Unlock instant, AI-driven research and patent intelligence for your innovation.

Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP

A technology of lactamase and drug resistance gene, applied in the direction of DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of time-consuming, cumbersome operation process, etc., and achieve the effect of high sensitivity, good specificity and high specificity

Inactive Publication Date: 2015-10-07
SUN YAT SEN UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The traditional microbial culture method and drug susceptibility test method can provide good clinical value, but due to various reasons such as time-consuming, cumbersome operation process, and expensive equipment, they have not been widely used in clinical practice.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP
  • Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP
  • Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 For the rapid detection of bacterial metallo-β-lactamase resistance genes IMP Establishment of the LAMP kit

[0032] For rapid detection of bacterial metallo-β-lactamase resistance genes IMP The LAMP kit includes the following components: (1) specific primer set; (2) DNA polymerase; (3) LAMP reaction solution; (4) chromogenic reagent; (5) positive control and negative control.

[0033] (1) Design of specific primers:

[0034] metallo-beta-lactamase resistance gene IMP (GenBank accession number is: (NF812058)) Specifically designed 6 specific primers, the sequences are as follows:

[0035] Internal primer 1: 5'- TTAGCTTGTACCTTACCGTCTTAGAGTGGCTTAATTCTCAATCT-3' (SEQ ID No.1);

[0036] Internal primer 2: 5'- GCGGAGTTAGCTATTGGCTAGTCCACTACGTTATCTGGAGC-3' (SEQ ID No.2);

[0037] Outer primer 1: 5'- TTCCATAGCGACAGCACG -3' (SEQ ID No.3);

[0038] Outer primer 2: 5'- ATTACCTAGACCGTAGGGTTT -3' (SEQ ID No.4);

[0039]Loop primer 1: 5'- GTTAATTCAGATGCATACGTGG-3'...

Embodiment 2

[0045] Example 2 Bacterial metallo-beta-lactamase resistance gene IMP rapid detection method

[0046] Rapid detection of bacterial metallo-beta-lactamase drug resistance gene using the kit of Example 1 IMP ,Specific steps are as follows:

[0047] (1) Extract template DNA: Extract bacterial genomic DNA by boiling water;

[0048] (2) Loop-mediated isothermal gene amplification reaction: 25 μL reaction system contains: inner primers 1 and 2 at a final concentration of 8 pmol / μL each, outer primers 1 and 2 at a final concentration of 1 pmol / μL each, loop primers 1 and 2 The final concentration is 4 pmol / μL, the reaction solution is 12.5 μL, the DNA polymerase is 8U, and the DNA to be tested is 50 ng. Make up to 25 μL with sterilized deionized water, then add 20 μL of sealing solution, and put the above reaction tube at 63 °C. Reaction 60min;

[0049] (3) Judgment of results: Add 1 μL of chromogenic agent 1×SYBR Green I to the above reaction tube, and observe the color of th...

Embodiment 3

[0050] Embodiment 3 specificity experiment

[0051] Utilize the method of embodiment 2 to identify not containing IMP Gene clinical isolates were tested, and DEPC water was used as a negative control.

[0052] See the test results figure 2 . bacterial metallo-β-lactamase resistance gene IMP The tube is green and the rest of the tubes are orange. The results show that the detection kit of the present invention has high specificity and can accurately detect IMP and other non- IMP differentiate.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP kit and method used for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP. The kit comprises a pair of outer primers, a pair of inner primers and a pair of loop primers. The method is implemented as SEQ ID NO.1-6 and includes the steps that DNA of a to-be-detected bacterium genome is extracted, six specific primers and a kind of DNA polymerase with the strand displacement activity are adopted, the DNA sample is amplified at 60 DEG C to 65 DEG C, and a user adds color developing agents to observe changes in the color in a reaction tube to judge whether amplifying is achieved or not. The LAMP kit and method have the advantages of being rapid, efficient, easy and convenient to operate, high in specificity, high in sensitivity, easy and convenient to detect, suitable for site detection and the like, and is suitable for application and popularization.

Description

technical field [0001] The invention relates to the detection of pathogenic microorganisms, in particular to a rapid detection of bacterial metallo-β-lactamase drug-resistant genes using loop-mediated isothermal gene amplification technology (LAMP technology) IMP kits and methods. Background technique [0002] In recent years, with the widespread clinical application of carbapenem antibiotics such as imipenem, bacteria have produced a class of metallo-β-lactamases that can widely hydrolyze β-lactam antibiotics. Bacteria are resistant to all β-lactam antibiotics, which has caused great difficulties in clinical anti-infection treatment, and the number and types of Pseudomonas aeruginosa producing metallo-lactamases are increasing continuously. The main reported have IMP and VIM two types. In Guangzhou, Guangdong, outbreaks of Pseudomonas aeruginosa producing IMP metalloenzymes occurred in many hospitals from 2005 to 2007, which has become a difficult problem for clinici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/689
Inventor 田国宝黄曦钟兰兰张雪飞
Owner SUN YAT SEN UNIV