Anti-influenza virus medicament screening model and application thereof
An anti-influenza virus and influenza A virus technology, applied in the anti-influenza virus drug screening model and its application field, to achieve the effect of small side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0020] Example 1
[0021] (1) By inserting four RNA polymerase-related genes (PB1, PB2, PA, and NP) containing influenza A virus into the pHW2000 bidirectional transcription eukaryotic expression vector BsmBI restriction site, construct an influenza virus RNA polymerase activity Eukaryotic plasmids pHWPB2, pHWPB1, pHWPA and pHWNP;
[0022] (2) According to the method of reference [1], the green fluorescent protein (GFP) gene was reversely inserted into the BsmBI restriction site of the pHW2000 vector by PCR with the following primers. The specific operation method is as follows:
[0023] Primer F1:
[0024] 5’-ATACGTCTCGGGG
[0025] AGCAAAAGCAGGGTAGATAATCACTCACCGAGTGACATCAACACCATGGTGAGCAAGGGCGAGG-3’
[0026] Primer F2:
[0027] 5’-ATACGTCTCATATTAGTAGAAACAAGGGTATTTTTCTTTACTTGTACAGCTCGTCC-3’
[0028] (3) Use liposome transfection reagent such as Lipofectamine2000 (Invitrogen) to co-transfect eukaryotic 293T cells according to the instructions of transfection reagent with the above plasmids ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap