Unlock instant, AI-driven research and patent intelligence for your innovation.

Brassica napus nuclear transcription factor nf-ya gene bnnf-ya3 and its application

A nuclear transcription factor, NF-YA technology, applied in the field of genetic engineering, can solve CO off-target and other problems

Inactive Publication Date: 2018-09-18
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This shows that NF-YA and CO are in a competitive relationship in plants, and a large amount of expressed NF-YA will competitively bind to NF-YB / NF-YC heterodimers, thereby causing off-target CO and inhibiting FT gene expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus nuclear transcription factor nf-ya gene bnnf-ya3 and its application
  • Brassica napus nuclear transcription factor nf-ya gene bnnf-ya3 and its application
  • Brassica napus nuclear transcription factor nf-ya gene bnnf-ya3 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] 1. Prediction and cloning of NF-YA gene BnNF-YA3

[0035] Four Brassica napus degradome sequencing databases (roots treated with cadmium, stems and leaves treated with cadmium, roots of the control group and stems and leaves of the control group, the data came from Zhou Zhaosheng) were analyzed by biological software (Zhou et al. , 2012), according to the evolutionary homology between Arabidopsis and rapeseed, the known sequences of Arabidopsis NF-YA gene family members and rapeseed NF-YA gene family members were introduced into the Brassica napus degradome Sequence the database, select the sequence with the highest similarity, download its cDNA sequence, and use the primer design software Primer Premier 5 to design appropriate primers at the coding start site and end site. The primer sequences are as follows:

[0036] BnNF-YA3-F: 5'GGATCTTGGGGATGGCTATG 3' (SEQ ID NO.4)

[0037] BnNF-YA3-R: 5'GGTCAAAATATCAGGTTTTG 3' (SEQ ID NO.5)

[0038] Using the cDNA of Brassica nap...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 and application thereof. The Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 has a CDS sequence shown as SEQ ID NO.1, and protein coded by the gene has an amino acid sequence shown as SEQ ID NO.3. Plants with overexpression of the gene present sensitivity to salt, drought and ABA treatment, and this shows that the gene BnNF-YA3 participates in the abiotic stress regulating process of the plants.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 and an application thereof. Background technique [0002] Abiotic stresses such as drought and high salinity are the main adversity factors affecting plant growth and crop yield. Therefore, people have long been looking for effective measures to breed crops that can resist abiotic stress and grow under various adversities. With the development of molecular biology, the use of genetic engineering to improve crop stress resistance genes and cultivate new varieties with stress resistance has become a feasible solution. [0003] The gene expression in each organism is strictly regulated and controlled by time and space constraints and external stimuli. Transcription Factors, also known as trans-acting factors, refer to proteins that have specific binding activity to cis-acting elements in eukaryotic gene promoters, wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82C12N1/21C07K14/415A01H5/00A01H6/20
CPCC07K14/415C12N15/8273C12N15/8293
Inventor 梁明祥任旭洋陶庆
Owner NANJING AGRICULTURAL UNIVERSITY