RAV-2 transcription factor from Brassica napus L., its preparation method and application
A technology of Brassica napus and RAV-2, which is applied in the field of crop genetics and breeding, can solve the problems of less research on the function of RAV-like transcription factors and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Extraction of RNA from Brassica napus "Huyou 15" Seedlings
[0042] (1) Test method:
[0043] 1. Extraction of RNA
[0044] 1) Add 100ml extraction buffer (rape RNA extraction buffer formula: CTAB 3% (W / V); PVP 3% (W / V) (Mw 4000); EDTA 25mM; NaCl 2.0 M; Tris-HCl 100mM, pH 8.0; Spermidine 0.5g / L; DEPC 0.1% (V / V); 0.1% DEPC-treated SDS 0.5% (W / V); 0.1% DEPC-treated LiCl 10M) into a 50 mL polypropylene tube, preheated at 65°C .
[0045] 2) Weigh 5 g of plant material and pour it into liquid nitrogen to keep the material in a frozen and brittle state, and grind it.
[0046] 3) After grinding, transfer the fine powder to a 50 mL centrifuge tube with preheated extraction buffer at 65°C.
[0047] 4) Place the centrifuge tube in a 65°C water bath for 45 min, and shake occasionally to mix the components.
[0048] 5) Add an equal volume of chloroform-isoamyl alcohol mixture, and mix gently up and down for about 10 minutes.
[0049] 6) Centrifuge at 12000g for 10 min at 18°C...
Embodiment 2
[0060] Obtaining RAV-2 Transcription Factors from Brassica napus by PCR BnaRAV-2-HY15 Gene fragment
[0061] (1) Test method:
[0062] Design a pair of forward and reverse primers. For the needs of construction such as cloning identification, the two ends of the primers are respectively introduced Bam HI and Sac Restriction site for I. The primer sequence is: the sequence of the forward primer is shown in SEQ ID No 3, specifically: GGATCCATGGAT AACAGCTGTATAGATG; the sequence of the reverse primer is shown in SEQ ID No 3, specifically: GAATTTCACAAGGCATTGATCATC ATCGTC.
[0063] PCR reaction system: 10×PCR buffer 5.0 μL; dNTPs (2.5mM each) 4 μl; common wheat seedling cDNA template 1 μl (20ng); forward primer 0.5 μl; reverse primer 0.5 μl; Ex-Taq 0.4 μl (pre- Add after denaturation); add sterile water to make up to 50 μl.
[0064] PCR reaction program: Denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, a total of 30 cycles of amplific...
Embodiment 3
[0068] Cloning identification, sequence determination
[0069] (1) Test method:
[0070] The amplified fragment was recovered by DNA agarose gel recovery kit of Hangzhou Weitejie Biochemical Technology Co., Ltd., and then cloned into the pMD-18-Simple T vector of Dalian Bao Bioengineering Co., Ltd. for cloning identification and sequence determination.
[0071] Through nucleotide sequence determination and analysis, the RAV-2 class transcription factor derived from Brassica napus of the present invention is finally obtained BnaRAV-2-HY15 The gene has base and amino acid sequence information as shown in SEQ ID No 1 and SEQ ID No 2.
[0072] The phylogenetic tree was drawn using the NJ (Neighbor-joining) method [Saitou et al., Mol Biol Evol, 1987, 4: 406-425], using the program MEGA4 (Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0) (http: / / www. megasoftware.net / mega.html) [Tamura et al., Mol Bio Evo, 2007, 24: 1596-1599].
[0073] (2) Test results:
[...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 