 (Xu, Y., & Li, Z. (2020). CRISPR-Cas systems: Overview, innovations and applications in human disease research and gene therapy. Computational and Structural Biotechnology Journal., 18, 2401- -15, which is incorporated by reference herein in its entirety). Importantly, the DNA binding activity of dCas9 is not affected. Fusing dCas systems with other effector domains can further extend CRISPR-Cas applications as catalytically inactive Cas nucleases are useful programmable proteins that localize the fused proteins to the target regions. For example, the CRISPR-dCas9 system fused to transcriptionalactivators (CRISPRa) or repressors (CRISPRi) can be used to activate or inhibit the transcription of target genes, respectively (Xu, Y., & Li, Z, (2020). CRISPR-Cas systems: Overview, innovations and applications in human disease research and gene therapy. Computational and Structural Biotechnology Journal., 18, 2401—15, which is incorporated by reference herein in its entirety). Furthermore, the development of the prime editing system, a versatile fusion between Cas9, a reverse transcriptase, and a prime editing gRNA (pegRNA), can mediate insertions, deletions, and all 12 types of base substitutions without double-strand breaks or donor templates (Anzalone, A.V., Randolph, P.B., Davis, J.R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019), which is incorporated by reference herein in its entirety).2. Base editors

[0306] In some embodiments, the methods provided herein comprises the administration of an LNP, wherein the LNP comprises a nucleic acid encoding a base editor. Base editors comprise fusions between impaired Cas enzymes which are unable to create double stranded breaks (DSBs), and a base-modification enzyme that modifies single-stranded nucleic acids only. Base editing can precisely convert one nucleic acid or base pair into another in genomic DNA or cellular RNA without double-strand breaks, DNA repair templates, or relying on repair mechanisms. Two classes of DNA base editors can convert a base pair to another: cytosine base editors (CBEs) can convert a C-G base pair into a T-A base pair, and adenine base editors (ABEs) can convert an A-T base pair to a G-C base pair. These editors can be used to perform all possible transition mutations. However, while base editors avoid the generation of indels, due to target sequence requirements, the base editing window is more restricted. Of note, cytosine to guanine base editors (CBGEs) have recently also been under development (Kurt, I.C., Zhou, R., Iyer, S. et al. CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Nat Biotechnol 39, 41 -46 (2021), which is incorporated by reference herein in its entirety).3. Cytosine base editors (CBEs)

[0307] In some embodiments, the base editor is a cytosine base editor. The first generation of CBEs were made up of a cytidine deaminase enzyme, such as an Apolipoprotein B MRNA Editing Enzyme Catalytic Subunit 1 (APOBEC1), fused to the amino terminus of a catalytically impaired Cas, which can only edit single- stranded DNA. The Cas protein can either be a catalytically inactive dCas, or a partially inactive Cas nickase (nCas), which includes mutationsthat only allow the enzyme to nick the non-edited strand (Porto, E.M., Komor, A.C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839-859 (2020); Huang, T.P., Newby, G.A. & Liu, D.R. Precision genome editing using cytosine and adenine base editors in mammalian cells, Nat Protoc 16, 1089—1128 (2021 ), which are incorporated by reference herein in its entirety). The use of nCas9 promotes repair of the non-edited strand using the deaminated strand as template, which increases editing efficiency (Huang, T.P., Newby, G.A. & Liu, D.R. Precision genome editing using cytosine and adenine base editors in mammalian cells. Nat Protoc 16, 1089—1128 (2021), which is incorporated by reference herein in its entirety). Improved versions also include uracil glycosylase inhibitor (UGI) in the CBE fusion complex to improve editing efficiency. UGI inhibits uracil DNA glycosylase (UNG), an enzyme which eliminates uracil bases through the base-excision repair (BER) pathway.

[0308] The CBE base editing process begins with sgRNA directing the Cas protein to the target locus. Cas binding to the target denatures the DNA duplex to generate a ssDNA R-loop formation that exposes a region of DNA with target cytosines that the cytidine deaminase enzyme can deaminate. CBEs convert a C-G base pair to a T-A base pair by deaminating the target cytosine to generate uracil, which will be read as a thymine by polymerases (Porto, E.M., Komor, A.C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839-859 (2020), which is incorporated by reference herein in its entirety). Further fusion proteins have been developed as cytosine base-editors to improve base-editing efficiency, modify the editing window, and reduce indel formation during base-editing (Kim, ¥., Komor, A., Levy, J. et al. Increasing the genome -targeting scope and precision of base editing with engineered Cas9-cytidine deaminase fusions. Nat Biotechnol 35, 371-376 (2017), which is incorporated by reference herein in its entirety).4. Adenine base editors (ABEs)

[0309] As methylated cytosines undergo high rates of spontaneous cytosine deamination, and almost half of the pathogenic point mutations identified can be corrected by a base pair conversion from an A-T base pair to a G-C base pair, ABEs are highly relevant in the context of correcting disease-causing mutations. ABEs contain a catalytically impaired Cas protein, either a dCas, with no endonuclease activity, or nCas, which yield single- stranded breaks, fused to a DNA modifying enzyme, Escherichia coli tRNA adenosine deaminase (ecTadA). As ssDNA adenosine deaminase enzymes are not naturally occurring, TadA required extensive engineering and development through the directed mutagenesis to produce the first generation of ABE.Similar to CBEs, sgRNA guides the Cas domain to the intended target locus, which exposes a stretch of ssDNA in an R-loop for editing. TadA deaminates an adenine’s exocyclic amine to yield inosine, which is read as guanine by polymerases, converting A-T base pairs to G-C base pairs (Porto, E.M., Komor, A.C., et al. Base editing: advances and therapeutic opportunities. Nat Rev Drug Discov 19, 839 -859 (2020), which is incorporated by reference herein in its entirety).

[0310] In contrast to CBEs, which are compatible with a variety of Cas homologs, ABEs are more restricted. Optimization and protein engineering of ABEs have been performed to improve editing efficiency and expand the targeting range. For example, a previous version of ABE, ABE7.10, was compatible with limited Cas9 enzymes and exhibited lower DNA editing efficiency than CBEs. Through directed evolution, the adenosine deaminase enzyme of ABE7.10, TadA-7.10, was evolved to include 8 additional mutations, yielding TadA-8e, which allowed for greater compatibility with more Cas9 and Cas 12a homologs, higher deamination rates, and overall improved DNA editing efficiency. The base editor variant ABE8e contains an ecTadA-8e fused to a Streptococcus pyogenes Cas9 nickase (SpCas9n). ABE8e has a broader base-editing window than ABE7.10, resulting in an editing window that is on par with that of CBEs (Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat Biotechnol. 2020 Jul;38(7):883-891, which is incorporated by reference herein in its entirety).5. Applications of CRISPR / Cas

[0311] CRISPR-Cas systems can be used in a number of disease-relevant contexts. The generation of animal and cell models of human disease has been facilitated by CRISPR-Cas systems as it allows for the generation of knockout, knock-in, and mutagenesis models. The high sensitivity and single-base specificity also allow CRISPR-Cas systems to be used in the molecular diagnosis of disease by screening for susceptibility genes and pathogenic genes. Additionally, CRISPR-mediated genome-editing therapies are increasingly relevant in treating specific conditions caused by mutated or defective genes, including monogenic diseases caused by mutations of a single allele or a pair of alleles on homologous chromosomes.

[0312] Several important issues and challenges need to be considered during the application of CRISPR-Cas. The editing efficiency and editing byproducts are important considerations when performing genome-editing alterations. There are also challenges associated with off- target effects and delivery methods. Modifications that enhance specificity and fidelity andreduce off-target effects have been made to Cas proteins. Improving the specificity when designing sgRNAs has also decreased the frequency of off-target effects. Lastly, effective delivery of CRISPR-Cas components remains a challenge. The ideal delivery methods should have reduced toxicity, high efficiency, low mutagenicity of the chromosomal DNA, and be cost- effective. See e.g., Jinek, M. et al., A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity, Science 2012, Koonin, E. et al., Diversity, classification and evolution of CRISPR-Cas systems, Current opinion in microbiology 2017, Rees, H. and Liu, D., Base editing: precision chemistry on the genome and transcriptome of living cells, Nature Reviews Genetics 2018, Adli, M., The CRISPR tool kit for genome editing and beyond, Nature communications 2018, and Xu, Y. and Li, Z., CRISPR-Cas systems: Overview, innovations and applications in human disease research and gene therapy, Computational and structural biotechnology journal 2020, which are incorporated by reference herein in its entirety.B. Gene Editing Systems

[0313] The present disclosure provides a method comprising administering a lipid nanoparticle (LNP) that comprises a gene editing system. As used herein, the term “gene editing system” refers to a DNA or RNA editing system that comprises an enzyme element that can bind to DNA or RNA. The enzyme element can comprise an enzyme with nuclease activity, including but not limited to endonuclease activity, or a nucleic acid encoding such an enzyme. The enzyme element can comprise an enzyme with recombinase activity, or a nucleic acid encoding such an enzyme. The gene editing system can further comprise a guide RNA (gRNA) element that comprises a RNA molecule comprising a nucleotide sequence substantially complementary to a nucleotide sequence at one or more target genomic regions. The enzyme element can comprise an enzyme that is guided or brought to a target genomic region(s) by a guide RNA element, or a nucleic acid encoding such an enzyme. In some embodiments, the enzyme element can be naturally occurring. In some embodiments, the enzyme element can comprise a fusion protein.

