Meloidogyne molecular identification primer set, and preparation method and application thereof
A root-knot nematode and molecular identification technology, applied in the fields of biotechnology and genetic engineering, can solve the problems of long time, complicated operation, few primers, etc., and achieve the effect of increasing accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] The genomes of M. incognita and M. northern have been sequenced by French and American scientists, respectively. Genome sequence data and predictions are available for download from the M. incognita (http: / / www.inra.fr / meloidogyne_incognita) and M. borealis (http: / / www.png.org / cbnp / index.php) genome databases gene and protein sequence data.
[0070] a. The sequence comparison software Exonerate can be used to compare the predicted M. incognita protein sequence with M. incognita and M. borealis genomes, and set the similarity of the compared sequences, that is, the percent parameter, to 75. The similarity setting in this step is relatively loose, and multi-copy homologous gene families are filtered as much as possible to obtain single-copy genes. From the comparison results, the single-copy gene was screened using the Perl program, and the sequence information of the single-copy gene in the two genomes was extracted.
[0071] b. Use the exonerate software to compare th...
Embodiment 2
[0080] The sample root-knot nematode was identified by using one of the primer pairs in Example 1.
[0081] (1) Collect southern, northern and Florida root-knot nematode samples. Put nematodes into ddH 2 O wash, pick a single nematode and put it into a 200 μL PCR tube (containing 8 μL ddH 2 O and 1 μL of 10X PCR buffer), placed in liquid nitrogen for 1 minute, heated at 85°C for 2 minutes, added 1 μL of 1mg / mL proteinase K to the PCR tube, heated at 56°C for 15 minutes, and heated at 95°C for 10 minutes to obtain nuclear genomic DNA extract .
[0082] (2) The obtained nuclear genomic DNA extract was directly amplified, and the PCR primer pair used was WBMinc00222:
[0083] Upstream primer WBMinc00222.L: tcataacatcaatagaggat
[0084] And the downstream primer WBMinc00222.R: cgaaacaatgctgccgtaca;
[0085] The PCR reaction system is: 10XPCR buffer (no Mg 2+ )5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP 4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL...
Embodiment 3
[0089] The sample root-knot nematode was identified by using one of the primer pairs in Example 1.
[0090] (1) Collect southern, northern and Florida root-knot nematode samples. Put nematodes into ddH 2 O wash, pick a single nematode and put it into a 200 μL PCR tube (containing 8 μL ddH 2 O and 1 μL of 10X PCR buffer), placed in liquid nitrogen for 1 minute, heated at 85°C for 2 minutes, added 1 μL of 1mg / mL proteinase K to the PCR tube, heated at 56°C for 15 minutes, and heated at 95°C for 10 minutes to obtain nuclear genomic DNA extract .
[0091] (2) The obtained nuclear genomic DNA extract is directly amplified, and the PCR primer pair is WBMinc00818:
[0092] Upstream primer WBMinc00818.L: aatgttattggaactaattt
[0093] And the downstream primer WBMinc00818.R: tccatagcacgcattgcttg;
[0094] The PCR reaction system is: 10XPCR buffer (no Mg 2+ )5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP 4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL, plus ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 