Applications of insertion of Arabidopis thaliana heat shock protein gene HSP101 and its T-DNA to mutant strain hot1
A heat shock protein and insertion mutation technology is applied in the fields of seed physiology and plant genetic engineering, which can solve the problems of changing the germination characteristics of seeds for preservation, and achieve the effect of changing the preservation and germination characteristics of seeds and having good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Obtaining of mutant strains:
[0029] The Arabidopsis thaliana heat shock protein gene HSP101 of the present invention is numbered in GenBank as AT1G74310. The CDS of the gene is 2736bp long, and the nucleotide sequence is shown in the sequence table (Table 1), encoding 911 amino acids. The amino acid sequence is as follows: shown in the list (Table 1). The seeds of the T-DNA insertion line (SALK_066374) of this gene were purchased from the Arabidopsis Biological Resource Center (ABRC). The mutant strain name is hot1, and the flanking sequence of the insertion site is shown in Table 2.
[0030] CDS sequence and amino acid sequence of table 1HSP101
[0031] 1 ATGAATCCAGAGAAATTCACACACAAGACAAACGAGACAATTGCTACAGCTCATGAGCTA
[0032]1 METAsnProGluLysPheThrHisLysThrAsnGluThrIleAlaThrAlaHisGluLeu
[0033] 61 GCTGTGAATGCAGGACATGCTCAATTCACTCCTTTGCATTTAGCTGGTGCTTTGATCTCT
[0034] 21 AlaValAsnAlaGlyHisAlaGlnPheThrProLeuHisLeuAlaGlyAlaLeuIleSer
[0035] 121 GATCCCACCGGTATATTTTCC...
Embodiment 2
[0128] Mutant testing and homozygosity identification:
[0129] Western Blot identification: The total protein was extracted from wild-type Col and mutant hot1 seeds, and the expression of protein HSP101 was detected by Western Blot. The result is as figure 1 As shown, the hsp101 gene is normally expressed in the wild-type seeds, and the HSP101 protein can be detected when there is a positive result; while the mutant hot1 has a negative result, and the HSP101 protein cannot be detected, indicating that the gene in the mutant hot1 is indeed knocked out, and the HSP101 protein cannot be detected. Express.
[0130] PCR identification of homozygotes: The genotype identification of T-DNA insertion strains requires three primers, namely: LP (5'-AAT AAT GCG GCA AAA GAG GAG-3'), located on the left arm of the T-DNA insertion site on the genome RP (5'-CTG CTT GCT CAA AAT CTC-3'), located at the right arm end of the T-DNA insertion site; primer BP on the left arm end of T-DNA: LBb3: (...
Embodiment 3
[0133] Higher germination vigor after hsp101 gene knockout in Arabidopsis:
[0134] Seeds of wild-type Col and mutant hot1 were germinated in a petri dish under light at 25°C, and carried out according to the standard germination test method, with four replicates for each treatment. Germination was defined as when the length of the radicle was equal to that of the seed and the length of the embryo reached half of the seed. Standard, 6 days to calculate the germination rate. Such as Figure 4 It was shown that the germination rate of wild-type Col seeds was lower than that of mutant hot1 at 24h and 48h, and the mutant hot1 seeds had higher germination vigor.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More