A specific antigenic peptide against gpr45 polyclonal antibody and its preparation and application
A polyclonal antibody, antigen peptide technology, applied in the fields of biochemistry and molecular immunology, can solve the problems of poor polypeptide immunogenicity and high price
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Preparation of polyclonal antibodies specific to GPR45
[0049] (1) Establishment of antigen sequence:
[0050] We removed all hydrophobic (transmembrane) peptides in the GPR45 amino acid sequence, the first extracellular region and part of the second extracellular region that are highly homologous to GPR63, and the first and second intracellular regions, and finally used to immunize guinea pigs The antigenic epitope coding nucleotide sequence clone is shown in SEQ ID NO: 1, specifically as follows:
[0051] ATGGCCTGTAACAGCACACCCATGGGGACTTACGAACATCTGCTGCTGAATGTGAGCAACACTTTGGACCCTGGGGACACCCCACTGTCTGCACCGCTCAGGATCTCGGGCTACACTGAGTTCCCAGCTGAACGCAATACGGTGCGGAAGAACGCTGTCCGTGTGCACAACCAGTCGGACAGCCTGGACCTCAGACAGCTGACCGGAGCTGGCCTGAGACGTCTCAGACGGCAGCAGCAGCAGGCCAGCCTGGACCTGAGTTTCAAAACCAAGTCTGCGTTCAGCCGGCGGTTCTATTACAGCGCCTCCTTCTACACCCCCCACACTTTCCAAATCCTCCCTAAAGTGCCTGAGCGGATCCAGAGGAAAATCCAGCCAAGCACCATCTATGTGTGCAACGAAAACCAATCCGCTGTC。
[0052] The amino acid sequence that ca...
Embodiment 2
[0119] Example 2 Western Blotting detects the specificity of the polyclonal antibody prepared in this example
[0120] The polyclonal antibody specific for GPR45 prepared in Example 1 was tested for cross-specificity with members of the GPRs family.
[0121] The polyclonal antibody against GPR45 prepared in Example 1 was used to perform immunofluorescent staining on the hypothalamus region of GPR45-deficient mice (PB1 / PB1, that is, GPR45 expression in mice was inhibited), and the results were not detected. Obvious signal to GPR45 (eg Figure 11 Shown), because the hypothalamus region of the GPR45-deficient mouse still expresses other GPCRs family members, but no signals of other GPCRs family members have been detected, indicating that the polyclonal antibody specific for GPR45 prepared by the experimental method of the present invention has a very high High specificity, no cross-reaction with other GPCRs family members. After analyzing the experimental data, the inventor fou...
Embodiment 3
[0130] Example 3 Application of the polyclonal antibody specific for GPR45 provided by the present invention in immunohistochemistry
[0131] In order to study the function of GPR45 in regulating energy metabolism in the hypothalamus, we used the polyclonal antibody against GPR45 prepared in Example 1 to carry out immunofluorescence staining on the hypothalamus region of wild-type mice (+ / +) (such as Figure 4 shown). The results showed that a clear signal of GPR45 could be detected. GPR45 was highly expressed in suprachiasmatic nucleus (suprachiasmatic, SCN), dorsomedial hypothalamic nucleus (DMN), ventromedial hypothalamic nucleus (VMN) and arcuate nucleus (ARC).
[0132]However, during the research and development process, the inventors of the present invention also tried the GPR45 antibody purchased through commercial channels, and the results of immunofluorescence staining were not as good as the GPR45 polyclonal antibody prepared by the present invention.
[0133] For ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