[0314] In some embodiments, the gene editing system comprises a CRISPR-Cas enzyme, or a variant thereof, and a guide RNA (gRNA). In some embodiments, the gene editing system comprises a fusion enzyme. In some embodiments, the fusion enzyme is a fusion of a Cas enzyme, or a variant thereof, with another enzyme, such as a recombinase, a polymerase, a deaminase, a reverse transcriptase, or another enzyme that binds to nucleic acids. In one embodiment, the fusion enzyme is a fusion between a catalytically impaired Cas enzymecapable of binding to a specific nucleotide sequence and a base-modifying enzyme. In one embodiment, the base-modifying enzyme is an adenosine deaminase. In another embodiment, the base-modifying enzyme is a cytidine deaminase. A base editor comprises a base-modifying enzyme, such as an adenosine deaminase or a cytidine deaminase, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

[0315] In some embodiments, the gene editing system comprises a base editor and a guide RNA (gRNA). In some embodiments, the base editor is an adenine base editor (ABE). In other embodiments, the base editor is a cytosine base editor (CBE). An ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. A CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the catalytically impaired Cas protein is a dead or deactivated Cas9 (dCas), In some embodiments, the catalytically impaired Cas is a Cas9 nickase (nCas). In some embodiments, a dCas has no endonuclease activity. In other embodiments, a nCas creates single-stranded breaks in a nucleic acid.

[0316] In some embodiments, the methods described herein include a gene editing system, a composition comprising a gene editing system, or a gene editing system assembled with the lipid composition. In some embodiment, the lipid composition comprises one or more polypeptides. Some polypeptides may include endonucleases such as any one of the nuclease enzymes described herein. For example, the nuclease enzyme may include from CRIS PR-associated (Cas) proteins or Cas nucleases including type I CRISPR-associated (Cas) polypeptides, type II CRISPR-associated (Cas) polypeptides, type III CRISPR-associated (Cas) polypeptides, type IV CRISPR-associated (Cas) polypeptides, type V CRISPR-associated (Cas) polypeptides, and type VI CRISPR-associated (Cas) polypeptides; zinc finger nucleases (ZFN); transcription activator- like effector nucleases (TALEN); meganucleases; RNA-binding proteins (RBP); CRISPR- associated RNA binding proteins; recombinases; flippases; transposases; Argonaute (Ago) proteins (e.g., prokaryotic Argonaute (pAgo), archaeal Argonaute (aAgo), eukaryotic Argonaute (eAgo), and Natronobacterium gregoryi Argonaute (NgAgo)); Adenosine deaminases acting on RNA (ADAR); CIRT, PUP, homing endonuclease, or any functional fragment thereof, any derivative thereof; any variant thereof; and any fragment thereof.

[0317] In some embodiments, the gene editing system comprises a zinc finger nuclease (ZFN). A zine-finger nuclease (ZFN) comprises a zinc-finger DNA binding domain fused to aDNA cleavage domain. For example, fusion proteins comprise the cleavage domain (or cleavage half-domain) from at least one Type IIS restriction enzyme and one or more zinc finger binding domains, which may or may not be engineered. In some embodiments, the cleavage domain is from the Type IIS restriction endonuclease FokI, which generally catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, e.g., U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; Li et al. (1992) Proc. Natl. Acad. Sci. USA 89:4275-4279; Li et al. (1993) Proc. Natl. Acad. Sci. USA 90:2764-2768; Kim et al. (1994a) Proc. Natl. Acad. Sci. USA 91:883-887; Kim et al. (1994b) J. Biol. Chem. 269: 978-982. Some gene-specific engineered zinc fingers are available commercially. For example, a platform called CompoZr, for zinc-finger construction is available that provides specifically targeted zinc fingers for thousands of targets. See, e.g,, Gaj et al., Trends in Biotechnology, 2013, 31(7), 397-405. In some cases, commercially available zinc fingers are used or are custom designed.

[0318] In some embodiments, the gene editing system comprises a Transcription Activator like Effector (TALE). TALE proteins are from the bacterial species Xanthomonas and comprise a plurality of repeated sequences, each repeat comprising di-residues in position 12 and 13 (RVD) that are specific to each nucleotide base of the nucleic acid targeted sequence. Binding domains with similar modular base-per-base nucleic acid binding properties (MBBBD) can also be derived from different bacterial species. In some embodiments, a “TALE DNA binding domain” or “TALE” is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains, each comprising a repeat variable diresidue (RVD), are involved in binding of the TALE to its cognate target DNA sequence. A single “repeat unit” (also referred to as a “repeat”) is typically 33-35 amino acids in length and exhibits at least some sequence homology with other TALE repeat sequences within a naturally occurring TALE protein. TALE proteins may be designed to bind to a target site using canonical or non-canonical RVDs within the repeat units. See, e.g., U.S. Pat. Nos. 8,586,526 and 9,458,205.

[0319] In some embodiments, the gene editing system comprises a TAL-effector nuclease (TALEN). In some embodiments, a “TALE-nuclease” (TALEN) is a fusion protein comprising a nucleic acid binding domain typically derived from a Transcription Activator Like Effector (TALE) and a nuclease catalytic domain that cleaves a nucleic acid target sequence. The catalytic domain comprises a nuclease domain or a domain having endonuclease activity, like for instance I-TevI, ColE7, NucA and Fok-I. In a particular embodiment, the TALE domain canbe fused to a meganuclease like for instance I-Crel and I-Onul or functional variant thereof. In some embodiments, the TALEN is a monomeric TALEN. A monomeric TALEN is a TALEN that does not require dimerization for specific recognition and cleavage, such as the fusions of engineered TAL repeats with the catalytic domain of I-TevI described in WO2012138927. TALENs have been described and used for gene targeting and gene modifications (see, e.g., Boch et al. (2009) Science 326(5959): 1509-12.; Moscou and Bogdanove (2009) Science 326(5959): 1501; Christian et al. (2010) Genetics 186(2): 757-61; Li et al. (201 1 ) Nucleic Acids Res 39(1): 359-72).1. CRISPR-Cas proteins

[0320] As used herein, the term “Cas protein” or “CRISPR-Cas protein” refers to a full- length Cas protein obtained from nature, a recombinant Cas protein having a sequence that differs from a naturally occurring Cas protein, or any fragment of a Cas protein that nevertheless retains all or a significant amount of the requisite basic functions needed for the disclosed methods, i.e., (i) possession of nucleic-acid binding of the Cas protein to a target DNA, (ii) ability to create double-strand breaks in the target DNA sequence; and / or (iii) ability to nick the target DNA sequence on one strand. The Cas proteins contemplated herein comprise CRISPR Cas9 proteins, as well as Cas9 equivalents, variants (e.g., Cas9 nickase (nCas9) or nuclease inactive Cas9 (dCas9) homologs, orthologs, or paralogs, whether naturally occurring or non- naturally occurring (e.g., engineered or recombinant), and may include a Cas9 equivalent from any type of CRISPR system (e.g., type II, V, VI), including Cpfl (a type-V CRISPR-Cas systems), C2cl (a type V CRISPR-Cas system), C2c2 (a type VI CRISPR-Cas system) and C2c3 (a type V CRISPR-Cas system). Further Cas-equivalents are described in Makarova et al., "C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector," Science 2016; 353(6299), the contents of which are incorporated herein by reference.

[0321] The term “Cas9” or “Cas9 domain” comprises any naturally occurring Cas9 from any organism, any naturally-occurring Cas9 equivalent or functional fragment thereof, any Cas9 homolog, ortholog, or paralog from any organism, and any mutant or variant of a Cas9, naturally-occurring or engineered. The term Cas9 is not meant to be particularly limiting and may be referred to as a “Cas9 or equivalent.” Additional Cas9 sequences and structures are well known to those of skill in the art (see, e.g., "Complete genome sequence of an Ml strain of Streptococcus pyogenes." Ferretti et al., J.J., McShan W.M., Ajdic D .J., Savic DJ., Savic G., Lyon K., Primeaux C., Sezate S., Suvorov A.N., Kenton S., Lai H.S., Lin S.P., Qian Y., JiaH.G., Najar F.Z., Ren Q„ Zhu H„ Song L„ White J., Yuan X., Clifton S.W., Roe B.A., McLaughlin R.E., Proc. Natl. Acad. Sci. U.S.A. 98:4658-4663(2001); "CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III." Deltcheva E., Chylinski K., Sharma C.M., Gonzales K., Chao Y., Pirzada Z.A., Eckert M.R., Vogel J., Charpentier E., Nature 47 1:602-607(2011); and "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity." Jinek M., Chylinski K., Fonfara I., Hauer M., Doudna J.A., Charpentier E. Science 337:816-821(2012), the entire contents of each of which are incorporated herein by reference).

[0322] Examples of Cas9 and Cas9 equivalents are provided as follows; however, these specific examples are not meant to be limiting. The base editors of the present disclosure may use any suitable CRISPR-Cas domain, including any suitable Cas9 or Cas9 equivalent.

