Diagnostic method for rapidly detecting bacterium metal beta-lactamase drug resistance gene IMP
A technology of lactamase and drug resistance gene, applied in the direction of DNA/RNA fragment, recombinant DNA technology, etc., can solve the problems of time-consuming, cumbersome operation process, etc., and achieve the effect of high sensitivity, good specificity and high specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 For the rapid detection of bacterial metallo-β-lactamase resistance genes IMP Establishment of the LAMP kit
[0032] For rapid detection of bacterial metallo-β-lactamase resistance genes IMP The LAMP kit includes the following components: (1) specific primer set; (2) DNA polymerase; (3) LAMP reaction solution; (4) chromogenic reagent; (5) positive control and negative control.
[0033] (1) Design of specific primers:
[0034] metallo-beta-lactamase resistance gene IMP (GenBank accession number is: (NF812058)) Specifically designed 6 specific primers, the sequences are as follows:
[0035] Internal primer 1: 5'- TTAGCTTGTACCTTACCGTCTTAGAGTGGCTTAATTCTCAATCT-3' (SEQ ID No.1);
[0036] Internal primer 2: 5'- GCGGAGTTAGCTATTGGCTAGTCCACTACGTTATCTGGAGC-3' (SEQ ID No.2);
[0037] Outer primer 1: 5'- TTCCATAGCGACAGCACG -3' (SEQ ID No.3);
[0038] Outer primer 2: 5'- ATTACCTAGACCGTAGGGTTT -3' (SEQ ID No.4);
[0039]Loop primer 1: 5'- GTTAATTCAGATGCATACGTGG-3'...
Embodiment 2
[0045] Example 2 Bacterial metallo-beta-lactamase resistance gene IMP rapid detection method
[0046] Rapid detection of bacterial metallo-beta-lactamase drug resistance gene using the kit of Example 1 IMP ,Specific steps are as follows:
[0047] (1) Extract template DNA: Extract bacterial genomic DNA by boiling water;
[0048] (2) Loop-mediated isothermal gene amplification reaction: 25 μL reaction system contains: inner primers 1 and 2 at a final concentration of 8 pmol / μL each, outer primers 1 and 2 at a final concentration of 1 pmol / μL each, loop primers 1 and 2 The final concentration is 4 pmol / μL, the reaction solution is 12.5 μL, the DNA polymerase is 8U, and the DNA to be tested is 50 ng. Make up to 25 μL with sterilized deionized water, then add 20 μL of sealing solution, and put the above reaction tube at 63 °C. Reaction 60min;
[0049] (3) Judgment of results: Add 1 μL of chromogenic agent 1×SYBR Green I to the above reaction tube, and observe the color of th...
Embodiment 3
[0050] Embodiment 3 specificity experiment
[0051] Utilize the method of embodiment 2 to identify not containing IMP Gene clinical isolates were tested, and DEPC water was used as a negative control.
[0052] See the test results figure 2 . bacterial metallo-β-lactamase resistance gene IMP The tube is green and the rest of the tubes are orange. The results show that the detection kit of the present invention has high specificity and can accurately detect IMP and other non- IMP differentiate.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 