Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant mutant strain capable of producing polyhydroxyalkanoate

A technology of polyhydroxyalkanoic acid and mutant strains, applied in the biological field, can solve the problems of unstable plasmid structure, unsynthesized products, empty nutrition and other problems, and achieve the effects of avoiding unstable distribution, stable fermentation process and high bacterial density.

Inactive Publication Date: 2014-12-03
CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method not only increases the production cost of PHA, but also easily spreads antibiotic resistance genes into the environment, posing a serious threat to the environment and human health
[0007] There are two reasons for the instability of the plasmid. One is that the restriction recombination system of the bacterial host can cause the structure of the plasmid to be unstable and lose the PHA synthesis operon.
The second is that during cell division, it is possible to produce cells that are not assigned to the plasmid, and because these cells do not need to synthesize PHA, the metabolic burden is less than that of engineered bacterial cells, so the growth rate is higher than other cells, and gradually occupy a larger population in the fermentation culture. The proportion of them, they consume nutrients in vain, but do not synthesize products, which greatly increases the production cost
[0008] In addition, among the mutant strains of Escherichia coli that are commonly used at present, although most of them can express foreign proteins well and grow well in natural medium, due to the loss of certain functions, it is generally difficult to reproduce them in cheap synthetic medium. high cell density

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant mutant strain capable of producing polyhydroxyalkanoate
  • Recombinant mutant strain capable of producing polyhydroxyalkanoate
  • Recombinant mutant strain capable of producing polyhydroxyalkanoate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Discovery of Escherichia coli SM suitable for growth on synthetic media

[0025] 1. Streak and passage the starting strain Escherichia coli HMS174 (hereinafter referred to as E.coli HMS174) on a synthetic medium plate, culture at 37°C, and transfer once every two days; after each transfer for 5 months, store at 4°C One month and 10 years in total, the strain Escherichia coli SM (hereinafter referred to as E.coli SM) was obtained.

[0026] 2. The E.coli HMS174 and E.coli SM were successively passaged 15 times in the above-mentioned culture medium and enriched LB culture medium with 5% glucose respectively, and then the concentrations were independently prepared as OD 600 0.5 bacterial suspension, with an inoculum volume of 1ml, was inserted into the corresponding liquid culture medium, and three bottles were made in parallel in each of the two groups. Liquid culture medium is with 500ml Erlenmeyer flask, and filling capacity is 100ml, and shaking table rotating speed is...

Embodiment 2

[0034] Embodiment 2 produces the construction of PHB Escherichia coli engineering strain E.coli SM (pDP)

[0035] Cultivate C. necator H16, DSM428 at 30°C with Cu. 600 =0.5~0.6, extract genomic DNA, and use it as a template to amplify the pha operon by PCR.

[0036] Forward primers are:

[0037] 5'ATGGATCCCGGGCAAGTACCTTGCCGACATC3' (SEQ ID No. 1),

[0038] The reverse primer is:

[0039] 5'GCCCGGATCCTATGCCCAACAAGGCACTAAG3' (SEQ ID No. 2).

[0040] The amplified product was cloned on the plasmid vector pTZ18u to construct the recombinant plasmid pTZ18u-PHB.

[0041] At the same time, the parDE operon (derived from plasmid RK2) on the plasmid pGW101 preserved in our laboratory was excised with deoxyribonucleic acid (DNA) restriction endonucleases BamH1 and Kpn1, connected to pTZ18u-PHB, and constructed into a recombinant Plasmid pDP, and finally transformed into E.coli SM to obtain Escherichia coli engineering strain E.coli SM (pDP).

Embodiment 3

[0042] The determination of embodiment 3 plasmid stability

[0043] The plasmids pTZ18u-PHB and pDP were respectively introduced into the hosts E.coli HMS174 and E.coliSM, and subcultured in a synthetic fermentation medium without ampicillin (Amp) for a total of 70 generations. Sampling was performed every five generations. After colonies were formed, Pick 500 single colonies and plant them on LB plates without Amp and Amp, respectively. The colonies that can grow on both plates are regarded as colonies that still carry recombinant plasmids. If only on plates without Amp The growing bacterium colony is regarded as the bacterium colony that loses plasmid, calculates the bacterium colony carrying recombinant plasmid to account for the percentage of total bacterium colony, lists in Table 2:

[0044] Plasmid stability (%) comparison in the subculture of recombinant bacteria in table 2

[0045]

[0046] It was found that the stability of the plasmid pDP was significantly higher...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant mutant strain capable of producing polyhydroxyalkanoate, and is applied in the production of polyhydroxyalkanoate. The recombinant mutant strain is an Escherichia coli SM (pDP) and is obtained by importing a recombinant plasmid pDP in a host mutant strain. The host mutant strain is an Escherichia coli which is preserved in the China General Microbiological Culture Collection Center (CGMCC) on April 28th, 2013, with a preservation number of CGMCC NO.7530. The most prominent feature of the recombinant mutant strain is rapid growth. The recombinant mutant strain is suitable for growing in a synthetic medium, low in cost, stable in fermentation process and high in polyhydroxyalkanoate yield.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a recombinant mutant strain producing polyhydroxyalkanoic acid and its application. Background technique [0002] With the development of the national economy and the petroleum industry, the amount of plastic products is increasing day by day. Due to the characteristics of light weight, low cost, corrosion resistance, easy processing, and high strength, plastics have been widely used in various fields of people's production and life, and they are growing year by year. With a large population and rapid economic growth in recent years, my country has become a major producer and consumer of plastic products, and its growth rate is much higher than the world average. [0003] However, a large number of plastic products, especially plastic packaging materials (such as plastic film, plastic bags and disposable plastic tableware, etc.), are generally discarded after use and are difficult t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/62C12R1/19
Inventor 田杰生王亚秋钱欣欣刘凌子迟爽黄金金刘金鑫李颖李季伦
Owner CHINA AGRI UNIV