Kit and method for detecting leishmania in sandfly
A Leishmania detection kit technology, applied in biochemical equipment and methods, microbe measurement/inspection, resistance to vector-borne diseases, etc., can solve time-consuming and labor-intensive problems, and achieve objective results and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1 The extraction of sandflies (using QIAGEN DNA extraction kit, the product model is 69504 purchased from QIAGEN domestic agent Shanghai Laifeng Technology Co., Ltd.)
[0021] 1. Collect sandflies in the field to verify positive Leishmania and promastigotes infection under an anatomical microscope, and bring them back to the laboratory;
[0022] 2. Get a sandfly and put it into a 1.5ml EP tube (centrifuge tube), add ATL (tissue lysate, purchased from QIAGEN company) 180ul (microliter), fully grind, add 20ul proteinase K (purchased from QIAGEN company), Water bath at 55°C for 2 hours;
[0023] 3. Add 200ul AL (lysate, purchased from QIAGEN company to EP tube, water bath 70°C for 10 minutes;
[0024] 4. Add 200ul of absolute ethanol to the EP tube, mix well, transfer the mixture to the filter column, and centrifuge at 8000rpm×1min;
[0025] 5. Discard the collection tube and liquid, add 500 ul of WA1 (washing liquid 1, purchased from QIAGEN Company) to which 25 ...
Embodiment 2
[0030] Embodiment 2, primer design
[0031] According to the kinetosome DNA circle of the conserved sequence of Leishmania published in the international gene bank, the kinetosome DNA has a high degree of conservation of Leishmania. There are differences in height, and there are also differences among different geographical strains of the same species. Two pairs of specific primers are designed:
[0032] The sequence of primer 1 is:
[0033] Upstream: 5'-CTT TTC TGG TCC CGC GGG TAG C-3', the sequence of which is shown in SEQ ID NO: 1;
[0034] Downstream: 5'-CCA CCT GGC CTA TTT TAC ACC A-3', the sequence of which is shown in SEQ ID NO: 2;
[0035] Fragment length: about 140bp
[0036] Sequencing results:
[0037] CCACCTGGCCTATTTTCACCAACCCCCAGTTTTCCGCCTCGGAGCCCATTTTGGCATTTTTGGCCGATTTTGAACGGGATTCTGCACCCATTTTTCCGATTTTGCAAAACGCCCCTACCCGCGGGACCAGAAAAGA
[0038] After extensive research, ribosomal gene (ribosome DNA, rDNA) is an ideal molecular index for molecular identificatio...
Embodiment 3
[0046] Embodiment 3 composite PCR method detects
[0047] To detect the compound PCR reaction system, add the following reagents in sequence to a 0.9ml PCR tube: 1.0 μl of DNA template (prepared in Example 1), 12.5 μl of 2×Master PCR Mix (provided by Laifeng Biotechnology Co., Ltd.), Example 2Synthesized primer 1 upstream (SEQ ID NO: 1) 10 μM, primer 1 downstream (SEQ ID NO: 2) 10 μM, primer 2 upstream (SEQ ID NO: 3) 10 μM, primer 2 downstream (SEQ ID NO: 4) 10 μM 0.5ul each, and finally add ddH2O (double steamed sterilized water) to make up 25.0μl reaction system. The reaction conditions were pre-denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 30 sec, and extension at 72°C for 10 min. The PCR product was stored at 4°C, and electrophoresed on a 1.5% agarose gel (containing 5 μg / ml EB (ethidium bromide)).
[0048] Experimental results such as figure 1 The second band shown is the target band fo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More