Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human stomach cancer cell NGAL gene promoter region TPA core reaction element

A gene promoter region, gastric cancer cell technology, applied in the direction of genetic engineering, plant gene improvement, recombinant DNA technology, etc., can solve the problems that reports are still rare

Inactive Publication Date: 2009-02-25
SHANTOU UNIV MEDICAL COLLEGE
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The current research mainly focuses on the function of NGAL protein, the molecules interacting with NGAL protein in cells and its mechanism of action, but there are few reports on the reasons for the high expression of NGAL and the regulation mechanism of transcriptional expression of this gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human stomach cancer cell NGAL gene promoter region TPA core reaction element
  • Human stomach cancer cell NGAL gene promoter region TPA core reaction element
  • Human stomach cancer cell NGAL gene promoter region TPA core reaction element

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1 The construction of the eukaryotic expression plasmid containing the TPA core response element of the NGAL gene promoter region

[0022] 1. Cloning and sequence analysis of the 5' upstream fragment (-1695~+84) of the human NGAL gene According to the NGAL gene sequence on the NCBI database ( X99133 ), designed and synthesized six pairs of primers P1~P6 for amplifying the downstream +84 of the NGAL transcription start codon to different upstream sites (respectively -1431, -1137, -945, -657, -416, -152) and R, the primer sequence is as follows:

[0023] R: 5′AT AGATCT +84 GAGACCTAGGGGCATGATTT +65 3' (the underline is the BglII site, this primer is the common 3' end primer of the following 6 primers)

[0024] P1: 5′TA CTCGAG -1431 AAAGACAGTAGCAGAGGTGG -1412 3' (the underline is the Xho I site)

[0025] P2: 5′TA CTCGAG -1137 CAAGCAGCACGTAGGCAGAG -1118 3' (the underline is the Xho I site)

[0026] P3: 5′TA CTCGAG -945 GTTGAGATAACTGCTTCCCT -926 3...

Embodiment 2

[0049] Example 2 Activity Analysis of TPA Core Response Elements in the Promoter Region of Human Gastric Cancer Cell NGAL Gene

[0050] A method

[0051] 1. Cell culture: gastric cancer cell line BGC823 in 5% CO 2 Under the condition of 37° C. and 37° C., the cells were grown adherently in conventional 199 medium (Invitrogen Company) containing 10% calf serum, and the cells were digested and passaged with a digestion solution of 0.25% trypsin and 0.02% EDTA.

[0052] 2. Transient transfection and TPA induction: Use QIAGEN Plasmid Midi Kit (QIAGEN Company) to extract the experimental plasmid to be transfected, the control plasmid pGL3-Basic (Promega Company) and the internal reference plasmid pRL-TK (Promega Company), and determine its content and purity. Take the above-mentioned experimental plasmid expressing firefly luciferase and control plasmid with Buffer EB (10mM Tris Cl, pH 8.5) and dilute to 100ng / μl, and the internal reference plasmid pRL-TK expressing Renilla lucif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the regulation of gene expression, and discloses a TPA core response element in a human gastric cancer cell NGAL gene promoter zone. A series of eukaryotic expression plasmids are constructed by inserting a regulatory sequence with gradual loss of the promoter sequence and with modification of part of the regulation elements thereof into the reporter gene upstream to transfect transient expression of mammal cells, thus determining the TPA key regulatory sequence of the human NGAL gene promoter in the gastric cancer cell. The invention contributes to exploring pathogenesis of tumors including the gastric cancer from the molecular level and provides a clue for the action mechanism of the malignant transformation of the TPA; in addition, the invention contributes to further recognizing the action of the transfer pathway network in TPA signal cell in the development mechanism of tumors. The invention has the significance for researching the expression regulation mechanism of the NGAL in the tumor cells and the clinical treatment which takes the NGAL as a target.

Description

technical field [0001] The invention relates to gene expression regulation, in particular to a TPA core response element in the NGAL gene promoter region of human gastric cancer cells. Background technique [0002] The incidence rate of gastric cancer is at the forefront of various malignant tumors, and the mortality rate is also at the top of malignant tumors. Generally speaking, the incidence rate of colored people is higher than that of white people. Japan, Chile, Russia and Iceland are high-incidence areas, and China is also relatively high. High-incidence countries; China's incidence rate is higher in the north than in the south, higher in the coast than in the inland, and highest in Gansu, Qinghai, Ningxia and other provinces and autonomous regions in the northwest. At present, the pathogenesis of gastric cancer is still unclear. Studies have found that NGAL gene is highly expressed in many tumor cells including gastric cancer cells; and 12-O-tetradecanoylphorbol acet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/63C12N15/85
Inventor 李恩民袁华敏许丽艳常静霞王子良
Owner SHANTOU UNIV MEDICAL COLLEGE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com