Tracing system anterograde across multilevel synapses and across neurons
A neuron, tracing technology, applied in the field of neurobiology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Cells and Cell Culture
[0045] VERO-E6 cells (VERO, ATCC #CRL-1586) were cultured in Dulbecco's medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 units / ml penicillin and 100 μg / ml streptomycin prime, Gibco)).
[0046] Following conventional procedures, hippocampal neurons derived from mouse embryos were isolated and cultured [20,21]. Briefly, hippocampi were dissected from pups of C57BL / 6 mice at embryonic day 18.5 (E18.5), sectioned, and further digested with trypsin / DNase I at 37°C for 15 minutes. Isolated neurons were washed with sterile Hank's Balanced Salt Solution (HBSS), suspended and cultured in supplemented with 2% B27, glutamax (25 μm) and penicillin-streptomycin (100 units / ml and 100 μg / ml) ( GIBCO) neuronal minimal medium. Change the medium every other day.
Embodiment 2
[0048] Build H129-G1
[0049] The HSV-1-H129 genome was cloned into the bacterial artificial chromosome with the green fluorescent protein gene to obtain H129-BAC (ie H129-G1). as attached figure 1 As shown in e and 1f, the specific main steps are as follows:
[0050] (2.1) Extraction of H129-wt virus genome
[0051] Infect VERO cells with H129-wt virus [22] at a multiplicity of infection of 1. After 12 hours of infection, scrape off the cells, collect the cell pellet by centrifugation, and wash once with solution I (10mM Tris, 10mM EDTA, pH 8.0) , then use 0.5ml solution I solution (comprising 0.25mg Proteinase K / ml (Roche company in the United States); 0.6% sodium dodecyl sulfate (SDS) (Sinopharm Group); final concentration is 1M sodium chloride) weight Suspend the cell pellet, incubate at 50°C for 2 hours, add RNase I (TaKaRa, Japan) at a final concentration of 10mg / ml and incubate at 37°C for 1 hour, and finally extract the DNA precipitate with phenol-chloroform (1:1), ...
Embodiment 3
[0079] Build H129-G3
[0080] H129-G3 was obtained based on homologous recombination transformation of H129-G1.figure 1 (c) shows the structural configuration of H129-G3.
[0081] (3.1) Cassette construction
[0082] Zeo was transformed by PCR, digestion, ligation and transformation R Cloned into vector pRK-GFP to construct CassetteCMVpromoter-GFP-Zeo R , the forward primer is F: CGGGATCCCAAGTTTCGAGGTCGAGTGTC-(SEQ ID NO33), the reverse primer is R: GCGAATTCGGAACGGACCGTGTTGACAA (SEQ ID NO 34); in the same way, mGFP is cloned into the vector pRK-kan to construct Cassette CMVpromoter-mGFP-kan R , the forward primer is F: GCGTCGACATGCTGTGCTGTATGAGAAG (SEQ ID NO 35), and the reverse primer is R: CGGGATCCTTACTTGTACAGCTCGTCC (SEQ ID NO 36).
[0083] (3.2) Preparation of activated Escherichia coli cells containing H129-G1
[0084] (i) Streak the E.coli DY380 containing H129-G1 on the LB solid plate containing the corresponding resistance, and culture at 32°C overnight;
[0085] (...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More