Japanese cedar COR gene and application thereof
A cedar, gene technology, applied in the field of Japanese cedar COR (CjCOR) gene, can solve the problem of low AFP
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Embodiment 1, the acquisition of CjCOR gene fragment
[0066] Using the database of the model plant Arabidopsis thaliana and the EST sequence database of Cedar japonica for large-scale sequence alignment, design primers according to the alignment results, and then conduct electronic PCR and other processes to design the ACGM markers of Taxaceae. The primers capable of amplifying the conserved region of the dehydrin gene of Cryptomeria japonica were selected from the designed ACGM markers, and the primer sequences were:
[0067] TA41F: 5' GGACGCCAAGAGAAGAAAGA 3'
[0068] TA41R: 5' ACACACCACGCATACAATCC 3'
[0069] To perform the PCR reaction:
[0070] The PCR system is: DNA (25 ng / μL) 2 μL, Taq DNA polymerase (5 U / μL, TaKaRa) 0.2 μL, forward and reverse primers (10 μmol / μL) 1 μL each, dNTPs (10 mmol / L, TaKaRa ) 1.6 μL, 10×PCR Buffer 2 μL, add dd H 2 0 to 20 μL.
[0071] PCR amplification conditions were: pre-denaturation at 94°C for 5 min; then 30 cycles, including: ...
Embodiment 2
[0075] Example 2, Obtaining the full length of the CjCOR gene coding region
[0076] Using the sequence obtained above as the target sequence, use the 3'RACR and 5'RACE kits (Takara) to amplify the unknown sequences at the 3' and 5' ends respectively, sequence them, design full-length primers according to the sequencing results, and amplify the gene full length. The primer sequences are as follows:
[0077]
[0078] The PCR systems are: cDNA (25 ng / μL) 2 μL, PrimerSTAR Max DNA polymerase (5 U / μL, TaKaRa) 0.2 μL, forward and reverse primers QCF and QCR (10 μmol / μL) each 1 μL, 2×PrimeSTAR Max Premix 10 μL, add ddH 2 0 to 20 μL.
[0079] The PCR amplification conditions were: pre-denaturation at 98°C for 1 min; then 35 cycles, including: denaturation at 98°C for 15 s, annealing at 58°C for 20 s, and extension at 72°C for 1 min; after the cycle was completed, extend at 72°C for 5 min.
[0080] The amplified product was electrophoresed on a 1% agarose gel, and a fragment...
Embodiment 3
[0084] Embodiment 3. Construction of CjCOR plant expression vector
[0085] (1) Preparation of pCAMBIA-2300 linearized vector
[0086] 30 μl enzyme digestion system, including: 3 μg of pCAMBIA-2300 plasmid; 10×Hind III restriction enzyme buffer (product of NEB company, included in Hind III) 3 μl; Hind III (product of NEB company, catalog number R0104V, the same below) 10U; SacI (NEB company product, article number R0156V, the same below) 10U; 100×BSA (NEB company product, included in Hind III) 0.3μl; add deionized water to 30μl. Digestion at 37°C for 12 hours, electrophoresis of the digested product, and recovery of the digested vector fragment.
[0087] (2) Preparation of target gene CjCOR insert fragment
[0088] The 30 μl digestion system includes: 3 μL of T-easy-COR recombinant plasmid obtained in Example 2; 3 μl of 10× restriction enzyme buffer; 10 U of HindIII; 10 U of SacI; 0.3 μl of 100×BSA; add deionized water to 30 μl. Digestion at 37°C for 12 hours, electrophore...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More