[0323] In some aspects, the disclosure provides base editors comprising one or more adenosine deaminase variants disclosed herein and a CRISPR-Cas protein. In some embodiments, the CRISPR-Cas protein comprises a Cas homolog. The CRISPR-Cas protein may be selected from any CRISPR associated protein, including but not limited to a Cas9, a Cas9n, a dCas9, a CasX, a CasY, a C2cl, a C2c2, a C2c3, a GeoCas9, a CjCas9, a Cas 12a, a Casl2b, a Casl2g, a Casl2h, a Casl2i, a Casl3b, a Casl3c, a Casl3d, a Cas14, a C8n2, an xCas9, an SpCas9-NG, an SpCas9-NG-CP1041, an SpCas9-NG-VRQR, an LbCasl2a, an AsCasl2a, a Cas9-KKH, a circularly permuted Cas9, an Argonaute (Ago) domain, a SmacCas9, a Spy-macCas9, an SpCas9-VRQR, an SpCas9-NRRH, an SpaCas9-NRTH, an SpCas9-NRCH. Other non-limiting examples of Cas proteins include Casl, Cas IB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as C8nl and C8xl2), Cas10, C8yl, C8y2, C8y3, C8el, C8e2, C8cl, C8c2, C8a5, C8n2, C8m2, C8m3, C8m4, C8m5, C8m6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, C8bl, C8b2, C8b3, C8xl7, C8x14, C8x10, C8xl6, C8aX, C8x3, C8xl, C8xl5, C8fl, C8f2, C8f3, C8f4, homologs thereof, or modified versions thereof. In certain embodiments, the CRISPR-Cas protein comprises or is a Cas9 protein or a Cas 12a protein derived from .S-. pyogenes or .S-. aureus. In some embodiments, the CRISPR-Cas protein comprises a nuclease dead Cas9 (dCas9) protein, a Cas9 nickase (nCas9) protein, or a nuclease active Cas9 protein. In some embodiments, the Cas protein may be complexed with a guide polynucleotide.

[0324] Exemplary CRISPR-Cas proteins include but are not limited to .S-, pyogenes Cas9 nickase (SpCas9n) and .S-. aureus Cas9 nickase (SaCas9n). Additional exemplary CRISPR-Cas proteins include .S-. aureus Cas9-KKH (SaCas9-KKH), LbCasl2a, enAsCasl2a (an engineeredAsCasl2a recently reported by Joung et al.), SpCas9-NG, SpCas9-VRQR, SpCas9-NG-CP1041, SpCas9-NG-VRQR, SpCas9-NRCH, CP1028-SpCas9, and CP1041-SpCas9. In some embodiments, the CRISPR-Cas protein comprises a Cas9 nickase (nCas9) protein. In some embodiments, the CRISPR-Cas protein comprises an SpCas9n protein. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is a SaCas9n. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is an SpCas9-NRCH. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is an LbCasl2a, e.g., a catalytically inactive or "dead" LbCasl2a. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is an AsCasl2a, e.g., an enAsCasl2a. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is a circular permuted variant of SpCas9, e.g., a CP1028 SpCas9 or a CP1041 SpCas9. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is an evolved SpCas9, e.g., an SpCas9-NG. In certain embodiments, the CRISPR-Cas protein of any of the disclosed base editors is an SpCas9-NG-CP1041. In certain embodiments, the CRISPR-Cas protein of any of the disclosed based editors is SpCas9-NG-VRQR.

[0325] The nuclease in the compositions described herein may be Cas9 (e.g., from .S-. pyogenes or .S-. pneumonia). The CRISPR-Cas protein can direct cleavage of one or both strands at the location of a target sequence, such as within the target sequence and / or within the complement of the target sequence of any one of the genes described herein. For example, the CRISPR enzyme may be directed and cleaved a genomic locus of CFTR.

[0326] The CRISPR-Cas protein may be mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR-Cas protein lacks the ability to cleave one or both strands of a target polynucleotide containing a target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC catalytic domain of Cas9 from .S-, pyogenes converts Cas9 from a nuclease that cleaves both strands to a nickase (cleaves a single strand). In some embodiments, a Cas9 nickase may be used in combination with guide sequence(s), e.g., two guide sequences, which target respectively sense and antisense strands of the DNA target. This combination allows both strands to be nicked and used to induce non-homologous end-joining (NHEJ) or homology directed repair (HDR). See e.g., WO2022216619, which is incorporated herein by reference in its entirety.

[0327] Adenine base editors can deaminate an adenosine that leads to a point mutation from adenine (A) to guanine (G). The adenine base editors can comprise the canonical SpCas9, or anyortholog Cas9 protein, or any variant Cas9 protein including any naturally occurring variant, mutant, or otherwise engineered version of Cas9 that is known or which can be made or evolved through a directed evolutionary or otherwise mutagenesis process. In various embodiments, the CRISPR-Cas protein has nickase activity, i.e., can only cleave one strand of the target DNA sequence. In other embodiments, the CRISPR-Cas protein has an inactive nuclease, e.g., are “dead” or deactivated proteins. Other variant Cas9 proteins that may be used are those having a smaller molecular weight than the canonical SpCas9 (e.g., for easier delivery) or having modified or rearranged primary amino acid sequence (e.g., the circular permutant forms). The adenine base editors described herein can also comprise Cas9 equivalents, including Cas 12a / Cpfl and Cas 12b proteins. The CRISPR-Cas proteins used herein (e.g., SpCas9, SaCas9, SaCas9 variant or SpCas9 variant) can also contain various modifications that alter / enhance their PAM specificities. The disclosure contemplates any Cas9, Cas9 variant, or Cas9 equivalent which has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%', at least 99%, or at least 99.9% sequence identity to a reference Cas9 sequence, such as a reference SpCas9 canonical sequence , a reference SaCas9 canonical sequence or a reference Cas9 equivalent (e.g., Casl2a / Cpfl).

[0328] In certain embodiments, the adenine base editors contemplated herein can include a Cas9 protein that is of smaller molecular weight than the canonical SpCas9 sequence. In some embodiments, the smaller-sized Cas9 variants may facilitate delivery to cells, e.g., by an expression vector, nanoparticle, or other means of delivery. The canonical SpCas9 protein is 1368 amino acids in length and has a predicted molecular weight of 158 kilodaltons. Smaller- sized Cas9 variants can be at least 1300 amino acids, or at least less than 1290 amino acids, or than less than 1280 amino acids, or less than 1270 amino acid, or less than 1260 amino acid, or less than 1250 amino acids, or less than 1240 amino acids, or less than 1230 amino acids, or less than 1220 amino acids, or less than 1210 amino acids, or less than 1200 amino acids, or less than 1190 amino acid, or less than 1180 amino acids, or less than 1170 amino acids, or less than 1160 amino acids, or less than 1150 amino acids, or less than 1140 amino acids, or less than 1130 amino acids, or less than 1120 amino acids, or less than 1110 amino acids, or less than 1100 amino acids, or less than 1050 amino acids, or less than 1000 amino acids, or less than 950 amino acids, or less than 900 amino acids, or less than 850 amino acids, or less than 800 amino acids, or less than 750 amino acids, or less than 700 amino acids, or less than 650 amino acids,or less than 600 amino acids, or less than 550 amino acids, or less than 500 amino acids, but at least larger than about 400 amino acids and retaining the required functions of the Cas9 protein.

[0329] In one embodiment, the base editors may comprise the “canonical SpCas9” nuclease from .S-. pyogenes, which has been widely used as a tool for genome engineering. This Cas9 protein is a large, multi-domain protein containing two distinct nuclease domains. Point mutations can be introduced into Cas9 to abolish one or both nuclease activities, resulting in a nickase Cas9 (nCas9) or dead Cas9 (dCas9), respectively, that still retains its ability to bind DNA in a sgRNA programmed manner. In principle, when fused to another protein or domain, Cas9 or variant thereof (e.g., nCas9) can target that protein to virtually any DNA sequence simply by co-expression with an appropriate sgRNA. As used herein, the canonical SpCas9 protein refers to the wild type protein from .S-. pyogenes having the following amino acid sequence. The base editors described herein may include canonical SpCas9, or any variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity with a wild type Cas9 sequence provided above. The adenine base editors described herein may include any of the above SpCas9 sequences, or any variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.

[0330] In other embodiments, the Cas9 protein can be a wild type Cas9 ortholog from another bacterial species. In some embodiments, the Cas9 protein is an ortholog comprising a sequence of at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to any of the below orthologs. In some embodiments, the adenine base editor may include any of the above Cas9 ortholog sequences, or any variants thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto.

[0331] The CRISPR-Cas domain may include any suitable homologs and / or orthologs or naturally occurring enzymes, such as Cas9. Cas9 homologs and / or orthologs have been described in various species, including, but not limited to, .S-. pyogenes and .S-, thermophilus. Preferably, the Cas moiety is configured (e.g., mutagenized, recombinantly engineered, or otherwise obtained from nature) as a nickase. Such Cas9 nucleases and sequences include Cas9 sequences from the organisms and loci disclosed in Chylinski, Rhun, and Charpentier, "The tracrRNA and Cas9 families of type II CRISPR-Cas immunity systems" (2013) RNA Biology 10:5, 726-737; the entire contents of which are incorporated herein by reference. In some embodiments, a Cas9 nuclease has an inactive (e.g., an inactivated) DNA cleavage domain, that is, the Cas9 is a nickase.

[0332] In some embodiments, the disclosed base editors may comprise a catalytically inactive, deactivated, or “dead,” CRISPR-Cas domain. Exemplary catalytically inactive domains in the disclosed adenine base editors are dead .S-. pyogenes Cas9 (dSpCas9), dead .S-. aureus Cas9 (dSaCas9) and dead Lachnospiraceae bacterium Casl2a (dLbCasl2a).

