Application of arabidopsis thaliana heat shock protein gene HSP101 in seed germination and preservation
A technology of heat shock protein and Arabidopsis thaliana, applied in the fields of seed physiology and plant genetic engineering, can solve the problems of changing the germination characteristics of preserved seeds, achieve the effect of changing the characteristics of seed preservation and germination, and have good application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Obtaining of mutant strains:
[0028] The numbering of Arabidopsis thaliana heat shock protein gene HSP101 of the present invention in GenBank is AT1G74310, the CDS length of this gene is 2736bp, and the nucleotide sequence is as shown in the sequence table (Table 1), encoding 911 amino acids, and the amino acid sequence is as follows: As shown in the list (Table 1). The seeds of the T-DNA insertion line of this gene (SALK_066374) were purchased from the Arabidopsis Biological Resource Center (ABRC).
[0029] CDS sequence and amino acid sequence of table 1HSP101
[0030] 1 ATGAATCCAGAGAAATTCACACACAAGACAAACGAGACAATTGCTACAGCTCATGAGCTA
[0031] 1 METAsnProGluLysPheThrHisLysThrAsnGluThrIleAlaThrAlaHisGluLeu
[0032] 61 GCTGTGAATGCAGGACATGCTCAATTCACTCCTTTGCATTTAGCTGGTGCTTTGATCTCT
[0033] 21 AlaValAsnAlaGlyHisAlaGlnPheThrProLeuHisLeuAlaGlyAlaLeuIleSer
[0034] 121GATCCCACCGGTATATTTTCCTCAAGCAATCTCTAGTGCCGGTGGCGAGAACGCAGCTCAA
[0035] 41 AspProThrGlyIlePheProGlnAlaIleSerSe...
Embodiment 2
[0127] Mutant testing and homozygosity identification:
[0128] Western Blot identification: The total protein was extracted from wild-type Col and mutant hot1 seeds, and the expression of protein HSP101 was detected by Western Blot. The result is as figure 1 As shown, the hsp101 gene is normally expressed in the wild-type seeds, and the HSP101 protein can be detected when there is a positive result; while the mutant hot1 has a negative result, and the HSP101 protein cannot be detected, indicating that the gene in the mutant hot1 is indeed knocked out, and the HSP101 protein cannot be detected. Express.
[0129] PCR identification of homozygotes: The genotype identification of T-DNA insertion strains requires three primers, namely: LP (5'-AAT AAT GCG GCA AAA GAG GAG-3'), located on the left arm of the T-DNA insertion site on the genome RP (5'-CTG CTT GCT CAA AAT CTC-3'), located at the right arm end of the T-DNA insertion site; primer BP on the left arm end of T-DNA: LBb3: (...
Embodiment 3
[0132] Higher germination vigor after hsp101 gene knockout in Arabidopsis:
[0133] Seeds of wild-type Col and mutant hot1 were germinated in a petri dish under light at 25°C, and carried out according to the standard germination test method, with four replicates for each treatment. Germination was defined as when the length of the radicle was equal to that of the seed and the length of the embryo reached half of the seed. Standard, 6 days to calculate the germination rate. Such as Figure 4 It was shown that the germination rate of wild-type Col seeds was lower than that of mutant hot1 at 24h and 48h, and the mutant hot1 seeds had higher germination vigor.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More