Supercharge Your Innovation With Domain-Expert AI Agents!

Method for expressing protein in fusarium moniliforme hypnospores

A technology of Fusarium moniliforme and dormant spores, applied in the biological field, can solve problems such as inapplicability, and achieve the effect of simple steps

Pending Publication Date: 2016-12-07
FUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, whether HDEN electroporation technology can be applied to species other than mammalian cells is still unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing protein in fusarium moniliforme hypnospores
  • Method for expressing protein in fusarium moniliforme hypnospores

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Expression of Green Fluorescent Protein (GFP) in Fusarium moniliforme cells:

[0067] 1. Plasmid construction

[0068] Using the GFP gene coding sequence, the GFP gene is shown in SEQ ID NO.5,

[0069] The protein sequence of the above GFP gene is shown in SEQ ID NO.6,

[0070] PCR primers for amplifying the GFP gene:

[0071] F: The wavy line is the Aat II restriction site

[0072] R: The wavy line is the Sal I restriction site

[0073] The underlined GCTAGC sequence in primer F is used to promote the binding of the translation initiation factor to RNA after the DNA is transcribed into RNA, and this sequence is adjacent to the initiation codon ATG of the expressed target gene. After using the above pair of primers for PCR, GCTAGC can be carried upstream of the GFP gene, and restriction sites can be carried upstream and downstream.

[0074]

[0075] After agarose gel electrophoresis was used to detect that the PCR product was correct, the PCR product was rec...

Embodiment 2

[0105] Expression of red fluorescent protein (RFP) in Fusarium moniliforme cells:

[0106] 1. Plasmid construction

[0107] The nucleic acid sequence of RFP is shown in SEQ ID NO.7,

[0108] The protein sequence of RFP is shown in SEQ ID NO.8,

[0109] The primers for amplifying the RFP gene are as follows:

[0110] Upstream primer: RFP-F:5'CGGAATTC GCCACC ATGGCCTCCTCCGAGGACGT 3'

[0111] Downstream primer: RFP-R: 5' TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

[0112] The 5-end of the upstream primer has an EcoR I restriction site and an underlined GCCACC sequence, which is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA. This sequence is consistent with the start codon of the expressed target gene ATG is next door.

[0113]The 5-end of the downstream primer has a Sal I restriction site.

[0114] According to the method of Example 1, the RFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vec...

Embodiment 3

[0130] Expression of yellow fluorescent protein (YFP) in Fusarium moniliforme cells:

[0131] 1. Plasmid construction

[0132] The nucleic acid sequence of YFP is shown in SEQ ID NO.9,

[0133] The protein sequence of YFP is shown in SEQ ID NO.10,

[0134] Using the same primers as GFP in Example 1, and according to the same experimental steps and methods, the GFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vector, and then transcribed in vitro, and the resulting RNA was transformed Host spores.

[0135] 2. Use the coding RNA of yellow fluorescent protein to express yellow fluorescent protein in the resting spores of Fusarium moniliforme, the steps are as follows:

[0136] A method for expressing protein in resting spores of Fusarium moniliforme, comprising the following steps:

[0137] 1) Fusarium moniliforme culture and spore collection

[0138] In a 15cm petri dish, prepare a solid agar medium (PDA medium), inoculate Fusarium moniliforme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expressing protein in fusarium moniliforme hypnospores. The method comprises the following three steps: cultivating fusarium moniliforme and collecting spores; pretreating the fusarium moniliforme; performing electric shock on the fusarium moniliforme spores by an HDEN method. The method avoids the step of germinating fungal spores and adopts the steps of delivering and penetrating in vitro single-chain encoded protein ribonucleic acid (RNA) through cell walls and cytomembranes by an HDEN electrotransformation technology and expressing the protein in the fusarium moniliforme hypnospores. The method provided by the invention has the advantages that the steps are simple, convenient and rapid; the effect is excellent; the transformation ratio reaches 90% or higher.

Description

technical field [0001] The invention belongs to the field of biological technology, in particular to a method for expressing protein in resting spores of Fusarium moniliforme Background technique [0002] The central dogma of molecular biology refers to the transfer of genetic information from DNA to RNA, and then from RNA to protein, that is, the process of completing the transcription and translation of genetic information. In modern genetic engineering, hosts are often used to express foreign proteins. The usual method is to construct a plasmid vector, put the coding DNA sequence of the foreign protein behind a strong promoter, and after being introduced into the host cell, the coding DNA sequence is transcribed into mRNA sequence (single-stranded RNA), and the mRNA sequence is expressed into a protein molecule by the translation machinery in the cell, completing the whole process of exogenous protein expression. [0003] Whether as a plasmid free from the host genome or...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/87C12R1/77
CPCC12N15/87
Inventor 林峻
Owner FUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com