[0333] In certain embodiments, the base editors described herein may include a dead Cas9, e.g.. dead SpCas9, which has no nuclease activity due to one or more mutations that inactivate both nuclease domains of SpCas9, namely the RuvC domain (which cleaves the nonprotospacer DNA strand) and HNH domain (which cleaves the protospacer DNA strand). The nuclease inactivation may be due to one or mutations that result in one or more substitutions and / or deletions in the amino acid sequence of the encoded protein, or any variants thereof having at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity thereto. The D10A and N580A mutations in the wild-type .S-. aureus Cas9 amino acid sequence may be used to form a dSaCas9. Accordingly, in some embodiments, the CRISPR-Cas domain of the base editors provided herein comprises a dSaCas9 that has D10A and N580A mutations relative to the wild-type SaCas9 sequence.

[0334] As used herein, the term “dCas9” refers to a nuclease-inactive Cas9 or nuclease-dead Cas9. The term dCas9 is not meant to be particularly limiting and may be referred to as a “dCas9 or equivalent.” Any suitable mutation which inactivates both Cas9 endonucleases may be used to form the dCas9.

[0335] In other embodiments, dCas9 corresponds to, or comprises in part or in whole, a Cas9 amino acid sequence having one or more mutations that inactivate the Cas9 nuclease activity. In other embodiments, Cas9 variants having mutations may result in the full or partial inactivation of the endogenous Cas9 nuclease activity (e.g., dCas9 or nCas9, respectively). In some embodiments, variants or homologues of Cas9 (e.g., variants of Cas9 from Streptococcus pyogenes) are provided which are at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the sequence of wild type Cas9 from Streptococcus pyogenes.

[0336] In some embodiments, the CRISPR-Cas protein of any of the disclosed base editors comprises a dead .S-. pyogenes Cas9 (dSpCas9). In some embodiments, the CRISPR-Cas protein of any of the disclosed base editors comprises a dead Lachnospiraceae bacterium Casl2a (dLbCasl2a).

[0337] In some embodiments, the disclosed base editors may comprise a CRISPR-Cas protein that comprises a nickase. In some embodiments, the base editors described herein comprise a Cas9 nickase. The term “Cas9 nickase” or “nCas9” refers to a variant of Cas9 which is capable of introducing a single-strand break in a double strand DNA molecule target. In some embodiments, the Cas9 nickase comprises only a single functioning nuclease domain. The wild type Cas9 (e.g., the canonical SpCas9) comprises two separate nuclease domains, namely, the RuvC domain (which cleaves the non-protospacer DNA strand) and HNH domain (which cleaves the protospacer DNA strand). In one embodiment, the Cas9 nickase comprises a mutation in the RuvC domain which inactivates the RuvC nuclease activity.

[0338] The catalytically impaired Cas9 protein can be, but is not limited to NRRH, NRTH, NRCH, xCas9, SpCas9-NG, SpCas9, SpG, SpRY, SauriCas9, SaCas9, Nme2Cas9, VRER- SpCas9, and VQRSpCas9. In some embodiments, the catalytically impaired Cas9 protein is SpCas9-NG.

[0339] In some embodiments, the CRISPR-Cas protein of any of the disclosed base editors comprises an 5. pyogenes Cas9 nickase (SpCas9n). In some embodiments, the CRISPR-Cas protein of any of the disclosed base editors comprises an 5. aureus Cas9 nickase (SaCas9n).

[0340] The CRISPR-Cas proteins used in the base editors described herein may also include other Cas9 variants that area at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference Cas9 protein, including any wild type Cas9, or mutant Cas9 (e.g., a dead Cas9 or Cas9 nickase), or circular permutant Cas9, or other variant of Cas9 disclosed herein or known in the art.

[0341] In some embodiments, the Cas9 variant comprises a fragment of a reference Cas9 (e.g., a gRNA binding domain or a DNA-cleavage domain), such that the fragment is at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to the corresponding fragment of wild type Cas9. In some embodiments, the fragment is at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%identical, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% of the amino acid length of a corresponding wild type Cas9.

[0342] In some embodiments, the disclosure also may utilize Cas9 fragments which retain their functionality and which are fragments of any herein disclosed Cas9 protein. In some embodiments, the Cas9 fragment is at least 100 amino acids in length. In some embodiments, the fragment is at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, or at least 1300 amino acids in length.

[0343] In various embodiments, the base editors disclosed herein may comprise one of the Cas9 variants described as follows, or a Cas9 variant thereof having at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to any reference Cas9 variants.

[0344] In some embodiments, the base editors described herein can include any Cas9 equivalent. As used herein, the term “Cas9 equivalent” is a broad term that encompasses any CRISPR-Cas protein that serves the same function as Cas9 in the present adenine base editors despite that its amino acid primary sequence and / or its three-dimensional structure may be different and / or unrelated from an evolutionary standpoint. Thus, while Cas9 equivalents include any Cas9 ortholog, homolog, mutant, or variant described or embraced herein that are evolutionarily related, the Cas9 equivalents also embrace proteins that may have evolved through convergent evolution processes to have the same or similar function as Cas9, but which do not necessarily have any similarity with regard to amino acid sequence and / or three dimensional structure. The adenine base editors described here embrace any Cas9 equivalent that would provide the same or similar function as Cas9 despite that the Cas9 equivalent may be based on a protein that arose through convergent evolution.

[0345] However, the Cas9 equivalents contemplated herein may also be obtained from archaea, which constitute a domain and kingdom of single-celled prokaryotic microbes different from bacteria.2. Base Editors

[0346] In some embodiments, the gene editing system comprises a base editor and a guide RNA (gRNA ). In some embodiments, the base editor is an adenine base editor (ABE). In other embodiments, the base editors is a cytosine base editor (CBE). An ABE comprises a tRNAadenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. A CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence. In some embodiments, the present disclosure provides base editors having adenosine deaminase domains that are mutated (e.g. evolved to have mutations) that enable the deaminase domain to have improved activity when used with Cas homologs (e.g., homologs other than SpCas9). Accordingly, the present disclosure provides variants of adenosine deaminases (e.g., variants of TadA-7.10). One example of an adenosine deaminase variant is TadA-8e, which contains eight additional mutations relative to the TadA- 7.10 deaminase domain (where TadA-7.10 contains the mutations W23R, H36L, P48A, R51L, L84F, A106V, D108N, H123Y, S146C, D147Y, R152P, E155V, I156F, and K157N in the ecTadA sequence). TadA-8e is broadly compatible with diverse Cas9 or Casl2 homologs, and exhibits improved editing efficiencies when paired with previously incompatible Cas9 or Cas 12 homologs. For instance, disclosed adenosine deaminase variants such as TadA-8e exhibit higher editing efficiencies when paired in a base editor with certain Cas9 variants, such as circularly permuted variants CP1041 and CP1028, than exhibited by the TadA-7.10 deaminase. In some embodiments, the adenosine deaminase is TadA-7.10. In some embodiments, the adenosine deaminase is TadA-8e.

[0347] In one embodiment, the base editor is ABE 0.1, ABE 0.2, ABE 1.1, ABE 1.2, ABE2.1, ABE 2.2, ABE 2.3, ABE 2.4, ABE 2.5, ABE 2.6, ABE 2.7, ABE 2.8, ABE 2.9, ABE 2.10, ABE 2.11, ABE 2.12, ABE 3.1, ABE 3.2, ABE 3.3, ABE 3.4, ABE 3.5, ABE 3.6, ABE 3.7, ABE 3.8, ABE 4.1, ABE 4.2, ABE 4.3, ABE 5.1, ABE 5.2, ABE 5.3, ABE 5.4, ABE 5.5, ABE 5.6, ABE 5.7, ABE 5.8, ABE 5.9, ABE 5.10, ABE 5.11, ABE 5.12, ABE 5.13, ABE 5.14, ABE6.1, ABE 6.2, ABE 6.3, ABE 6.4, ABE 6.5, ABE 6.6, ABE 7.1, ABE 7.2, ABE 7.3, ABE 7.4, ABE 7.5, ABE 7.6, ABE 7.7, ABE 7.8, ABE 7.9, ABE 7.10, or ABEmax, as described in US 2020 / 0308571, which is hereby incorporated by reference in its entirety. In another embodiment, the base editor is an ABE8 variant. In some embodiments, the base editor is ABE8e.

[0348] Exemplary ABEs include, but are not limited to, ABE7.10 (or ABEmax), ABE8e, SaKKH-ABE8e, NG-ABE8e, ABE-xCas9, SaKKH-ABE7.10, NG-ABE7.10, ABE7.10-VRQR, ABE8e-NRTH, ABE8e-NRRH, ABE8e-NRCH, NG-CP1041-ABE8e, ABE8eCP1041, ABE8e- CP 1028, and ABE8e-VRQR. In certain embodiments, the ABE used in the disclosed methods is an ABE8e or an ABE7.10. ABE8e may be referred to herein as “ABE8” or “ABE8.0.” TheABE8e base editor and variants thereof may comprise an adenosine deaminase domain containing a TadA-8e adenosine deaminase monomer (monomer form) or a TadA-8e adenosine deaminase homodimer or heterodimer (dimer form). ABE8e is further described in Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA, Liu DR. Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Nat Biotechnol. 2020 Jul;38(7):883-891, which is incorporated by reference herein in its entirety. Other ABEs can be used to deaminate a target adenosine in accordance with the disclosure.

