Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of method that improves L-phenylalanine genetic engineering bacteria to produce L-phenylalanine

A technology of genetically engineered bacteria and phenylalanine, applied in the field of bioengineering, can solve problems affecting the production of phenylalanine, reduce metabolic flow, etc., and achieve the effect of avoiding excessive accumulation of acetic acid

Inactive Publication Date: 2015-09-09
UNIV OF SCI & TECH BEIJING
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The generation of phenylalanine consumes a large amount of PEP, which reduces the metabolic flow of PEP to generate oxaloacetate, thereby affecting the tricarboxylic acid cycle and bacterial growth of E. coli, and finally affecting the production of phenylalanine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of method that improves L-phenylalanine genetic engineering bacteria to produce L-phenylalanine
  • A kind of method that improves L-phenylalanine genetic engineering bacteria to produce L-phenylalanine
  • A kind of method that improves L-phenylalanine genetic engineering bacteria to produce L-phenylalanine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] Step 1: Construction of a plasmid containing the citT gene, the specific method is as follows:

[0013] (1) Amplify the citT gene

[0014] According to the genome sequence of Escherichia coli published by NCBI, the citT gene amplification primers were designed as follows, and were commissioned to be synthesized by Bioengineering (Shanghai) Co., Ltd. using a DNA synthesizer:

[0015] CitF1: GGAAGCTAAAATGTCTTTAGCAAAAGATAATA

[0016] CitR2:CAGTCTAGAGGAACTCATACATACACTGAATAC

[0017] Genomic DNA of Escherichia coli DH5α was extracted using a genomic DNA extraction kit, and used as a template for PCR to amplify the citT gene. The reaction system was as follows:

[0018]

[0019] The reaction conditions are as follows:

[0020] Pre-denaturation at 94°C for 5min, denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 3min and 30s, amplification for 30 cycles, and 10min at 72°C.

[0021] After the PCR amplification reaction, the PCR product was rec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of bioengineering, and relates to a method for enhancing the citric acid absorption capability of escherichia coli to improve the output of L-phenylalanine. The method includes the following steps: adopting an escherichia coli citT gene, and adopting a constitutively expressed promoter at the upstream region of the citT gene; connecting the promoter and the gene to an L-phenylalanine engineered vector to form constructed plasmids; finally transferring the constructed plasmids to an escherichia coli, constitutively expressing the citT gene, and adding citric acid or citrate in a culture medium to improve the capability of engineering bacteria to produce the phenylalanine after fermentation. The constructed plasmids containing the citT gene can constitutively express the citT gene to generate citric acid transport protein, the citric acid can be absorbed under an aerobiotic condition, the citric acid or the citrate which is cheap and easily obtained is added in the culture medium, oxaloacetic acid is generated by the escherichia coli through tricarboxylic acid cyclic reaction, so that excessive accumulation of the acetic acid is avoided, besides, energy is provided for the growth of bacterial cells through strengthening the tricarboxylic acid cycle, and the generation of the phenylalanine is facilitated.

Description

Technical field: [0001] The invention relates to the field of bioengineering, in particular to a method for Escherichia coli to strengthen the absorption of citric acid or citrate and regulate the synthesis of L-phenylalanine. technical background: [0002] Aromatic amino acids include phenylalanine, tyrosine, and tryptophan, which can only be synthesized by microorganisms and plants via the shikimate pathway. As an essential amino acid for human body, L-phenylalanine is an essential ingredient for amino acid infusion and amino acid diet, and is also an important amino acid for commercial production. Among them, the main use of L-phenylalanine at present is to synthesize aspartame (aspartame), accounting for about 90% of its consumption composition. Aspartame has been approved for use in more than 100 countries and regions around the world, and is used in more than 6,000 beverage, food, and pharmaceutical products. The annual demand for L-phenylalanine has exceeded 15,000 t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12P13/22C12N15/70C12N1/21C12R1/19
Inventor 张怀杨园园
Owner UNIV OF SCI & TECH BEIJING