Method for predicting Iga nephropathy and method for screening Iga nephropathy patient
A prediction method and technology for kidney disease, applied in biochemical equipment and methods, microbiological determination/inspection, measuring devices, etc., can solve problems such as the inability to predict the effectiveness of tonsil removal in advance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0136] [Example 1: Research on tonsillar flora of patients with IgA nephropathy]
[0137] (1) Registration of patients
[0138] Tonsil samples at the time of tonsillectomy were obtained after written consent was obtained from 68 patients who were diagnosed with IgA nephropathy by renal biopsy and 28 patients who underwent tonsillectomy for chronic tonsillitis hospitalized at the Osaka University Hospital of Medicine . Immediately after tonsillectomy, RNA was extracted using Trizol (invitrogen) and stored as RNA. The study on the tonsils of patients with IgA nephropathy was carried out with the approval of the Ethics Committee of Osaka University Hospital.
[0139] (2) Inclusive analysis of tonsil flora based on DGGE (denaturing gradient gel electrophoresis) method
[0140] RNA obtained from the tonsils of patients with IgA nephropathy and chronic tonsillitis was reverse-transcribed, and the obtained cDNA was used as a template to use the universal bacterial primer 954f, a P...
Embodiment 2
[0147] [Example 2: Detection of Treponema bacteria in excised tonsils based on RT-PCR method]
[0148] As a specific primer set for Treponema sp., synthesized and used the document "Asai, Y., et al., Detection and quantification of oral treponemes in subgingival plaque by real-time PCR. J Clin Microbiol, 2002.40 (9): total Treponema primer described in p.3334-40." (forward primer: TTACGTGCCAGCAGCCGCGGTAAC (SEQ ID NO: 1), reverse primer: GTCRYMGGCAGTTCCGCCWGAGTC (SEQ ID NO: 2)). Specifically, RNA obtained from the tonsils of patients with IgA nephropathy and chronic tonsillitis described in Example 1 was reverse-transcribed, and the obtained cDNA was used as a template to carry out PCR using the above-mentioned primer set (SEQ ID NOS: 1 and 2). . The PCR conditions were: denaturation at 95°C for 5 minutes, followed by 25 cycles of 95°C for 30 seconds, 69.5°C for 60 seconds, and 72°C for 1 minute. The reaction solution was electrophoresed on agarose gel, and then stained with ...
Embodiment 3
[0150] [Example 3: Detection of Campylobacter rectum in extirpated tonsils based on RT-PCR method]
[0151]As a primer set specific for Campylobacter rectus, a literature "Hayashi, F., et al., Subgingival distribution of Campylobacter rectus and Tannerella forsythensis in healthy children with primary dentition. Archives of Oral Biology, 2006.51: p.10- 14. Primers described in " (forward primer: TTTCGGAGCGTAAACTCCTTTTC (SEQ ID NO: 9), reverse primer: TTTCTGCAAGCAGACACTCTT (SEQ ID NO: 10)). Except for the primer, it was carried out in the same manner as in Example 2.
[0152] The results of electrophoresis are shown in image 3 . It can be confirmed that in the DGGE method of Example 1, a band appears at the position of 598 bp in the Campylobacter rectum positive sample, while no band appears in the negative sample. This result demonstrates that Campylobacter rectus present in tonsils can be detected by RT-PCR.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More