Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for obtaining target mDNA

A purposeful and quantitative technology, applied in the direction of DNA preparation, recombinant DNA technology, and the use of vectors to introduce foreign genetic material, etc., can solve the problems of difficult access to mRNA, non-specificity, etc., and achieve the effect of convenient application and easy detection

Inactive Publication Date: 2007-12-19
EAST CHINA UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To overcome the disadvantages of not being easy to obtain mRNA in the prior art and not having specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining target mDNA
  • Method for obtaining target mDNA
  • Method for obtaining target mDNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The content of the present invention is further elaborated by the following examples and accompanying drawings, the method for obtaining the mRNA of SARS coronavirus.

[0024] Construction of pGEX4T-S vector system:

[0025] Get the 18159 to 18268 positions (SEQ ID NO: 1) of SARS coronavirus Sino3-11 (SARS coronavirus) gene sequence from Genbank accession number: AY485278:

[0026] TA ATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGG C

[0027] The S gene is artificially introduced into oligo(dT) at the 3' end of SEQ ID NO:1 23 The sequence was obtained, and the restriction endonuclease BamHI and EcoRI sequences were added at its 5' end and 3' end respectively, and its final complete gene sequence was (SEQ ID NO: 2):

[0028] BamHI sense

[0029] GGATCC TA ATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGG CTTTTTTTTTTTTTTTTT

[0030] Antisense

[0031] TTTTTTT GAATTC

[0032] EcoRI

[0033] Inducible expression of fus...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for obtaining target mRNA is to reform the target gene which introduces oligo(dT) sequence at its 3' end, then adds limited endoprotease identification sequence on 5' and 3' ends separately and combines with a carrier to be transferred into colibacillus competence cells to urge them to express highly and extract RNA of colibacillus then to be separated and purified with aoligo(dT) cellulose to get the required target mRNA.

Description

technical field [0001] The present invention relates to a method for obtaining target mRNA, more specifically, transferring the target gene into Escherichia coli for expression, extracting the total RNA of Escherichia coli, and then separating and purifying by affinity chromatography to finally obtain the required mRNA . Background technique [0002] Messenger RNA (mRNA) is the product of DNA transcription. The genetic information encoded by DNA is transcribed into mRNA sequence, and the mRNA sequence guides the synthesis of protein on the ribosome, a process called translation. Thus, if the expression of a protein can be detected, the presence of the specific mRNA encoding it can be inferred. And in general, the amount of protein expression is directly proportional to the amount of mRNA encoding the protein. However, it is difficult to isolate the mRNA encoding a certain protein, mainly because the absolute amount of mRNA is small, and the sequence specificity of mRNA is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/10C12N15/70C12N15/66C12Q1/68G01N33/50
Inventor 杨忠赵建龙马昱澍肖君华王锦之魏东芝
Owner EAST CHINA UNIV OF SCI & TECH