Anti-influenza virus medicament screening model and application thereof

An anti-influenza virus and influenza A virus technology, applied in the anti-influenza virus drug screening model and its application field, to achieve the effect of small side effects

Inactive Publication Date: 2010-11-03
CHINA PHARM UNIV
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Contents of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-influenza virus medicament screening model and application thereof
  • Anti-influenza virus medicament screening model and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0020] Example 1

[0021] (1) By inserting four RNA polymerase-related genes (PB1, PB2, PA, and NP) containing influenza A virus into the pHW2000 bidirectional transcription eukaryotic expression vector BsmBI restriction site, construct an influenza virus RNA polymerase activity Eukaryotic plasmids pHWPB2, pHWPB1, pHWPA and pHWNP;

[0022] (2) According to the method of reference [1], the green fluorescent protein (GFP) gene was reversely inserted into the BsmBI restriction site of the pHW2000 vector by PCR with the following primers. The specific operation method is as follows:

[0023] Primer F1:

[0024] 5’-ATACGTCTCGGGG

[0025] AGCAAAAGCAGGGTAGATAATCACTCACCGAGTGACATCAACACCATGGTGAGCAAGGGCGAGG-3’

[0026] Primer F2:

[0027] 5’-ATACGTCTCATATTAGTAGAAACAAGGGTATTTTTCTTTACTTGTACAGCTCGTCC-3’

[0028] (3) Use liposome transfection reagent such as Lipofectamine2000 (Invitrogen) to co-transfect eukaryotic 293T cells according to the instructions of transfection reagent with the above plasmids ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to an anti-influenza virus medicament screening model, an anti-influenza virus medicament screening method and application, in particular to an influenza virus RNA polymerase suppressant screening model and the application thereof. The method of the invention comprises the following steps that: by utilizing the transcriptional activity of four polymerase (PB1, PB2, PA and NP) genes of influenza A viruses, cells are transfected with the four RNA polymerase genes and reporter genes, and the reporter genes are transcribed and expressed in the cells; and then anti-influenza virus medicaments are screened by detecting the luminous intensity of the fluorescence reporter genes generated by the transcription or indirectly detecting the variations of reporter gene substrates with a fluorescence detection apparatus, such as a fluorescence microscope and the like. In the invention, the novel anti-influenza virus medicament screening model adopts the RNA polymerase of which an influenza virus infection and growth cycle plays an important role and is relatively more stable so as to be expected to develop novel anti-influenza virus medicaments, which are used for damaging enzymatic structures or suppressing enzymatic activity and has high efficiency, low toxicity and little side effect.

Description

Technical field: [0001] The invention relates to a screening model, method and application for anti-influenza virus drugs, in particular to a screening model and application of influenza virus RNA polymerase inhibitors. Background technique: [0002] Influenza A and avian influenza are acute respiratory transmissible diseases that seriously threaten human life and health. With the widespread use of vaccines and drugs, the emergence of antigenic variants and drug-resistant strains will significantly reduce the protective efficacy of vaccines and the therapeutic effect of current anti-influenza drugs. Therefore, it is imminent to develop new anti-influenza drugs. Influenza A viruses belong to the family Orthomyxoviridae, the genus Influenza A virus. So far, 16 HA subtypes and 9 NA subtypes have been found. Influenza A virus RNA polymerase is a multi-subunit, multifunctional enzyme responsible for the biological functions of influenza virus RNA replication, transcription, etc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N5/10C12Q1/25
Inventor 张评浒张陆勇
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products