A kind of method that improves L-phenylalanine genetic engineering bacteria to produce L-phenylalanine
A technology of genetically engineered bacteria and phenylalanine, applied in the field of bioengineering, can solve problems affecting the production of phenylalanine, reduce metabolic flow, etc., and achieve the effect of avoiding excessive accumulation of acetic acid
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0012] Step 1: Construction of a plasmid containing the citT gene, the specific method is as follows:
[0013] (1) Amplify the citT gene
[0014] According to the genome sequence of Escherichia coli published by NCBI, the citT gene amplification primers were designed as follows, and were commissioned to be synthesized by Bioengineering (Shanghai) Co., Ltd. using a DNA synthesizer:
[0015] CitF1: GGAAGCTAAAATGTCTTTAGCAAAAGATAATA
[0016] CitR2:CAGTCTAGAGGAACTCATACATACACTGAATAC
[0017] Genomic DNA of Escherichia coli DH5α was extracted using a genomic DNA extraction kit, and used as a template for PCR to amplify the citT gene. The reaction system was as follows:
[0018]
[0019] The reaction conditions are as follows:
[0020] Pre-denaturation at 94°C for 5min, denaturation at 94°C for 30s, annealing at 55°C for 30s, extension at 72°C for 3min and 30s, amplification for 30 cycles, and 10min at 72°C.
[0021] After the PCR amplification reaction, the PCR product was rec...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 