Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method and detection kit of t-2 toxin

A detection method, T-2 technology, applied in the direction of material excitation analysis, fluorescence/phosphorescence, etc., can solve the problems of expensive instruments, easy inactivation, and difficulty in popularization, and achieve the effect of improving detection sensitivity and accuracy and eliminating interference

Active Publication Date: 2018-07-24
HUNAN UNIV OF SCI & TECH
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, each of these methods has its own disadvantages: such as chromatography-mass spectrometry, not only the instrument is expensive, but also needs specialized technical personnel to be competent, so it is difficult to popularize; immunoassay reagents are expensive and easy to inactivate; The method for the determination of T-2 toxin by formula reaction requires the use of expensive labeled DNA and other deficiencies.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method and detection kit of t-2 toxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A kit for detecting T-2 toxin at least includes: T-2 toxin nucleic acid aptamer, single-stranded signal probe ssDNA, DNA amplification system, exonuclease, and silver ion reduction detection system. T-2 toxin aptamer is 5'-CAGCTCAGAAGCTTGATCCTGTATATCAAGCATCGCGTGTTTACACATGCGAGA GGTGAAGACTCGC -3'. The single-stranded signal probe ssDNA is 5'-CCCCCCACACCCGATCCCCCCC GCGAGTCTTCACC -3'. DNA amplification system comprises buffer solution, dNTP and Phi29 DNA polymerase; Described buffer solution is made of Tris-HCl, MgCl 2 , (NH 4 ) 2 SO 4 composition. The exonuclease is Exo III exonuclease. The reducing agent in the silver ion reduction detection system is borohydride, such as sodium borohydride.

Embodiment 2

[0030] A method for detecting T-2 toxin, the specific operation process is as follows:

[0031] Each DNA stock solution was heat-treated at 95°C for 5 minutes, and left at room temperature for 30 minutes before use. Then, take 40 μL of the hybridization buffer solution containing 3.0 μmol T-2 toxin nucleic acid aptamer (Apt) and 40 μL of the hybridization buffer solution containing 3.0 μmol signal probe ssDNA, respectively, and place them in a 2ml centrifuge tube, and hybridize at 37°C for 1 hour , Generate T-2 toxin nucleic acid aptamer-signaling probe hybrid (Apt-ssDNA).

[0032] At 37°C, add T-2 toxin with a concentration of 0 ~ 1.0 ng / mL to the Apt-ssDNA solution in turn, and the T-2 toxin reacts with the T-2 toxin nucleic acid aptamer to generate the nucleic acid aptamer-T- 2 toxin, releasing ssDNA. At this time, there are substances such as ssDNA, residual (unreacted) APT-ssDNA and aptamer-T-2 toxin in the system.

[0033] Add 10 μL buffer solution (buffer solution co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
recovery rateaaaaaaaaaa
Login to View More

Abstract

The invention relates to a method and kit for detecting T-2 toxins. The method includes the steps of A, hybridizing T-2 toxin aptamer with single-chain signal probe ssDNA to form a hybridized chain; B, allowing the hybridized chain to contact with a to-be-detected sample, wherein the hybridized chain reacts with the T-2 toxins to release the single-chain signal probe ssDNA when the T-2 toxins exist in the to-be-detected sample; C, using DNA amplification to allow the hybridized chain to form double-chain DNA, and using excision enzyme to hydrolyze the double-chain DNA into mononucleotide to remove the double-chain DNA so as to leave ssDNA in the system; D, under induction of the ssDNA, using silver ion reduction to generate near infrared fluorescence silver nano clusters; detecting system fluorescence intensity to determine the T-2 toxin content in the to-be-detected sample. The method is high in sensitivity, simple to operate, low in cost, and the like.

Description

technical field [0001] The invention belongs to the technical field of nanobiological sensing and biological detection, and specifically provides a detection method and a detection kit for T-2 toxin. Background technique [0002] T-2 toxin (trichothecenes, TS) is one of the trichothecene compounds mainly produced by Fusarium tritinarum and other fungi. In 1973, at the joint meeting held by the Food and Agriculture Organization of the United Nations (FAQ) and the World Health Organization (WHO) in Geneva, this type of toxin, like aflatoxin, was regarded as the most dangerous source of food contamination in nature. It is widely distributed in nature and is Common toxins that contaminate field crops and stored grains are more harmful to humans and livestock. T-2 toxin is very stable at room temperature, and its toxicity cannot be destroyed by placing it for 6-7 years or heating it to 100-120°C for 1 hour. At present, there is no specific control method for T-2 toxin poisoning...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/64
CPCG01N21/64
Inventor 夏晓东冉海宁杨阳唐春然
Owner HUNAN UNIV OF SCI & TECH