[0349] In some embodiments, any of the disclosed base editors are capable of deaminating adenosine in a nucleic acid sequence (e.g., DNA or RNA). In various embodiments, the adenosine deaminases of the base editors hydrolytically deaminate a targeted adenosine in a nucleic acid of interest to an inosine, which is read as a guanosine (G) by DNA polymerase enzymes. In some embodiments, the base editor is an ABE. In another embodiment, the base editor is ABE8e. In other embodiments, the base editor is a CBE. In some embodiments, the gene editing system comprises a ABE and a guide RNA (gRNA). In some embodiments, the gene editing system comprises a CBE and a guide RNA (gRNA).

[0350] In some embodiments, any of the adenosine deaminases provided herein are capable of deaminating adenine, e.g., deaminating adenine in a deoxyadenosine residue of DNA. The adenosine deaminase may be derived from any suitable organism (e.g., E. coli). In some embodiments, the adenosine deaminase is a naturally -occurring adenosine deaminase that includes one or more mutations corresponding to any of the mutations provided herein (e.g., mutations in ecTadA). In some embodiments, the adenosine deaminase is derived from a prokaryote. In some embodiments, the adenosine deaminase is from a bacterium. In some embodiments, the disclosed adenosine deaminases are variants of a TadA derived from a species other than Escherichia coli, such as Staphylococcus aureus, Salmonella typhi, Shewanella putrefaciens, Elaemophilus influenzae, Caulobacter crescentus, or Bacillus subtilis. In some embodiments, the adenosine deaminase is from E. coli.

[0351] In certain embodiments, the base editor includes mutations that confer reduced off- target effects, such as reduced RNA editing activity and off-target DNA editing activity, on the adenine base editor. In various embodiments, the disclosure provides an ABE that has one or more amino acid variations introduced into the amino acid sequence of the adenosine deaminase domain relative to the amino acid sequence of the reference adenosine deaminase domain. TheABE may include variants in one or more components or domains of the base editor (e.g., variations introduced into the adenosine deaminase domain, or variations introduced into both the adenine deaminase domain and the CRISPR-Cas domain).

[0352] For example, the disclosed adenosine deaminase variants may be at least about 70% identical, at least about 80% identical, at least about 90% identical, at least about 95% identical, at least about 96% identical, at least about 97% identical, at least about 98% identical, at least about 99% identical, at least about 99.5% identical, or at least about 99.9% identical to a reference adenosine deaminase domain.

[0353] In some embodiments, the adenosine deaminase domain of any of the disclosed base editors comprises a single adenosine deaminase, or a monomer. In some embodiments, the adenosine deaminase domain comprises 2, 3, 4 or 5 adenosine deaminases. In some embodiments, the adenosine deaminase domain comprises two adenosine deaminases, or a dimer. In some embodiments, the deaminase domain comprises a dimer of an engineered (or evolved) deaminase and a wild-type deaminase, such as a wild-type E. co / z-derived deaminase. Base editors are further described in International Publication No. WO 2018 / 027078, published August 2, 2018; International Publication No. WO 2019 / 079347 on April 25, 2019; international Application No PCT / US2019 / 033848, filed May 23, 2019, which published as International Publication No. WO 2019 / 226953 on November 28, 2019; U.S. Patent Publication No. 2018 / 0073012, published March 15, 2018, which issued as U.S. Patent No. 10,113,163, on October 30, 2018; U.S. Patent Publication No. 2017 / 0121693, published May 4, 2017, Which issued as U.S. Patent No. 10,167,457 on January 1, 2019; International Publication No. WO 2017 / 070633, published April 27, 2017; U.S. Patent Publication No. 2015 / 0166980, published June 18, 2015; U.S. Patent No. 9,840,699, issued December 12, 2017; and U.S. Patent No. 10,077,453, issued September 18, 2018, and International Patent Application No. PCT / US2020 / 28568, filed April 16, 2020: all of which are incorporated herein by reference in their entireties.

[0354] Exemplary ABEs of this disclosure comprise the monomer and dimer versions of the following editors: ABE8e, SaABE8e, SaKKH-ABE8e, NG-ABE8e, ABE-xCas9, ABE8e- NRTH, ABE8e-NRRH, ABE8e-NRCH, ABE8e-NG-CP1041, ABE8e-VRQR-CP1041, ABE8e- CP1041, ABE8e-CP1028, ABE8e-VRQR. ABE8e-LbCasl2a (LbABE8e), ABE8eAsCasl2a (enAsABE8e), ABE8e-SpyMac, ABE8e (TadA-8e V 106W), ABE8e (K20A, R21A), and ABE8e (TadA-8e V82G). The monomer version refers to an editor having an adenosinedeaminase domain that comprises a TadA-8e and does not comprise a second adenosine deaminase enzyme. The dimer version refers to an editor having an adenosine deaminase domain that comprises a first and second adenosine deaminase, i.e., a wild-type TadA enzyme and a TadA-8e enzyme. In some embodiments, the ABE is a ABE8e.

[0355] Any two or more of the adenosine deaminases described herein may be connected to one another (e.g., by a linker, such as a peptide linker) within an adenosine deaminase domain of the base editors provided herein. In some embodiments, the base editor comprises two adenosine deaminases (e.g., a first adenosine deaminase and a second adenosine deaminase). For instance, in certain embodiments, the base editors provided herein may contain exactly two adenosine deaminases. In some embodiments, the first and second adenosine deaminases are any of the adenosine deaminases provided herein. In some embodiments, the adenosine deaminases are the same. In some embodiments, the adenosine deaminases are different. In some embodiments, the first adenosine deaminase and second adenosine deaminase are derived from the same bacterial species. In some embodiments, the first adenosine deaminase and second adenosine deaminase are derived from different bacterial species.

[0356] In some embodiments, the base editor comprises a heterodimer of a first adenosine deaminase and a second adenosine deaminase. In some embodiments, the first adenosine deaminase is N-terminal to the second adenosine deaminase in the base editor. In some embodiments, the first adenosine deaminase is C-terminal to the second adenosine deaminase in the base editor. In some embodiments, the first adenosine deaminase and the second deaminase are fused directly to each other or via a linker. In some embodiments, the first adenosine deaminase is fused N-terminal to the CRISPR-Cas protein via a linker, and the second deaminase is fused C-terminal to the CRISPR-Cas protein via a linker. In other embodiments, the second adenosine deaminase is fused N-terminal to the CRISPR-Cas protein via a linker, and the first deaminase is fused C-terminal to the CRISPR-Cas protein via a linker.

[0357] In some embodiments, the base editors described herein may comprise one or more heterologous protein domains (e.g., about or more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more domains in addition to the base editor components). A base editor may comprise any additional protein sequence, and optionally a linker sequence between any two domains. Other exemplary features that may be present are localization sequences, such as cytoplasmic localization sequences, export sequences, such as nuclear export sequences, or other localization sequences, as well as sequence tags.

[0358] In certain embodiments, linkers may be used to link any of the peptides or peptide domains or domains of the base editor (e.g., a CRISPR-Cas protein covalently linked to an adenosine deaminase domain). In some embodiments, the linker is 5-100 amino acids in length, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35-40, 40-45, 45-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100- 110, 110- 120, 120-130, 130-140, 140-150, or 150-200 amino acids in length. Longer or shorter linkers are also contemplated. In some embodiments, the linker is 32 amino acids in length.

[0359] The linker may be as simple as a covalent bond, or it may be a polymeric linker many atoms in length. In certain embodiments, the linker is a polypeptide or based on amino acids. In other embodiments, the linker is not peptide-like. In certain embodiments, the linker is a covalent bond (e.g., a carbon-carbon bond, disulfide bond, carbon-heteroatom bond, etc.). In certain embodiments, the linker is a carbon-nitrogen bond of an amide linkage. In certain embodiments, the linker is a cyclic or acyclic, substituted or unsubstituted, branched or unbranched aliphatic or heteroaliphatic linker. In certain embodiments, the linker is polymeric (e.g., polyethylene, polyethylene glycol, polyamide, polyester, etc.). In certain embodiments, the linker comprises a monomer, dimer, or polymer of aminoalkanoic acid. In certain embodiments, the linker comprises an aminoalkanoic acid (e.g., glycine, ethanoic acid, alanine, beta-alanine, 3- aminopropanoic acid, 4- aminobutanoic acid, 5-pentanoic acid, etc.). In certain embodiments, the linker comprises a monomer, dimer, or polymer of aminohexanoic acid (Ahx). In certain embodiments, the linker is based on a carbocyclic moiety (e.g., cyclopentane, cydohexane). In other embodiments, the linker comprises a polyethylene glycol moiety (PEG). In other embodiments, the linker comprises amino acids. In certain embodiments, the linker comprises a peptide. In certain embodiments, the linker comprises an aryl or heteroaryl moiety. In certain embodiments, the linker is based on a phenyl ring. The linker may include functionalized moieties to facilitate attachment of a nucleophile (e.g., thiol, amino) from the peptide to the linker. Any electrophile may be used as part of the linker. Exemplary electrophiles include, but are not limited to, activated esters, activated amides, Michael acceptors, alkyl halides, aryl halides, acyl halides, and isothiocyanates.

[0360] In some aspects, the present disclosure provides compositions comprising the ABE as described herein and one or more guide RNAs, e.g., a single-guide RNA (“sgRNA”). In addition, the present disclosure provides for nucleic acid molecules encoding and / or expressing the adenine base editors as described herein, as well as expression vectors or constructs forexpressing the adenine base editors described herein and a gRNA, host cells comprising said nucleic acid molecules and expression vectors, and optionally one or more gRNAs, and compositions for delivering and / or administering nucleic acid-based embodiments described herein.

