Unlock instant, AI-driven research and patent intelligence for your innovation.

Yeast expression vector

A yeast expression vector and vector technology, applied in the biological field, can solve problems such as the inability to widely apply genetic engineering, and achieve the effects of rapid expression detection, expanded range, and reliable results

Inactive Publication Date: 2015-05-27
JIANGSU ACAD OF AGRI SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, when the target gene is constructed on the expression vector pYES2, it is still necessary to confirm whether the target protein is expressed and the expression level by methods such as SDS-PAGE and Western hybridization after induction by adding an inducer, in order to quickly detect whether the target gene is in the For effective expression in yeast cells, Biovector Co., Ltd. introduced the green fluorescent protein gene (EGFP) into the expression vector to construct the pYES2-EGFP expression vector (such as figure 1 shown), the target gene and the green fluorescent protein gene are expressed at the same time, and the expression level of the target gene can be obtained by fluorescence detection, but the expression vector only has BamHI A restriction site is available, which limits the cloning of the target gene and the transformation of yeast containing the restriction site gene, and cannot be widely used in genetic engineering
[0004] The pJITI66-GFP transient expression vector was transformed by the State Key Laboratory of Crop Genetics and Breeding, Nanjing Agricultural University, and has been reported in many articles (such as "Isolation of Cotton Mesophyll Protoplasts and Establishment of Transient Expression System for Target Genes", Li Nina et al., Crop Science, 2014; "Subcellular localization and expression analysis of grape flower development genes" Yang Guang et al., Chinese Agricultural Sciences, 2011), the GFP gene contained in the vector is an enhanced fluorescent protein gene; Yeast expression vectors with restriction restriction sites have not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast expression vector
  • Yeast expression vector
  • Yeast expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Construction of pYES2-GFP vector

[0041](1) use Hind III with EcoRI Double digestion pJITI66-GFP transient expression vector, the digestion system is:

[0042] 120ng / uL-150ng / uL pJITI66-GFP transient expression vector 6 μl, 10U uL –1 EcoR I endonuclease 1.5μl, 10U uL –1 Hind III endonuclease 1.5 μl, 10× buffer Tango TM 3 μl, ddH 2 O 18 μl.

[0043] Reaction conditions for enzyme digestion were as follows: enzyme digestion was carried out according to the manual of Fermentas restriction endonucleases.

[0044] The digested products were detected by 1% agarose gel electrophoresis, and the electrophoresis results were as follows: Figure 4 As shown, the M lane is the DL2000 molecular weight Marker, the lane 1 is the pJITI66-GFP transient expression vector without restriction electrophoresis, and the lane 2 is the vector fragment after digestion, the size is 980bP, and the fragment contains the GFP gene and the NOS terminator The sequence was puri...

Embodiment 2

[0081] Example 2 Detection of pYES2-GFP vector expression

[0082] SEQ ID NO.4:AT A A G C T T T T T C G A A ATGggtggcattgcat;

[0083] SEQ ID NO.5:cg CGGATCCG AAATTCACTGGAAAGA

[0084] The effectiveness of the pYES2-GFP vector obtained in Example 1 was verified with a cell membrane protein TIP cloned in our laboratory:

[0085] (1) First construct the upstream primer TIP-F (its sequence is shown in SEQ ID NO.4) and the downstream primer TIP-R (its sequence is shown in SEQ ID NO.5), and the primers were handed over to Nanjing GenScript Co., Ltd. Company Synthesis.

[0086] (2) use Hind III with Bam H I Double enzyme digestion of pYES2-GFP expression vector, enzyme digestion reaction system: 120ng / uL-150ng / uL pYES2-GFP expression vector 6 μl, 10U uL –1 EcoR I endonuclease 1.5μl, 10U uL –1 Hind III endonuclease 1.5 μl, 10× buffer Tango TM 3 μl, ddH 2 O 18 μl.

[0087] The reaction conditions are: digestion according to the manual of Fermentas restrict...

Embodiment 3

[0096] Example 3 Verification of endoplasmic reticulum membrane protein SIP1

[0097] SEQ ID NO.6: AT A A G C T T T T T C G A A ATGGTTGGTGCTATAAAAGCAGCGA;

[0098] SEQ ID NO.7: GC CGGATCCG TCATGCTTTCTTCTGTTTTACTTC;

[0099] Taking another endoplasmic reticulum membrane protein SIP1;3 cloned in our laboratory as an example, according to SIP1;3 Gene sequence design forward primer SEQ ID NO.6 and reverse primer SEQ ID NO.7, two primers with Hind III with BamHI The restriction site was used and then constructed into the pYES2-GFP vector after digestion, and then transformed into Saccharomyces cerevisiae through a lithium acetate-mediated method. The gene cloning, yeast transformation and functional identification methods were the same as in Example 2.

[0100] The tobacco genetic transformation method mainly refers to the Agrobacterium transformation method of Horsch et al:

[0101] 1) Preparation of Agrobacterium liquid: Inoculate Agrobacterium carrying ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a yeast expression vector. The yeast expression vector is prepared by the following steps: carrying out double digestion on pJITI66-GFP, serving as a transient expression vector, and pYES2, serving as a vector, by utilizing HindIII and EcoRI respectively, recovering enzyme digest target fragments, and connecting the enzyme digest target fragments by virtue of T4DNA ligase to obtain the yeast expression vector. The yeast expression vector contains enzyme digest multiple cloning sites of HindIII, SalI and BamHI and an NOS terminator. Compared with the sold vector, according to the yeast expression vector disclosed by the invention, SalI and HindIII, serving as two new enzyme digest sites, are introduced, so that the enzyme digest site range selected by a gene is expanded, and function identification and cloning of the gene are convenient; meanwhile, with the addition of the NOS terminator, fusion protein translation is convenient to be effectively ended up.

Description

Technical field [0001] The invention is a biotechnology field, especially a yeast expression carrier. Background technique [0002] The carrier expression carrier is commonly used in genetic engineering. At present, the commercial carrier is mainly the PYES series, PYC series and ATCC's Yep series, PBT series, etc. Among them, PYES2 is widely used as the expression carrier of the wine yeast expression system.Especially in genetic functional verification, it has a wide range of applications: Wang Liqiang et al. (2011) By building the DREB gene of two -color blood grass to Pyes2, the genes' resistance to drought, high salt and cold damage, and resistance otherThe ability of heavy metal; Zhou Kai (2011) built the cotton GHGNT gene to Pyes2, and found that its excessive expression can improve the salt resistance of yeast;Strong alkali and active oxygen resistance.However, these commercial vectors are intracellular expression vectors, which is not suitable for extracellular secretion....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/66C12N15/81
Inventor 张大勇邵宏波徐照龙黄益洪何晓兰郭士伟
Owner JIANGSU ACAD OF AGRI SCI