Unlock instant, AI-driven research and patent intelligence for your innovation.

Tracing system anterograde across multilevel synapses and across neurons

A neuron, tracing technology, applied in the field of neurobiology

Active Publication Date: 2020-06-26
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, efficient and high-resolution mapping of the details of anterograde output neural circuits remains a challenge

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tracing system anterograde across multilevel synapses and across neurons
  • Tracing system anterograde across multilevel synapses and across neurons
  • Tracing system anterograde across multilevel synapses and across neurons

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Cells and Cell Culture

[0045] VERO-E6 cells (VERO, ATCC #CRL-1586) were cultured in Dulbecco's medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 units / ml penicillin and 100 μg / ml streptomycin prime, Gibco)).

[0046] Following conventional procedures, hippocampal neurons derived from mouse embryos were isolated and cultured [20,21]. Briefly, hippocampi were dissected from pups of C57BL / 6 mice at embryonic day 18.5 (E18.5), sectioned, and further digested with trypsin / DNase I at 37°C for 15 minutes. Isolated neurons were washed with sterile Hank's Balanced Salt Solution (HBSS), suspended and cultured in supplemented with 2% B27, glutamax (25 μm) and penicillin-streptomycin (100 units / ml and 100 μg / ml) ( GIBCO) neuronal minimal medium. Change the medium every other day.

Embodiment 2

[0048] Build H129-G1

[0049] The HSV-1-H129 genome was cloned into the bacterial artificial chromosome with the green fluorescent protein gene to obtain H129-BAC (ie H129-G1). as attached figure 1 As shown in e and 1f, the specific main steps are as follows:

[0050] (2.1) Extraction of H129-wt virus genome

[0051] Infect VERO cells with H129-wt virus [22] at a multiplicity of infection of 1. After 12 hours of infection, scrape off the cells, collect the cell pellet by centrifugation, and wash once with solution I (10mM Tris, 10mM EDTA, pH 8.0) , then use 0.5ml solution I solution (comprising 0.25mg Proteinase K / ml (Roche company in the United States); 0.6% sodium dodecyl sulfate (SDS) (Sinopharm Group); final concentration is 1M sodium chloride) weight Suspend the cell pellet, incubate at 50°C for 2 hours, add RNase I (TaKaRa, Japan) at a final concentration of 10mg / ml and incubate at 37°C for 1 hour, and finally extract the DNA precipitate with phenol-chloroform (1:1), ...

Embodiment 3

[0079] Build H129-G3

[0080] H129-G3 was obtained based on homologous recombination transformation of H129-G1.figure 1 (c) shows the structural configuration of H129-G3.

[0081] (3.1) Cassette construction

[0082] Zeo was transformed by PCR, digestion, ligation and transformation R Cloned into vector pRK-GFP to construct CassetteCMVpromoter-GFP-Zeo R , the forward primer is F: CGGGATCCCAAGTTTCGAGGTCGAGTGTC-(SEQ ID NO33), the reverse primer is R: GCGAATTCGGAACGGACCGTGTTGACAA (SEQ ID NO 34); in the same way, mGFP is cloned into the vector pRK-kan to construct Cassette CMVpromoter-mGFP-kan R , the forward primer is F: GCGTCGACATGCTGTGCTGTATGAGAAG (SEQ ID NO 35), and the reverse primer is R: CGGGATCCTTACTTGTACAGCTCGTCC (SEQ ID NO 36).

[0083] (3.2) Preparation of activated Escherichia coli cells containing H129-G1

[0084] (i) Streak the E.coli DY380 containing H129-G1 on the LB solid plate containing the corresponding resistance, and culture at 32°C overnight;

[0085] (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an anterograde trans-multi-synaptic transneutonal virus tracing system derived from a recombinant herpes simplex virus 1 (HSV-1) strain H129. The tracing system is the HSV-1 strain H129, and comprises two or more fluorescence expression cassettes inserted into different loca of an H129 gene complex. Each fluorescence expression cassette comprises at least two copied fluorescent protein-encoding sequences which are distributed front and back, and at least one spacer-encoding sequence, wherein at least one spacer-encoding sequence is inserted into the two fluorescent protein-encoding sequences, so that the fluorescent protein-encoding sequences and the spacer-encoding sequences are transcribed into a transcripton; and the spacer-encoding sequences are used for encoding a spacer polypeptide, each spacer polypeptide contains at least two adjacent amino acids, and peptide bonds between the adjacent amino acids are formed at very low efficiency. Therefore, since the spacer polypeptides hinder forming of the peptide bonds, at least two non-fusion fluorescent proteins can be produced metrically when the transcriptons are translated.

Description

technical field [0001] The present invention relates generally to neurobiology, and more particularly to an anterograde, multi-synaptic transneuronal viral tracer system. Background technique [0002] Mapping the brain's connectome is essential to understanding how the brain works. As the basic unit of neural function, neural circuits serve as bridges between macroscopic structure / function and micromolecular / signaling circuits. However, the architecture of many specific functional neural circuits, including components, connections and distributions, remains to be elucidated. New tracing techniques and tracing tools, especially viral tracing tools, help to discover new circuits and reveal new connections and functions of known classical circuits. [0003] Viral tracer tools are already used in neuroscience research. Rabies virus (RV) and pseudorabies virus (PRV)-derived virus tracers can retrogradely trace neural circuits to label inputs to neural networks (1). Recombinan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01
CPCC07K14/43595C12N7/00C12N2710/16621
Inventor 罗敏华曾文波江海飞赵非杨虹宋一舸谌章舟
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI