Recombinant mutant strain capable of producing polyhydroxyalkanoate
A technology of polyhydroxyalkanoic acid and mutant strains, applied in the biological field, can solve the problems of unstable plasmid structure, unsynthesized products, empty nutrition and other problems, and achieve the effects of avoiding unstable distribution, stable fermentation process and high bacterial density.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Discovery of Escherichia coli SM suitable for growth on synthetic media
[0025] 1. Streak and passage the starting strain Escherichia coli HMS174 (hereinafter referred to as E.coli HMS174) on a synthetic medium plate, culture at 37°C, and transfer once every two days; after each transfer for 5 months, store at 4°C One month and 10 years in total, the strain Escherichia coli SM (hereinafter referred to as E.coli SM) was obtained.
[0026] 2. The E.coli HMS174 and E.coli SM were successively passaged 15 times in the above-mentioned culture medium and enriched LB culture medium with 5% glucose respectively, and then the concentrations were independently prepared as OD 600 0.5 bacterial suspension, with an inoculum volume of 1ml, was inserted into the corresponding liquid culture medium, and three bottles were made in parallel in each of the two groups. Liquid culture medium is with 500ml Erlenmeyer flask, and filling capacity is 100ml, and shaking table rotating speed is...
Embodiment 2
[0034] Embodiment 2 produces the construction of PHB Escherichia coli engineering strain E.coli SM (pDP)
[0035] Cultivate C. necator H16, DSM428 at 30°C with Cu. 600 =0.5~0.6, extract genomic DNA, and use it as a template to amplify the pha operon by PCR.
[0036] Forward primers are:
[0037] 5'ATGGATCCCGGGCAAGTACCTTGCCGACATC3' (SEQ ID No. 1),
[0038] The reverse primer is:
[0039] 5'GCCCGGATCCTATGCCCAACAAGGCACTAAG3' (SEQ ID No. 2).
[0040] The amplified product was cloned on the plasmid vector pTZ18u to construct the recombinant plasmid pTZ18u-PHB.
[0041] At the same time, the parDE operon (derived from plasmid RK2) on the plasmid pGW101 preserved in our laboratory was excised with deoxyribonucleic acid (DNA) restriction endonucleases BamH1 and Kpn1, connected to pTZ18u-PHB, and constructed into a recombinant Plasmid pDP, and finally transformed into E.coli SM to obtain Escherichia coli engineering strain E.coli SM (pDP).
Embodiment 3
[0042] The determination of embodiment 3 plasmid stability
[0043] The plasmids pTZ18u-PHB and pDP were respectively introduced into the hosts E.coli HMS174 and E.coliSM, and subcultured in a synthetic fermentation medium without ampicillin (Amp) for a total of 70 generations. Sampling was performed every five generations. After colonies were formed, Pick 500 single colonies and plant them on LB plates without Amp and Amp, respectively. The colonies that can grow on both plates are regarded as colonies that still carry recombinant plasmids. If only on plates without Amp The growing bacterium colony is regarded as the bacterium colony that loses plasmid, calculates the bacterium colony carrying recombinant plasmid to account for the percentage of total bacterium colony, lists in Table 2:
[0044] Plasmid stability (%) comparison in the subculture of recombinant bacteria in table 2
[0045]
[0046] It was found that the stability of the plasmid pDP was significantly higher...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 