A kind of nanobody and application of anti-B cell growth stimulating factor
A technology of growth stimulation and nano-antibody, applied in the direction of anti-receptor/cell surface antigen/cell surface determinant immunoglobulin, antibody, biochemical equipment and method, etc. Effects on B cell proliferation or survival
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1: Expression of BAFF extracellular protein
[0054] 1. Extraction of sBAFF gene: extract normal human venous blood, and extract peripheral blood mononuclear cells (PBMC) according to conventional methods. The RNA extraction was carried out in accordance with Invitorgen's instructions. Take 3ug RNA reverse transcription to prepare cDNA template, and use it as template to amplify BAFF gene.
[0055] The primer sequence is:
[0056] 5’CGGGAATTCCTGGTGCCACGCGGTGCCGTCAGGGTCCAGAAG3’ (SEQ ID No.3)
[0057] 5’CCCAAGCTTTCACAGCAGTTTCAATGC3’ (SEQ ID No. 4)
[0058] PCR reaction conditions:
[0059]
[0060] 2. Construction of expression vector: PCR amplified products are separated and recovered by agarose gel electrophoresis, digested with EcoRI (BioLab) and HindIII (BioLab), and then press 3 with the vector pET-30a (Sigma) treated with the same enzyme. :1 end ratio for sticky end connection. Connection product according to CaCl 2 The transformation method was used to transform c...
Embodiment 2
[0067] Example 2: Construction of anti-BAFF specific Nanobody library
[0068] 1. Immunize the alpaca and analyze the production of nano antibodies by enzyme immunoassay.
[0069] A total of 1.5 mg of antigen was injected subcutaneously on the back of the alpaca's neck and Freund’s adjuvant was added for 4 immunizations. The absorption of the injected mass was followed up to confirm the correct immunization. Serum antibody titer was determined one month after the first immunization ( figure 2 ); After immunization, the interval between each immunization is halved, and the titer is determined. The protein G column and affinity chromatography were used to separate the serum one week after the fourth immunization, and the ELISA method was used to detect the production of heavy chain antibodies and antibody titer. After the fourth immunization, the titer of alpaca immune serum can reach 1: 10000. ( image 3 ).
[0070] 2. Isolation of alpaca peripheral blood lymphocytes
[0071] Isola...
Embodiment 3
[0100] Example 3: Obtaining anti-BAFF Nanobodies
[0101] 1. Screening of anti-BAFF specific Nanobodies
[0102] Biotinylated BAFF and streptavidin magnetic beads were used to screen antibodies from the phage library to obtain anti-BAFF Nanobodies. The biotin-labeled BAFF antigen and the phage antibody library were mixed in proportion, and reacted overnight at 4°C. Add the antigen-phage antibody complex to the EP tube containing streptavidin magnetic beads, and roll for 0.5h to make the magnetic beads fully bind to the biotin-labeled antigen-phage antibody complex. After rinsing each with PBST (0.05% T20) and PBS 10 times, the phages were eluted with TEA, and they were allowed to stand at room temperature for 10 minutes. Add TEA in 1M Tris-HCl and store on ice. The phage was infected with TG1 in the semi-log phase. Diluted the appropriate amount of bacterial solution and spread it on an AMP / LB plate, incubated at 32°C, and measured the titer of the eluate. The supernatant was c...
PUM
| Property | Measurement | Unit |
|---|---|---|
| purity | aaaaa | aaaaa |
| affinity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More