Unlock instant, AI-driven research and patent intelligence for your innovation.

Meloidogyne molecular identification primer set, and preparation method and application thereof

A root-knot nematode and molecular identification technology, applied in the fields of biotechnology and genetic engineering, can solve the problems of long time, complicated operation, few primers, etc., and achieve the effect of increasing accuracy

Inactive Publication Date: 2015-07-01
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] 1. The operation is complex, time-consuming and insensitive;
[0006] 2. The method based on PCR detection has few primers to choose from, so only two or a few kinds of nematodes can be identified;
[0007] 3. Molecular evolution research cannot be carried out systematically, and the identification of physiological races is very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Meloidogyne molecular identification primer set, and preparation method and application thereof
  • Meloidogyne molecular identification primer set, and preparation method and application thereof
  • Meloidogyne molecular identification primer set, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The genomes of M. incognita and M. northern have been sequenced by French and American scientists, respectively. Genome sequence data and predictions are available for download from the M. incognita (http: / / www.inra.fr / meloidogyne_incognita) and M. borealis (http: / / www.png.org / cbnp / index.php) genome databases gene and protein sequence data.

[0070] a. The sequence comparison software Exonerate can be used to compare the predicted M. incognita protein sequence with M. incognita and M. borealis genomes, and set the similarity of the compared sequences, that is, the percent parameter, to 75. The similarity setting in this step is relatively loose, and multi-copy homologous gene families are filtered as much as possible to obtain single-copy genes. From the comparison results, the single-copy gene was screened using the Perl program, and the sequence information of the single-copy gene in the two genomes was extracted.

[0071] b. Use the exonerate software to compare th...

Embodiment 2

[0080] The sample root-knot nematode was identified by using one of the primer pairs in Example 1.

[0081] (1) Collect southern, northern and Florida root-knot nematode samples. Put nematodes into ddH 2 O wash, pick a single nematode and put it into a 200 μL PCR tube (containing 8 μL ddH 2 O and 1 μL of 10X PCR buffer), placed in liquid nitrogen for 1 minute, heated at 85°C for 2 minutes, added 1 μL of 1mg / mL proteinase K to the PCR tube, heated at 56°C for 15 minutes, and heated at 95°C for 10 minutes to obtain nuclear genomic DNA extract .

[0082] (2) The obtained nuclear genomic DNA extract was directly amplified, and the PCR primer pair used was WBMinc00222:

[0083] Upstream primer WBMinc00222.L: tcataacatcaatagaggat

[0084] And the downstream primer WBMinc00222.R: cgaaacaatgctgccgtaca;

[0085] The PCR reaction system is: 10XPCR buffer (no Mg 2+ )5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP 4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL...

Embodiment 3

[0089] The sample root-knot nematode was identified by using one of the primer pairs in Example 1.

[0090] (1) Collect southern, northern and Florida root-knot nematode samples. Put nematodes into ddH 2 O wash, pick a single nematode and put it into a 200 μL PCR tube (containing 8 μL ddH 2 O and 1 μL of 10X PCR buffer), placed in liquid nitrogen for 1 minute, heated at 85°C for 2 minutes, added 1 μL of 1mg / mL proteinase K to the PCR tube, heated at 56°C for 15 minutes, and heated at 95°C for 10 minutes to obtain nuclear genomic DNA extract .

[0091] (2) The obtained nuclear genomic DNA extract is directly amplified, and the PCR primer pair is WBMinc00818:

[0092] Upstream primer WBMinc00818.L: aatgttattggaactaattt

[0093] And the downstream primer WBMinc00818.R: tccatagcacgcattgcttg;

[0094] The PCR reaction system is: 10XPCR buffer (no Mg 2+ )5ul, 25mmol / L MgCl 2 5ul, 0.1mmol / L dNTP 4ul, 10umol / L upstream primer and downstream primer, 5U / uL Tag enzyme 0.6uL, plus ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Meloidogyne molecular identification primer set which is prepared by the following steps: by comparing a predicted south Meloidogyne protein sequence respectively with south Meloidogyne genome and north Meloidogyne genome, setting the similarity of the comparison sequence, i.e. the percent parameter is 75, thereby obtaining the single-copy gene; by comparing the single-copy gene protein sequence respectively with the south Meloidogyne genome and the north Meloidogyne genome, setting the similarity of the comparison sequence, i.e. the percent parameter is 85, and screening the conserved single-copy gene in both of the two genomes; screening the gene of which the introne length difference between the two genomes is greater than 200bp; and designing primers on the basis of the exon sequences on two sides of the difference introne. Abundant primers are provided to enhance the detection accuracy; and the difference between the PCR (polymerase chain reaction) products of the primers via agarose gel electrophoresis is more than 200bp, and thus, the primers can be identified conveniently.

Description

technical field [0001] The invention belongs to the technical field of biotechnology and genetic engineering, relates to the technical field of root-knot nematode gene research and application, in particular to a root-knot nematode molecular identification primer set and its preparation method and application. Background technique [0002] Root-knot nematode (Meloidogyne) is an obligate endoparasite of plant roots. Because of its wide distribution and multiparasitic nature, it is the main pathogen and plant quarantine object that threatens agricultural production worldwide. At present, there are more than 80 kinds of root-knot nematodes described in detail, among which the most harmful ones are M. incognita, M. hapla, M javanica and peanut Root-knot nematode (M. arenaria). Serious losses are caused to most food crops, oil crops, fiber crops, tobacco, tea, fruit trees, vegetables, medicinal materials, flowers, etc. Because of the significant pathogenicity differences among ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 龚达平解敏敏孙玉合晁江涛
Owner TOBACCO RES INST CHIN AGRI SCI ACAD