[0361] In some embodiments, the LNP comprises a gene editing system, wherein the gene editing system comprises a gRNA and the mRNA of the base editor. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar ratio that is 1 : 1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar ratio that is not 1:1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio less than 1:1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of at most about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1 :10, 1:11, 1:12, 1:13, 1 :14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1 :29, or 1:30. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of at least about 1:30, 1:29, 1:28, 1 :27, 1:26, 1:25, 1:24, 1 :23, 1:22, 1:21, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1:9, 1:8, 1:7, 1:6, 1:5, 1 :4, 1 :3, 1:2, or 1 :1. In some embodiments, the gRNA and the mRNA of the base editor are present at a molar or weight ratio of about 1:1, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1:21, 1:22, 1:23, 1:24, 1:25, 1:26, 1 :27, 1:28, 1:29, or 1:30, or a range between any two of the foregoing values.

[0362] In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio that is not 1:1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio less than 1:1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of at most about 1 :1, 1 :2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1 :21 , 1:22, 1:23, 1:24, 1 :25, 1 :26, 1:27, 1:28, 1 :29, or 1 :30. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of at least about 1:30, 1:29, 1:28, 1:27, 1 :26, 1:25, 1:24, 1:23, 1:22, 1:21, 1:20, 1:19, 1:18, 1:17, 1:16, 1:15, 1:14, 1:13, 1:12, 1:11, 1:10, 1 :9, 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, or 1:1. In some embodiments, the mRNA of the base editor and the gRNA are present at a molar or weight ratio of about 1:1, 1:2, 1:3, 1:4, 1:5, 1 :6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, 1:18, 1:19, 1:20, 1 :21, 1:22, 1:23, 1:24, 1:25, 1:26, 1:27, 1:28, 1:29, or 1:30, or a range between any two of the foregoing values.3. Guide RNA

[0363] In some embodiments, the one or more polynucleotides comprise a guide RNA (gRNA). In some embodiments, gRNAs are designed to recognize target sequences in a gene or genome of interest. Such gRNAs may be designed to have guide sequences (or "spacers") having complementarity to a protospacer within the target sequence.

[0364] In some embodiments, the gRNA is complexed with a recombinant nuclease capable of inducing a DNA break. In some embodiments, the gRNA is a single guide RNA (sgRNA). In some embodiments, the gRNA comprises a crispr RNA (crRNA) and a tracrRNA. In some embodiments, the gRNA is modified. In some embodiments, the gRNA is modified with an end modification (e.g. (3 x 2'-O-methyl-3'-phosphorothioate (MS) on 5’ end and 3 x 2'-O-methyl-3'- phosphonoacetat (MP) on 3’end (K. A. Hajj, K. A. Whitehead, Nat. Rev. Mater. 2, 17056 (2017)). In some embodiments, the gRNA can be heavily modified (T. Wei et al., ACS Nano 14, 9243-9262 (2020).

[0365] In some embodiments, gRNAs can be used with one or more of the disclosed ABEs, e.g., in the disclosed methods of editing a nucleic acid molecule. Such gRNAs may be designed to have guide sequences having complementarity to a protospacer within a target sequence to be edited, and to have backbone sequences that interact specifically with the CRISPR-Cas protein of any of the disclosed base editors, such as Cas9 nickase proteins of the disclosed base editors. The guide sequence becomes associated or bound to the base editor and directs its localization to a specific target sequence having complementarity to the guide sequence or a portion thereof. The particular design of a guide sequence will depend upon the nucleotide sequence of a genomic target sequence (i.e., the desired site to be edited) and the type of CRISPR-Cas protein (e.g., type of Cas9 protein) present in the base editor, among other factors, such as PArvl sequence locations, percent G / C content in the target sequence, the degree of microhomology regions, and / or secondary structures.

[0366] In some embodiments, the polynucleotide encodes a guide polynucleotide (such as guide RNA (gRNA) or guide DNA (gDNA)) that is at least partially complementary to the genomic region of a gene, where upon binding of the guide polynucleotide to the gene the guide polynucleotide recruits the guide polynucleotide guided CRISPR-Cas protein to cleave and genetically modified the region. In some embodiments, a CFTR gene can be modified by the guide polynucleotide-guided CRISPR-Cas protein.

[0367] In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of the CRISPR-Cas protein (e.g., a Cas9 or Cas9 variant) to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, or more. Optimal alignment may be determined with the use of any suitable algorithm for aligning sequences, non-limiting example of which include the Smith- Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., the Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, Calif.), SOAP, and Maq (available at maq.sourceforge.net).

[0368] In some embodiments, a guide sequence is above or more than about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75, or more nucleotides in length. In some embodiments, each gRNA comprises a guide sequence of at least 10 contiguous nucleotides (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 contiguous nucleotides) that is complementary to a target sequence (or off target site).

[0369] In some embodiments, a guide sequence is less than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12, or fewer nucleotides in length. The ability of a guide sequence to direct sequence- specific binding of a base editor to a target sequence may be assessed by any suitable assay. For example, the components of a base editor, including the guide sequence to be tested, may be provided to a host cell having the corresponding target sequence, such as by transfection with vectors encoding the components of a base editor disclosed herein, followed by an assessment of preferential cleavage within the target sequence. Similarly, cleavage of a target polynucleotide sequence may be evaluated in situ by providing the target sequence, components of a base editor, including the guide sequence to be tested and a control guide sequence different from the test guide sequence, and comparing binding or rate of cleavage at the target sequence between the test and control guide sequence reactions. Other assays are possible, and will occur to those skilled in the art.

[0370] In some embodiments, the gRNA comprises a sequence that is complementary to a target sequence. In some embodiments, the gRNA comprises a sequence that is complementaryto a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene or transcript. In some embodiments, the gRNA comprises a sgRNA. In some embodiments, the sequence of the gRNA is shown in Table 9. In some embodiments, the gRNA comprises the nucleic acid sequence of SEQ ID NO: 1 or a nucleic acid sequence having at least at or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 1. In some embodiments, the gRNA comprises the nucleic acid sequence of SEQ ID NO: 2 or a nucleic acid sequence having at least at or about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 2.Table 9: Sequences of sgRNA

[0371] In some embodiments, a guide RNA (gRNA) comprising a sequence that is complementary to a target sequence (e.g. CFTR gene) and is used with RNA-guided nucleases, e.g., Cas, to induce a DNA break at the target site or target position. Methods for designing gRNAs and exemplary targeting domains can include those described in, e.g., WO2015 / 161276, W02017 / 193107, WO2017 / 093969, US2016 / 272999 and US2015 / 056705, the contents of which are incorporated by reference. Methods for introducing a genetic disruption at one or more target sites and gRNAs that target the target sites include those described in, e.g., WO2015 / 161276, W02015 / 070083, WO2019 / 070541, WO2019 / 195491, WO2019 / 195492, WO2019 / 089884, and WO2020 / 223535, the contents of which are incorporated by reference.

[0372] Several exemplary gRNA structures, with domains indicated thereon, are described in WO2015 / 161276. While not wishing to be bound by theory, with regard to the three dimensional form, or intra- or inter- strand interactions of an active form of a gRNA, regions of high complementarity are sometimes shown as duplexes in WO2015 / 161276.

[0373] In some embodiments, the gRNA is a unimolecular or chimeric gRNA comprising, from 5’ to 3’: a targeting domain which targets a target site (e.g., a locus in the CFTR gene); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and optionally, a tail domain.

[0374] In some embodiments, the gRNA is a modular gRNA comprising first and second strands. In these cases, the first strand preferably includes, from 5’ to 3’: a targeting domain (which targets a target site e.g., at CFTR gene); and a first complementarity domain. The second strand generally includes, from 5’ to 3’: optionally, a 5’ extension domain; a second complementarity domain; a proximal domain; and optionally, a tail domain.IV. COMPOSITIONS

[0375] Provided herein are methods comprising compositions comprising lipid nanoparticles (LNPs), such as LNPs comprising a gene editing system. In some embodiments, the composition comprises LNPs in any formulation such as those described in Section IID. In some embodiments, the method comprises administration of the LNPs comprising a gene editing system and / or compositions containing said LNPs to a subject for the treatment of disease or condition. In some aspects, the LNPs or compositions comprising said LNPs are administered to a subject, such as a subject with a disease or condition, or to prevent or reduce the severity of a disease or condition. In some embodiments, the method comprises administration of the LNPs comprising a gene editing system and / or compositions containing said LNPs to a subject for the treatment of cystic fibrosis. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition comprises a pharmaceutically acceptable excipient.

[0376] In some embodiments, the LNPs, or compositions comprising the same, can be administered by any suitable means, for example, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration. In some embodiments, the nanoparticle is administered (e.g., in a lipoplex particle or liposome) intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, intracranial, intrathoracic, or subcutaneous administration. Dosing and administration may depend in part on whether the administration is brief or chronic. Various dosing schedules include but are not limited to single or multiple administrations over varioustime-points, bolus administration, and pulse infusion. In some embodiments, the LNPs, or compositions comprising the same are administered intravenously. In some embodiments, the LNPs or compositions comprising the same are administered by way of aerosolized delivery.

[0377] In some embodiments, the LNPs or compositions are administered in the presence of an adjuvant. In some embodiments, the LNPs or compositions can be administered by repeat administration of the peptide a plurality of times. In some embodiments, repeated administration is with a low dose of peptide. In some embodiments, the r...

Claims

Claims1. A method of treating a subject with cystic fibrosis, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP) that comprises a gene editing system, wherein the gene editing system comprises:(i) a first nucleic acid encoding a base editor; and(ii) a second nucleic acid encoding a guide RNA (gRNA), and wherein the composition treats the cystic fibrosis in the subject.

2. A method of treating cystic fibrosis in a subject, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA, wherein the first nucleic acid and the second nucleic acid are delivered to a lung cell in the subject.

3. The method of claim 1 or 2, wherein the CFTR gene of the subject comprises a R553X stop codon mutation.

4. The method of claim 3, wherein the administration of the composition results in an increase in the expression of the full-length cystic fibrosis transmembrane conductance regulator (CFTR) protein in the subject, as compared to a subject with cystic fibrosis and whose CFTR gene comprises a R553X stop codon mutation, and that is not administered the composition.

5. The method of claim 3, wherein the administration of the composition results in an increase in the function of the cystic fibrosis transmembrane conductance regulator (CFTR) protein in the subject, as compared to a subject with cystic fibrosis and whose CFTR gene comprises a R553X stop codon mutation, and that is not administered the composition.

6. The method of any of claims 1-5, wherein the nucleic acid encoding the base editor isRNA.

7. The method of any of claims 1-6, wherein the base editor is an adenine base editor (ABE).

8. The method of claim 7, wherein the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

9. The method of claim 7, wherein the ABE is ABE8e.

10. The method of any of claims 1-6, wherein the base editor is a cytosine base editor (CBE).

11. The method of claim 10, wherein the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

12. The method of any of claims 7-11, wherein the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

13. The method of any of claims 1-12, wherein the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid.

14. The method of any of claims 1-13, wherein the LNP comprises 5A2-SC8, 1,2-dioleoyl- sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules.

15. A method of delivering a gene editing system to a lung cell type in a subject, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP) that comprises a gene editing system, wherein the gene editing system comprises (i) a first nucleic acid encoding an endonuclease or a base editor; and (ii) a second nucleic acid encoding a guide RNA (gRNA), and wherein the gene editing system is delivered to a lung cell type in a subject.

16. The method of claim 15, wherein the lung cell type is an endothelial cell or an epithelial cell.

17. The method of claim 15 or 16, wherein the lung cell type is an immune cell.

18. The method of any of claims 15-17, wherein the lung cell type is a stem cell.

19. The method of any of claims 15-18, wherein the endonuclease is a Cas nuclease of the CRISPR-Cas system.

20. The method of claim 19, wherein the Cas nuclease is a Cas9 nuclease, a Casl2 nuclease, or a Cas 13 nuclease.

21. The method of any of claims 15-20, wherein the nucleic acid encoding the endonuclease is DNA.

22. The method of any of claims 15-20, wherein the nucleic acid encoding the endonuclease is RNA.

23. The method of any of claims 15-18, wherein the nucleic acid encoding the base editor is DNA.

24. The method of claim 15-18, wherein the nucleic acid encoding the base editor is RNA.

25. The method of any of claims 15-18, 23, and 24, wherein the base editor is an adenine base editor (ABE).

26. The method of claim 25, wherein the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

27. The method of claim 25, wherein the ABE is ABE8e.

28. The method of any of claim 15-18, 23, and 24, wherein the base editor is a cytosine base editor (CBE).

29. The method of claim 28, wherein the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

30. The method of any of claims 15-18 and 23-29, wherein the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

31. The method of any of claims 1-30, wherein the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a molecule: molecule basis.

32. The method of any of claims 1-30, wherein the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a weight basis.

33. The method of any of claims 1-30, wherein the ratio of the first nucleic acid to the second nucleic acid is 2: 1 on a molecule: molecule basis.

34. The method of any of claims 1-30, wherein the ratio of the first nucleic acid to the second nucleic acid is 2: 1 on a weight basis.

35. The method of any one of claims 15-34, wherein the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid.

36. The method of any one of claims 15-35, wherein the LNP comprises 5A2-SC8, 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules.

37. The method of claim 14 or 36, wherein the one or more SORT molecules comprises permanently positively charged moiety.

38. The method of claim 37, wherein the one or more SORT molecules is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt);18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

39. The method of claim 14 or 36, wherein the one or more SORT molecule comprises DOTAP (l,2-dioleoyl-3-trimethylammonium propane).

40. The method of claim 37 or 38, wherein the one or more SORT molecule comprises 18PA.

41. The method of claim 37 or 38, wherein the one or more SORT molecule comprises DODAP.

42. The method of claim 41, wherein the DODAP comprises about 20% molar ratio of the total lipids.

43. The method of claim 39, wherein the DOTAP comprises about 50% molar ratio of the total lipids.

44. The method of claim 40, wherein the 18PA comprises about 10% molar ratio of the total lipids.

45. The method of claim 37 or 38, wherein the one or more SORT molecule comprisesDOTMA.

46. The method of claim 36, 37 or 38, wherein the LNP comprises a ratio of DOPE:DOTMA between 3:1 and 1:3.

47. The method of claim 46, wherein the ratio of DOPE:DOTMA is about 3:1.

48. The method of claim 46, wherein the ratio of DOPE:DOTMA is about 1:1.

49. The method of any of claims 14, 36-48, wherein the SORT molecule comprises from about 5% to about 60% molar percentage of the LNP.

50. The method of any of claims 14, 36-48, wherein the SORT molecule comprises about 40% molar percentage of the LNP.

51. The method of any of claims 14, 36-48, wherein the SORT molecule comprises about 50% molar percentage of the LNP.

52. The method of any of claims 1-51, wherein the LNP binds vitronectin.

53. The method of any one of claims 1-52, wherein the guide RNA comprises a circular RNA.

54. The method of any one of claims 1-52, wherein the guide RNA comprises a linear RNA.

55. The method of any of claims 1-52, wherein the guide RNA is a single guide RNA (sgRNA).

56. The method of any of claims 1-55, wherein the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene.

57. The method of any of claims 1-56, wherein the nucleotide sequence of the guide RNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

58. The method of any one of claims 1 to 57, wherein the composition comprises a pharmaceutically acceptable carrier.

59. The method of any one of claims 1-58, wherein the composition is administered intravenously.

60. The method of any one of claims 1-59, wherein the subject is a human.

61. The method of any one of claims 15-60, wherein the subject has cystic fibrosis.

62. A method of modifying the nucleic acid sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a lung cell type, wherein the CFTR gene comprises a R553X stop codon mutation, the method comprising: a. contacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA; b. determining the nucleic acid sequence of the CFTR gene in the lung cell type, wherein the nucleic acid sequence of the CFTR gene in the lung cell type is modified to remove the R553X stop codon mutation.

63. The method of claim 62, wherein the modification comprises the replacing of the thymine at 1789 base in exon 11 of the CFTR gene with cytosine.

64. A method of increasing the expression of full-length cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type, wherein a CFTR gene in the lung cell type comprises a R553X mutation, the method comprisingcontacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA.

65. A method of modulating the activity of the cystic fibrosis transmembrane conductance regulator (CFTR) protein in a lung cell type, wherein the CFTR gene in the lung cell type comprises a R553X mutation, the method comprising contacting the lung cell type with a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA.

66. The method of claim 64, wherein expression of the CFTR protein is determined in a lung cell type in a subject, wherein the subject has been administered the composition, and wherein the expression is determined by one or more bioassays comprising sweat chloride concentration assay, β-adrenergic sweat assay, and nasal potential difference assay.

67. The method of claim 66, wherein expression of the CFTR protein is determined by analysis of chloride levels in the sweat of the subject.

68. The method of claim 66, wherein the chloride levels in the sweat of the subject after being administered the composition are decreased as compared to the chloride levels in the sweat of the subject before being administered the composition.

69. The method of claim 64, wherein the expression is measured using western blotting, immunoprecipitation, and anti-CFTR antibodies.

70. The method of claim 65, wherein the activity of the CFTR protein is increased in the lung cell type, as compared to a lung cell type comprising a CFTR gene comprising a R553X mutation, and that is not contacted with the composition.

71. The method of any one of claims 62-70 wherein the lung cell type is an endothelial cell or an epithelial cell.

72. The method of any one of claims 62-70, wherein the lung cell type is an immune cell.

73. The method of any one of claims 62-70, wherein the lung cell type is a stem cell.

74. The method of any one of claims 62-73, wherein the nucleic acid encoding the base editor is DNA.

75. The method of any one of claims 62-73, wherein the nucleic acid encoding the base editor is RNA.

76. The method of any one of claims 62-73, wherein the base editor is an adenine base editor (ABE).

77. The method of claim 76, wherein the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

78. The method of any one of claims 62-73, wherein the base editor is a cytosine base editor (CBE).

79. The method of claim 78, wherein the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

80. The method of any of claims 76-79, wherein the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

81. The method of any one of claims 62-80, wherein the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a molecule: molecule basis.

82. The method of any one of claims 62-80, wherein the ratio of the first nucleic acid to the second nucleic acid is 1: 1 on a weight basis.

83. The method of any one of claims 62-80, wherein the ratio of the first nucleic acid to the second nucleic acid is 2: 1 molecule: molecule basis.

84. The method of any one of claims 62-80, wherein the ratio of the first nucleic acid to the second nucleic acid is 2: 1 on a weight basis.

85. The method of any one of claims 62-84, wherein the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid.

86. The method of any one of claims 62-85, wherein the LNP comprises 5A2-SC8, 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules.

87. The method of claim 86, wherein the one or more SORT molecules comprises permanently positively charged moiety.

88. The method of claim 86 or 87, wherein the one or more SORT molecule is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt);18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP; 18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

89. The method of any of claims 86-88, wherein the one or more SORT molecules comprises DOTAP (l,2-dioleoyl-3-trimethylammonium propane).

90. The method of any of claims 86-88, wherein the one or more SORT molecules comprises 18PA.

91. The method of any of claims 86-88, wherein the one or more SORT molecules comprises DODAP.

92. The method of claim 91, wherein the DODAP comprises about 20% molar ratio of the total lipids.

93. The method of claim 89, wherein the DOTAP comprises about 50% molar ratio of the total lipids.

94. The method of claim 90, wherein the 18PA comprises about 10% molar ratio of the total lipids.

95. The method of any of claims 86-88, wherein the SORT molecule comprises DOTMA.

96. The method of claim 86, 87 or 88, wherein the LNP comprises a ratio of DOPE:DOTMA of between 3:1 and 1:3.

97. The method of claim 96, wherein the ratio of DOPE:DOTMA is about 3:1.

98. The method of claim 96, wherein the ratio of DOPE:DOTMA is about 1:1.

99. The method of any of claims 86-97, wherein the SORT molecule comprises from about 5% to about 60% molar percentage of the LNP.

100. The method of any of claims 86-99, wherein the SORT molecule comprises about 40% molar percentage of the LNP.

101. The method of any of claims 86-99, wherein the SORT molecule comprises from 50% molar percentage of the LNP.

102. The method of any of claims 62-101, wherein the LNP binds vitronectin.

103. The method of any one of claims 62-102, wherein the guide RNA comprises a circular RNA.

104. The method of any one of claims 62-102, wherein the guide RNA comprises a linear RNA.

105. The method of any one of claims 62-102, wherein the guide RNA is a single guide RNA (sgRNA).

106. The method of any of claims 62-105, wherein the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene.

107. The method of any of claims 62-106, wherein the nucleotide sequence of the guide RNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

108. The method of claim 5, wherein the function of the CFTR protein is determined by one or more bioassays comprising sweat chloride concentration assay, β-adrenergic sweat assay, and nasal potential difference assay.

109. The method of claim 108, wherein the function of the CFTR protein is determined by analysis of chloride levels in the sweat of the subject.

110. The method of claim 109, wherein the chloride levels in the sweat of the subject after being administered the composition are decreased as compared to the chloride levels in the subject before being administered the composition.

111. The method of any one of claims 62-110, wherein the composition comprises a pharmaceutically acceptable carrier.

112. The method of any one of claims 67-111, wherein the subject is a human.

113. The method of any one of claims 67-112, wherein the administration of the composition to the subject is by intravenous administration.

114. A method of restoring the function of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in a subject with cystic fibrosis, the method comprising administering to the subject a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises (i) a first nucleic acid encoding a base editor; and (ii) a second nucleic acid encoding a guide RNA.

115. The method of claim 114, wherein about 5% to about 95% of the function of the CFTR gene is restored.

116. The method of claim 114 or 115, wherein the restoring of the function of the CFTR gene is determined by the increase of CFTR protein expression.

117. The method of claim 116, wherein expression of the CFTR protein is determined by one or more bioassays comprising sweat chloride concentration assay, β-adrenergic sweat assay, and nasal potential difference assay.

118. The method of claim 116 or 117 wherein expression of the CFTR protein is determined by analysis of chloride levels in the sweat of the subject.

119. The method of claim 118, wherein chloride levels in the sweat of the subject after being administered the composition are decreased as compared to levels in a subject before being administered the composition.

120. The method of claim 116, wherein the expression is measured using western blotting, immunoprecipitation, and anti-CFTR antibodies.

121. The method of any one of claims 114-120, wherein the nucleic acid encoding the base editor is DNA.

122. The method of any one of claims 114-120, wherein the nucleic acid encoding the base editor is RNA.

123. The method of any one of claims 114-122, wherein the base editor is an adenine base editor (ABE).

124. The method of claim 123, wherein the base editor is ABE8e.

125. The method of claim 123, wherein the ABE comprises a tRNA adenosine deaminase (TadA) protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

126. The method of any one of claims 114-122, wherein the base editor is a cytosine base editor (CBE).

127. The method of claim 123, wherein the CBE comprises a cytidine deaminase protein, or a variant thereof, fused to a catalytically impaired Cas protein capable of binding to a specific nucleotide sequence.

128. The method of claim 123-127, wherein the ABE or the CBE further comprises a Cas9 enzyme that does not have any nuclease activity.

129. The method of any one of claims 114-127, wherein the ratio of the first nucleic acid to the second nucleic acid is 1:1 on a molecule: molecule basis.

130. The method of any one of claims 114-127, wherein the ratio of the first nucleic acid to the second nucleic acid is 1:1 on a weight basis.

131. The method of any one of claims 114-130, wherein the ratio of the first nucleic acid to the second nucleic acid is 2:1 molecule: molecule basis.

132. The method of any one of claims 114-130, wherein the ratio of the first nucleic acid to the second nucleic acid is 2:1 on a weight basis.

133. The method of any one of claims 114-132, wherein the LNP comprises an ionizable cationic lipid, a zwitterionic phospholipid, a cholesterol, and a PEG lipid.

134. The method of any one of claims 114-133, wherein the LNP comprises 5A2-SC8, 1,2- dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, DMG-PEG, and one or more selective organ targeting (SORT) molecules.

135. The method of claim 133, wherein the one or more SORT molecules comprises permanently positively charged moiety.

136. The method of claim 134 or 135, wherein the one or more SORT molecule is selected from the group consisting of 18:1 DOTMA (DOTMA); DORI, DC-6-14; 12:0 EPC (Chloride Salt); 14:0 EPC (Chloride Salt); 16:0 EPC (Chloride Salt); 18:0 EPC (Chloride Salt); 18:1 EPC (Chloride Salt); 16:0-18:1 EPC (Chloride Salt); 14:1 EPC (Triflate Salt); 18:0 DDAB (Dimethyldioctadecylammonium (Bromide Salt)); 14:0 TAP; 16:0 TAP;18:0 TAP; 18:1 TAP (DOTAP); 18:1 TAP (DOTAP, MS Salt); 18:1 DODAP, or 18:1 PA (l,2-dioleoyl-sn-glycero-3-phosphate (sodium salt)) (18PA).

137. The method of any of claims 134-136, wherein the one or more SORT molecules comprises DOTAP (l,2-dioleoyl-3-trimethylammonium propane).

138. The method of any of claims 134-136, wherein the one or more SORT molecules comprises 18PA.

139. The method of any of claims 134-136, wherein the one or more SORT molecules comprises DODAP.

140. The method of claim 139, wherein the DODAP comprises about 20% molar ratio of the total lipids.

141. The method of claim 137, wherein the DOTAP comprises about 50% molar ratio of the total lipids.

142. The method of claim 138, wherein the 18PA comprises about 10% molar ratio of the total lipids.

143. The method of any of claims 134-136, wherein the one or more SORT molecules comprises DOTMA.

144. The method of claim 134, 135, or 136, wherein the LNP comprises a ratio of DOPE:DOTMA of between 3:1 and 1:3.

145. The method of claim 144, wherein the ratio of DOPE:DOTMA is about 3:1.

146. The method of claim 144, wherein the ratio of DOPE:DOTMA is about 1:1.

147. The method of any of claims 115-146, wherein the one or more SORT molecules comprises from about 5% to about 60% molar percentage of the LNP.

148. The method of any of claims 134-146, wherein the one or more SORT molecules comprises about 40% molar percentage of the LNP.

149. The method of any of claims 134-146, wherein the SORT molecule comprises from 50% molar percentage of the LNP.

150. The method of any of claims 115-149, wherein the LNP binds vitronectin.

151. The method of any one of claims 115-150, wherein the guide RNA comprises a circular RNA.

152. The method of any one of claims 115-150, wherein the guide RNA comprises a linear RNA.

153. The method of any one of claims 115-150, wherein the guide RNA is a single guide RNA (sgRNA).

154. The method of any of claims 115-153, wherein the guide RNA comprises a target sequence that is complementary with a target sequence of a cystic fibrosis transmembrane conductance regulator (CFTR) gene.

155. The method of any of claims 112-151, wherein the nucleotide sequence of the guide RNA is AAGTAAAACCTCTACAAATG (SEQ ID NO: 1) or TTGCTCATTGACCTCCACTC (SEQ ID NO: 2).

156. The method of any one of claims 115-155, wherein the composition comprises a pharmaceutically acceptable carrier.

157. The method of any one of claims 115-156, wherein the subject is a human.

158. The method of any one of claims 115-157, wherein the administration of the composition to the subject is by intravenous administration.

159. The method of any of claims 1-158, wherein the LNP is localized to the lungs of the subject.

160. The method of any of claims 1-158, wherein the LNP is capable of delivering the first and second nucleic acids to the lungs of the subject.

61. A lung cell type comprising a modified cystic fibrosis transmembrane conductance regulator (CFTR) gene, wherein the modification comprises the replacement of the thymine at 1789 base in exon 11 of the CFTR gene with cytosine.