Unlock instant, AI-driven research and patent intelligence for your innovation.

RAV-2 transcription factor from Brassica napus L., its preparation method and application

A technology of Brassica napus and RAV-2, which is applied in the field of crop genetics and breeding, can solve the problems of less research on the function of RAV-like transcription factors and the like

Inactive Publication Date: 2012-03-14
SHANGHAI ACAD OF AGRI SCI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with the DREB and ERF subfamilies belonging to the AP2 / ERF family, the functional studies of RAV transcription factors are less

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RAV-2 transcription factor from Brassica napus L., its preparation method and application
  • RAV-2 transcription factor from Brassica napus L., its preparation method and application
  • RAV-2 transcription factor from Brassica napus L., its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Extraction of RNA from Brassica napus "Huyou 15" Seedlings

[0042] (1) Test method:

[0043] 1. Extraction of RNA

[0044] 1) Add 100ml extraction buffer (rape RNA extraction buffer formula: CTAB 3% (W / V); PVP 3% (W / V) (Mw 4000); EDTA 25mM; NaCl 2.0 M; Tris-HCl 100mM, pH 8.0; Spermidine 0.5g / L; DEPC 0.1% (V / V); 0.1% DEPC-treated SDS 0.5% (W / V); 0.1% DEPC-treated LiCl 10M) into a 50 mL polypropylene tube, preheated at 65°C .

[0045] 2) Weigh 5 g of plant material and pour it into liquid nitrogen to keep the material in a frozen and brittle state, and grind it.

[0046] 3) After grinding, transfer the fine powder to a 50 mL centrifuge tube with preheated extraction buffer at 65°C.

[0047] 4) Place the centrifuge tube in a 65°C water bath for 45 min, and shake occasionally to mix the components.

[0048] 5) Add an equal volume of chloroform-isoamyl alcohol mixture, and mix gently up and down for about 10 minutes.

[0049] 6) Centrifuge at 12000g for 10 min at 18°C...

Embodiment 2

[0060] Obtaining RAV-2 Transcription Factors from Brassica napus by PCR BnaRAV-2-HY15 Gene fragment

[0061] (1) Test method:

[0062] Design a pair of forward and reverse primers. For the needs of construction such as cloning identification, the two ends of the primers are respectively introduced Bam HI and Sac Restriction site for I. The primer sequence is: the sequence of the forward primer is shown in SEQ ID No 3, specifically: GGATCCATGGAT AACAGCTGTATAGATG; the sequence of the reverse primer is shown in SEQ ID No 3, specifically: GAATTTCACAAGGCATTGATCATC ATCGTC.

[0063] PCR reaction system: 10×PCR buffer 5.0 μL; dNTPs (2.5mM each) 4 μl; common wheat seedling cDNA template 1 μl (20ng); forward primer 0.5 μl; reverse primer 0.5 μl; Ex-Taq 0.4 μl (pre- Add after denaturation); add sterile water to make up to 50 μl.

[0064] PCR reaction program: Denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, a total of 30 cycles of amplific...

Embodiment 3

[0068] Cloning identification, sequence determination

[0069] (1) Test method:

[0070] The amplified fragment was recovered by DNA agarose gel recovery kit of Hangzhou Weitejie Biochemical Technology Co., Ltd., and then cloned into the pMD-18-Simple T vector of Dalian Bao Bioengineering Co., Ltd. for cloning identification and sequence determination.

[0071] Through nucleotide sequence determination and analysis, the RAV-2 class transcription factor derived from Brassica napus of the present invention is finally obtained BnaRAV-2-HY15 The gene has base and amino acid sequence information as shown in SEQ ID No 1 and SEQ ID No 2.

[0072] The phylogenetic tree was drawn using the NJ (Neighbor-joining) method [Saitou et al., Mol Biol Evol, 1987, 4: 406-425], using the program MEGA4 (Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0) (http: / / www. megasoftware.net / mega.html) [Tamura et al., Mol Bio Evo, 2007, 24: 1596-1599].

[0073] (2) Test results:

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a RAV-2 transcription factor from Brassica napus L., its preparation method and application. The transcription factor has the base sequence of SEQ ID No: 1, and the protein coded by the transcription factor has the amino acid sequence of SEQ ID No:2. The transcription factor is a BnaRAV-2-HY15 gene, has the coding reading frame of 1119 bp and encodes protein containing 372 amino acids. Experiments show the relevance of the BnaRAV-2-HY15 gene disclosed herein and Brassica napus L. to high salt, drought, low temperature and other adverse situations.

Description

technical field [0001] The invention relates to the field of crop genetics and breeding, in particular to a RAV-2 transcription factor derived from Brassica napus and its preparation method and application. Background technique [0002] rape( B. napus L.) is an important oil crop widely planted all over the world. It is an important oil crop with traditional advantages in my country and the fifth largest crop in China. my country's rapeseed planting area is maintained at 7 to 7.5 million hectares throughout the year, accounting for about 26% of the world's rapeseed area, and the total rapeseed production accounts for about 28% of the world's total rapeseed production. The winter rapeseed area in the Yangtze River Basin is an important production area of ​​rapeseed in my country. The annual area of ​​rapeseed in this area is about 90 million mu, with a total output of 11 million tons, accounting for 87% and 90% of the total area and total output of rapeseed in the country, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C07K14/415A01H5/00
Inventor 庄静周熙荣孙超才
Owner SHANGHAI ACAD OF AGRI SCI