Application for breeding transgenic water-saving and drought-resistance plant by using aspen ABA (Abscisic Acid) receptor PtPYRL gene
A transgenic, poplar technology, applied in the field of transgenic technology for water-saving and drought-resistant plant cultivation, to achieve the effect of preventing land desertification and broad market prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] 1. Using the sequences shown in SEQ ID NO.15 and 16 and the sequences shown in SEQ ID NO.17 and 18 as primers and the Populus trichocarpa genome as a template, clone the target sequence PtPYRL1 (as shown in SEQ ID NO.1) and PtPYRL5 (as shown in SEQ ID NO.5), the homology of PtPYLR1 and PtPYRL5 genes is 53.67%, and the target sequence is constructed into the plant expression vector pCAMBIA1301 (purchased From Nanjing Best Biotechnology Co., Ltd.) (such as figure 1 );
[0042] 5'GGGTCTAGAATGACTGACCCAGCACAACAAGAAC3' (SEQ ID NO. 15)
[0043] 5'GGGGTCGACTTATTTACCGTCACCGTCACGAGC3' (SEQ ID NO. 16)
[0044] 5'GGGGGATCCATGCCTGCATCACTACAGCTCCAG3' (SEQ ID NO. 17)
[0045] 5'GGGGTCGACTCATGATGATGTAGAAATCTGGGCAT3' (SEQ ID NO. 18)
[0046] 2. Transform the cloned plant expression vectors containing the ABA receptors PtPYRL1 and PtPYRL5 genes into EHA105 Agrobacterium cells, and culture them in the dark at 28°C for 2 days;
[0047] 3. Pick the monoclonal Agrobacterium into LB medi...
Embodiment 2
[0061] 1, utilize the method identical with embodiment 1 to obtain PtPYRL3 and PtPYRL4 from poplar species clone, and this gene is inserted in the plant expression vector pCAMBIA1301, with the agrobacterium culture fluid that contains pCAMBIA1301 / PtPYRL3 and 4 infection wild-type tobacco leaf section , after 2 days of co-cultivation on co-cultivation medium (MS medium), transfer to regeneration medium (MS+1mg / L6-BA, 0.1mg / L NAA, 25mg / L hygromycin), after 20-23 days , the regenerated transgenic seedlings were excised, transferred to the rooting medium (MS+0.1mg / L NAA) to induce rooting, and the transgene identification was carried out. The specific method was the same as in Example 1.
[0062] 2. The study found that compared with the wild type, the transgenic tobacco can extend the wilting time to more than 3-5 days after drought treatment. After drought treatment, rehydration restored the growth of tobacco, and the survival rate of transgenic tobacco increased by 42% compared...
Embodiment 3
[0064] 1. Utilize the method identical with embodiment 1 to obtain PtPYRL6 and PtPYRL7 from poplar species clone, and this gene is inserted in the plant expression vector pCAMBIA1301, with the agrobacterium culture fluid that contains pCAMBIA1301 / PtPYRL6 and 7 infection wild-type Arundis basalum , after 2 days of co-culture on co-cultivation medium (MS medium), transfer to regeneration medium (MS+1mg / L6-BA, 0.1mg / L NAA, 25mg / L hygromycin), after 25-30 days , excise the regenerated transgenic seedlings (eg Figure 8 ), transferred to rooting medium (MS+0.1mg / L NAA) to induce rooting, and carried out transgene identification, the specific method was the same as that of Example 1.
[0065] 2. The study found that compared with the wild type, the transgenic Arundis can prolong the wilting time to more than 5 days after drought treatment. After the drought treatment, rehydration restored the growth of Arundis, and the survival rate of the transgenic Arundo was increased by 86% com...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More