Unlock instant, AI-driven research and patent intelligence for your innovation.

Nano-gold miR-375 conjugate, and preparation method and application thereof

A technology of mir-375 and conjugates, applied in the field of liver cancer, can solve the problems that there are no reports on the application of nano-gold carrying miRNA in the treatment of liver cancer, and achieve good pharmacological properties, good stability, and increase the effect of expression

Active Publication Date: 2014-05-07
TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there has been no report on the application of gold nanoparticles carrying miRNA in the treatment of liver cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nano-gold miR-375 conjugate, and preparation method and application thereof
  • Nano-gold miR-375 conjugate, and preparation method and application thereof
  • Nano-gold miR-375 conjugate, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Example 1 The preparation and identification of nano-gold particles with a particle size of about 13nm

[0051] 1) Preparation of aqua regia: Prepare according to the volume ratio of concentrated hydrochloric acid and concentrated nitric acid as 1:3, that is, measure 90ml of concentrated hydrochloric acid with a measuring cylinder and put it in a 500ml clean beaker, then measure 30ml of concentrated nitric acid, slowly move along the glass rod under stirring Add it into concentrated hydrochloric acid, stir it evenly, and it turns yellowish brown (nitrosyl chloride is produced, and has a chlorine smell, all preparation and use must be carried out in a fume hood), seal the mouth of the beaker with a parafilm, and mark it as king with a marker pen Water back up.

[0052] 2) 10ml 25mM HAuCl 4 The preparation of solution: take the HAuCl of 0.0995g 4 .3H 2 Dissolve O in 10ml of ultrapure water, mix well, wrap in foil paper and store in dark at 4°C for later use.

[0053] ...

Embodiment 2

[0065] The coupling method of nano gold and miR-375, the steps are as follows:

[0066] 1) Preparation of 0.1% DEPC: Take 0.446ml of 1.12g / ml DEPC into 500ml of ultrapure water, place it in an ultrasonic cleaning device for ultrasonic treatment for 2 hours until there are no oily droplets;

[0067] 2) Preparation of 10mM PBS: Accurately weigh 8g of NaCl, 0.2g of KCl, and 0.2g of KH with an analytical balance 2 PO 4 and 2.9 g of Na 2 HPO 4 .12H 2 O, dissolved in 100ml of enzyme-free sterile water, after ultrasonically dissolved fully, dilute to 1L with enzyme-free sterile water;

[0068] 3) 0.18MPBS preparation: according to the PBS preparation plan, first prepare 0.2M PBS with pH 8.0 with enzyme-free sterile water, and then dilute to 0.18M according to the proportion;

[0069] 4) Design and chemically synthesize double-stranded miR-375 nucleotides, the sense strand is "5'-GCGUUUUGUUCGUUCGGCUCGCGUGAGG-3'", and the 22 bases of "UUUGUUCGUUCGGCUCGCGUGA" in the sense strand ar...

Embodiment 3

[0087] miR-375-Au NPs directly entered HCC cells and significantly upregulated the detection of miR-375:

[0088] 1) Cell culture: Liver cancer cell lines Huh7, Hep3B, and HepG2 cells were placed in Dulbecco’s modified Eagle medium (DMEM) medium with 10% fetal bovine serum, 37°C, 5% CO 2 and cultured in a cell incubator with saturated humidity; when the cells grow to about 90% confluent, discard the old culture medium in the culture bottle and wash once with sterilized PBS. Add 0.25% trypsin digestion solution for digestion, and lay the culture bottle flat so that the digestion solution covers the bottom of the bottle. Observe under an inverted microscope and find that the cytoplasm of the cells has retracted and the gap has increased, immediately discard the digestion solution, add 6-8ml of fresh DMEM culture solution containing 10% fetal bovine serum to stop the digestion, and repeat along the edge of the culture bottle Pipette adherent cells to form a homogeneous single-ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention discloses a nano-gold miR-375 conjugate, and a preparation method and application thereof. The conjugate comprises nano-gold particles and double-strand nucleotide, wherein two strands of the double-strand nucleotide are double-strand miR-375 with 28 basic groups, or double-strand nucleotide with homology of 95-100 percent and same coding function of the double-strand miR-375 sequence; the double-strand oligonucleotide has two stem-loop structures, and the 5' terminal of an antisense strand has C6 alkyl mercaptan, and is coupled with the nano-gold particles. The nano-gold miR-375 conjugate has a remarkably growth inhibiting effect on in-vitro liver cancer cells and in-vivo transplantation tumor in nude mice with liver cancer, has beneficial effects in liver cancer treatment and application, and can be potentially applied to treatment of tumors of other digestive systems.

Description

technical field [0001] The invention relates to the field of liver cancer, in particular to a nano-gold miR-375 conjugate and its preparation method and application. Background technique [0002] Primary hepatocellular carcinoma (hepatocellular carcinoma; HCC; liver cancer for short) is a highly malignant tumor with high morbidity and mortality. Surgical resection is still the first choice for the treatment of liver cancer. However, less than 20% of liver cancer patients are suitable for surgical treatment, and the 5-year survival rate after surgery is only 30%, and the 5-year recurrence rate is as high as 80%. Most of the patients are already in the advanced stage when they go to the doctor, and they lose the chance of surgical resection. The average survival period of patients with liver cancer after diagnosis is 3 to 8 months. At present, we still lack effective treatment measures for advanced liver cancer. [0003] MicroRNAs (miRNAs) are a group of about 22 nucleotides ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/48A61K48/00A61K31/713A61P35/00A61P1/16A61P1/18A61P1/00
Inventor 林菊生何星星廖家智徐传瑞刘勇闫静君冉伟常莹黎培员田德安赵秋但自力
Owner TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More