Unlock instant, AI-driven research and patent intelligence for your innovation.

A specific antigenic peptide against gpr45 polyclonal antibody and its preparation and application

A polyclonal antibody, antigen peptide technology, applied in the fields of biochemistry and molecular immunology, can solve the problems of poor polypeptide immunogenicity and high price

Active Publication Date: 2020-10-27
FUDAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The invention obtains the antigen through a prokaryotic expression system, and the antigen carries a 6XHis tag, which is easy to purify; the invention overcomes the disadvantages of poor immunogenicity and high price of existing polypeptides, and also has extremely high specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A specific antigenic peptide against gpr45 polyclonal antibody and its preparation and application
  • A specific antigenic peptide against gpr45 polyclonal antibody and its preparation and application
  • A specific antigenic peptide against gpr45 polyclonal antibody and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Preparation of polyclonal antibodies specific to GPR45

[0049] (1) Establishment of antigen sequence:

[0050] We removed all hydrophobic (transmembrane) peptides in the GPR45 amino acid sequence, the first extracellular region and part of the second extracellular region that are highly homologous to GPR63, and the first and second intracellular regions, and finally used to immunize guinea pigs The antigenic epitope coding nucleotide sequence clone is shown in SEQ ID NO: 1, specifically as follows:

[0051] ATGGCCTGTAACAGCACACCCATGGGGACTTACGAACATCTGCTGCTGAATGTGAGCAACACTTTGGACCCTGGGGACACCCCACTGTCTGCACCGCTCAGGATCTCGGGCTACACTGAGTTCCCAGCTGAACGCAATACGGTGCGGAAGAACGCTGTCCGTGTGCACAACCAGTCGGACAGCCTGGACCTCAGACAGCTGACCGGAGCTGGCCTGAGACGTCTCAGACGGCAGCAGCAGCAGGCCAGCCTGGACCTGAGTTTCAAAACCAAGTCTGCGTTCAGCCGGCGGTTCTATTACAGCGCCTCCTTCTACACCCCCCACACTTTCCAAATCCTCCCTAAAGTGCCTGAGCGGATCCAGAGGAAAATCCAGCCAAGCACCATCTATGTGTGCAACGAAAACCAATCCGCTGTC。

[0052] The amino acid sequence that ca...

Embodiment 2

[0119] Example 2 Western Blotting detects the specificity of the polyclonal antibody prepared in this example

[0120] The polyclonal antibody specific for GPR45 prepared in Example 1 was tested for cross-specificity with members of the GPRs family.

[0121] The polyclonal antibody against GPR45 prepared in Example 1 was used to perform immunofluorescent staining on the hypothalamus region of GPR45-deficient mice (PB1 / PB1, that is, GPR45 expression in mice was inhibited), and the results were not detected. Obvious signal to GPR45 (eg Figure 11 Shown), because the hypothalamus region of the GPR45-deficient mouse still expresses other GPCRs family members, but no signals of other GPCRs family members have been detected, indicating that the polyclonal antibody specific for GPR45 prepared by the experimental method of the present invention has a very high High specificity, no cross-reaction with other GPCRs family members. After analyzing the experimental data, the inventor fou...

Embodiment 3

[0130] Example 3 Application of the polyclonal antibody specific for GPR45 provided by the present invention in immunohistochemistry

[0131] In order to study the function of GPR45 in regulating energy metabolism in the hypothalamus, we used the polyclonal antibody against GPR45 prepared in Example 1 to carry out immunofluorescence staining on the hypothalamus region of wild-type mice (+ / +) (such as Figure 4 shown). The results showed that a clear signal of GPR45 could be detected. GPR45 was highly expressed in suprachiasmatic nucleus (suprachiasmatic, SCN), dorsomedial hypothalamic nucleus (DMN), ventromedial hypothalamic nucleus (VMN) and arcuate nucleus (ARC).

[0132]However, during the research and development process, the inventors of the present invention also tried the GPR45 antibody purchased through commercial channels, and the results of immunofluorescence staining were not as good as the GPR45 polyclonal antibody prepared by the present invention.

[0133] For ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of biochemistry and molecular immunity, and discloses a specific antigen peptide aiming at a GPR45 polyclonal antibody, and preparation and applications thereof. The amino acid sequence or conservative variant polypeptide of the antigen peptide is represented by SEQ ID No.2. The prepared polyclonal antibody specifically aiming at GPR45 will not carry out cross reactions with other members of the GPCRs family. In one preferential sample, a prokaryotic expression system is adopted to obtain an antigen, moreover, the antigen carries a 6XHis label, and thus the product is easy to purify. The provided preparation method is simple, and the prepared antibody has strong immunogenicity.

Description

technical field [0001] The invention belongs to the field of biochemistry and molecular immunology, mainly relates to a specific antigen for GPR45 polyclonal antibody, and discloses the preparation of the antigen peptide and its application in the preparation of GPR45 polyclonal antibody. Background technique [0002] G protein-coupled receptors (GPCRs) are the membrane protein family with the largest number of members, and there are about 800 GPCRs in the human genome. GPCRs play a key role in a variety of life activities. They receive various external signals such as hormones, neurotransmitters, ions, and photons. and regulation of transcription of various genes. GPCRs are also important candidate drug targets, and more than 30% of commercially available drugs act on GPCR signaling systems. GPR45 is an "orphan" receptor with unknown function and ligand, and its function and tissue cell localization still need to be further studied. [0003] Antibodies are an important t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/72C07K19/00C12N15/12C12N15/62C07K16/28G01N33/68
CPCC07K14/723C07K16/2869C07K2319/21G01N33/6872G01N2333/726
Inventor 吴晓晖许田韩珉崔婧
Owner FUDAN UNIV