A chicken-derived transmembrane intracellular antibody against chicken Newcastle disease virus p protein, preparation method and application thereof
A chicken Newcastle disease virus and intracellular antibody technology, applied in the field of genetic engineering, can solve the problem of ineffective introduction into living animal tissue cells, and achieve the effect of significant intracellular antiviral activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Construction of the recombinant plasmid pET28a-scFvZL1-CTP resistant to chicken Newcastle disease virus P protein
[0037] 1. Design of PCR primers for gene sequence amplification
[0038]According to the single-chain antibody sequence scFvZL1 (application number: 2013102369637) obtained earlier, two primers (P1, P2) were designed, wherein P1 is the 5' primer of the heavy chain variable region VH, and P2 is the 3' primer of the light chain variable region VL. 'primer; introduce endonuclease EcoR I at the 5' end of VH; and add 33 bases of CTP at the 3' end of VL, and introduce a Not I restriction site at the 3' end of CTP. The primers for amplifying scFvZL1-CTP in this way are:
[0039] P1, upstream primer: 5'-CGGAATTCGCCGTGACGTTGGAC-3';
[0040] P2, downstream primers:
[0041] 5'-GAGTCATTCTGCGGCCGC ACGGCGACGCTGGCGACGTTTCTTACGACCGTA TAGGACGGTCAGGGTTGTCCC-3'.
[0042] The upstream primer contains an EcoR I restriction site; the downstream primer contains a...
Embodiment 2
[0051] Example 2 pET28a-scFvZL1-CTP recombinant plasmid induced expression and purification
[0052] 1. Induced expression of pET28a–scFvZL1-CTP recombinant plasmid
[0053] The identified recombinant plasmid pET28a-scFvZL1-CTP was transformed into Trans1-Blue competent cells and cultured overnight at 37°C on LB plates containing Kana. Pick the monoclonal bacteria and shake for 10 hours, then inoculate them into LB liquid medium containing Kana at a ratio of 1:100, shake the bacteria at 37°C until the OD600 is close to 0.6-0.8, take 1 mL of transformed bacteria as a control, and add the remaining culture medium to the final concentration 1mM IPTG, induced at 37°C, centrifuged at 12000rpm / min for 5min at room temperature, collected the bacteria, then suspended the bacteria in 0.01M ice-bathed PBS with pH 7.4 and mixed well, added 2×SDS-PAGE loading buffer, boiled for 10min, Then put into ice-water mixture and freeze for 10 minutes. Centrifuge at 13000rpm / 30min at 4°C, and tak...
Embodiment 3
[0068] Example 3 Transmembrane intracellular antibody (Trans-ZL1-CTP) transmembrane into BHK21 cells
[0069] 1. Determination of the optimal concentration of Trans-ZL1-CTP protein entering cells
[0070] (1) Subculture BHK21 cells and transfer them into 6-well plates;
[0071] (2) Wash the cells in the 100mL cell culture flask twice with DMEM, then trypsinize for 1min, add 4ml DMEM (10% calf serum + double antibody) and pipette to suspend, take 0.6ml of the cell suspension and transfer them into 6 wells, Add 1.5ml DMEM (10% calf serum + double antibody) respectively, and culture overnight in the cell culture incubator;
[0072] (3) When the cells are about 80% full, dilute Trans-ZL1-CTP with DMEM (serum-free) culture solution respectively. The final concentration of protein: 1 μM, 2 μM, 3 μM, 4 μM;
[0073] (4) After culturing for 2 hours, wash twice with DMEM, (or: wash twice with PBS after incubation for 3 hours, replace with fresh culture medium, continue culturing for 2...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More