Detection method and detection kit of t-2 toxin
A detection method, T-2 technology, applied in the direction of material excitation analysis, fluorescence/phosphorescence, etc., can solve the problems of expensive instruments, easy inactivation, and difficulty in popularization, and achieve the effect of improving detection sensitivity and accuracy and eliminating interference
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] A kit for detecting T-2 toxin at least includes: T-2 toxin nucleic acid aptamer, single-stranded signal probe ssDNA, DNA amplification system, exonuclease, and silver ion reduction detection system. T-2 toxin aptamer is 5'-CAGCTCAGAAGCTTGATCCTGTATATCAAGCATCGCGTGTTTACACATGCGAGA GGTGAAGACTCGC -3'. The single-stranded signal probe ssDNA is 5'-CCCCCCACACCCGATCCCCCCC GCGAGTCTTCACC -3'. DNA amplification system comprises buffer solution, dNTP and Phi29 DNA polymerase; Described buffer solution is made of Tris-HCl, MgCl 2 , (NH 4 ) 2 SO 4 composition. The exonuclease is Exo III exonuclease. The reducing agent in the silver ion reduction detection system is borohydride, such as sodium borohydride.
Embodiment 2
[0030] A method for detecting T-2 toxin, the specific operation process is as follows:
[0031] Each DNA stock solution was heat-treated at 95°C for 5 minutes, and left at room temperature for 30 minutes before use. Then, take 40 μL of the hybridization buffer solution containing 3.0 μmol T-2 toxin nucleic acid aptamer (Apt) and 40 μL of the hybridization buffer solution containing 3.0 μmol signal probe ssDNA, respectively, and place them in a 2ml centrifuge tube, and hybridize at 37°C for 1 hour , Generate T-2 toxin nucleic acid aptamer-signaling probe hybrid (Apt-ssDNA).
[0032] At 37°C, add T-2 toxin with a concentration of 0 ~ 1.0 ng / mL to the Apt-ssDNA solution in turn, and the T-2 toxin reacts with the T-2 toxin nucleic acid aptamer to generate the nucleic acid aptamer-T- 2 toxin, releasing ssDNA. At this time, there are substances such as ssDNA, residual (unreacted) APT-ssDNA and aptamer-T-2 toxin in the system.
[0033] Add 10 μL buffer solution (buffer solution co...
PUM
| Property | Measurement | Unit |
|---|---|---|
| recovery rate | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
